MXPA02006934A - Compositions and methods for the therapy and diagnosis of prostate cancer. - Google Patents

Abstract

Compositions and methods for the therapy and diagnosis of cancer, particularly prostate cancer, are disclosed. Illustrative compositions comprise one or more prostatespecific polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention andor treatment of diseases, particularly prostate cancer.

Description

COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF PROSTATE CANCER TECHNICAL FIELD OF THE INVENTION The present invention relates in general to the therapy and diagnosis of cancer, such as prostate cancer. The invention more specifically relates to polypeptides, which comprise at least a portion of a prostate-specific protein, and to polynucleotides that encode such polypeptides. Said polypeptides and polynucleotides are useful in pharmaceutical compositions, for example, vaccines and other compositions for the diagnosis and treatment of prostate cancer.

BACKGROUND OF THE INVENTION Cancer is a major problem for health throughout the world. Although cancer is a major health problem throughout the world, advances have been made in the detection of cancer therapy, at present no vaccine or other universally successful method for prevention treatment is available. Current therapies, which are generally based on a combination of chemotherapy or surgery and radiation, continue to be inadequate in many patients. Prostate cancer is the most common form of cancer among men, with an estimated rate of 30% in men over 50 years of age. Irresistible clinical evidence shows that human prostate cancer presents the propensity to metastasize to the bones, and the disease appears to inevitably proceed from the androgen dependent on the androgen refractory state, leading to high patient mortality. This frequent disease is currently the second leading cause of death from cancer in men in the United States. Despite considerable research in therapies for the disease, prostate cancer remains a difficult way to treat. Usually, the treatment is based on surgery and / or radiation therapy, but these methods are not effective in a large percentage of cases. Two previously identified prostate-specific proteins, prostate-specific antigen (PSA) and prostatic acid phosphatase (PAP), have limited therapeutic and diagnostic potential. For example, PSA levels do not always correlate well with the presence of prostate cancer, but are positive in a percentage of non-prostate cancer cases, including benign prostatic hyperplasia (BPH). In addition, PSA measurements correlate with prostate volume, and do not indicate the level of metastasis. Despite considerable research in therapies for this and other cancers, prostate cancer remains difficult to diagnose and treat effectively, so there is a need in the art for improved methods to detect and treat such cancers. The present invention satisfies these needs and furthermore provides other related advantages.

COMPENDIUM OF THE INVENTION In one aspect, the present invention provides polynucleotide compositions comprising a sequence selected from the group consisting of: (a) the sequences provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305 , 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591 , 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765 , 773-776 and 786-788; (b) complements of the sequences provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (c) sequences consisting of at least 20 continuous residues of a sequence provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330 , 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630 , 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (d) sequences that hybridize to a sequence provided in SEQ ID NOs: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375 , 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639 -655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788, under moderately severe conditions; (e) sequences having at least 75% identity with a sequence of SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (f) sequences having at least 90% identity to the sequence of SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; and (g) variants of degeneracy of a sequence provided in SEQ ID NOs: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340- 375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 71 1, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788. In another preferred embodiment, the polynuclde compositions of the invention are expressed in at least about 20%, preferably at least about 30%, and most preferably at least about 50% of the prostate tissue samples tested, at a level that is at least about twice, preferably at least about 5 times and most preferably at least about 10 times higher than that for other normal tissues. The present invention, in another aspect, provides polypeptide compositions comprising an amino acid sequence that is encoded by a polynuclde sequence described above. The present invention further provides polypeptide compositions comprising an amino acid sequence selected from the group consisting of sequences presented in SEQ ID NO: 1 12-14, 172, 176, 178, 327, 329, 331, 336, 339, 376 380, 383, 477-483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551, 553-568, 573-586, 588-590, 592, 627-629 , 632, 633, 635, 637, 638, 656-671, 675, 683, 684, 710, 712, 714, 715, 717-719, 723-734, 736, 740-750, 752, 754, 755, 766 -722, 777-785 and 789-791. In certain preferred embodiments, the polypeptides and / or polynucldes of the present invention are immunogenic, is say, they are capable of producing an immune response, particularly a moral and / or cellular immune response, as described below. The present invention further provides fragments, variants and / or derivatives of the described polypeptide and / or polynuclde sequences, wherein the fragments, variants and / or derivatives preferably have an immunogenic activity level of at least about 50%, preferably at least about 70% and most preferably at least about 90% of the level of immunogenic activity of a polypeptide sequence presented in SEQ ID NO: 1 12-1 14, 172, 176, 178, 327, 329, 331 , 336, 339, 376-380, 383, 477-483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551, 553-568, 573-586, 588-590 , 592, 627-629, 632, 633, 635, 637, 638, 656-671, 675, 683, 684, 710, 712, 714, 715, 717-719, 723-734, 736, 740-750, 752 , 754, 755, 766-722, 777-785 or 789-791, or a polypeptide sequence encoded by a polynuclde sequence presented in SEQ ID NO: 1 -1 1 1, 1 15-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639 655, 674, 680, 681, 71 1, 713, 716, 720- 722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788. The present invention further provides polynucleotides that encode a polypeptide described above, expression vectors comprising said polynucleotides and host cells. transformed or transfected with said expression vectors. Within other aspects, the present invention provides pharmaceutical compositions comprising a polypeptide or polynucleotide as described above and a physiologically acceptable carrier. Within a related aspect of the present invention, pharmaceutical compositions, e.g., vaccine compositions, are provided for prophylactic or therapeutic applications. Such compositions generally comprise an immunogenic polypeptide or polynucleotide of the invention and an immunostimulant, such as an adjuvant, together with a physiologically acceptable carrier. The present invention further provides pharmaceutical compositions comprising: (a) an antibody or antigen-binding fragment thereof which specifically binds to the polypeptide of the present invention, or a fragment thereof; and (b) a physiologically acceptable carrier Within other aspects, the present invention provides pharmaceutical compositions comprising: (a) an antigen-presenting cell expressing a polypeptide as described above, and (b) a pharmaceutically acceptable carrier or excipient. Illustrative antigen presenting cells include dendritic cells, monocyte macrophages, fibroblasts, and B cells. Related aspects are provided pharmaceutical compositions comprising: (a) an antigen presenting cell which expresses a polypeptide as described above, and (b) an immunostimulant. The present invention further provides, in other aspects, fusion proteins comprising at least one polypeptide as described above, as well as polynucleotides encoding said fusion proteins, typically in the form of pharmaceutical compositions, e.g., vaccine compositions, comprising a physiologically acceptable vehicle and / or immunostimulant. The fusion proteins may comprise multiple immunogenic polypeptides or portions / variants thereof, as described herein, and may further comprise one or more polypeptide segments to facilitate and / or enhance the expression, purification and / or immunogenicity of the polypeptide (s). ). Within other aspects, the present invention provides methods for stimulating an immune response in a patient, preferably a T cell response in a human patient, which comprises administering a pharmaceutical composition described herein. The patient may present with prostate cancer, in which case the methods provide treatment for the disease, or a patient considered at risk of obtaining said disease may be treated prophylactically. Within other aspects, the present invention provides methods for inhibiting the development of a cancer in a patient, which they comprise administering to a patient a pharmaceutical composition presented herein. The patient may present with prostate cancer, in which case the methods provide treatment for the disease, or a patient considered to be at risk of having said disease may be treated prophylactically. The present invention further provides, within other aspects, methods for removing tumor cells from a biological sample, comprising contacting a biological sample with T cells that specifically react with a polypeptide of the present invention, wherein the step of in contact is carried out under conditions and for a sufficient time to allow the removal of the cells expressing the polypeptide of the sample.

Within related aspects, methods are provided for inhibiting the development of a cancer in a patient, comprising administering to a patient a biological sample treated as described above. In addition, methods are provided, within other aspects, for stimulating and / or expanding T cells specific for a polypeptide of the present invention, comprising contacting T cell with one or more of: (i) a polypeptide as described above; (ii) a polynucleotide encoding a polypeptide; (iii) an antigen-presenting cell expressing a polypeptide; under conditions and for a sufficient time to allow the stimulation and / or expansion of T cells. They also provide isolated T cell populations that comprise T cells prepared as described above. Within other aspects, the present invention provides methods for inhibiting the development of a cancer in a patient, comprising administering to a patient an effective amount of a population of T cells as described above. The present invention further provides methods for inhibiting the development of a cancer in a patient, comprising the steps of: (a) incubating CD4 + and / or CD8 + T cells isolated from a patient with one or more of: (i) a polypeptide that comprises at least an immunogenic portion of the polypeptide described herein; (ii) a polynucleotide encoding said polypeptide; and (iii) a presented antigen cell expressing said polypeptide; and (b) administering to the patient an effective amount of proliferated T cells, thereby inhibiting the development of a cancer in the patient. Proliferated cells may, but not necessarily, be cloned before administration to the patient. Within other aspects, the present invention provides methods for determining the presence or absence of a cancer, preferably prostate cancer, in a patient, which comprise: (a) contacting a biological sample obtained from a patient with an agent of binding that binds to a polypeptide as presented above; (b) detecting in the sample a quantity of polypeptide that binds to the binding agent; and (c) comparing the amount of polypeptide with a predetermined cut-off value, and then determining the presence or absence of a cancer in the patient.

Within preferred embodiments, the binding agent is an antibody, most preferably a monoclonal antibody. The present invention also provides, within other aspects, methods for verifying the progression of a cancer in a patient. Such methods comprise the steps of: (a) contacting a biological sample obtained from a patient at a prime point of time with a binding agent that binds to a polypeptide as presented above; (b) detecting in the sample, an amount of polypeptide that binds to the binding agent; (c) repeating steps (a) and (b) using a biological sample obtained from the patient at a subsequent point in time; and (d) comparing the amount of polypeptide detected in step (c) with the amount detected in step (b) and hence verifying the progression of cancer in the patient. The present invention also provides, within other aspects, methods for determining the presence or absence of cancer in a patient, comprising the steps of: (a) contacting a biological sample obtained from a patient with an oligonucleotide that hybridizes to a patient; a polynucleotide of the present invention; (b) detecting in the sample, a level of a polynucleotide, preferably mRNA that hybridizes to the oligonucleotide; and (c) comparing the level of polynucleotide that hybridizes to the oligonucleotide with a predetermined cutoff value, and then determining the presence or absence of a cancer in the patient. Within certain modalities, the amount of mRNA is detected through a polymerase chain reaction using, for example, at least one oligonucleotide primer that hybridizes to a polynucleotide of the present invention, or a complement to said polynucleotide. Within other embodiments, the amount of mRNA is detected using a hybridization technique, employing an oligonucleotide probe that hybridizes to a polynucleotide of the invention, or a complement of said polynucleotide. In related aspects, methods for verifying the progression of a cancer in a patient are provided, comprising the steps of: (a) contacting a biological sample obtained from a patient with an oligonucleotide that hybridizes to a polynucleotide of the present invention; (b) detecting in the sample, an amount of a polynucleotide to the oligonucleotide; (c) repeating steps (a) and (b) using a biological sample obtained from the patient at a subsequent point in time; and (d) comparing the amount of the polynucleotide detected in step (c) with the amount detected in step (b), and then verifying the progression of the cancer in the patient.

Within other aspects, the present invention provides antibodies, such as monoclonal antibodies, which bind to a polypeptide as described above, as well as diagnostic kits comprising such antibodies. Diagnostic equipment comprising one or more waves or oligonucleotide primers are also provided. These and other aspects of the present invention will become apparent after reference to the following description Details and annex drawings. All references described herein are hereby incorporated by reference in their entirety as if each were incorporated individually.

BRIEF DESCRIPTION OF THE DRAWINGS AND IDENTIFICIENTS OF SEQUENCE Figure 1 illustrates the ability of T cells to annihilate fibroblasts expressing the representative prostate-specific polypeptide P501 S, as compared to control fibroblasts. The percentage of lysis is shown as a series ofpointer effect relationships, as indicated. Figures 2A and 2B illustrate the ability of T cells to recognize cells expressing the representative prostate-specific polypeptide P502S. In each case, the number of? -interferon points is displayed with different numbers of responders. In Figure 2A, the data is presented for pulsed fibroblasts with the P2S-12 peptide, as compared to pulsed fibroblasts with an E75 control peptide. In Figure 2B, the data represent parafibroblasts expressing P502S, as compared to fibroblasts expressing H ER-2 / neu. Figure 3 depicts a peptide competition binding assay showing peptide P 1 S # 10, derived from P501 S, bound to H LA-A2. The P 1 S # 10 peptide inhibits the HLA-A2 restricted presentation of the f! UM58 peptide for the CTL D 150M58 clone in the bioassay of TNF release. The CTL of D 150M58 is specific for the HLA-A2 binding influenza matrix peptide, fluM58. Figure 4 illustrates the ability of T cell lines generated from mice immunized with P 1 S # 10 to specifically lyse Jurkat A2Kb targets pulsed with P 1 S # 10 and Jurkat A2Kb targets transduced with P501 S, according to compared to A2Kb of Jurkat transduced with EG FP. The percentage of lysis is shown as a series of effector to objective ratio, as indicated. Figure 5 illustrates the ability of a T cell clone to recognize and specifically lyse Jurkat A2Kb cells expressing the representative prostate specific polypeptide P501 S, thus demonstrating that the P1 S # 10 peptide can be a naturally processed epitope of the P501 polypeptide S. Figures 6A and 6B are graphs illustrating the specificity of a CD8 + cell line (3A-1) for a representative prostate-specific antigen (P501 S). Figure 6A shows the results of a 51 Cr release assay. The percentage of specific lysis is shown as a series of effector: target ratios, as indicated. Figure 6B shows the production of interferon-gamma through 3A-1 cells stimulated with autologous B-LCL transduced with P501 S, at variable effector: target ratios as indicated. Figure 7 is a Western plot showing the expression of P501 S in baculovirus.

Figure 8 illustrates the results of studies of epitope map formation on P501S. Figure 9 is a schematic representation of the protein P501S showing the location of the transmembrane domains and intracellular and extracellular predicted domains. Figure 10 is a genomic map showing the location of the prostate genes P775P, P704P, B305D, P712P and P774P within the cat eye syndrome region of chromosome 22q11.2. Figure 11 shows the results of an ELISA assay to determine the specificity of rabbit polyclonal antisera raised against P501S. SEQ ID NO: 1 is the cDNA sequence determined for F1-13. SEQ ID NO: 2 is the 3 'cDNA sequence determined for F1-12.

SEQ ID NO: 3 is the 5 'cDNA sequence determined for F1-12. SEQ ID NO: 4 is the 3 'cDNA sequence determined for F1-16.

SEQ ID NO: 5 is the 3 'cDNA sequence determined for H1-1.

SEQ ID NO: 6 is the 3 'cDNA sequence determined for H1-9.

SEQ ID NO: 7 is the 3 'cDNA sequence determined for H1-4.

SEQ ID NO: 8 is the 3 'cDNA sequence determined for J1-17. SEQ ID NO: 9 is the 5 'cDNA sequence determined for J1-17.

SEQ ID NO: 10 is the 3 'cDNA sequence determined for L1-12.

SEQ ID NO: 11 is the 5 'cDNA sequence determined for L1-12.

SEQ ID NO: 12 is the 3 'cDNA sequence determined for N1-1862. SEQ ID NO: 13 is the 5' cDNA sequence determined for N1- 1862. SEQ ID NO: 14 is the 3 'cDNA sequence of terminated for J1-13. SEQ ID NO: 15 is the 5 'cDNA sequence of terminated for J1-13. SEQ ID NO: 16 is the 3 'cDNA sequence of finished for J1-19. SEQ ID NO: 17 is the 5 'cDNA sequence of terminated for J1-19. SEQ ID NO: 18 is the 3 'cDNA sequence of finished for J1-25. SEQ ID NO: 19 is the 5 'cDNA sequence of terminated for J1-25. SEQ ID NO: 20 is the 5 'cDNA sequence of terminated for J1-24. SEQ ID NO: 21 is the 3 'cDNA sequence of terminated for J1-24. SEQ ID NO: 22 is the 5 'cDNA sequence of terminated for K1-58. SEQ ID NO: 23 is the 3 'cDNA sequence of terminated for K1-58. SEQ ID NO: 24 is the 5 * cDNA sequence of terminated for K1-63. SEQ ID NO: 25 is the 3 'cDNA sequence of terminated for K1-63. SEQ ID NO: 26 is the 5 'cDNA sequence of terminated for L1-4. SEQ ID NO: 27 is the 3 'cDNA sequence of terminated for L1-4. SEQ ID NO: 28 is the 5 'cDNA sequence of terminated for L1-14. SEQ ID NO: 29 is the 3 'cDNA sequence of terminated for L1-14. SEQ ID NO: 30 is the 3 'cDNA sequence of finished for J1-12. SEQ ID NO: 31 is the 3 'cDNA sequence of terminated for J1-16. SEQ ID NO: 32 is the 3 'cDNA sequence of terminated for J1-21. SEQ ID NO: 33 is the 3 * cDNA sequence of completed for K1-48. SEQ ID NO: 34 is the 3 'cDNA sequence of terminated for K1-55. SEQ ID NO: 35 is the 3 'cDNA sequence of terminated for L1-2. SEQ ID NO: 36 is the 3 'cDNA sequence of terminated for L1-6. SEQ ID NO: 37 is the 3 'cDNA sequence determined for N1 1858. SEQ ID NO: 38 is the 3 'cDNA sequence determined for N1-1860. SEQ ID NO: 39 is the 3 'cDNA sequence determined for N1 1861. SEQ ID NO: 40 is the 3' cDNA sequence determined for N1-1864. SEQ ID NO: 41 is the cDNA sequence determined for P5. SEQ ID NO: 42 is the cDNA sequence determined for P8. SEQ ID NO: 43 is the cDNA sequence determined for P9. SEQ ID NO: 44 is the cDNA sequence determined for P18 SEQ ID NO: 45 is the cDNA sequence determined for P20 SEQ ID NO: 46 is the cDNA sequence determined for P29 SEQ ID NO: 47 is the determined cDNA sequence for P30 SEQ ID NO: 48 is the cDNA sequence determined for P34 SEQ ID NO: 49 is the cDNA sequence determined for P36 SEQ ID NO: 50 is the cDNA sequence determined for P38 SEQ ID NO: 51 is the sequence of CDNA determined for P39 SEQ ID NO: 52 is the cDNA sequence determined for P42 SEQ ID NO: 53 is the cDNA sequence determined for P47 SEQ ID NO: 54 is the cDNA sequence determined for P49 SEQ ID NO: 55 is the cDNA sequence determined for P50 SEQ ID NO: 56 is the cDNA sequence determined for P53 SEQ ID NO: 57 is the cDNA sequence determined for P55 SEQ ID NO: 58 is the cDNA sequence determined for P60 SEQ ID NO: 59 is the cDNA sequence determined for P64. SEQ ID NO: 60 is the cDNA sequence determined for P65. SEQ ID NO: 61 is the cDNA sequence determined for P73. SEQ ID NO: 62 is the cDNA sequence determined for P75. SEQ ID NO: 63 is the cDNA sequence determined for P76. SEQ ID NO: 64 is the cDNA sequence determined for P79. SEQ ID NO: 65 is the cDNA sequence determined for P84. SEQ ID NO: 66 is the cDNA sequence determined for P68. SEQ ID NO: 67 is the cDNA sequence determined for P8 (also determined as P704P). SEQ ID NO: 68 is the cDNA sequence determined for P82. SEQ ID NO: 69 is the cDNA sequence determined for U1-3064. SEQ ID NO: 70 is the cDNA sequence determined for U1-3065. SEQ ID NO: 71 is the cDNA sequence determined for V1-3692. SEQ ID NO: 72 is the cDNA sequence determined for 1A-3905. SEQ ID NO: 73 is the cDNA sequence determined for V1-3686. SEQ ID NO: 74 is the cDNA sequence determined for R1-2330. SEQ ID NO: 75 is the cDNA sequence determined for 1B-3976. SEQ ID NO: 76 is the cDNA sequence determined for V1-3679. SEQ ID NO: 77 is the cDNA sequence determined for 1G-4736. SEQ ID NO: 78 is the cDNA sequence determined for 1G-4738. SEQ ID NO: 79 is the cDNA sequence determined for 1G-4741. SEQ ID NO: 80 is the cDNA sequence determined for 1G-4744. SEQ ID NO: 81 is the cDNA sequence determined for 1G-4734. SEQ ID NO: 82 is the cDNA sequence determined for 1H-4774.

SEQ ID NO: 83 is the cDNA sequence determined for 1H-4781.

SEQ ID NO: 84 is the cDNA sequence determined for 1H-4785.

SEQ ID NO: 85 is the cDNA sequence determined for 1H-4787.

SEQ ID NO: 86 is the cDNA sequence determined for 1H-4796. SEQ ID NO: 87 is the cDNA sequence determined for 11-4807.

SEQ ID NO: 88 is the cDNA sequence determined for 11-4810.

SEQ ID NO: 89 is the cDNA sequence determined for 11-4811.

SEQ ID NO: 90 is the cDNA sequence determined for 1J-4876.

SEQ ID NO: 91 is the cDNA sequence determined for 1K-4884. SEQ ID NO: 92 is the cDNA sequence determined for 1K-4896.

SEQ ID NO: 93 is the cDNA sequence determined for 1G-4761.

SEQ ID NO: 94 is the cDNA sequence determined for 1G-4762.

SEQ ID NO: 95 is the cDNA sequence determined for 1H-4766.

SEQ ID NO: 96 is the cDNA sequence determined for 1H-4770. SEQ ID NO: 97 is the cDNA sequence determined for 1H-4771.

SEQ ID NO: 98 is the cDNA sequence determined for 1H-4772.

SEQ ID NO: 99 is the cDNA sequence determined for 1D-4297. SEQ ID NO: 100 is the cDNA sequence determined for 1D-4309. SEQ ID NO: 101 is the cDNA sequence determined for 1D.1 4278. SEQ ID NO 102 is the cDNA sequence determined for 1D-4288. SEQ ID NO 103 is the cDNA sequence determined for 1D-4283. SEQ ID NO 104 is the cDNA sequence determined for 1D-4304. SEQ ID NO: 105 is the cDNA sequence determined for 1D-4296. SEQ ID NO 106 is the cDNA sequence determined for 1D-4280.

SEQ ID NO: 107 is the full-length cDNA sequence determined for F1-12 (also referred to as P504S). SEQ ID NO: 108 is the amino acid sequence predicted for Fl-12. SEQ ID NO: 109 is the full-length cDNA sequence determined for J1-17. SEQ ID NO: 110 is the full-length cDNA sequence determined for L1-12 (also referred to as P501S). SEQ ID NO: 111 is the full-length cDNA sequence determined for N1-1862 (also referred to as P503S). SEQ ID NO: 112 is the amino acid sequence predicted for Jl-17. SEQ ID NO: 113 is the predicted amino acid sequence for Ll-12 (also referred to as P501S). SEQ ID NO: 114 is the amino acid sequence predicted for N1-1862 (also referred to as P503S). SEQ ID NO: 115 is the cDNA sequence determined for P89. SEQ ID NO: 116 is the cDNA sequence determined for P90. SEQ ID NO: 117 is the cDNA sequence determined for P92. SEQ ID NO: 118 is the cDNA sequence determined for P95. SEQ ID NO: 119 is the cDNA sequence determined for P98. SEQ ID NO: 120 is the cDNA sequence determined for P102. SEQ ID NO: 121 is the cDNA sequence determined for P110. SEQ ID NO: 122 is the cDNA sequence determined for P111. SEQ ID NO: 123 is the cDNA sequence determined for P114.

SEQ ID NO: 124 is the cDNA sequence determined for P115.

SEQ ID NO: 125 is the cDNA sequence determined for P116.

SEQ ID NO: 126 is the cDNA sequence determined for P124.

SEQ ID NO: 127 is the cDNA sequence determined for P126.

SEQ ID NO: 128 is the cDNA sequence determined for P130.

SEQ ID NO: 129 is the cDNA sequence determined for P133.

SEQ ID NO: 130 is the cDNA sequence determined for P138.

SEQ ID NO: 131 is the cDNA sequence determined for P143.

SEQ ID NO: 132 is the cDNA sequence determined for P151.

SEQ ID NO: 133 is the cDNA sequence determined for P156.

SEQ ID NO: 134 is the cDNA sequence determined for P157.

SEQ ID NO: 135 is the cDNA sequence determined for P166.

SEQ ID NO: 136 is the cDNA sequence determined for P176.

SEQ ID NO: 137 is the cDNA sequence determined for P178.

SEQ ID NO: 138 is the cDNA sequence determined for P179.

SEQ ID NO: 139 is the cDNA sequence determined for P185.

SEQ ID NO: 140 is the cDNA sequence determined for P192.

SEQ ID NO: 141 is the cDNA sequence determined for P201.

SEQ ID NO: 142 is the cDNA sequence determined for P204.

SEQ ID NO: 143 is the cDNA sequence determined for P208.

SEQ ID NO: 144 is the cDNA sequence determined for P211.

SEQ ID NO: 145 is the cDNA sequence determined for P213.

SEQ ID NO: 146 is the cDNA sequence determined for P219.

SEQ ID NO: 147 is the cDNA sequence determined for P237.

SEQ ID NO: 148 is the cDNA sequence determined for P239.

SEQ ID NO: 149 is the cDNA sequence determined for P248.

SEQ ID NO: 150 is the cDNA sequence determined for P251.

SEQ ID NO: 151 is the cDNA sequence determined for P255.

SEQ ID NO: 152 is the cDNA sequence determined for P256.

SEQ ID NO: 153 is the cDNA sequence determined for P259.

SEQ ID NO: 154 is the cDNA sequence determined for P260.

SEQ ID NO: 155 is the cDNA sequence determined for P263.

SEQ ID NO: 156 is the cDNA sequence determined for P264.

SEQ ID NO: 157 is the cDNA sequence determined for P266.

SEQ ID NO: 158 is the cDNA sequence determined for P270.

SEQ ID NO: 159 is the cDNA sequence determined for P272.

SEQ ID NO: 160 is the cDNA sequence determined for P278.

SEQ ID NO: 161 is the cDNA sequence determined for P105.

SEQ ID NO: 162 is the cDNA sequence determined for P107.

SEQ ID NO: 163 is the cDNA sequence determined for P137 SEQ ID NO: 164 is the cDNA sequence determined for P194.

SEQ ID NO: 165 is the cDNA sequence determined for P195.

SEQ ID NO: 166 is the cDNA sequence determined for P196.

SEQ ID NO: 167 is the cDNA sequence determined for P220.

SEQ ID NO: 168 is the cDNA sequence determined for P234.

SEQ ID NO: 169 is the cDNA sequence determined for P235.

SEQ ID NO: 170 is the cDNA sequence determined for P243.

SEQ ID NO: 171 is the cDNA sequence determined for P703P-DE1 SEC (D NO: 172 is the cDNA sequence determined for P703P- OF 1. SEQ ID NO: 173 is the cDNA sequence determined for P703P-DE2. SEQ ID NO: 174 is the cDNA sequence determined for P703P-DE6. SEQ ID NO: 175 is the cDNA sequence determined for P703P-DE13. SEQ ID NO: 176 is the cDNA sequence determined for P703P-DE13. SEQ ID NO: 177 is the cDNA sequence determined for P703P-DE14. SEQ ID NO: 178 is the amino acid sequence predicted for P703P-DE14. SEQ ID NO: 179 is the extended cDNA sequence determined for 1G-4736. SEQ ID NO: 180 is the extended cDNA sequence determined for 1G-4738. SEQ ID NO: 181 is the extended cDNA sequence determined for 1G-4741. SEQ ID NO: 182 is the extended cDNA sequence determined for 1G-4744. SEQ ID NO: 183 is the extended cDNA sequence determined for 1H-4774. SEQ ID NO: 184 is the extended cDNA sequence determined for 1H-4781.

SEQ ID NO: 185 is the extended cDNA sequence determined for 1H-4785. SEQ ID NO: 186 is the extended cDNA sequence determined for 1H-4787. SEQ ID NO: 187 is the extended cDNA sequence determined for 1H-4796. SEQ ID NO: 188 is the extended cDNA sequence determined for 11-4807. SEQ ID NO: 189 is the 3 'cDNA sequence determined for 11-4810. SEQ ID NO: 190 is the 3 'cDNA sequence determined for 11-4811 SEQ ID NO: 191 is the extended cDNA sequence determined for 1J-4876. SEQ ID NO: 192 is the extended cDNA sequence determined for 1K-4884. SEQ ID NO: 193 is the extended cDNA sequence determined for 1K-4896. SEQ ID NO: 194 is the extended cDNA sequence determined for 1G-4761. SEQ ID NO: 195 is the extended cDNA sequence determined for 1G-4762. SEQ ID NO: 196 is the extended cDNA sequence determined for 1H-4766. SEQ ID NO: 197 is the 3 'cDNA sequence determined for 1H 4770. SEQ ID NO: 198 is the 3 'cDNA sequence determined for 1H-4771. SEQ ID NO: 199 is the extended cDNA sequence determined for 1H-4772. SEQ ID NO: 200 is the extended cDNA sequence determined for 1D-4309. SEQ ID NO: 201 is the extended cDNA sequence determined for ID.1-4278. SEQ ID NO: 202 is the extended cDNA sequence determined for ID-4288. SEQ ID NO: 203 is the extended cDNA sequence determined for 1D-4283. SEQ ID NO: 204 is the extended cDNA sequence determined for 1D-4304. SEQ ID NO: 205 is the extended cDNA sequence determined for 1D-4296. SEQ ID NO: 206 is the extended cDNA sequence determined by pair 1D-4280. SEQ ID NO: 207 is the cDNA sequence determined for 10-d8fwd.

SEQ ID NO: 208 is the cDNA sequence determined for 10 H10con. SEQ ID NO: 209 is the cDNA sequence determined for 11-C8rev.

SEQ ID NO: 210 is the cDNA sequence determined for 7.g6fwd. SEQ ID NO: 211 is the cDNA sequence determined for 7.g6rev.

SEC I D NO: 212 is the cDNA sequence determined for 8-b5fwd.

SEC I D NO: 213 is the cDNA sequence determined for 8-b5rev.

SEQ ID NO: 214 is the cDNA sequence determined for 8-b6fwd.

SEQ ID NO: 215 is the cDNA sequence determined for 8-b6-rev.

SEC I D NO: 216 is the cDNA sequence determined for 8-d4fwd.

SEC I D NO: 217 is the cDNA sequence determined for 8-d9rev.

SEC I D NO.-218 is the cDNA sequence determined for 8-g3fwd.

SEC I D NO: 21 9 is the cDNA sequence determined for 8-g3rev.

SEC I D NO: 220 is the cDNA sequence determined for 8-h 1 1 rev.

SEQ ID NO: 221 is the cDNA sequence determined for g-f12fwd.

SEQ ID NO 222 is the cDNA sequence determined for g-f3rev.

SEC I D NO: 223 is the cDNA sequence determined for P509S.

SEC I D NO: 224 is the cDNA sequence determined for P510S.

SEC I D NO: 225 is the cDNA sequence determined for P703DES SEC I D NO: 226 is the cDNA sequence determined for 9-A1 1.

SEC I D NO: 227 is the cDNA sequence determined for 8-C6.

SEC I D NO: 228 is the cDNA sequence determined for 8-H7.

SEC I D NO: 229 is the cDNA sequence determined for JPTPN 13 SEC I D NO: 230 is the cDNA sequence determined for JPTPN 14 SEC I D NO: 231 is the cDNA sequence determined for JPTPN23 SEC I D NO: 232 is the cDNA sequence determined for JPTPN24 SEC I D NO: 233 is the cDNA sequence determined for JPTPN25 SEC I D NO: 234 is the cDNA sequence determined for J PTPN30 SEC I D NO: 235 is the sequence of AD Nc determined for JPTPN34 SEC I D NO: 236 is the cDNA sequence determined for JPTPN35 SEQ ID NO 237 is a cDNA sequence of the terminated for JPTPN36 SEQ ID NO 238 is a cDNA sequence of the terminated for JPTPN38 SEQ ID NO 239 is a cDNA sequence from erminated for JPTPN39 SEQ ID NO 240 is a cDNA sequence of the erminated for JPTPN40 SEQ ID NO 241 is a cDNA sequence of the terminated for JPTPN41 SEQ ID NO 242 is a cDNA sequence of the terminated for JPTPN42 SEQ ID NO 243 is a cDNA sequence from erminated for JPTPN45 SEQ ID NO 244 is a cDNA sequence of the terminated for JPTPN46 SEQ ID NO 245 is a cDNA sequence of the terminated for JPTPN51 SEQ ID NO 246 is a cDNA sequence of the terminated for JPTPN56 SEQ ID NO 247 is a cDNA sequence of the erminated for PTPN64.

SEQ ID NO 248 is a cDNA sequence of the terminated for JPTPN65 SEQ ID NO 249 is a cDNA sequence of the terminated for JPTPN67 SEQ ID NO 250 is a cDNA sequence of the erminated for JPTPN76 SEQ ID NO 251 is a cDNA sequence of the terminated for JPTPN84 SEQ ID NO 252 is a finished cDNA sequence for JPTPN85 SEQ ID NO 253 is a finished cDNA sequence for JPTPN86 SEQ ID NO 254 is a finished cDNA sequence for JPTPN87 SEQ ID NO 255 is a finished cDNA sequence for JPTPN88 SEQ ID NO 256 is a cDNA sequence terminated for JP1F1.

SEQ ID NO 257 is a cDNA sequence terminated for JP1F2.

SEQ ID NO 258 is a cDNA sequence terminated for JP1C2.

SEQ ID NO 259 is a cDNA sequence terminated for JP1B1.

SEQ ID NO 260 is a cDNA sequence terminated for JP1B2.

SEQ ID NO 261 is a finished cDNA sequence for JP1D3.

SEQ ID NO 262 is a cDNA sequence determined for JP1A4.

SEQ ID NO 263 is a cDNA sequence determined for JP1F5.

SEQ ID NO 264 is a cDNA sequence determined for JP1E6.

SEQ ID NO 265 is a cDNA sequence determined for JP1D6.

SEQ ID NO 266 is a cDNA sequence determined for JP1B5.

SEQ ID NO 267 is a cDNA sequence determined for JP1A6.

SEQ ID NO 268 is a cDNA sequence determined for JP1E8.

SEQ ID NO 269 is a cDNA sequence determined for JP1D7.

SEQ ID NO 270 is a cDNA sequence determined for JP1D9.

SEQ ID NO 271 is a cDNA sequence determined for JP1C10.

SEQ ID NO 272 is a cDNA sequence determined for JP1A9.

SEQ ID NO 273 is a cDNA sequence determined for JP1F12.

SEQ ID NO 274 is a cDNA sequence determined for JP1E12.

SEQ ID NO 275 is a cDNA sequence determined for JP1D11.

SEQ ID NO 276 is a cDNA sequence determined for JP1C11.

SEQ ID NO 277 is a cDNA sequence determined for JP1C12.

SEQ ID NO: 278 is a cDNA sequence determined for JP1B12.

SEQ ID NO 279 is a cDNA sequence determined for JP1A12.

SEQ ID NO 280 is a cDNA sequence determined for JP8G2.

SEQ ID NO 281 is a cDNA sequence determined for JP8H1.

SEQ ID NO: 282 is a cDNA sequence determined for JP8H2.

SEQ ID NO: 283 is a cDNA sequence determined for JP8A3.

SEQ ID NO: 284 is a cDNA sequence determined for JP8A4.

SEC ID NO • 285 is the cDNA sequence determined for JP8C3.

SEQ ID NO: 286 is the cDNA sequence determined for JP8G4.

SEQ ID NO: 287 is a cDNA sequence determined for JP8B6. SEQ ID NO: 288 is a cDNA sequence determined for JP8D6. SEQ ID NO: 289 is a cDNA sequence determined for JP8F5. SEQ ID NO: 290 is a cDNA sequence determined for JP8A8. SEQ ID NO: 291 is a cDNA sequence determined for JP8C7. SEQ ID NO: 292 is a cDNA sequence determined for JP8D7. SEQ ID NO.-293 is a cDNA sequence determined for P8D8. SEQ ID NO: 294 is a cDNA sequence determined for JP8E7. SEQ ID NO: 295 is a cDNA sequence determined for JP8F8. SEQ ID NO: 296 is a cDNA sequence determined for JP8G8. SEQ ID NO: 297 is a cDNA sequence determined for JP8B10. SEQ ID NO: 298 is a cDNA sequence determined for JP8C10. SEQ ID NO: 299 is a cDNA sequence determined for JP8E9. SEQ ID NO: 300 is a cDNA sequence determined for JP8E10. SEQ ID NO: 301 is a cDNA sequence determined for JP8F9. SEQ ID NO: 302 is a cDNA sequence determined for JP8H9. SEQ ID NO: 303 is a cDNA sequence determined for JP8C12. SEQ ID NO: 304 is a cDNA sequence determined for JP8E11. SEQ ID NO: 305 is a cDNA sequence determined for JP8E12. SEQ ID NO: 306 is a cDNA sequence determined for peptide PS2 # 12. SEQ ID NO: 307 is a cDNA sequence determined for P711P. SEQ ID NO: 308 is a cDNA sequence determined for P712P. SEQ ID NO: 309 is the cDNA sequence determined by CLONE23.

SEQ ID NO: 310 is the cDNA sequence determined for P774P.

SEC I D NO: 31 1 is the cDNA sequence determined for P775P.

SEC I D NO: 312 is the cDNA sequence determined for P715P.

SEQ ID NO: 313 is the cDNA sequence determined for P710P. SEC I D NO: 314 is the cDNA sequence determined for P767P.

SEQ ID NO: 315 is the cDNA sequence determined for P768P.

SEC I D NO: 316-325 are the cDNA sequences determined from previously isolated genes. SEQ ID NO: 326 is the cDNA sequence determined by P703PDE5. SEQ ID NO: 327 is the predicted amino acid sequence pair P703PDE5 SEQ ID NO: 328 is the cDNA sequence determined by pair P703P6.26. SEC I D NO: 329 is the predicted cDNA sequence for P703P6.26. SEQ ID NO: 330 is the cDNA sequence determined for P703PX 23. SEQ ID NO: 331 is the amino acid sequence predicted by P703PX-23. SEC I D NO: 332 is the complete length cDNA sequence determined for P509S. SEC I D NO: 333 is the extended cDNA sequence determined by pair P707P (also referred to as 1 1 -C9). SEQ ID NO: 334 is the cDNA sequence determined for P714P SEQ ID NO: 335 is the cDNA sequence determined for P705 (also referred to as 9-F3). SEQ ID NO: 336 is the amino acid sequence predicted by P705P. SEQ ID NO: 337 is the amino acid sequence of peptide P1S # 10. SEQ ID NO: 338 is the amino acid sequence of the p5 peptide. SEQ ID NO: 339 is the amino acid sequence predicted by P509S. SEQ ID NO: 340 is the cDNA sequence determined for P778P. SEQ ID NO: 341 is the cDNA sequence determined for P786P. SEQ ID NO: 342 is the cDNA sequence determined for P789P. SEQ ID NO: 343 is the cDNA sequence determined for a clo that shows homology to the MM46 mRNA of Homo sapiens. SEQ ID NO: 344 is the cDNA sequence determined for a clo that shows homology to the ABC protein mRNA (ABC 50 stimulated with Homo sapiens TNF-alpha SEQ ID NO: 345 is the cDNA sequence determined for a clo shows homology to Homo sapiens mRNA for E-cadherin.

SEQ ID NO: 346 is the cDNA sequence determined for a clo showing homology to a hydroxymethyl transferase of serine d mitochondria encoded in human nuclear form (SHMT). SEQ ID NO: 347 is the cDNA sequence determined for a clo showing homology with a protein 2 associated with natural resistance of Homo sapiens (NRAMP2). SEQ ID NO: 348 is the cDNA sequence determined for a clo showing homology to a phosphoglucomutase-related protein from Homo sapiens (PGMRP). SEC I D NO: 349 is the cDNA sequence determined for a clo that shows homology to a human mRNA for the p40 proteasome subunit. SEQ ID NO: 350 is the cDNA sequence determined for P777P.

SEQ ID NO: 351 is the cDNA sequence determined for P779P.

SEQ ID NO: 352 is the cDNA sequence determined for P790P.

SEQ ID NO: 353 is the cDNA sequence determined for P784P. SEC I D NO: 354 is the cDNA sequence determined for P776P.

SEC I D NO: 355 is the cDNA sequence determined for P780P.

SEC I D NO: 356 is the cDNA sequence determined for P544S.

SEC I D NO: 357 is the cDNA sequence determined for P745S.

SEC I D NO: 358 is the cDNA sequence determined for P782P. SEC I D NO: 359 is the cDNA sequence determined for P783P.

SEC I D NO: 360 is the cDNA sequence determined for unknown 1798. SEQ ID NO: 361 is the cDNA sequence determined for P787P.

SEQ ID NO: 362 is the cDNA sequence determined for P788P. SEC I D NO: 363 is the cDNA sequence determined for unknown 1799. SEQ ID NO: 364 is the cDNA sequence determined for P781 P.

SEC I D NO: 365 is the cDNA sequence determined for P785P.

SEC I D NO: 366-375 are the cDNA sequences determined by splice variants of B305 D.

SEQ ID NO: 376 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: 366. SEC I D NO: 377 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: 372. SEC I D NO: 378 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: 373. SEQ ID NO: 379 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: 374. SEC I D NO: 380 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: 375. SEQ ID NO: 381 is the cDNA sequence determined for B716P.

SEQ ID NO: 382 is the full-length cDNA sequence determined for P71 1 P. SEQ ID NO: 383 is the predicted amino acid sequence for P71 1 P. SEC I D NO: 384 is the cDNA sequence for P 1000C. SEQ ID NO: 385 is the cDNA sequence for CGI-82. SEQ ID NO: 386 is the cDNA sequence for 23320. SEC I D NO: 387 is the cDNA sequence for CGI-69. SEC I D NO: 388 is the cDNA sequence for L-iditol-2 dehydrogenase. SEC I D NO: 389 is the cDNA sequence for 23379. SEQ ID NO: 390 is the cDNA sequence for 23381. SEQ ID NO: 391 is the cDNA sequence for K1 AA0122. SEC I D NO: 392 is the cDNA sequence for 23399.

SEQ ID NO: 393 is the cDNA sequence for a previously identified gene. SEQ ID NO: 394 is the cDNA sequence for HCLBP. SEQ ID NO: 395 is the cDNA sequence for transglutaminase. SEQ ID NO: 396 is the cDNA sequence for a previously identified gene. SEQ ID NO: 397 is the cDNA sequence for PAP. SEQ ID NO: 398 is the cDNA sequence for transcription factor Ets, PDEF. SEQ ID NO: 399 is the cDNA sequence for hTGR. SEQ ID NO: 400 is the cDNA sequence for KIAA0295. SEQ ID NO: 401 is the cDNA sequence for 22545. SEQ ID NO: 402 is the cDNA sequence for 22547. SEQ ID NO: 403 is the cDNA sequence for 22548. SEQ ID NO: 404 is the cDNA sequence for 22550. SEQ ID NO: 405 is the cDNA sequence for 22551. SEQ ID NO: 406 is the cDNA sequence for 22552. SEQ ID NO: 407 is the cDNA sequence for 22553 (also known as P1020C). SEQ ID NO: 408 is the cDNA sequence for 22558. SEQ ID NO: 409 is the cDNA sequence for 22562. SEQ ID NO: 410 is the cDNA sequence for 22565. SEQ ID NO: 411 is the cDNA sequence for 22567. SEQ ID NO: 412 is the cDNA sequence for 22568. SEQ ID NO: 413 is the cDNA sequence for 22570.

SEQ ID NO: 414 is a cDNA sequence for 22571. SEQ ID NO: 415 is a cDNA sequence for 22572. SEQ ID NO: 416 is a cDNA sequence for 22573. SEQ ID NO: 417 is a cDNA sequence for 22573. SEQ ID NO: 418 is a cDNA sequence for 22575. SEQ ID NO: 419 is a cDNA sequence for 22580. SEQ ID NO: 420 is a cDNA sequence for 22581. SEQ ID NO: 421 is a sequence of CDNA for 22582. SEQ ID NO: 422 is a cDNA sequence for 22583. SEQ ID NO: 423 is a cDNA sequence for 22584. SEQ ID NO: 424 is a cDNA sequence for 22585. SEQ ID NO: 425 is a cDNA sequence for 22586. SEQ ID NO: 426 is a cDNA sequence for 22587. SEQ ID NO: 427 is a cDNA sequence for 22588. SEQ ID NO: 428 is a cDNA sequence for 22589. SEQ ID NO: 429 is a cDNA sequence for 22590. SEQ ID NO: 430 is a cDNA sequence for 22591. SEQ ID NO: 431 is a cDNA sequence for 22592. SEQ ID NO: 432 is a cDNA sequence for 22593. SEQ ID NO. : 433 is a cDNA sequence for 22594. SEQ ID NO: 434 is as cDNA sequence for 22595. SEQ ID NO: 435 is a cDNA sequence for 22596. SEQ ID NO: 436 is a cDNA sequence for 22847. SEQ ID NO: 437 is a cDNA sequence for 22848. SEQ ID NO: 438 it is a cDNA sequence for 22849.

SEQ ID NO: 439 is the cDNA sequence for 22851. SEQ ID NO: 440 is the cDNA sequence for 22852. SEQ ID NO: 441 is the cDNA sequence for 22853. SEQ ID NO: 442 is the cDNA sequence for 22854. SEQ ID NO: 443 is the cDNA sequence for 22855. SEQ ID NO: 444 is the cDNA sequence for 22856. SEQ ID NO: 445 is the cDNA sequence for 22857. SEQ ID NO: 446 is the sequence of CDNA for 23601. SEQ ID NO: 447 is the cDNA sequence for 23602. SEQ ID NO: 448 is the cDNA sequence for 23605. SEQ ID NO: 449 is the cDNA sequence for 23606. SEQ ID NO: 450 is the cDNA sequence for 23612. SEQ ID NO: 451 is the cDNA sequence for 23614. SEQ ID NO: 452 is the cDNA sequence for 23618. SEQ ID NO: 453 is the cDNA sequence for 23622. SEQ ID NO: 454 is the cDNA sequence for hydrolase folate. SEQ ID NO: 455 is the cDNA sequence for LIM protein. SEQ ID NO: 456 is the cDNA sequence for a known gene. SEQ ID NO: 457 is the cDNA sequence for a known gene. SEQ ID NO: 458 is the cDNA sequence for a previously identified gene. SEQ ID NO: 459 is the cDNA sequence for 23045. SEQ ID NO.460 is the cDNA sequence for 23032. SEQ ID NO: 461 is the cDNA sequence for a clone 23054. SEQ ID NO: 462-467 is cDNA sequences for gene known. SEQ ID NO: 468-471 are the cDNA sequences for P710P. SEC I D NO: 472 is the cDNA sequence for P1001 C. SEQ ID NO: 473 is the cDNA sequence determined for a first splice variant of P775P (also referred to as 27505). SEQ ID NO: 474 is the cDNA sequence determined for a second splice variant of P775P (also referred to as 19947). SEQ ID NO: 475 is the cDNA sequence determined for a third splice variant of P775P (also referred to as 19941). SEC I D NO: 476 is the cDNA sequence determined for a fourth splice variant of P775P (also called com 19937). SEQ ID NO: 477 is a first predicted amino acid sequence encoded by the sequence of SEQ ID NO: 474. SEQ ID NO: 478 is a second predicted amino acid sequence encoded by the sequence of SEQ ID NO: 474. SEC I D NO: 479 is the predicted amino acid sequence encoded by the sequence of SEC I D NO: 475. SEC I D NO: 480 is a first predicted amino acid sequence encoded by the sequence of SEQ ID NO: 473. SEC I D NO: 481 is a second predicted amino acid sequence encoded by the sequence of SEQ ID NO: 473.

SEQ ID NO: 482 is a third predicted amino acid sequence encoded by the sequence of SEQ ID NO: 473. SEC I D NO: 483 is a fourth predicted amino acid sequence encoded by the sequence of SEQ ID NO: 473. SEQ ID NO: 484 is the first 30 amino acids of the M tuberculosis antigen, Ra 12. SEC I D NO: 485 is the AW025 PCR primer. SEC I D NO: 486 is the PCR primer AW003. SEC I D NO: 487 is the PCR primer AW027. SEC I D NO: 488 is the PCR initiator AW026. SEQ ID NO: 489-501 are peptides used in epitope mapping studies. SEQ ID NO: 502 is the cDNA sequence determined from the region of determination of complementarity for the anti-P503S monoclonal antibody, 20D4. SEQ ID NO: 503 is the cDNA sequence determined from the region of determination of complementarity for the anti-P503S monoclonal antibody, JA1. SEQ ID NO: 504 and 505 are peptides used in epitope mapping studies. SEC I D NO: 506 is the cDNA sequence determined from the region of determination of complementarity for the anti-P703P monoclonal antibody, 8H2. SEQ ID NO: 507 is the cDNA sequence determined from the region of determination of complementarity for the monoclonal antibody anti-P703P, 7H8. SEQ ID NO: 508 is the cDNA sequence determined from the region of determination of complementarity for the anti-P703P monoclonal antibody, 2D4. SEQ ID NO: 509-522 are peptides used in epitope mapping studies. SEQ ID NO: 523 is a mature form of P703P used to raise antibodies against P703P. SEC I D NO: 524 is a full length putative length cDNA sequence of P703P. SEC I D NO: 525 is the predicted amino acid sequence encoded by SEQ ID NO: 524. SEC I D NO: 526 is the full-length cDNA sequence for P790P. SEC I D NO: 527 is the predicted amino acid sequence pair P790P. SEC I D NO: 528 and 529 are PCR initiators. SEC I D NO: 530 is the cDNA sequence of a splice variant of SEQ ID NO: 366. SEC I D NO: 531 is the cDNA sequence of the open reading frame of SEQ ID NO: 530. SEC I D NO: 532 is the predicted amino acid encoded by the sequence of SEC I D NO: 531. SEQ ID NO: 533 is the DNA sequence for a putative ORF of P775P.

SEQ ID NO: 534 is the predicted amino acid sequence encoded by SEQ ID NO: 533. SEC I D NO: 535 is a first complete length cDNA sequence for P510S. SEC I D NO: 536 is a second complete length cDNA sequence for P510S. SEC I D NO: 537 is the predicted amino acid sequence encoded by SEQ ID NO: 535. SEC I D NO: 538 is the predicted amino acid sequence encoded by SEC I D NO: 536. SEC I D NO: 539 is the peptide P501 S-370. SEQ ID NO: 540 is the peptide P501 S-376. SEQ ID NO: 541 -551 are epitopes of P501 S. SEC I D NO: 552 is an extended cDNA sequence for P712P. SEQ ID NO: 553-568 are the amino acid sequences encoded by open reading frames predicted within SEC I NO: 552 SEC I D NO: 569 is an extended cDNA sequence for P776P.

SEQ ID NO: 570 is the cDNA sequence determined for a splice variant of P776P referred to as contig 6. SEQ ID NO: 571 is the cDNA sequence determined for a splice variant of P776P referred to as contig 7. SEQ ID NO: 572 is the cDNA sequence determined for a splice variant of P776P designated as contig 14. SEQ ID NO: 573 is the amino acid sequence encoded by u first predicted ORF of SEQ ID NO: 570. SEC I D NO: 574 is the amino acid sequence encoded by a second predicted ORF of SEQ ID NO: 570. SEC I D NO: 575 is the amino acid sequence encoded by a predicted OR of SEQ ID NO: 571. SEQ ID NO: 576-586 are amino acid sequences encoded by Predicted ORFs of SEQ ID NO: 569. SEC ID NO: 587 is. a DNA consensus sequence of the sequences of P767P and P777P. SEQ ID NO: 588-590 are amino acid sequences encoded by Predicted ORFs of SEC I D NO: 587. SEQ ID NO: 591 is an extended cDNA sequence for P1020C.

SEC I D NO: 592 is the predicted amino acid sequence encoded by the sequence of SEQ ID NO: P1020C. SEQ ID NO: 593 is a splice variant of P775P named as 50748. SEQ ID NO: 594 is a splice variant of P775P named as 50717. SEQ ID NO: 595 is a splice variant of P775P referred to as 45985. SEQ ID NO: 595 NO: 596 is a splice variant of P775P named 38769. SEQ ID NO: 597 is a P775P splice variant named 37922. SEQ ID NO: 598 is a splice variant of P510S called P575P. as 49274. SEQ ID NO: 599 is a splice variant of P504S referred to as 39487. SEQ ID NO: 600 is a splice variant of P504S referred to as 5167.16. SEQ ID NO: 601 is a splice variant of P504S named as 5167.1. SEQ ID NO: 601 is a splice variant of P504S named as 5167.1. SEQ ID NO: 602 is a splice variant of P504S named as 5163.46. SEQ ID NO: 603 is a splice variant of P504S named as 5163.42. SEQ ID NO: 604 is a splice variant of P504S named as 5163.34. SEQ ID NO: 605 is a splice variant of P504S named as 5163.17. SEQ ID NO: 606 is a splice variant of P501 S referred to as 10640. SEQ ID NO: 607-615 are the PCR primer sequences. SEQ ID NO: 616 is the cDNA sequence determined from a fusion of P703P and PSA. SEQ ID NO: 617 is the amino acid sequence of the fusion of P703 and PSA. SEC I D NO.618 is the cDNA sequence for the DD3 gene.

SEC I D NO: 61 9 is an extended cDNA sequence for P714P.

SEQ ID NO: 620-622 are the cDNA sequences for splice d variants of P704P. SEQ ID NO: 623 is the cDNA sequence of a splice variant of P553S designated as P553S-14. SEQ ID NO: 624 is the cDNA sequence of a splice variant of P553S designated as P553S-12. SEQ ID NO: 625 is the cDNA sequence of a splice d variant of P553S designated as P553S-10. SEQ ID NO: 626 is the cDNA sequence of a splice d variant of P553S designated as P553S-6. SEQ ID NO: 627 is the amino acid sequence encoded by SEC I NO: 626 SEQ ID NO: 628 is a first amino acid sequence encoded by SEC I D NO: 623. SEQ ID NO: 629 is a second amino acid sequence encoded by SEC I D NO: 623. SEC I D NO: 630 is a first full-length cDNA sequence for the prostate-specific transglutaminase gene (also referred to herein as P558S). SEQ ID NO: 631 is a second complete length cDNA sequence for the prostate-specific transglutaminase gene.

SEQ ID NO: 632 is the amino acid sequence encoded by the sequence of SEQ ID NO: 630. SEQ ID NO: 633 is the amino acid sequence encoded by the sequence. sequence of SEC I D NO: 631. SEC I D NO: 634 is the full-length cDNA sequence for P788P. SEQ ID NO: 635 is the amino acid sequence encoded by SEC I NO: 634. SEQ ID NO: 636 is the cDNA sequence determined for a polymorphic variant of P188P. SEQ ID NO: 637 is the amino acid sequence encoded by SEC I NO: 636 SEC I D NO: 638 is the amino acid sequence for peptide 4 d P703P. SEQ ID NO: 639 is the cDNA sequence encoding peptide 4 d P703P. SEQ ID NO: 640-655 are cDNA sequences encoding the epitopes of P703P. SEQ ID NO: 656-671 are the amino acid sequences of l epitopes of 703P. SEQ ID NO: 672 and 673 are PCR primers. SEQ ID NO: 674 is the cDNA sequence encoding a terminal portion of P788P expressed in E. coli. SEC I D NO: 675 is the amino acid sequence of the terminal portion of P788P expressed in E. coli. SEQ ID NO: 676 is the amino acid sequence of the tuberculosis antigen, Ra 12. SEC I D NO: 677 and 678 are PCR primers.

SEQ ID NO: 679 is the cDNA sequence for the Ra12 construct P510S-C. SEC I D NO: 680 is the cDNA sequence for construction P510S-C. SEQ ID NO: 681 is the cDNA sequence for construction P510S-E3. SEC I D NO: 682 is the amino acid sequence for the construction Ra 12-P510S-C. SEC I D NO: 683 is the amino acid sequence for the P510S-C construct. SEC I D NO: 684 is the amino acid sequence for the construction P510S-E3. SEC I D NO: 685-690 are PCR initiators. SEQ ID NO: 691 is the cDNA sequence of the Ra12 P775P-ORF3 construct. SEQ ID NO: 692 is the cDNA sequence of the Ra 12 construction P775P-ORF3. SEC I D NO: 693 and 694 are PCR primers. SEC I D NO: 695 is the amino acid sequence determined for a fusion protein of label P703P H is. SEC I D NO: 696 is the AD Nc sequence determined for a fusion protein labeled P703P H is. SEQ ID NO: 697 and 698 are PCR primers. SEC I D NO: 699 is the amino acid sequence determined for a fusion protein of label P705P H is.

SEQ ID NO: 700 is the cDNA sequence determined for a P705P His tag fusion protein. SEQ ID NO: 701 and 702 are PCR primers. SEQ ID NO: 703 is the amino acid sequence determined for a fusion protein of P711P His tag. SEQ ID NO: 704 is the cDNA sequence determined for a fusion protein of P711P His tag. SEQ ID NO: 705 is the amino acid sequence of the tuberculosis antigen, Ra12. SEQ ID NO: 706 and 707 are PCR primers. SEQ ID NO: 708 is the cDNA sequence determined for the construction Ra12-P501S-E2. SEQ ID NO: 709 is the amino acid sequence determined for the construction Ra12-P501S-E2. SEQ ID NO: 710 is the amino acid sequence for an epitope d P501S. SEQ ID NO: 711 is the DNA sequence encoding SEQ ID NO: 710 SEQ ID NO: 712 is the amino acid sequence for an epitope d P501S. SEQ ID NO: 713 is the DNA sequence encoding SEQ ID NO: 71 SEQ ID NO: 714 is a peptide in epitope mapping studies.

SEQ ID NO: 715 is the amino acid sequence for an epitope P501S. SEQ ID NO: 716 is the DNA sequence SEQ ID NO: 715. SEQ ID NO: 717-719 are the amino acid sequences for CD4 epitopes of P501 S. SEQ ID NO: 720-722 are the DNA sequences encoding the sequences of SEQ ID NO: 717-719. SEC I D NO: 723-734 are the amino acid sequences for putative CTL epitopes of P703P. SEQ ID NO. 735 is the full-length cDNA sequence for P189P. SEQ ID NO: 736 is the amino acid sequence encoded by SEC I NO: 735 SEQ ID NO: 737 is the full-length cDNA sequence determined for the splice variant of P776P called contig 6. SEQ ID NO: 738-739 are the complete length cDNA sequences determined for the splice variant of P776 termed contig. 7. SEQ ID NO: 740-744 are amino acid sequences encoded p SEQ ID NO: 737. SEQ ID NO: 745-750 are the amino acid sequences encoded for the splice variant of P776P called contig 7. SEQ ID NO: 751 is the full-length cDNA sequence for transmembrane protease serine. h umana 2. SEQ ID NO: 752 is the amino acid sequence encoded by SEC I NO: 751 SEC I D NO: 753 is the cDNA sequence coding for the first 209 amino acids of the transmembrane protease serine 2.

SEQ ID NO: 754 are the first 209 amino acids of human transmembrane serine d protease 2. SEQ ID NO: 755 is the amino acid sequence of peptide 296-32 of P501 S. SEQ ID NO: 756-759 are PCR primers. SEC I D NO: 760 is the determined cDNA sequence of the chain Vb of a T cell receptor for the P501 S specific T cell clone 4E5. SEQ ID NO: 761 is the determined cDNA sequence of the Va range of a T cell receptor for the P501 specific T cell clone 4E5. S. SEQ ID NO: 762 is the amino acid sequence encoded by SEC I NO: 760 SEQ ID NO: 763 is the amino acid sequence encoded by SEC I NO: 761. SEQ ID NO: 764 is the full length open reading frame for P768P including the stop codon. SEQ ID NO: 765 is the full-length open reading frame for P768P without the stop codon. SEQ ID NO: 766 is the amino acid sequence encoded by SEC I NO: 765 SEQ ID NO: 767-772 are the amino acid sequences for domini prognostics of P768P. SEC I D NO: 773 is the full-length cDNA sequence of P835P.

SEC I D NO: 774 is the cDNA sequence of the previously identified FLJ 135 clone. SEQ ID NO: 775 is the cDNA sequence of the open reading frame for P835P with the stop codon. SEQ ID NO: 776 is the cDNA sequence of the open reading frame for P835P without the stop codon. SEQ ID NO: 777 is the full-length amino acid sequence for P835P. SEQ ID NO: 778-785 are the amino acid sequences of the extracellular and intracellular domains of P835P. SEQ ID NO: 786 is the full-length cDNA sequence for P1000C. SEQ ID NO: 787 is the cDNA sequence of the open reading frame for P1000C, including a stop codon. SEQ ID NO: 788 is the cDNA sequence of the open reading frame for P 1000C, without the stop codon. SEQ ID NO: 789 is the amino acid sequence of full length for P 1000C. SEQ ID NO: 790 are amino acids 1 -100 of SEQ ID NO: 789. SEC I D NO: 791 are amino acids 100-492 of SEC I D NO: 789.

SEQ ID NO: 792 is the amino acid sequence of a recombinant protein prepro-P501 S.

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed generally to composition and its use in cancer diagnostic therapy, in particular prostate cancer. As described below, illustrative compositions of the present invention include, but are not limited to polypeptides, in particular immunogenic polypeptides that encode such polypeptides, antibodies and other binding agents, antigen presenting cells (APCs) cells of the immune system ( for example, T cells). The practice of the present invention will employ, unless specifically indicated otherwise, conventional virology, immunology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art, much of which is described below for the purpose illustration. These techniques are fully explained in literature, see, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (2nd Edition, 1989); Maniatis et al., Molecul Cloning: A Laboratory Manual (1982); DNA Cloning A Practic Approach, vol. I and II (D. Glover, ed); Oligonucleotide Synthesis (Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames &S. Higgin eds, eds., 1985); Transcription and Translation (B. Hames &Higgins, eds., 1984); Animal Cell Culture (R. Freshney, ed., 1986 Perbal, A Practical Guide to Molecular Cloning (1984).) All publications, patents and patent applications. cited here, whether above or below, are hereby incorporated by reference in their entirety. As used herein, and in the appended claims, the singular forms "a", "an" and "the" include plural reference unless the clear content dictates otherwise.

Polypeptide Compositions As used herein, the term "polypeptide" is used in its conventional meaning, that is, as a sequence of amino acids. The polypeptides are not limited to a specific length of the product; thus, peptide oligopeptides and proteins are included within the definition of polypeptide, such terms may be used interchangeably herein unless specifically indicated otherwise. This term also does not refer to or exclude post-expression modifications of the polypeptide, for example, glycosylation, acetylations, phosphorylations, and the like, as well as other modifications known in the art, both of natural and non-natural existence. A polypeptide can be a complete protein, a subsequence thereof. Particular polypeptides of interest in the context of this invention are amino acid subsequences comprising epitopes, ie, antigenic determinants substantially responsible for the immunogenic properties of a polypeptide and which are capable of evoking a immune response. Particularly illustrative polypeptides of the present invention comprise those encoded by a polynucleotide sequence set forth in any of SEQ ID NOs: 1-11 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330 , 332-33 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 53 552, 569-572, 587, 591, 593-606, 618-626, 630, 631 , 634, 636, 63 655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 75 764, 765, 773-776 and 786-788, or a sequence that hybridizes in moderately severe conditions, or, alternatively, in highly severe conditions, to a polynucleotide sequence set forth in any of SEQ ID NOs: 1-111, 115-171, 17 175, 177, 179-305, 307-315, 326 , 328, 330, 332-335, 340-375, 38 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-57 587, 591, 593-606, 618-626 , 630, 631, 634, 636, 639-655, 674, 68 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 77 776 and 786-788. In specific embodiments, the invention polypeptides comprise amino acid sequences as set forth in any of SEQ ID NO: 112-114, 172, 176, 178, 327, 329, 33 336, 339, 376-380, 383, 477- 483, 496, 504, 505, 519, 520, 522, 52 527, 532, 534, 537-551, 553-568, 573-586, 588-590, 592, 627-62 632, 633, 635, 637, 638, 656-671, 675, 683, 684, 710, 712, 714, 71 717-719, 723-734, 736, 740-750, 752, 754, 755, 766-722, 777-785 789-791. The polypeptides of the present invention sometimes referred to as prostate-specific proteins or prostate-specific polypeptides, as an indication that their identification has been based at least in part on their elevated expression levels in prostate tissue samples. Thus, "prostate-specific polypeptide" or "prostate-specific protein" generally refers to a polypeptide sequence of the present invention, or a polynucleotide sequence encoding said polypeptide, which is expressed in a substantial proportion of tissue samples of prostate, for example, preferably greater than about 20%, preferably greater than about 30%, and most preferably greater than about 50% or more of the prostate tissue samples tested, at a level that is at least two times, preferably at least five times greater than the expression level in other normal tissues, as determined using the representative assay provided herein. A prostate-specific polypeptide sequence of the invention, based on an increased level of expression in tumor cells, has particular utility both as a diagnostic marker as well as a therapeutic target, as will be described below. In certain preferred embodiments, the polypeptides of the invention are immunogenic, ie, they react detectably within an immunoassay (such as an ELISA assay or T cell stimulation assay) with antisera and / or T cells from a patient with prostate cancer. The classification of the activity Immunogenic can be performed using techniques well known to those skilled in the art. For example, such classifications can be made using methods such as those described for Harlow and Lane, Antivodies: A Laboratory Manual, Cold Spring Harb Laboratory, 1988. In an illustrative example, a polypeptide can be immobilized on a solid support and contacted. with patient's serum to allow the binding of antibodies within the serum to the immobilized polypeptide. Unbound serum can then be removed from the bound antibodies detected using, for example, protein A labeled with 12 l. As will be recognized by those skilled in the art, the immunogenic portions of the polypeptides described herein are also encompassed by the present invention. An "immunogenic portion", as used herein, is an immunogenic polypeptide fragment of the invention that is itself immunologically active (i.e., specifically binds) with the B cell surface antigen receptors and / or T cells recognize the polypeptide. The immunogenic portions can generally be identified using well-known techniques, such as those summarized in Paul, Fundamental Immunolog 3o. ed. , 243-247 (Raven Press, 1993) and cited references to such techniques include classification of polypeptides for ability to react with antigen-specific antibodies antiserum and / or T-cell clones. As used herein, antiserum and antibodies are "antigen-specific" specifically they bind to an antigen (ie, they react with the protein in an ELISA immunoassay or other immunoassay, and n react detectably with unrelated proteins). Said antisera and antibodies can be prepared as described herein, and using well-known techniques. In a preferred embodiment, an immunogenic portion of a polypeptide of the present invention is a portion that reacts with antisera and / or T cells at a level that is substantially no less than the reactivity of the full-length polypeptide (e.g., in an assay of ELISA and / or assay of cell reactivity T). Preferably, the level of immunogenic activity of the immunogenic protein is at least about 50%, preferably at least about 70%, and m preferably greater than about 90% of the immunogenicity for the full-length polypeptide. In some cases, the preferred immunogenic portions that will be identified have a higher level of immunogenic activity than that of the corresponding full-length polypeptide, eg, have more than about 100% or 150% or m immunogenic activity. In certain embodiments, illustrative immunogenic portions may include peptides wherein a N-terminal leader sequence and transmembrane domain have been removed. Other exemplary immunogenic moieties will contain a small deletion and / or C-terminal (e.g., 1-30 amino acids, preferably 5-1. amino acids), in relation to the mature protein. In another embodiment, a polypeptide composition of the invention may also comprise one or more polypeptides that are immunologically reactive with T cells and / or antibody generated against the polypeptide of the invention, in particular, a polypeptide having an amino acid sequence described herein, for an immunogenic fragment or variant thereof. In another embodiment of the invention, polypeptides are provided which comprise one or more polypeptides that are capable of producing T cells and / or antibodies that are immunologically reactive with one or more polypeptides described herein, or one or more polypeptides encoded by contiguous nucleic acids contained in the polynucleotide sequences described herein, or immunogenic fragments or variants thereof, or for one or more nucleic acid sequences q hybridize to one or more of these sequences under conditions of moderate to high severity. The present invention, in another aspect, provides fragment of polypeptide comprising at least 5, 10, 15, 20, 25, 50, 100 contiguous amino acids, or more, including all the intermediate lengths, of a polypeptide composition established herein such as set forth in SEQ ID NO: 1 1 2-1 14, 172, 176, 17 327, 329, 331, 336, 339, 376-380, 383, 477-483, 496, 504, 505, 51 520, 522, 525 , 527, 532, 534, 537-551, 553-568, 573-586, 588-59 592, 627-629, 632, 633, 635, 637, 638, 656-671, 675, 683, 684, 71 712, 714, 715, 717-719, 723-734, 736, 740-750, 752, 754, 755, 766 722, 777-785 and 789-791, or those encoded by a polynucleotide sequence d set forth in a SEQ ID NO. NO: 1 -1 1 1, 1 15-171, 173 175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381 382 and 384-476, 524, 526 , 530, 531, 533, 535, 536, 552, 569-57 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 68 681, 71 1, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773 776 and 786-788. In another aspect, the present invention provides variants of the polypeptide compositions described herein. The polypeptide variants generally encompassed by the present invention will typically exhibit at least about 70%, 75 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99 or more identity (determined as described below), along its length, for a polypeptide sequence set forth herein. In a preferred embodiment, the polypeptide fragments and variants provided by the present invention are immunologically reactive with an antibody and / or T cell that reacts with a full length polypeptide specifically as set forth herein. In another preferred embodiment, the polypeptide fragments and variants provided by the present invention exhibit a level of immunogenic activity of at least about 50%, preferably about 70%, and most preferably at least approximately 90% or more of that exhibited by a full length polypeptide sequence specifically set forth herein.

A "variant" of polypeptide, as the term used herein, is a polypeptide that typically differs from a polypeptide specifically described herein in one or more substitutions for deletions, additions, and / or insertions. Such variants may be naturally occurring or may be synthetically generated, for example, by modifying one or more of the above polypeptide sequences of the invention and the value of their immunogenic activity as described herein using any of a number of well-known techniques. in the countryside. For example, certain exemplary variants of the polypeptides of the invention include those in which one or more portions such as an N-terminal leader sequence or transmembrane domain have been removed. Other illustrative variants include variants in which a small portion (eg, 1-3 amino acids, preferably 5-15 amino acids) has been removed from the N and / or C terminus of the mature protein. In many cases, a variant will contain conservative substitutions. A "conservative substitution" is one in which amino acid is substituted by another amino acid having similar properties, so that one skilled in the art of peptide chemistry can expect that the secondary structure of the hydropathic nature of the polypeptide does not change substantially. As previously described , modifications can be made the structure of the polynucleotides and polypeptides of the present invention and still obtain a functional molecule that encodes a variant or derivative of polypeptide with desirable characteristics for example, with immunogenic characteristics. When the polypeptide amino acid sequence is to be altered to create or equivalent, or even an improved immunogenic variant or portion of a polypeptide of the invention, one skilled in the art will typically change one or more of the codons of the coding DNA sequence. according to Table 1. For example, certain amino acids can be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as antigen binding regions of antibodies or binding site on substrate molecules. Since it is the interactive capacitance and the nature of a protein that define the biological functional activity of the protein, certain amino acid sequence substitutions can be made in a protein sequence, and, of course, its underlying AD coding sequence. , and yet obtain a protein with similar properties. In this way, it is contemplated that various changes can be made in the peptide sequences of the described compositions, or corresponding DNA sequences encoding said peptides without appreciable loss of their usefulness or biological activity.

TABLE 1 Amino Acids Codons Alanine W A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic Acid Asp D GAC GAU Glu Acid Glu E GAA GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGC GGG GGU Histidine His H CAC CAU Isoleucine Me I AUA AUC AUU Lysina Lys K AAA AAG Leucina Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutamine Gln Q CAÁ CAG Arginine Arg R AGA AGG CGA CGC CGG CG U Serina Ser S AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val V GUA GUC GUG G UU Triptophane Trp w UGG Tyrosine Tyr and UAC UAA To make such changes, the hydropathic amino acid index can be considered. The importance of the index d Hydropathic amino acid to confer interactive biological function in a protein is generally well understood in the art (Kyte Doolittle, 1982, incorporated herein by reference). It is accepted that the relative hydropathic nature of the amino acid contributes to the secondary structure of the resulting protein, which in turn defines the interaction of the protein with other molecules, for example enzymes, substrates, receptors, DNA, antibodies, antigens, similar. Each amino acid has been assigned a hydropathic index based on its hydrophobic character and loading characteristics (Kyt and Doolittle, 1982). These values are: isoleucine (+4.5); valine (+4.2 leucine (+3.8), phenylalanine (+2.8), cysteine / cystine (+2.5), methionine (+1.9), alanine (+1.8), glycine (-0.4), threonine (-0.7); serine (-0.8 tryptophan (-0.9), tyrosine (-1.3), proline (-1.6), histidine (-3.2 glutamate (-3.5), glutamine (-3.5), aspartate (-3.5), lysine (-3.9) ) arginine (-4.5) It is known in the art that certain amino acids can be substituted by other amino acids having a similar hydropathic index or classification, and that they still result in a protein with similar biological activity, ie, they still obtain a functionally equivalent, biological protein To make such changes, the substitution of amino acids whose hydropathic index are within ± 2 is preferred, those within ± are particularly preferred, and those within ± 0.5 are very particularly preferred. the technique that the substitution of similar amino acids can be done effectively based on the hydrophilic nature. The patent of E.U.A. 4,554, 101 (specifically incorporated herein by reference in its entirety), states that the largest hydrophilic loc average character of a protein, as governed by the hydrophilic character of its adjacent amino acids, correlates with a biological property of the protein. As detailed in the patent of E.U.A. 4,554, 101, the following hydrophilic character values have been assigned amino acid residues: arginine (+3.0); lysine (+3.0); aspartat (+ 3.0 ± 1); glutamate (+ 3.0 ± 1); serine (+0.3); asparagine (+0.2 glutamine (+0.2), glycine (0), threonine (-0.4), proline (-0.5 ± 1), alanine (-0.5), histidine (-0.5), cysteine (-1.0), methionine (-1 .3), valine (-1.5 leucine (-1.8), isoleucine (-1.8), tyrosine (-1.3), phenylalanine (-2.5 tryptophan (-3.4), it is understood that an amino acid can be substituted by another have a similar hydrophilic character value and continue to obtain a biologically equivalent protein, and in particular, an immunologically equivalent protein.In such changes, the substitution of amino acids whose hydrophilic character values are within ± 2 is preferred, those within ± 1 s particularly preferred and those within +0.5 are still particularly preferred As noted above, amino acid substitutions generally, therefore, are based on the relative similarity of the amino acid side chain substituents, eg, their character hydrophobic, its hydrophilic nature, charge size, and similar. Illustrative substitutions which take var of the above characteristics into account are well known to those skilled in the art, and include: arginine and lyso glutamate and aspartate; serine and trionine; glutamine and asparagine valine, leucine and isoleucine. In addition, any polynucleotide can be further modified to increase the stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5 'and / or 3' ends; the use of phosphorothioate or 2'O-methyl in place of phosphodiesterase bonds in the base structure; and / or the inclusion of non-traditional bases such as inosine, queocine and wentsin, as well as acetyl-methyl-thio and other modified forms of adenine, histidine, guanine, thymine and uridine In addition, amino acid substitutions can be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the unfriendly nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine; and amino acids with uncharged polar upper groups having similar hydrophilic value include leucine, isoleucine and valin glycine and alanine; asparagine and glutamine; and serine, threonine phenylalanine and tyrosine. Other groups of amino acids that can represent conservative changes include: (1) wing, pro, gly, gl asp, gln, asn, ser, thr, (2) cys, ser, tyr, thr; (3) val, ile, leu, met, al phe; (4) lys, arg, his; and (5) phe, tyr, trp, his. A variant may also, or alternatively, contain non-conservative changes. In a preferred embodiment, variant polypeptides differ from a native sequence by substitution, removal or addition of amino acids or less. The variants also (or alternatively can be modified, for example, by the elimination addition of amino acids that have a minimal influence on the immunogenicity, secondary structure and hydropathic nature of the polypeptide) As noted above, the polypeptides may comprise a signal sequence ( or leader) at the terminal end of the protein, which directs co-trans-transnationally or trans-translationally the protein.The polypeptide can also be conjugated to a linker or other sequence to facilitate the synthesis, purification or identification of the polypeptide (e.g., poly-His), or to improve the binding of polypeptide to solid sut. For example, a polypeptide can be conjugated to an immunoglobulin Fc region. When polypeptide sequences are compared, two sequences are said to be "identical" if the amino acid sequence in the two sequences is the same when aligned for maximum correspondence, as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A window comparison "as used herein, refers to a segment of at least about 20 contiguous positions, usually from 30 to about 75, from about 50, wherein a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.The optimal alignment of the sequences for comparison can be conducted using the Megalign program in Lasergen suite of bioinformatics software (DNASTAR, Inc., Madison, Wl using default parameters. various alignment schemes described in the following references Dayhoff, MO (1978) A model of evolutionary change in proteins Matrices for detecting distant relationships In Dayhoff, MO (ed. Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol 5, Suppl 3, pp 345-35 Hein J. (1990) Unifed Approach to Alignment and Phylogenes Pá 626-645 Methods in Enzymology, vol. 183, Academic Press, Inc., Sa Diego, CA; Higgins, D. G. and Sharp, P. M. (1989) CABIOS 5: 151 153; Myers, E. W. and Muller W. (1988) CAB IOS 4: 1 1-17; Robinso E. D. (1971) Comb. Theor 1 1: 105; Santou, N. Nes, M. (1987) Mo Biol. Evol. 4: 406-425; Sneath, P. H. A. and SOCAL, RR (197 Numerical Taxonomy-the Principles and Practice of Numeric Taxoconomy, Freeman Press, San Francisco, CA; Wilbur, WJ an Lipman, DJ (1983) Proc. Nati. Acad., Sci. USA 80: 726 -730 Alternatively, optimal alignment of sequences can be conducted for comparison through the local identi fi cation algorithm of Smith and Waterman (1981) Add. API. Math 2: 482, through the identity alignment algorithm of Needleman and Wunsc (1970) J. Mol. Biol .. 48: 443, through the similarity method investigation of Pearson and Lipman (1988) Proc. Nati Acad. Sc USA 85: 2444, through computerized implementations of this algorithm (GAP, BESTFIT, BLAST, FASTA, and TFASTA in Wisconsi Genetics Software Package, Genetics Computer Group (GCG), 57 Science Dr. Madison, Wl), or through inspection. Another preferred example of algorithms that are suitable for determining the percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described by Altschul et al. (1997) Nucí. Acids Res. 25: 3389-340 and Altschul et al. (1990) J. Mol. Biol. 215: 403-410, respectively BLAST and BLAST 2.0 can be used, for example, with the parameters described herein, to determine the percentage of sequence identity for the polynucleotides and polypeptides of the invention. The software to perform BLAST analysis is publicly available from the National Center for Biotechnology Information. For amino acid sequences, a classification matrix can be used to calculate the cumulative classification. word extension collides in each direction and is hidden when the cumulative classification of alignment falls by the amount X of maximum value achieved; the cumulative classification goes to zero or p below, due to the accumulation of one or more residue alignments with negative classification; or it is added to the end of any sequence. The parameters of the algorithm BLAST, W, T and X determine the sensitivity and speed of the alignment. In a preferred aspect, the "percentage of sequence identity" is determined by comparing two optimally aligned sequences on a comparison window of at least 2 positions, wherein the portion of the polypeptide sequence in the comparison window may comprise additions or elimination (ie, gaps) of 20% or less, usually from 5 to 15%, or from 1 to 12%, as compared to the reference sequences (which do not comprise additions or deletions) for the optimal alignment of the two sequences. The percentage is calculated to determine the number of positions where the identical amino acid residue occurs in both sequences to produce the matching position number, dividing the number of positions coincided between the total number of positions in the reference sequence (that is, the size of the advantage) and multiplying the results by 100 pa to produce the percentage of the sequence identity. Within other illustrative embodiments, a polypeptide may be a fusion polypeptide comprising multiple peptides as described herein, or comprising at least one polypeptide as described herein and an unrelated sequence, such as a known tumor protein. A fusion pattern can, for example, help provide auxiliary T epitopes (a fusion pattern). immunological), preferably T helper epitopes recognized by humans, or can help express the protein (an expression enhancement) at higher yields than the native recombinant protein. Certain preferred fusion patterns are fusion patterns of both immunological and expression enhancers. Another fusion patterns can be selected in order to increase the solubility d polypeptide or polypeptide is activated allowing desired patterns Other additional fusion nclude afinida labels which facilitate purification of polypeptide intracellular compartments. Fusion polypeptides can generally be prepared using standard techniques, including chemical conjugation. Preferably, a fusion polypeptide is expressed with recombinant polypeptide, allowing high level production, relative to a non-fused polypeptide, in an expression system. In summary, the DNA sequences encoding the polypeptide components can be assembled separately, and linked to an appropriate expression vector. The extre 3 'of the DNA sequence encoding a polypeptide component is ligated, with or without a peptide linker, to the end of a DNA sequence encoding the second polypeptide component so that the sequence reading frames are in phase . This allows translation of a single fusion polypeptide that retains the biological activity of both component polypeptides.

Can use a linker sequence of polipéptid to separate the first and second polypeptide components by a distance sufficient to ensure that cad polypeptide d upliq ue in their secondary structures and terciari This sequence of peptide linker is incorporated into the fusion polypeptide using standard techniques well known in the field. The linker sequences suitable peptide may be selected based on the following factors: (1 their ability to adopt a flexible extended conformation; (2) s inability to adopt a secondary structure that pued interact with functional epitopes on the first and segund polypeptides; and (3) the lack of hydrophobic or charged qu can react with functional epitopes polypeptide residues. the linker sequences of preferred peptide containing residue Gly, Asn and Ser. Other near neutral, such as Thr and Al amino acids can also be used in the linker sequence The amino acid sequences that can be usefully employed as linkers include those described by Maratea et al., ge 40: 39-46, 1985; Myrphy et al., Proc. Nati. Acad. Sci. USA 83: 825 8262, 1986; U.S. Patent No. 4,935,233 and U.S. Patent No. 4,751, 180. The linker sequence generally may have a length of 1 to ximately 50 amino acids. The linker sequences are not required when the first second polypeptides have essential N-terminal amino acid regions that can be used to separate the domini functional and avoid spherical interference. The ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for the DNA expression are located only 5 'towards the AD sequence encoding the first polypeptides. Similarly, the stop codons required to terminate the translation and transcription termination signals are only present 3 'to the DNA sequence encoding the second polypeptide. The fusion polypeptide may comprise a polypeptide as described herein in conjunction with a related immunogenic protein, such as a immunogenic protein capable of producing a call response. Examples of such proteins include tetanus, tuberculosis and hepatitis proteins (see, for example, Stoute et al., New Engl. J. Med., 336: 86-91)., 1997). In a preferred embodiment, the immunological fusion pattern is derived from a Mycobacterium sp. , such as a fragment Ra 12 derived from Mycobacterium tuberculosis. The compositions of Ra 12 and methods for their use to improve the expression and / immunogenicity of heterologous polynucleotide / polypeptide sequences are described in the patent application of EU 60/158, 585, the description of which is incorporated herein. reference in its entirety. In summary, Ra 12 refers to a polynucleotide regio which is a subsequence of a MTB32A nucleic acid from Mycobacterium tuberculosis. MTB32A is a proteas of serine with a molecular weight of 32 KD encoded by a gene of virulent and avirulent strains of M. tuberculosis. The d nucleotide sequence and the amino acid sequence of MTB32A have been described (eg, U.S. Patent Application 60 / 158,585 see also Skeiky et al., I nfection and Immun. (1999) 67: 3998 4007, incorporated herein by reference. The C-terminal fragments of the MTB32A-encoding sequence are expressed at high levels remain as soluble polypeptides through the purification procedure.In addition, Ra12 can enhance the immunogenicity of heterologous immunogenic polypeptides with which they are fused. Preferred comprises a C-terminal fragment of 14 KD corresponding to residues d amino acid 192 to 323 of MTB32A Other preferred Ra1 polynucleotides generally comprise at least about 1 consecutive nucleotides, at least about 30 nucleotides at least about 60 nucleotides, at least about d 100 nucleotides, at least about 200 nucleotides, or at least at about 300 nucleotides that encode a portion of Ra 1 polypeptide 2. The Ra 12 polynucleotides may comprise a native sequence (ie, an endogenous sequence encoding Ra 12 polypeptide or a portion thereof), or may comprise a variant of said sequence. Variants of the Ra 12 polynucleotide may contain one or more substitutions, add deletions, and / or insertions, so that the biological activity of the substantially encoded fusion polypeptide is not decreases, relative to a fusion polypeptide comprising a native Ra12 polypeptide. The variants preferably exhibit at least about 70% identity, preferably at least about 80% identity and most preferably at least about 90% identity with a polynucleotide sequence encoding a native Ra12 polypeptide or a portion thereof. of the same. Within other preferred embodiments, an immune fusion pattern is derived from protein D, a surface protein of influenza B of the Haemophilus bacterium, gram negative (W 91/18926). Preferably, a protein D derivative comprises approximately the first third of the protein (e.g., the first N-terminal 100-110 amino acids), and a D protein derivative can be treated with lipids. Within certain preferred embodiments, the first 109 residues of a lipoprotein D fusion pattern are included in the N-terminus to provide the polypeptide with additional exogenous T-cell epitopes and to increase the expression of the E. coli level (functioning in this way as an expression enhancer). E lipid end ensures optimal presentation of antigen presenting antigen presenting cells. Other fusion patterns include the non-structural protein of the influenza virus NS (heglatunin). Typically, the N-terminal 81 amino acids are used, although different fragments may be used which include T-helper epitopes. In another embodiment, the immune fusion pattern is l protein known as LYTA, or a portion thereof (preferably a C-terminal portion). LYTA is derived from Streptococcus pneumoniae, which synthesizes an N-acetyl-L alanine amidase known as LYTA amidase (encoded by ge LytA, Gene 43: 265-292, 1986). LYTA is an autolysin that specifically degrades certain bonds in the glycan peptide structure. The C-terminal domain of the LYTA protein is responsible for the affinity to choline or some choline analogues such as DEAE. This property has been exploited for the development of plasmids expressing C-LYTA from E. coli useful for the expression of fusion proteins. Purification of hybrid proteins containing the C-LYTA fragment in the term amin has been described (see, Biotechnology 10: 795-798, 1992). Within a preferred modality, a repeating portion of LYTA can be incorporated into a fusion polypeptide. A repeat portion is found in the C-terminal region starting at residue 178. A particularly preferred repeat portion incorporates residues 188-305.

Another, more illustrative embodiment involves fusion polypeptides and the polynucleotides encoding them, wherein the fusion pattern comprises an activation signal capable of targeting a polypeptide into the endozomal / lysozomal compartment, as described in the E patent. U .A. No. 5,633,234. An immunogenic polypeptide of the invention, when working with this activation signal, will be associated more efficiently with MHC molecules of class I I and d this way will provide improved in vivo stimulation.

CD4 + T cells specific for the polypeptide. The polypeptides of the invention are prepared using any of a variety of well-known synthetic and / or recombinant techniques, the latter of which are described below. Polypeptides, portions and other variants generally less than about 15 amino acids can be generated, through synthetic means, using techniques well known to those skilled in the art. In an illustrative example, said polypeptides are synthesized using any of the commercially available solid phase techniques, such as the Merrifield solid phase synthesis method, wherein s sequentially add amino acids to a growing amino acid chain. See, Merrifield, J. Am. Chem. Soc. 85: 2149-214 1963. The equipment for the automatic synthesis of polypeptides is commercially available from suppliers such as Perki Elmer / Applied BioSystems Division (Foster City, CA), and It can be operated according to the manufacturer's instructions. In general, polypeptide compositions (including fusion polypeptides) of the invention are isolated. A "isolated" polypeptide is removed from its original environment. For example, a naturally occurring protein or polypeptide is isolated if it separates from some or all of the coexisting materials in the natural system. Preferably, said polypeptides are also identified for example, and are at least about 90% pure, mu preferably at least about 95% pure and preference of at least about 99% pure.

Polynucleotide Compositions The present invention, in other aspects, provides polynucleotide compositions. The terms "DNA" "polynucleotide" are used essentially interchangeably herein to refer to a DNA molecule that has been isolated free from total genomic DNA of a particular species. "Isolated as used herein, means that a polynucleotide is substantially remote from other coding sequences, and that the DNA molecule does not contain large portions of unrelated DNA coding, such as large chromosomal fragments or other functional genes or regions. of polypeptide coding.Of course, this refers to the DNA molecule as originally isolated, and does not exclude genes or coding regions subsequently added to the segment by the human hand.As understood by those skilled in the art , the polynucleotide compositions of this invention may include genomic sequences, stragenomic sequences and sequence encoded by plasmid and smaller engineered gene segments that express, or may be adapted to express, proteins, polypeptides, peptides, and the like. segments can be naturally isolated, or modified synthetically by hand of man As will be recognized by those skilled in the art, the polynucleotides of the invention may be single chain (coding or antisense) or double structure chain structures, and may be DNA (genomic, cDNA or synthetic) or RNA molecules . RNA molecules can include molecules of HmRNA, which contain ntrons and correspond to a DNA molecule in a one-to-one form, and mRNA molecules which do not contain introns. Additional coding or non-coding sequences may, but not necessarily, being present within a polynucleotide of the present invention, and a polynucleotide may, but not necessarily, be linked to other molecules and / or support materials. The polynucleotides may comprise a native sequence (i.e., an endogenous sequence encoding a polypeptide / protein of the invention or a portion thereof) or may comprise a sequence encoding a variant or derivative, preferably a variant or immunogenic derivative, of said sequence. Therefore, according to another aspect of the present invention, polynucleotide compositions comprising some of the entire polynucleotide sequence set forth in any of SEQ ID NOs: 1-111, 115-171, 173-175, 177, are provided. 179 305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587 , 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788 complements of an established polynucleotide sequence of any of SEQ ID NOs: 1-111, 115-171, 173-175 , 177, 179-305 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524 526, 530, 531, 533, 535, 536, 552, 569-572 , 587, 591, 593-606, 618 626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720 722, 735, 737-739, 751, 753, 764 , 765, 773-776 and 786-788, degenerate variants of a polynucleotide sequence set forth in any of SEQ ID NOs: 1-111, 115-171, 173-175, 177, 179 305, 307-315, 326, 328 , 330, 332-335, 340-375, 381, 382 and 384-476 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606 618-626, 630 , 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788. In certain preferred embodiments, the polynucleotide sequences set forth herein encode immunogenic polypeptides, as described above. In other related embodiments, the present invention provides polynucleotide variants that have substantial identity to the sequences described herein in SEQ ID NOs: 1-111 115-171, 173-175, 177, 179-305, 307-315, 326, 328 , 330, 332-33 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 53 552, 569-572, 587, 591, 593-606, 618-626, 630 , 631, 634, 636, 63 655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 75 764, 765, 773-776 and 786-788, for example, those that comprise at least 70% sequence identity, preferably by less 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher, of sequence identity compared to a polynucleotide sequence of this invention used in all methods described here (for example, the BLAST analysis using standard parameters, as described below). One of skill in the art will recognize that these values may be appropriately adjusted to determine the corresponding identity of proteins encoded by two nucleotide sequences taking into account codon degeneracy, amino acid d-likeness, reading frame placement, and the like. Typically, the polynucleotide variants will contain further substitutions, adhesions, deletions and / or insertions preferably so that the immunogenicity of the polypeptide encoded by the variant polypeptide is not substantially diminished relative to a polypeptide encoded by a specifically established polynucleotide sequence. here. The terms "variants" should also be understood as encompassing gene homologues of xenogeneic origin. In further embodiments, the present invention provides fragments of polynucleotide polynucleotides that comprise various lengths of contiguous stretches of sequence identical to or complementary to one or more of the sequences described herein. For example, s provide polynucleotides through this invention which comprise at least about 10, 20, 30, 40, 50, 7, 100, 150, 200, 300, 400, 500 or 1000 or more contiguous nucleotides. d one or more of the sequences described here, as well as intermediate lengths that exist between them. It will be easily understood what "intermediate lengths", in this context, means any length between the observed values, such as 16, 17, 18, 1 etc.; 21, 22, 23, etc.; 30, 31, 32, etc.; 50, 51, 52, 53, etc .; 100, 101 102, 103, etc .; 150, 151, 152, 153, etc .; including all the whole through 200-500; 500-1000, and the like. In another embodiment of the invention, polynucleotide compositions are provided which are capable of hybridizing under conditions of moderate to high severity to a polynucleotide polynucleotide sequence provided herein, or a fragment thereof, or a complementary sequence thereof. Hybridization techniques are well known in the field of molecular biology. For purposes of illustration, moderately severe conditions suitable for testing the hybridization of a polynucleotide of this invention with other polynucleotides include prewash in a solution of 5 X SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0); hybridize at 50-60 ° 5 X SSC, overnight; followed by a double wash at 65 ° for 20 minutes each with 2X, 0.5X and 0.2X SSC containing 0.1% of S DS. A person skilled in the art will understand that the severity of the hybridization can be easily manipulated, such as by altering the salt content of the hybridization solution and / or temperature at which the hybridization is performed. For example, in another modality, the appropriate high-severity hybridization conditions include those observed previously, with except that the hybridization temperature is increased, for example, at 60-65 ° C or 65-70 ° C. In certain preferred embodiments, the polynucleotides described above, for example, polynucleotide variants, fragments, hybridization sequences, encode polypeptides that are immunologically cross-reactive with a polypeptide sequence specifically set forth herein. In other preferred embodiments, said polynucleotides encode polypeptides having an immunogenic activity level of at least about 50%, preferably at least about 70%, and mu preferably at least about 90% of that of a polypeptide sequence specifically stated herein. The polynucleotides of the present invention, or their fragments without considering the length of their same coding sequence can be combined with other AD N sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other cloning segments, and the like, so that their tot length can vary considerably. Therefore, it is contemplated that a n-nucleic acid fragment of almost any length can be employed, the total length preferably being limited by ease of preparation and use in the intended recombinant AD protocol. For example, illustrative polynucleotide segments d with total lengths of about 10,000, about 5,000, about 3.00 about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs in length, and the like (including all the intermediate lengths) are contemplated as being useful in many implementations of this invention. When comparing polynucleotide sequences, it is said that two sequences are "identical" if the nucleotide sequences in the two sequences are the same when they are aligned for maximum correspondence, as described below. The comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identand compare local regions of sequence similarity. A "comparison window", as used herein, refers to a segment of at least about 20 contiguous positions, usually from 30 to about 75, preferably from about 40 to about 50, wherein a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Optimal sequence alignment for comparison can be conducted using the Megalign software in the Lasergene suite of bioinformatics software (DNASTAR, Inc., Madison Wl), using default parameters. This program modalizes several alignment schemes described in the following references: Dayhoff, M. O. (1978) A model of evolutionary change i proteins - Matrices for detecting distant relationships. In Dayhoff, M O. (ed.) Atlas of Protein Sequence and Structure, Nationa Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3 p. 345-358; Hein J. (1990) Unifed Approach to Alignment an Phylogenes p. 626-645 Methods in Enzymology, vol. 183 Academic Press, Inc., San Diego, CA; Higgins, D.G. and Sharp, P M. (1989) CAB IOS 5: 1 51-153; Myers, EW and Muller W. (1988 CABIOS 4: 1 1 -17; Robinson, ED (1971) Comb. Theor 1 1: 105 Santou, N. Nes, M. (1987) Mol. Biol. Evol. 4: 406 -425; Sneath, P. H A. and SOCAL, RR (1973) Numerical Taxonomy-the Principles an Practice of Numerical Taxoconomy, Freeman Press, San Francisco CA; Wilbur, WJ and Lipman, DJ (1983) Proc. Nati. ., Sc USA 80: 726-730 Alternatively, optimal alignment of sequences can be conducted for comparison through the local identi fi cation algorithm of Smith and Waterman (1981) Add.App.Math 2: 482, through algorithm d of Identity Alignment of Needleman and Wunsc (1970) J. Mol. Biol .. 48: 443, through the similarity method investigation of Pearson and Lipman (1988) Proc. Nati Acad. Sc USA 85: 2444, through computerized implementations of this algorithm (GAP, BESTFIT, BLAST, FASTA, and TFASTA in Wisconsi Genetics Software Package, Genetics Computer Group (GCG), 57 Science Dr. Madison, Wl), or through inspection. A preferred example of algorithms that are suitable for determining the percentage of sequence identity and similarity sequence are the BLAST and BLAST 2.0 algorithms, which are described by Altschul et al. (1997) Nucí. Acids Res. 25: 3389-340 and Altschul et al. (1990) J. Mol. Biol .. 215: 403-410, respectively. BLAST and BLAST 2.0 can be used, for example, with the parameters described herein, to determine the percentage of sequence identity for the polynucleotides of the invention. The software for performing BLAST analysis is the one that is publicly available from the National Center for Biotechnology Information. In an illustrative example, the cumulative classifications can be calculated using, for d nucleotide sequences, the parameters M (compensation classification for a p of matching residues, always> 0) and N (classification of the penalty for unequal residues, always < 0). The extension of the word collides in each direction and is hidden when: the cumulative classification of alignment falls by the quantity X of its maximum achieved value; the cumulative classification goes to zero or below, due to the accumulation of one or more residual alignments or negative classification; or it is added at the end of any sequence The parameters of the algorithm BLAST, W, T and X determine the sensitivity and speed of the alignment. The BLASTIN program (pa sequences of n ucleotide) uses as defaults a word length (W) of 1 1 and a wait (E) of 10, and l alignments of the BLOSUM62 classification matrix (see Henikoff an Henikoff (1989) Proc. Nati. Acad. Sci. USA 89: 1 091 1 5), (B) of 5 expected from (E) of 10, M = 5, N = 4 and a comparison of amb standards Preferably, the "percentage of sequence identity" s determines compared two optimally aligned sequences on a comparison window of at least 20 positions, and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (eg, deci hollow) of 20% or less, usually from 5 to 15%, or from 10 to 12% as compared to the reference sequences (which n comprise additions or deletions) for the optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the identical nucleic acid bases occur in both sequences to produce the number d coincident positions, dividing the number of matching positions by the total number of positions in the reference sequence d (ie, the size of the window) and multiplying the results by 100 to produce the percentage of sequence identity. It will be appreciated by those skilled in the art, as a result of the degeneracy of the genetic code, that there are many nucleotide sequences encoding a polypeptide as described herein. Some of these polynucleotides carry minimal homology to the nucleotide sequence of any native gene. However, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention. In addition, within the scope of the present invention find alleles of the genes comprising the polynucleotide d sequences provided herein. Alleles are endogenous genes that are altered as a result of one or more mutations, such as deletions, additions, and / or nucleotide substitutions. Resulting mRNA and protein may, but not necessarily have an altered structure or function. Alleles can be identified using standard techniques (such as hybridization amplification, and / or database sequence comparison). Therefore, in another embodiment of the invention, a mutagenesis aspect is employed, such as site-specific mutagenesis for the preparation of variants and / or immunogenic derivatives of the polypeptides described herein. By this aspect, specific modifications can be made to a polypeptide sequence through mutagenesis of the underlying polynucleotides that encode them. These techniques provide a direct aspect for preparing sequence variants., for example, incorporating one or more of the following considerations, introducing one or more of the nucleotide sequence changes to the polynucleotide. Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences, which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides to provide an initiator sequence of sufficient size sequence complexity to form a stable duplex on both sides of the elimination junction that is being traversed. It can employ mutations in the selected polynucleotide sequence to improve, alter, diminish, modify, or otherwise change the properties of the same polynucleotide, and / or alter the properties, activity, composition, stability, or primary sequence of the encoded polypeptide. In certain embodiments of the present invention, the inventors contemplate the mutagenesis of the described polynucleotide sequences to alter one or more properties of the encoded polypeptide, such as the immunogenicity of a polypeptide vaccine. Site-specific mutagenesis techniques are well known in the art, and are widely used to create variants of both polypeptides and polynucleotides. For example, site-specific mutagenesis is usually used to alter a specific portion of a DNA molecule. In such embodiments, an initiator is used which typically comprises about 14 to 25 nucleotides or more in length, with about 5 to 10 residues on both sides of the junction of the sequence being altered. As will be appreciated by those skilled in the art, site-specific mutagenesis techniques generally employ a phage vector that exists in a double-stranded structure. Typical vectors useful in site-directed mutagenesis include vectors such as fa M13. These phages are easily and commercially available and their us is generally well known to those experts in the field.

Routinely double-stranded structure plasmids are also employed in site-directed mutagenesis which eliminates the step d transferring the gene of interest from a plasmid to a phage. In general, the site-directed mutagenesis according to the present invention is performed by first obtaining an individual strand structure vector or by fusing two strand structures of a double strand structure vector which includes within sequence, a DNA sequence which encodes the desired peptide An oligonucleotide primer carrying the desired mutant sequence is prepared, generally in synthetic form. This initiate is then fixed with the individual chain structure vector and subjected to DNA polymerization enzymes such as polymerase I of E. coli, Klenow fragment, in order to complete the synthesis of the chain structure bearing the mutation . In this way, a heteroduplex is formed, where a chain structure encodes the original non-mutated sequence and the second chain structure carries the desired mutation. This heteroduplex vector is then used to transform appropriate cells such as E. coli cells, and clones are selected which include recombinant vectors carrying the mutated sequence arrangement. The preparation of sequence variants of the DNA segments encoding the selected peptide using site-directed mutagenesis provides a means to produce potentially useful species and does not mean that it is limiting as it exists other ways in which sequence variants of peptides and the DNA sequences encoding them can be obtained. For example, recombinant vectors encoding the desired peptide sequence can be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants. The specific details with respect to these methods and protocols are the teachings of Maloy et al., 1994; Segal, 1976; Prokop Bajpai, 1991; Kuby, 1994; and Maniatis et al., 1982, each incorporated herein by reference, for that purpose. As used herein, the term "oligonucleotide-directed mutagenesis method" refers to template-dependent and vector-mediated propagation procedures which result in an increase in the concentration of a specific nucleic acid molecule relative to initial concentration, or an increase in the concentration of a detectable signal, such as amplification., the term "oligonucleotide-directed mutagenesis method" refers to a method that involves template-dependent extension of an initiator molecule. term, template-dependent procedure, refers to nucleic acid syntheses of an RNA or DNA molecule, wherein sequence of the newly synthesized chain structure of n-nucleic acid is dictated by the well-known rules of base pairs of complementarity (see, for example, Watson, 1987 Typically, vector-mediated methodologies involve introduction of the nucleic acid fragment to the DNA RNA vector, clonal amplification of the vector, and recovery of amplified nucleic acid fragment. Examples of such methodologies are provided in the patent of US Pat. No. 4,237,224, specifically incorporated herein by reference in its entirety. In another aspect, for the production of polypeptide variants of the present invention, recurrent sequence recombination can be employed, as described in the patent of US Pat. No. 5,837,458. In this regard, iterative cycles of recombination and sorting or selection are performed to "produce" individual polynucleotide variants of the invention, having, for example, improved immunogenic activity. In other embodiments of the present invention, the polynucleotide sequences provided herein can advantageously be used as probes or primers for hybridization of nucleic acid. As such, it is contemplated that the nucleic acid segments comprising a sequence region of at least about 15 contiguous nucleotides having the same sequence as, or complementary to, a contiguous sequence with a length of 1 5 nucleotides described herein. í, you will find particular utility. Longer contiguous identical or complementary sequences, for example, those of about 20, 30, 50, 100, 200, 500, 1000 (including all intermediary lengths and even up to full length sequences, will also be u in certain modalities. The ability of said nucleic acid probes to hybridize specifically to a sequence of interest will allow them to be used to detect the presence of complementary sequences in a given sample. However, other uses are also contemplated, such as the use of sequence formation for the preparation of initiators of mutant species, or primers for use in the preparation of other genetic constructs. Polynucleotide molecules having d sequence regions consisting of contiguous nucleotide stretch d 10-14, 15-20, 30, 50, or even 100-200 nucleotides or more (including intermediate lengths as well), identical complementary to a sequence of polynucleotide described herein are particularly contemplated as hybridization probes for use in, for example, Southern and Northern staining. This may allow a gene product, or fragment thereof, to be analyzed, both in various cell types and in several bacterial cells. The total size of the fragment, as well as the size of the complementary stretch (s), will ultimately depend on the intended use or application of the particular nucleic acid segment. The smaller fragments will find use in general hybridization modalities, wherein the length of the complementary region contiguous may vary, such as from approximately 15 to approximately 100 nucleotides, but may use contiguous stretch adjacent to each other according to the length complementarity sequences one wishes to detect. The use of a hybridization probe of approximately 15-2 nucleotides in length allows the formation of a double molecule that is both stable and selective. Molecules that have contiguous complementary sequences on stretches greater than 15 bases in length are generally preferred, although, in order to increase the stability and selectivity of the hybrid, and thus improve the quality and degree of the specific hybrid molecules obtained. Generally, it will be preferred to design nucleic acid molecule having complementary stretches of ge of 15 to 25 contiguous nucleotides, or even larger when desired. Hybridization probes can be selected from any portion of any of the sequences described herein. All that is required is to review the established sequences aq or any contiguous portions of the sequences, with a length of about 15-25 n ucleotides up to and including The full-length sequence, which you want to use as a probe or initiator. The selection of the probe and initiator d sequences can be governed by several factors, for example, s may wish to employ primers of the terms of the total sequence. Small polynucleotide segments or fragments can be easily prepared, for example, by synthesizing directly the fragment through chemical means, as is common practice using an automatic oligonucleotide synthesizer. Also, fragments can be obtained through the application of nucleic acid reproduction technology, such as the PCR ™ technology of US Pat. No. 4,683.20 (incorporated herein by reference), by introducing selected sequences into recombinant vectors for production. recombinant, and through other recombinant DNA techniques generally known to those skilled in the field of molecular biology. The nucleotide sequences of the invention can be used for their ability to selectively form double molecules with complementary stretches of the entire gene gene fragments of interest. Depending on the application contemplated, it is typically desired to employ variable hybridization conditions to achieve varying degrees of sond selectivity toward the target sequence. For applications that require high selectivity, it will typically be desired to employ relatively severe conditions to form the hybrids, for example, they will select relatively low salt conditions and / or high temperature, such as those provided by a salt concentration of about 0.02 M. at about 0.15 M salt temperatures of about 50 ° C to about 70 ° C. These selective conditions tolerate little or no inequality, between the probe and the target base structure or template, and can be particularly suitable for isolating related sequences.

Of course, for some applications, for example, where mutants are prepared using a mutant primer structure hybridize to an underlying template, less severe hybridization conditions (reduced severity will typically be necessary in order to allow the formation of In these circumstances, it may be desired to employ salt conditions such as those of about 0.15 to about 0.9 M salt, at temperatures ranging from about 20 ° C to about 55 ° C. In this way the cross-hybridized species can They can easily be identified as positively hybridizing signals with respect to control hybrids In any case, it is generally seen that conditions can be made more severe through the addition of increasing amounts of formamide, which serves to destabilize the hybrid duplex. in the same way as the temperature increased, in this way, Hybridization conditions can be easily manipulated, it will generally be a selection method depending on the desired results. In accordance with another embodiment of the present invention, s provide polynucleotide compositions comprising antisense oligonucleotides. It has been shown that antisense oligonucleotides are effective and activated inhibitors of protein synthesis and, consequently, provide an important aspect Therapeutics through which a disease can be treated by inhibiting the synthesis of proteins that contribute to the disease The efficacy of antisense oligonucleotides to inhibit protein synthesis is well established. For example, the synthesis of polygalactogonasa and the acetylcholine receptor of type II d muscarin are inhibited through antisense oligonucleotides directed to their respective mRNA sequences (patent of US Pat. No. 5,739,119 and patent of US Pat. No. 5,559,829). In addition, examples of antisense inhibition have been demonstrated with nuclear protein cyclin d, the multidrug resistance gene (MD 1), E-selectin, STK-1, stratial GABAA receptor and human EGF (Jaskulski et al., Science, 1988 , June 10; 240 (4858): 1544-6 Vasanthakumar and Ahmed, Common Cancer 1989, 1 (4) 225-32; Peris others, Brain Res Mol Brain Res. 1998 June 15; 57 (2): 310-20 US patent 5,801,154, US patent 5,789,573, US patent 5,718,709 and US patent 5610,288). Antisense constructs that inhibit and can be used to treat a variety of abnormal cellulare proliferations, eg, cancer, have also been described (U.S. Patent No. 5,747,470, U.S. Patent No. 5,591,317 and U.S. Patent No. 5,783,683). Therefore, in certain embodiments, the present invention provides oligonucleotide sequences comprising a whole portion of any sequence that is capable of specifically binding to a polynucleotide sequence described herein, an adjunct thereof. In one embodiment, the oligonucleotide antisense comprise DNA or derivatives thereof. In another embodiment, the oligonucleotides comprise RNA or its derivatives. In a third embodiment, the oligonucleotides are modified DNA, comprising a phosphorothioate-modified base structure. In a fourth embodiment, the oligonucleotide sequences comprise peptide nucleic acids or their derivatives. In each case, preferred compositions comprise a sequence region that is complementary, and mu preferably substantially complementary, and even preferably, completely complementary to one or more of the polynucleotides described herein. The selection of specific compositions for a gene sequence is based on the analysis of the selected target sequence and the determination of the secondary structure, Tm, binding energy, relative stability. The antisense compositions may be selected based on their relative inability to form dimers, hairpins, or other secondary structures that could reduce or prohibit specific binding to the target mRNA in a host cell. The highly preferred target regions of the mRNA, or those that are at or near the translation initiation codon AUG, and those sequences that are substantially complementary to the 5 'regions of the mRNA. These secondary structure analyzes and the objective site selection considerations can be performed, for example, using OLIGO initator analysis software v.4 and / or the algorithm suftware.

BLSTIN 2.0.5 (Altschul et al., Nucleic Acids Res. 1997 Se 1; 25 (17): 3389-402). The use of an antisense delivery method employing short peptide vector, termed MPG (27 residues, also contemplated) The MPG peptide contains a hydrophobic domain derived from the fusion sequence of HIV gp41 and a hydrophilic domain of the nuclear localization antigen T SV40 (Morris others, Nucleic Acuds Res. 1997, July 15; 25 (14): 2730-6). It has been shown that several MPG peptide molecules cover the antisense oligonucleotides and can be delivered to mammalian cells cultured in less than 1 hour with a relatively high efficiency (90%) In addition, the interaction with PMG greatly increases both the stability of the oligonucleotide to the nuclease and the ability to cross the plasma membrane In accordance with another embodiment of the invention , the polynucleotide compositions described herein are used in the design and preparation of ribozyme molecules to inhibit the expression of the polypeptides and proteins of tumor of the present invention in tumor cells. Ribozymes are RNA-protein complexes that divide nucleic acids in a specific form at the site. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, Proc Nati Acad Sci USA 1987 Dec; 84 (24): 8788-92; Foster and Symons, Cell, 1987, April 24; 49 (2): 211 -twenty). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specific character, usually separating only one of several phosphoesters on a Cech oligonucleotide substrate other, Cell. 1981, December 5; 216 (3): 585-61 0; Reimhold-Hurek an Shub, Nature, 1992, May 14; 357 (6374): 173-6). This specific character has been attributed to the requirement that the substrate binds through specific base pair interactions to the internal guide sequence ("IGS") of the ribozyme before the chemical reaction. Currently, six basic varieties of naturally occurring enzymatic RNA are known. Each one can catalyze the hydrolysis of phosphodiester bonds of RNA in trans (and this way it can separate other RNA molecules) under physiological conditions. In general, enzymatic nucleic acids act by first attaching to a target RNA. Said binding does not run through the target binding portion of an enzymatic nucleic acid, and which is maintained very close to an enzymatic portion of the molecule that acts to separate the target RNA. In this way, and enzymatic nucleic acid first recognizes and then binds a target AR through complementary base pairs, and once attached to the correct site it acts enzymatically to cut the target RNA. The strategic cleavage of said target RNA will destroy its ability to direct the synthesis of a codified protein. After an enzymatic nucleic acid has bound and separated its target RNA it is released from the RNA to look for another target and can bind repeatedly separating new targets.

The enzymatic nature of a ribozyme is advantageous over many technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its translation), since the ribozyme concentration needed to effect a therapeutic treatment and lower than that of the antisense oligonucleotide. This advantage reflects the ability of the ribozyme to act enzymatically. In this way, an individual ribozyme molecule is capable of separating many molecules of target RNA. In addition, the ribozyme is a highly specific inhibitor, with the specific character of inhibition depending not only on the mechanism of binding pairs to the target RNA, but also on the cleavage mechanism of the target RNA. Individual inequalities, base substitutions, near the excision site can completely eliminate the catalytic activity of a ribozyme. Similar inequalities of antisense molecules do not prevent their action (Wolf and others Proc Nati Acad Sci USA, 1992, August 15; 89 (16): 7305-9). In this way, the specific action character of a ribozyme is greater than that of an antisense oligonucleotide joining the same RNA site. The enzyme nucleic acid molecule can be formed into a hepatitis D virus from fork, hammerhead, group I intron or RNA from RnaseP (in association with an RNA gui sequence) or the RNA motif from Neurospora VS . Examples of motif with hammerhead are described by Rossi et al., Nucleic Acid Res. 1992, September 11; 20 (17): 4559-65. Examples of hairpin motifs are described by Hampel et al. (European Patent Application Publication No. EP 0360257), Hampel and Trit Biochemistry 1989, June 13; 28 (12): 4929-22; Hampel et al., Nuclei Acids Res. 1990, January 25; 18 (2): 299-304 and U.S. Patent 5,631,359. An example of a hepatitis d virus motif is described by Perrota and Been, Biochemistry. 1992, December 1; 31 (47): 1184 52; an example of the RnaseP motif is described by Guerrie Takada et al., Cell. 1983, December; 35 (3 Pt 2): 849-57; the RNA ribozyme motif of Nueospora VS is described by Collins (Saville Collins, Cell, 1990, May 18; 61 (4): 685-96; Savilie and Collins, Pro Nati Acad Sci USA 1991, October 1; 88 (19 ): 8826-30, Collins and Oliv Biochemistry, 1993, March 23; 32 (11): 2795-9); and an example of group I intro is described in the patent of US Pat. No. 4,987,071. All that is important in an enzyme nucleic acid molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the regions of the target gene RNA, and which has nucleotide sequences within or surround that substrate binding site, which imparts an activity d cleavage RNA to the molecule. In this way, ribozyme constructions do not need to be limited to the specific reasons mentioned here. Ribozymes can be designated as described in the patent application publication International No. WO 93/23569 International Patent Application Publication WO 94/02595, Ch. one specifically incorporated herein by reference, and synthesized to be tested in vitro and in vivo, as described. Said ribozymes can also be optimized for delivery. Although specific examples are provided, those skilled in the art will recognize that equivalent RNA targets in other species may be used when necessary. The ribozyme activity can be optimized by altering the length of the ribozyme binding arms, or by chemically synthesizing the ribozymes with modifications that prevent degradation through serum ribonucleases (see, for example, international patent application publication No. WO 92). / 07065 International Patent Application Publication No. WO 93/15187 International Patent Application Publication No. WO 91/03162 European Patent Application Publication No. 921 10298.4; patent of U.A. 5,334.71 1; and international patent application publication WO 94/13688, which describe various chemical modifications that can be made to the sugar portions of enzymatic RNA molecules, modifications that improve their efficiency in cells, and the removal of class I bases to reduce the RNA synthesis times and reduce the chemical requirements. Sullivan et al. (International Patent Application Publication No. WO 94/02595) describe general methods for delivering enzymatic RNA molecules. Ribozymes can be administered to cells through a variety of methods known to those skilled in the art, including but not limited to, encapsulation in liposomes, through iontophoresis, or through incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microespears. For some indications, ribozymes can be directly supplied by ex vivo to cells or tissues with or without the aforementioned vehicles. Alternatively, the RNA / vehicle combination can be locally delivered through direct inhalation, or through direct injection or through the use of a catheter, infusion pump or stent. Other route of delivery includes, but is not limited to, intravascular, subcutaneous or joint intramuscular injection, inhalation of oral aerosol (tablet or pill form), topical, systemic, intraperitoneal and / or intra-ocular ocular. Further detailed descriptions of ribozyme delivery and administration are provided in International Patent Application Publication No. WO 94/02595 International Patent Application Publication No. WO 93/23569 each specifically incorporated herein by reference. Other means for accumulating high concentrations of a ribozyme (s) within cells is to incorporate the ribozyme coding sequences into a DNA expression vector. The transcription of the ribozyme sequences are digested from a promoter for polymerase I of eukaryotic RNA (pol I), polymerase I of RNA (pol I I), or polymerase I 1 of RNA (pol l l l). The transcription of the pol I I or pol l l promoters will be expressed at high levels all the cells The levels of a pol II promoter data in a given cell type will depend on the nature of the gene regulatory sequences (enhancers, silencers, etc.) presently present. Prokaryotic RNA polymerase promoters can also be used, provided that the prokaryotic AR polymerase enzyme is expressed in the appropriate cells. The expressed ribozymes of said promoters have been shown to function in mammalian cells. Said transcription units can be incorporated into a variety of vectors to be introduced into a mammalian cell, including, but not limited to, plasmid DNA vectors, viral DNA vectors (such as adenoviruses or vectore associated with adeno), or RNA vectors viral (such as retroviral vectore, semliki forest virus, and sindbis virus). In another embodiment of the invention, peptide nucleic acid (PNAs) compositions are provided. PNA is mimicking DNA, where the nucleobases bind to a pseudopeptide-based structure (Good and Nielsen, Antisense Nucleic Aci Drug Dev. 1997 7 (4) 431-37). The PNA is also capable of being used in a number of methods that have traditionally used RNA or DNA. In general, PNA sequences work better in techniques than the corresponding RNA or DN sequences, and have utilities that are not inherent to DNA RNA. A review of the PNA, including the characteristic manufacturing methods and methods of use, by Corey. { Trends Biotechno 1997, June; 15 (6): 224-9). As such, in certain modalities, s can prepare PNA sequences that are complementary to one or more portions of the ACE mRNA sequence, and said PNA compositions can be used to regulate, alter decrease or reduce the translation of ACE-specific mRNA, and thus alter the level of ACE activity in a host cell to which said PNA compositions have been administered. The PNAs have 2-aminoethyl glycine linkages that replace the normal phosphodiester DNA base structure (Nielsen et al., Science 1991, December 6; 254 (5037): 1497-500; Hanvey et al., Science. 1992, Nov. 27; 258 (5087): 1481-5; Hyrup and Nielsen Bioorg Med Chem. 1996, January; 4 (1): 5-23). This chemistry has three important consequences: first, in contrast to the DNA oligonucleotides of phosphorothioate, the PNAs are neutral molecules in second place, the PNAs are achiral, which avoids the need to develop a stereoselective synthesis; and thirdly, the PNA synthesis uses the BOC or Fmoc protocols for solid phase peptide synthesis, although other methods have been used including a modified Merrifield method. PNA monomers or oligomers that are readily made are commercially available from PerSeptive Biosystem (Framingham, MA). Syntheses of PNA through either Boc or Fmoc protocols are direct using automatic manual protocols (Norton et al., Bioorg Med Chem. 1995, April; 3 (4): 437 45). The manual protocol leads by itself the production of Chemically modified PNAs or the simultaneous synthesis of family of closely related PNAs. As with peptide synthesis, the success of a synthesis of Particular PNA will depend on the properties of the selected sequence. For example, while in theory PNAs can incorporate any combination of nucleotide bases, the presence of adjacent corines can lead to eliminations of one or more residues in the product. While waiting for this difficulty, it was suggested that, when producing PNAs with adjacent purines, the coupling of residues should probably be repeated, which will be added inefficiently. This should be followed by purification of the PNAs through reversed-phase alt-pressure liquid chromatography, yielding yields and product purity similar to those observed during the synthesis of peptides. Modifications of the PNAs for a given application can be achieved by coupling amino acids during the synthesis of solid fas or joining compounds containing a carboxylic acid group to the exposed N-terminal amine. Alternatively, the PNAs can be modified after synthesis through coupling to an introduced lysine or cysteine. The ease with which PNAs can be modified facilitates optimization for better solubility or for specific functional requirements. Once synthesized, the identity of the PNAs and their derivatives can be confirmed through mass spectrometry. It has been Several studies have been made and modifications of PNAs have been used (eg, Norton et al., Bioorg Med Chem. 1995, April; 3 (4): 437-4 Petersen et al., J. Pept Sci. 1995, May-June; 1 ( 3): 175-83, Orum others, Biotechniques, 1995, September, 19 (3): 472-80, Footer and other Biochemistry, 1996, August 20, 35 (33): 10673-9, Griffith and other Nucleic Acids Res. 1995, August 11; 23 (15): 3003-8; Pardrige and another Proc. Nati Acad Sci USA, 1995, June 6; 92 (12): 5592-6; Bofia and other Proc Nati Acad Sci USA. March 14, 92 (6): 1901-5, Gambacort Passerini and others, Blood, 1996, August 15, 88 (4): 1411-7, Armitage others, Proc Nati Acad Sci USA, 1997, November 11, 94 (23 ): 12320-Seeger et al., Biotechniques, 1997, September; 23 (3) -512-7). The patent of E. U. A. No. 5,700,922 discusses pNA-DNA-PNA chimeric molecules and their uses in diagnosis, protein modulation in organisms and treatment of conditions susceptible to therapeutic agents. Methods for characterizing the antisense properties of the PNAs are discussed by Rose (Anal Chem. 199 December 15; 65 (24): 3545-9) and Jensen et al., (Biochemistry, 199 April 22; 36 (16): 5072-7). Rose uses capillary gel electrophoresis to determine the binding of PNAs to their complementary oligonucleotide, measuring the relative binding kinetics and l estequimetry. Similar types of measurements were made by Jense and others, using BIAcore ™ technology. Other applications of PNAs that have been described and will be apparent to those skilled in the art include the use of invasion of DNA strand structure, antisense inhibition, mutational analysis, transcription enhancers, nucleic acid purification, transcriptionally active gene isolation, transcription factor binding block, biosensor genom inscription, in situ hybridization, and the like.

ID. Characterization and Expression of the Polynucleotide The polynucleotide compositions of the present invention can be identified, prepared and / or manipulated using any of a variety of well-established techniques (see General Sambrook et al., Molecular Cloning: A Manua Laboratory Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989, other similar references). For example, a polynucleotide can be identified, as described in more detail below, by classifying a microarray of cDNAs for tumor-associated expression (ie, expression that is at least twice as large as a tumor than in normal tissue)., as determined using representative test provided herein). Such classifications may be made, for example, using the microdisposition technology of Affymetrix, Inc. (Santa Clara, CA) in accordance with the manufacturer's instructions (and essentially as described by Schena et al., Proc Nati. Acad. Sci. USA 93: 10614 10619, 1996 and Heller et al., Proc. Nati, Acad. Sci. USA 94: 2150 2155, 1997). Alternatively, polynucleotide can be amplified from cDNA prepared from cells expressing the proteins described here, such as tumor cells. Many template dependent procedures are available to amplify target sequences of interest present in a sample. One of the best known amplification methods is the polymerase chain reaction (PCR ™), which is described in detail in the patents of E. U. A. Nos. 4,683,195; 4,683,202 4,800,159, each of which is incorporated herein by reference in its entirety. Briefly, in the PCR ™ reaction, two primer sequences are prepared, which are complementary regions on complementary strand structures opposite the target sequence. An excess of deoxynucleoside triphosphates is added to a reaction mixture together with a DNA polymerase (eg, Taq polymerase). If the target sequence is present in a sample, the primers will bind to the target and the polymerase will cause the primers to be extended along the target sequence by adding in nucleotides. When raising the temperature of the reaction mixture decreases, the extended initiators will dissociate from the target to form reaction products, the excess initiators will bind to the target and the reaction product and the procedure will be repeated.

Preferably, the reverse transcription PCR ™ amplification procedure can be performed in order to quantitate the amount of amplified mRNA. Polymerase reaction methodologies are well known in the art. Any of a number of other procedures dependient of template, many of which are variations of the PCR ™ amplification technique, are readily known and available in the art. Illustratively, some of these methods include the ligand chain reaction (referred to as LCR), described in, for example, European Patent Application Publication No. 320, 308 and U.A. Patent No. 4,883,750; Qbet Replicasa, described in the international patent application publication PCT No. PCT / US87 / 00880; amplification d displacement chain structure (SDA) and repair chain reaction (RCR). Other methods of amplification are described in British Patent Application No. 2,202,328, and in PCT International Patent Application Publication No. PCT / US89 / 01025. Other nucleic acid amplification methods include transcription-based amplification (TAS) systems (PCT international patent application publication No WO 88/10315), including amplification based on a nucleic acid sequence (NASBA) and 3SR. The patent application publication European Patent No. 328,822 discloses a nucleic acid amplification method that involves cyclically synthesizing individual chain structure RNA ("ssRNA"), ssDNA, and d-DNA double-stranded structure (dsDNA). PCT International Patent Application Publication No. WO 89/06700 discloses a nucleic acid sequence amplification scheme based on the hybridization of a promoter / primer sequence to an individual target chain DNA ("ssDNA") DNA. followed by the transcription of many RNA copies of the sequence. Other amplification methods such as "RACE" (Fohman, 1990), and "Single-sided PC" (Ohara, 1989) are also well known to those skilled in the art. An amplified portion of a polynucleotide of the present invention can be used to isolate a full-length gene from a suitable collection (eg, a collection of tumor cDNA) using well-known techniques. Within such techniques a collection (cDNA or genomic) is classified using one or more polynucleotide primers or primers suitable for amplification. Preferably, a collection is selected by the even size to include larger molecules. Randomly initiated collections may also be preferred to identify regions and regions upstream of genes. Genomic libraries are preferred to obtain introns and 5 'extension sequences. For hybridization techniques, a partial sequence can be labeled (for example, through notch translation or extreme 32P labeling) using well-known techniques. Afterwards, a bacterial bacteriophage collection is generally classified by hybridizing filters containing denatured bacterial colonies (or sieves containing phage plates) with the labeled probe (see, Sambrook et al., Molecular Cloning: Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, 1989). Colonies or hybridization plates are selected and expanded, and the DNA is isolated for further analysis The cDNA clones can be analyzed for the amount of additional sequence, for example, through PC using a partial sequence primer and a vector primer. Partial restriction and sequence maps can be generated to identify one or more overlapping clones. The complete sequence can then be determined using standard techniques, which may involve generating a series of elimination clones. The resultant overlapping sequences can then be assembled into an individual contiguous sequence. A full-length cDNA molecule can be generated by ligating suitable fragments, using well known techniques. Alternatively, amplification techniques such as those described above may be useful to obtain a full length coding sequence from a partial AD Nc sequence. One amplification technique is reverse PC (see, Triglia et al, Nucí Acids Res. 16: 81 86, 1888), which uses restriction enzymes to generate a fragment in the known region of the gene. The fragment is then circularized through intramolecular ligation and used as a template for the PC with divergent primers derived from the known reglon. Within an alternative aspect, sequences adjacent to a partial sequence can be recovered through amplification with an initiator for a linker sequence and a specific initiate for a known region. The amplified sequences they are typically subjected to a second round of amplification with the same linker primer and a second primer specific for the known region. A variation on this procedure, which employs two initiators that initiate extension in opposite directions from the known sequence, is described in W 96/38591. Another technique is known as "rapid amplification of cDNA ends" or RACE. This technique involves the use of an internal primer and an external primer, which hybridizes to a poly A region or vector sequence, to identify sequences that are 5 '3' of a known sequence. Additional techniques include capture PCs (Lagerstrom et al., PCR Methods Applic.1: 111-19 1991) and walking PCR (Parker et al., Nucí Acids, Res. 19: 3055-60, 1991). Other methods employing the amplification can also be used to obtain a full-length cDNA sequence. In certain cases, it is possible to obtain a full length cDNA sequence through the analysis of sequences provided in an expressed sequence label (EST) database, t as that available from GenBank. Generally, investigations for overlapping ESTs can be performed using well known programs (eg, NCBI BLAST searches), and said ESTs can be used to generate a contiguous full length sequence. Complet length DNA sequences can also be obtained through genomic fragment analyzes.

In other embodiments of the invention, polynucleotide sequences or fragments thereof encoding polypeptide of the invention, or fusion proteins or functional equivalents thereof, can be used in recombinant AD molecules to direct the expression of a polypeptide in host cell appropriate. Due to the inherent degeneracy of the genetic code, other DNA sequences that encode substantially the same amino acid sequence or a functionally equivalent amino acid sequence can be produced, and these sequences can be used to clone and express a given polypeptide. As will be understood by those skilled in the art, it may be advantageous in some cases to produce nucleotide sequences encoding polypeptides that possess natural n-codons. For example, preferred codons for a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life that is longer than that of a transcript. generated from the sequence of natural existence.

In addition, the polynucleotide sequences of the present invention can be engineered using a method generally known in the art, for the purpose of altering the polypeptide coding sequences for a variety of reasons, including, but not limited to, alterations that modify the cloning, processing, and / or expression of the product d gene. For example, the intermixing of DNA through random fragmentation and PCR reassembly of synthetic oligonucleotide gene fragments can be used to engineer the nucleotide sequences. In addition, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change the codon preference, produce splice or binding variants, or introduce mutations, etc. In another embodiment of the invention, the natural, modified or recombinant nucleic acid sequences can be linked to an etherologous sequence to encode a fusion protein. For example, to classify peptide collections for inhibitors of polypeptide activity, it may be useful to encode a chimeric protein that can be recognized by a commercially available antibody. A fusion protein can also be engineered to contain a cleavage site located between the polypeptide coding sequence and the heterologous protein sequence, so that the polypeptide can be separated and purified from the heterologous portion. The sequences encoding a desired polypeptide can be synthesized, as a whole or in part, using chemical methods well known in the art (see, Caruthers, MH et al. (1980) Nucí.Aids Res. Sy. Ser. 215-223, Horn, T. et al. (1980 Nucí.Aids Res. Symp.Ser 225-232) .Alternatively, the same. protein can be produced using chemical methods to synthesize the amino acid sequence of a polypeptide, or a portion thereof. For example, peptide synthesis can be performed using various solid phase techniques (Roberge, JY others (1995) Science 269: 202-204) and automatic synthesis can be obtained, for example using the AB 431A peptide synthesizer (Perkin Elmer , Palo Alto, CA). A newly synthesized peptide can be substantially purified through high performance liquid chromatography of preparation (eg, Creighton, T. (1983 Proteins, Structures and Molecular Principles, WH Freeman and Co. New York.), Or other comparable techniques. Available in the field The composition of synthetic peptides can be confirmed through amino acid analysis or sequencing (e.g., Edman degradation procedure.) In addition, the amino acid sequence of a polypeptide, or any part thereof, can be altered during direct synthesis and / or combined using chemical method with sequences of other proteins, or any part thereof, to produce a variant polypeptide In order to express a desired polypeptide, the nucleotide sequence encoding the polypeptide, or functional equivalents can be inserted into the appropriate expression vector, is a vector that contains to the necessary elements for the transcription and translation of the inserted coding sequence. You can use methods that are well known to those experts in the technique for constructing expression vectors containing sequence encoding a polypeptide of interest and elements of transcriptional and translational control. These methods include recombinant DNA techniques in vitro, synthetic techniques, and in vivo recombination. Such techniques are described in, for example, Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual Cold Spring Harbor Press, Plainview, N. Y., and Ausubel, F. M. and others (1989) Current Protocols in Molecular Biology, John Wiley & Sons New York, N. Y. A variety of expression / host vector systems can be used to contain and express d polynucleotide sequences. These include, but are not limited to, microorganism such as bacteria transformed with recombinant bacteriophage, plasmid, or d-DNA cosmid expression vectors.; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (eg, baculovirus); plant cell systems transformed with virus expression vectors (eg, cauliflower mosaic virus, Ca MV, PMV tobacco mosaic virus), or bacterial expression linkers (eg, Ti plasmids or pBR322); or animal cell systems. The "control elements" or "regulatory sequences present in an expression vector are those n-translated regions of the vector enhancers, promoters, traduced 5 'and 3' regions, which interact with cell proteins. guest to perform the transcription and translation. These elements can vary in their strength and specific character. Depending on the system of vector and host used, any number of elements of transcription and translation, including cost-effective and inducible promoters, can be used. For example, when cloning into bacterial systems, inducible promoters such as the lacZ hybrid promoter of the phagemid PBLU ESCRI PT (Stratagene, La Jolla, Calif.) Or the PSPORT plasmid (Gibco BRL, Gaithersburg, MD), and the like can be used. . In mammalian cell systems, promoters of mammalian or mammalian virus genes are generally preferred. If it is necessary to generate a cell line containing multiple copies of the sequence encoding a polypeptide, SV40 EBV-based vectors with an appropriate selectable marker are advantageously used. In bacterial systems, any number of expression vectors may be used, depending on the intended use for the expressed polypeptide. For example, when large quantities are needed, for example, for the induction of antibodies, vectors that direct the high level expression of fusion proteins that are easily encoded can be used. Said vectors include, but are not limited to, multifunctional E.coli cloning and expression vectors, such as BLUESCRI PT (Stratagene), and wherein the sequence encoding the polypeptide of interest can be ligated to the vector in frame with sequences for the amino-terminal Met and the 7 subsequent residues of beta-galactosidase, so that a hybrid protein is produced; pIN vectors (Van Heeke, G. and S. M Schuster (1989) J. Biol. Chem. 264: 5503-5509); and similar. Also, pGEX vectors (Promega, Madison, Wis.) Can be used to express foreign polypeptides as fusion proteins with glutathione S transferase (GST). In general, said fusion proteins are soluble and can be easily purified from d Used cells through adsorption to glutathione-agar beads followed by elution in the presence of free glutathione. The proteins made in such systems can be designed to include heparin cleavage site, thrombin, or factor XA protease, so that the cloned polypeptide of interest can be released from the GST portion in the future. In yeast, Saccharomyces cerevisiae, a number of vectors containing inducible constitutive promoters such as alpha factor, alcohol, and PGH can be used. For reviews, see Ausubel et al (supra) and Grant et al (1987 Methods Enzymol, 153-516-544) In cases where plant expression vectors are used, the expression of polypeptide-encoding sequences can be directed through any of a number of promoters, eg, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the TMV omega leader sequence (Takamatsu, N. (1987) EMBO J 6: 307-311 Alternatively, promoters of plants such as the small subunit of RUBISCO or promoter can be used.

Heat shock (Coruzzi, G. et al. (1984) EMBO J. 3: 1671-1680 Broglie, R. et al. (1984) Science 224: 838-843; and Winter, J. et al. (1991) Results Probl. Cell Differ. 17: 85-105). These constructs can be introduced into plant cells through direct DNA transformation or pathogen-mediated transfection. These techniques are described in a generally available review number (see, for example, Hobbs, S. or Murry, L. and McGraw Hill, Yearbook of Science and Technology (1992) McGra Hill, New York, NY, page 191- 196). An insect system can also be used to express a polypeptide of interest. For example, in said system, Autographa californica nuclear polyhedron virus (AcNPV) is used as a vector to express foreign genes in Spodopter Frugiperda cells or Trichoplusia larvae. The sequences encoding the polypeptide can be cloned to a non-essential region of the virus, such as the polyhedrin gene, and placed under the control of the polyhedrin promoter. Successful insertion of the sequence encoding the polypeptide will render the polyhedrin gene inactive, producing a cover protein lacking recombinant virus. The recombinant viruses can then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae where the polypeptide of interest can be expressed (Engelhard, E K. And others (1994) Proc. Nati Acad. 91: 3224-3227). In mammalian host cells, a number of viral base expression systems are generally available. For example, e In cases where an adenovirus is used with an expression vector, the sequences encoding a polypeptide of interest can be linked to an adenovirus transcription / translation complex consisting of the last promoter and the tripartite leader sequence. S can use the insertion in a non-essential E1 or E3 region d viral genome to obtain a viable virus, which is able to express the polypeptide in infected host cells (Logan, J. Shenk, T. (1984) Proc. Nati Acad. Sci. 81: 3655-3659). In addition, transcriptional enhancers can be used, such as Rous sarcoma virus (RSV) enhancement to increase expression in mammalian host cells. Specific initiation signals can also be used to achieve a more efficient translation of sequences encoding a polypeptide of interest. Said signals include the ATG initiation codon and adjacent sequences. In cases where the coding sequences of the polypeptide, its initiation codon, upstream sequences are inserted into the appropriate expression vector, no transcriptional or translational signal is needed. However, in cases where the coding sequence or a portion thereof is inserted in the sun, s must provide exogenous translation control signals including the ATG start codon. In addition, the initiation codon must be in the correct reading frame to ensure the translation of the entire insert. The exogenous elements of translation and the codons of initiation may be of various origins. both natural and synthetic. The expression efficiency can be improved through the inclusion of enhancers that are appropriate for the particular cell system used, such as those described in the literature (Scharf, D. et al. (1994) Resul Probl. Cell Differ. 20: 1 25-162). In addition, a host cell strain can be selected by its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired form. Said modifications of the polypeptide include, but are not limited to acetylation, carboxylation, glycosylation, phosphorylation, acylation lipidation. Post-translation processing can also be used, which separates a "prepro" form of the protein to facilitate correct insertion, folding and / or function. Different host cells can be selected such as CHO, COS, HeLa MDCK, HEK293, and W138, which have specific cell machinery and characteristic mechanisms for said post-translation activities, to ensure the correct processing of the foreign protein. For the production of high-yield, long-term recombinant proteins, stable expression is generally preferred. For example, cell lines that stably express a nucleotide polynucleotide of interest can be transformed using expression vectors that may contain viral origins d replication and / or endogenous expression elements and a selectable labeled gene on the same vector or on a vector separated After the introduction of the vector, the cells can be allowed to develop for 1 -2 days in an enriched medium before they are walled to the selective medium. The purpose of selectable labeling is to confer resistance for selection, and its presence allows growth and recovery of cells that successfully express the introduced sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate for the cell type. Any number of selection systems can be used to retrieve transformed cell lines. These include, but are not limited to, thymidine kinase genes from herpes simplex virus (Wingler, M. et al. (1977) Cell 1 1: 223-32) and adenine phosphoro-benzyltransferase (Lowy, I., et al. 1990) ce 22: 817-23), which can be used in tksup cells. aprt.sup.-, respectively. Also, you can use antimetabilite, antibiotic resistance or herbicide, as the bas for the selection; for example, dhfr, which confers metrotexatro resistance (Wigler, M. et al. (1 980) Proc. Nati. Acad. Sc 77: 3567-70); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Gerapin, F. et al. (1981) J. Mol. Biol. 150: 1-14); and iso or pat, which confer resistance to phosphinothricin acetyltransferase chlorfurfuron, respectively (Murry, supra) Additional selectable genes have been described, for example trpB, which allows cells to use indole instead of tryptophan or hisD, which allows the cells to use histinol instead of histidine (Hartman, S.C. and R.C. Mulligan (1988) Proc. Nati. Acad Sci. 85: 8047-51). The use of visible markers has gained popularity with markers such as anthocyanins, beta glucuronidase and its GUS substrate, and lucifera and its luciferin substrat, being widely used not only to identify transformants, but also to quantify the amount of transient protein expression or stable due to a specific vector system (Rodees, CA et al. (1 995) Methods Mol. Biol 55: 121-131). Although the presence / absence of labeled gene expression suggests that the gene of interest is also present, its presence expression can necessarily be confirmed. For example, if the sequence encoding a polypeptide is inserted into a marker gene sequence, sequences containing recombinant cells can be identified through the absence of the marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a polypeptide under the control of an individual promoter. The expression of the marker gene in response to induction or selection usually indicates the expression of the gene in tandem, as well. Alternatively, host cells may be identified that contain and express a desired polynucleotide sequence, through a variety of methods known to those skilled in the art. These procedures include but not limit, DNA-DNA or DNA-RNA hybridization and techniques or bioassay or protein immunoassay including, for example, membrane-based technologies, solution, or wafer for the detection and / or quantification of nucleic acid or protein. A variety of protocols are known in the art for detecting and measuring the expression of products encoded by polynucleotide, using either polyclonal monoclonal antibodies specific for the product. Examples include assay with enzyme-linked immunosorbent (ELISA) radioimmunoassay (RIA), and fluorescence activated cell (FACS) classification. A monoclonal bas immunoassay of two sites using monoclonal antibodies reactive for two epitopes without interference to a given polypeptide is preferred for some applications, but a competitive binding assay may also be employed. These and other assays are described elsewhere, in Hampton, R. et al. (1990; Serological Methods, Laboratory Manual, APS Press, St Paul, Minn.) And Maddox, DE others (1983; J. Exp. Med. 158).; 1211-1216). A wide variety of labels and conjugation techniques are known to those skilled in the art and various nucleic acid and amino acid assays can be used. Means to produce labeled hybridization or PCR probes to detect polynucleotide-related sequences include oligotagnation, nick translation, end-labeling, PCR amplification using a labeled nucleotide Alternatively, the sequences, or any portion thereof, can be cloned into a vector for the production of an mRNA probe. Such vectors are well known in the art, and are commercially available, and can be used to synthesize RNA probes in vitro through the addition of an appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides. These procedures may be known using a variety of commercially available equipment. Suitable reporter molecules or labels, which may be used include radionuclides, enzymes, fluorescent, chemoluminescent or chromogenic agents, as well as substrates, co-factors, inhibitors, magnetic particles, and the like. Host cells transformed with a polynucleotide sequence of interest can be cultured under conditions suitable for expression and recovery of the protein from the cell culture. The protein produced through a recombinant cell can be secreted or contained intracellularly, depending on the sequence and / or the vector used. As will be understood by those skilled in the art, expression vectors containing polynucleotides of the invention can be designed to contain signal sequences that direct the secretion of the encoded polypeptide through a prokaryotic or eukaryotic cell membrane. Other recombinant constructs can be used to bind sequences encoding a polypeptide of interest to a nucleotide sequence which encodes a polypep domain that will facilitate the purification of soluble protein. Said purification that facilitates domains includes but is not limited to, metal chelating peps such as hisne-tryptophan modules that allow purification and immobilized metals, protein A domains that allow purification in immobilized immunoglobulin, and the domain used in the system. / affinity purification purification Immunex Corp., Seattle, Wash.). The inclusion of cleavage linker sequences such as those specific for the XA or endokinease factor (Invitrogen, San Diego, Calif.) Between the purification domain and the encoded polypep can be used to facilitate purification. Said expression vector provides expression of a fusion protein containing a polypep of interest and nucleic acid encoding six hisne residues preceding a thioredoxin or enterokinase cleavage site. The hisne residues facilitate purification in IMIAC (immobilized metal ion affinity chromatography) as described by Porta, J. et al. (1992, Prot. Exp. Pur. 3: 263-281), while the site cleaved. of enterokinase provides a means to purify the desired pep from the fusion protein. A discussion of qu vectors containing fusion proteins is provided by Kroll, D.J. and others (1993, DNA Cell Biol. 12: 441-453). In addition to recombinant production methods, polypeps of the invention, and their fragments, can be produced through direct pep synthesis using solid phase techniques.

(Merrifield J. (1993) J. Am. Chem. Soc. 85: 2149-2154). Protein synthesis can be performed using manual techniques or through automation. Automatic synthesis can be achieved, for example, using the pep synthesizer Applied Biosystems 431A Pep Synthesizer (Perkin Elmer). Alternatively, several fragments can be chemically synthesized separately and combined using chemical methods to produce the full-length molecule.

Antibody Compositions, Their Fragments and Other Binding Agents In accordance with another aspect, the present invention further provides binding agents, such as antibodies and their antigen-binding fragments, that exhibit immunological binding to a tumor polypep described herein, or a portion, variant or derivative thereof. An antibody, or an antigen-binding fragment thereof, is said to "bind specifically", "bind immunologically", and / or "is immunologically reactive" to a polypep of the invention if it reacts at a detectable level ( within, for example, an ELISA assay) with the pep, and does not react detectably with non-related polypeps under similar conditions. Immunological binding, as used in this context, generally refers to non-covalent interactions of the type that occur between an immunoglobulin molecule and an antigen for the which is specific immunoglobulin. Resistance, or affinity of immunological binding interactions, can be expressed in terms of the dissociation constant (Kd) of the interaction, and where a smaller Kd value represents a higher affinity. The immunological binding properties of selected peps They can be quantified using well-known methods in the field. A detailed method measures the rates of formation dissociation of the antigen / antigen binding site complex, and where those rates depend on the concentrations of the complex patterns, the affinity of the geometric parameter interaction that equally influence the velocity and both addresses. In this way, both the "ignition speed constant" (Kensing) and the "speed constant off (Kg) can be determined through the calculation of the concentrations and the actual speeds of association dissociation. allows the cancellation of all parameters not related to affinity, and in this way is equal to the dissociation constant Kd-Ver, in general Davies et al. (1990) Annual Rev. Biochem. 59: 439-473. An "antigen binding site" or "binding portion" of an antibody refers to that part of the immunoglobulin molecule that participates in antigen binding. The antigen binding site is formed through amino acid residues of the variable N-terminal ("V") regions of the heavy ("H") and light ("L") chains. Three highly divergent stretches within the regions V d the heavy and light chains are referred to as "hypervariable regions", which are interposed between more conserved flanking d stretches known as "structure regions", "FRs". In this way, the term "FR" refers to amino acid sequences that are naturally found between and adjacent hypervariable regions in immunoglobulin. In an antibody molecule, the three hypervariable regions of a light chain the three hypervariable regions of a heavy chain are arranged relative to one another in the three-dimensional space to form an antigen-binding surface. The antigen binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the light and heavy chains are referred to as "complementarity determination regions" or "CDRs." The binding agents may also be able to differentiate between patients with and without a cancer, such as cancer of the prostate, using the representative assays provided herein. For example, antibodies or other ionic agents that bind to a tumor protein will preferably generate a signal indicating the presence of a cancer in at least about 20% of patients with the disease, most preferably at least about 30% of patients. Alternatively, or in addition, the antibody will generate a negative signal indicating the absence of the disease in at least about 90% of the individuals without the cancer. To determine if a union agent satisfies this As a requirement, biological samples (eg, blood, serum, sputum, urine, and / or tumor biopsies) were analyzed from patients with and without cancer (as determined using standard clinical tests), as described herein, for the presence of polypeptides They join the bonding agent. Preferably, a significant number of samples with and without the disease will be analyzed statistically. Each binding agent must satisfy the above criteria; however, those skilled in the art will recognize that binding agents can be used in combination to improve sensitivity. Any agent that satisfies the above requirements can be a binding agent. For example, a binding agent can be a ribosome with or without a peptide component, an RNA molecule or a polypeptide. In a preferred embodiment, a binding agent is an antibody or an antigen-binding fragment thereof. The antibodies can be prepared through any variety of techniques known to those skilled in the art. See, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. In general, antibodies can be produced through cell culture techniques, including the generation of monoclonal antibodies as described herein. , or through transfection of antibody genes to suitable bacterial or mammalian host cells, in order to allow the production of recombinant antibodies. In one technique, an immunogenene, which comprises the polypeptide, is initially injected into any of a wide variety of mammals (eg, mice, rats, rabbits, sheep or goats). In this step, the polypeptides of this invention can serve as the immunogen without modification. Alternatively, in particular for relatively short polypeptides, a superior immune response may be produced if the polypeptide binds to a carrier protein, such as bovine serum albumin or keyhole limpet emotion. The immunogen is injected into the host animal, preferably according to a predetermined schedule incorporating one or more booster immunizations, and the animals are bled periodically. Then, polyclonal antibodies specific for the polypeptide can be purified from said antisera, for example, through affinity chromatography using the polypeptide coupled to a suitable solid support. Monoclonal antibodies specific for a polypeptide of interest can be prepared, using, for example, the technique of Kohler and Milstein, Eur. J. Immunol. 6: 511-519, 1976, and improvements thereto. In summary, these methods involve the preparation of immortal cell lines capable of producing antibodies having specific desired character (i.e., reactivity with the polypeptide of interest). Said cell lines may be produced, for example, from spleen cells obtained from an immunized animal as described above. The baz cells are then immortalized, for example, through fusion with a myeloma cell fusion pattern, preferably that is Syngeneic with the immunized animal. A variety of fusion techniques can be employed. For example, spleen cells and myeloma cells can be combined with a non-ionic detergent for a few minutes and then plated out at low density in a selective medium that supports the growth of hybrid cells, but not of myeloma cells. A preferred selection technique uses the selection of HAT (hixanthin, aminopepterin, thymidine). After a sufficient time, usually around 1 to 2 weeks, colonies of hybrids are observed. Individual colonies are selected and their culture supernatants tested for binding activity against the polypeptide. Hybridomas having high reactivity and specific character are preferred. The monoclonal antibodies can be isolated from the supernatants of growing hybridoma colonies. In addition, various techniques can be employed to improve production, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Then, the monoclonal antibodies can be harvested from the ascites fluid or blood. The contaminants can be removed from the antibodies through conventional techniques, such as chromatography, gel filtration, precipitation and extraction. The peptides of this invention can be used in the purification process in, for example, an affinity chromatography step. A number of therapeutically useful molecules are known in the art, which comprise antigen binding sites that are capable of exhibiting immunological binding properties of an antibody molecule. The proteolytic enzyme papain preferentially cleaves the IgG molecules to produce several fragments, two of which (the "F (ab)" fragments) each comprise a covalent ether thimer that includes an intact antigen binding site. The enzyme pepsin is capable of separating IgG molecules to provide various fragments, including the "F (ab ') 2" fragment, which comprises both antigen binding sites. An "Fv" An fragment can be produced through preferential proteolytic cleavage of an IgM, and on rare occasions an IgG or IgA immunoglobulin molecule. However, Fv fragments are most commonly derived using recombinant techniques known in the art. The Fv fragment includes a non-covalent VH :: VL heterodimer that includes an antigen-binding site that retains much of the antigen recognition and binding capabilities of the native antibody molecule. Invar. And others (1972) Proc. Nat. Acad. Sci. USA 69: 2659-2662; Hochman et al. (1976) Biochem 15: 2706-2710; and Ehñich et al. (1980) Biochem 19: 4091-4096. An individual chain Fv polypeptide ("sFv") is a covalently linked VH :: VL heterodimer, which is expressed from a gene fusion including VH- and VL- encoding genes through a peptide coding linker . Houston et al. (1988) Proc. Nat. Acad. Sci. USA 85 (16): 5879-5883. A number of methods have been described to find out the structures Chemicals for converting naturally added but chemically separated light and heavy polypeptide chains from a V region of antibody to a sFv molecule, which will be bent into a three dimensional structure substantially similar to the structure of an antigen binding site. See, for example, patents of E. U. A. Nos. 5,091,513 and 5,132,405 of Houston et al .; and U.A. Patent No. 4,946,778, to Ladner et al. Each of the above-described molecules includes a heavy chain and light chain CDR group, respectively interposed between a heavy chain and light chain FR group that supports CDRS and defines the spatial relationship of CDRs relative to each other . As used herein, the term "CD group" refers to the three hypervariable regions of a heavy or light chain V region. Continuing from the N term of a heavy or light chain, these regions are denoted as "CDR1", "CDR2" and "CDR3", respectively. Therefore, an antigen binding site includes 6 CDRs, the CDR group comprising each heavy chain and light chain V region. A polypeptide comprising an individual CDR (eg, a CDR1, CDR2 or CDR3) is referred to herein as a "molecular recognition unit". Crystallographic analysis of a number of antigen-antibody complexes has shown that the amino acid residues of CDRs form extensive contact with bound antigen, where the bulk of the extensive antigen contact is with heavy chain CDR3. In this way, the units of Molecular recognition are primarily responsible for the specific character of an antigen binding site. As used herein, the term "FR group" refers to the four flanking amino acid sequences, which frames the CDRs of a CDR group of a light heavy chain V region. Some FR residues can make contact with the bound antigen; however, FRs are mainly responsible for doubling the V region at the antigen binding site, particularly FR residues directly adjacent to CDRS. Within FRs certain amino residues and certain structural aspects are highly conserved. In this regard, all V region sequences contain an internal disulfide loop of approximately 90 amino acid residues. When the V regions are doubled at a binding site, the CDRs are presented as projection loop motifs that form an antigen binding surface. It is generally recognized that there are structurally conserved regions of FRs, which influence the doubled form of CD R loops to certain "canonical" structures, without considering the precise CDR amino acid sequence. In addition, it is known that certain FR residues participate in contacts between n covalent domains, which stabilize the interaction of the light heavy chains of the antibody. A number of "humanized" antibody molecules have been described which comprise an antigen binding site derived from a non-human immunoglobulin, including antibody chimeric regions that have rodent V regions and their associated CDRs linked to human constant domains (Winter et al. (1991 Nature 349: 293-299; Lobuglio et al. (1989) Proc. Nati. Acad. Sci USA 86: 4220-4224; Shaw et al. (1987) J. Immunol., 138: 4534-4538 and Brown et al. (1987) Cancer Res. 47: 3577-3583), Roedo CDRs grafted onto a human support FR before fusion with a constant domain of suitable human antibody (Riechmann others (1988) Nature 332: 323-327; Verhoeyen et al. (1988) Scienc 239: 134-1 536; and Jones et al. (1986) Nature 321: 522-525), and supported rodent CDRs by recombinantly coated rodent FRs (European Patent Application No. 519-596, published on December 2, 1992.) These "humanized" molecules are designed to minimize the unwanted immune response to rodent antihuman antibody molecules, that limits the d uració and effectiveness of therapeutic applications of those portions and human receptors. or is used herein, the terms "covered FRs" "recombinantly coated FRs" refers to the selective replacement of FR residues from, for example, a light heavy chain V region of rodent, with human FR residues in order to provide a xenogeneic molecule comprising antigen binding site that substantially retains the entire folding structure of the native FR polypeptide. The coating techniques are based on the understanding that the ligand binding characteristics of an antigen-binding site are determined primarily through the structure and relative arrangement of the heavy chain and light chain CDR groups within the antigen binding surface. Davies et al. (1990) Ann. Rev. Biochem. 59: 439-473. In this way, the specific character of antigen binding can be conserved in a humanized antibody only where the CDR structures, their interaction with each other, and their interaction with the rest of the V domains are carefully maintained. By using coating techniques, the outer FR residues (eg, solvent accessible), which are easily found by the immune system, are selectively replaced with human residues to provide a hybrid molecule comprising either a weakly immunogenic coated surface, or substantially non-immunogenic. The procedure for coating makes use of the sequence data available for the human antibody variable domains compiled by Kabat and others, in Sequences of Proteins of Immunological Interest, 4th. ed., (U. S. Dept. of Health and Human Services, U. S. Goverment Printing Office, 1987), updates the Kabat database, and other accessible U. A. and foreign databases (both nucleic acid and protein). The amino acid solvent accessibilities of the V region can be deduced from the known three-dimensional structure for human and murine antibody fragments. There are two general steps to coat a murine antigen binding site. Initially, the FRs of the variable domains of a molecule of antibody of interest are compared to the corresponding F sequences of human variable domains obtained from the sources previously identified. The homologous human V regions are then compared residue by residue to the corresponding murine amino acids. Residues in murine FR d that differ from the human counterpart are re-emplaced by residues present in the human portion using recombinant techniques well known in the field. Switching d waste is only done with portions that are at least partially exposed (accessible to solvent), and great care must be taken in the replacement of the amino acid residues that can have an important effect on the tertiary structure of the domains. of the V region, such as proline, glycine and amino acid charged. In this way, the murine antigen binding sites "covered" resulting in this way are designed to retain the CDR residues of murine, the residues substantially adjacent CDRs, the residues identified as buried or mostly buried (inaccessible to solvents), the residues that are believed to be involved in non-covalent contacts (eg, hydrophobic electrostatic) between heavy and light chain domains, and the residues of conserved framework regions of FRs, which are believed to have influence on the "canonical" tertiary structures of the CDR loops. These design criteria are then used to prepare recombinant nucleotide sequences which combine the CDRs of both heavy chain and light d of a murine antigen binding site to human appearance FRs that can be used to transfect mammalian cells for the expression of recombinant human antibodies that exhibit the antigen-specific character of The murine antibody molecule. In another embodiment of the invention, the monoclonal antibodies of the present invention can be coupled to one or more other therapeutic agents. Suitable agents in this regard include radionuclides, differentiation inducers, drug toxins and their derivatives. Preferred radionuclides include 90Y 123I, 125I, 131i, 186Re, 188Re, 211At, and 212Bi. Preferred drugs include methotrexate, and pyrimidine and purine analogues. Preferred inducers of differentiation include formol esters butyric acid. Preferred toxins include resin, abrin, diphtheria toxin, cholera toxin, gelonin, Pseudomonas exotoxin from Shigella toxin, and antiviral protein from grana. A therapeutic agent can be coupled (eg, covalently linked) to a suitable monoclonal antibody either directly or indirectly (eg, through a linker group). A direct reaction between an agent and a possible antibody when each one possesses a substituent capable of reacting with the other. For example, a nucleophilic group, such as an amino or sulfhydryl group, which may be capable of reacting with the group containing carbonyl, such as an anhydride or a halogenur acid, or with an alkyl group containing a good leaving group (eg, a halogenide) on the other. Alternatively, it may be desirable to couple a therapeutic agent and an antibody through a linker group. A linker group can function as a separator for distance an antibody from an agent in order to avoid interference with binding capabilities. A linker group can also serve to increase the chemical reactivity of a substituent or an agent an antibody, and thereby increase the coupling efficiency. An increase in chemical reactivity can also facilitate the use of agents or functional groups on agents, which otherwise would not be possible. It will be apparent to those skilled in the art that a variety of bifunctional or polyfunctional reagents, both homo- and hetero-functional (such as those described in the Pierce Chemical Co. catalog., Rockford, I L), can be used as the linker group. The coupling can be effected, for example, through amino groups, carboxyl groups, sulfhydryl group or residues of oxidized carbohydrate. There are numerous references describing said methodology, for example, patent of E. U. A. No. 4,671, 958 of Rodwell et al. When a therapeutic agent is more potent when it is free of the antibody portion of the immobucts of the present invention, it may be desirable to use a group in the lacer which can be separated during or after the internationalization to a cell. A number of different linker groups that can be separated have been described. Mechanisms for the intracellular release of an agent from these linker groups include cleavage through reduction of a disulfide bond (eg, US Patent No. 4,489,710 to Spitler), through irradiation of a photolabile bond (e.g. , U.S. Patent No. 4,625,014 to Senter et al.), through derivatized amino acid side chain hydrolysis (e.g. U. U. Patent No. 4,638,045 to Kohn et al.), through complement-mediated hydrolysis. of serum (e.g., US Patent No. 4,671,958 to Rodwell et al., and acid catalyzed hydrolysis (e.g., U.S. Patent No. 4,569,789 to Blattler et al.) It may be desirable to couple more than one agent to an antibody. In another embodiment, more than one type of agent can be coupled to an antibody, regardless of the particular modality, immunoconjugates with More than one agent can be prepared in a variety of ways. For example, more than one agent can be directly coupled to an antibody molecule, or multiple site linkers can be used for binding. Alternatively, you can use a vehicle. A vehicle can carry agents in a variety of ways, including covalent attachment either directly or through a linker group. Suitable vehicles include protein such as albumins (e.g., U.S. Patent No. 4,507,234 to Kato et al.), peptides and polysaccharides such as aminodextran (e.g., U.S. Patent No. 4,699,784 to Shih et al.). A vehicle can also carry an agent through non-covalent attachment or through encapsulation, such as within a liposome vesicle (eg, U.S. Patent Nos. 4,429,008 and 4,873,088). The specific vehicles for radionuclide agents include small molecules radiohalogenated chelating compounds. For example, the patent of E. U. A. No. 4,735,792 discloses representative radiohalogenated small molecules and their synthesis. A radionuclide chelator can be formed from chelating compounds that include those that contain nitrogen and sulfur atoms as the donor atoms for the binding of metal, or metal oxide, radionuclide. For example, the patent of E. U. A. No. 4,673,562, Davison et al. Describes chelating compounds representative of their synthesis.

T Cell Compositions The present invention, in another aspect, provides cells specific for a polypeptide described herein, or for a variant derivative thereof. Said cells can generally be prepared in vitro or ex vivo, using standard procedures. For example, T cells from bone marrow, peripheral blood, or a fraction of bone marrow or peripheral blood can be isolated of a patient, using a commercially available cell separation system, such as the Isolex ™ system, available from Nexell Therapeutics, Inc. (Irvine, CA; also see U.S. Patent No. 5,240,856; U.S. Patent No. 5,215,926; W 89/06280, WO 91/16116 and WO 92/07243). Alternatively, T cells can be derived from mammalian cell lines or cultures that are non-human, or related or related humans. T cells can be stimulated as a polynucleotide polypeptide encoding a polypeptide and / or an antigen presenting cell (APC) expressing said polypeptide Said stimulation is carried out under conditions and for a sufficient time to allow the generation of T cells that are specific for the polypeptide of interest. Preferably, the tumor polypeptide or polynucleotide of the invention is present within a delivery vehicle, such as a microsphere, to facilitate the generation of specific T cells. T cells are considered to be specific for the polypeptide of the present invention if the T cells specifically prollferan, secrete cytokines or annihilate target cells coated with the polypeptide or expressing a gene encoding the polypeptide. The specific character of the T cell can be evaluated using any of a variety of standard techniques. For example within a chromium release assay or proliferation assay, a stimulation index of more than two times Increase in lysis and / or proliferation, compared to negative controls, indicates the specific character of the T cell. Said assays can be performed, for example, as described by Chen et al., Cancer Res. 54: 1065-1070, 1994. Alternatively, the detection of T cell proliferation can be achieved through a variety of known techniques. For example, T cell proliferation can be detected by measuring an increased rate of DNA synthesis (e.g., through cultures of T pulse labeling with titred thymidine and measuring the amount of titred thymidine incorporated in the DNA) . Contacting a tumor polypeptide (100 ng / ml - 100 μg / ml, preferably 200 ng / m - 25 μg / ml) for 3-7 days will typically result in a twofold increase in T cell proliferation. Contact as described above for 2-3 hours should result in the activation of T cells, as measured using cytosine assays where a two-fold increase in cytosine release level (eg, TNF or IFN- ?) is indicative of T cell activation (see, Coligan et al., Current Protocols and Immunology, vol.I, Wiley Interscience (Greene 1988)). Cells that have been activated in response to a polynucleotide tumor polypeptide or APC of polypeptide expression can be DC4 and / or CD8 +. Tumor polypeptide specific T cells can be expanded using standard techniques. Within preferred embodiments, the T cells are derived from a patient, a related donor or an unrelated donor, and are administered to the patient after stimulation and expansion. For therapeutic purposes, CD4 + or CD8 + T cells proliferate in response to a tumor polypeptide, APC polynucleotide can be expanded in a number either in vitro or in vivo. Proliferation of said T cells in vitro can be achieved in a variety of ways . For example, T cells can be re-exposed to a tumor polypeptide, or to a short peptide which corresponds to an immunogenic portion of said polypeptide, without the addition of T cell growth factors, such as interleukin-2, and / or stimulator cells that synthesize a tumor polypeptide. Alternatively, one or more T cells that proliferate in the presence of the tumor polypeptide may be expanded in number through cloning. Methods for cloning cells are well known in the art, and include limiting dilution.

Pharmaceutical Compositions In further embodiments, the present invention relates to formulations of one or more of the polypeptide, T cell and / or antibody polynucleotide compositions described herein, in pharmaceutically acceptable carriers for administration to an oau animal cell, either alone or in combination with one or more other modalities of therapy. It will be understood that, if desired, a composition as described herein can be administered in combination with another agents as well, such as, for example, other polypeptide proteins or various pharmaceutically active agents. In reality, there is virtually no limit to other components that may also be included, since the additional agents do not cause a significant adverse effect after contact with the target cells or host tissues. The compositions can thus be supplied together with several other agents as required at the particular time. Said compositions can be purified from host cells or other biological sources, or alternatively they can be chemically synthesized as described herein. Likewise, said compositions may further comprise derivatized substituted RNA or DNA compositions. Therefore, in another aspect of the present invention, they provide pharmaceutical compositions comprising one more of the polynucleotide, polypeptide, antibody and / or T cell compositions described herein, in combination with a physiologically acceptable carrier. In certain preferred modalities, the pharmaceutical compositions of the invention comprise immunogenic polynucleotide and / or polypeptide compositions of the invention for use in prophylactic therapeutic vaccine applications. The vaccine preparation is generally described in for example M. F. Powell and M. J. Newman, eds. , "Vaccine Design (th subunit and Adj uvant approach)", Plenium Press (NY, 1995). In general, such compositions will comprise one or more of the Jfc poly-nucleotide and / or polypeptide compositions of the present invention in combination with one or more immunostimulants. It will be apparent that any of the pharmaceutical compositions described herein may contain pharmaceutically acceptable salts of the polynucleotides and polypeptide of the invention. Said salts can be prepared, for example, from non-toxic pharmaceutically acceptable bases, including organic bases (for example, salts of primary amines, secondary tertiary and basic amino acids) and inorganic bases (e.g., sodium, potassium, lithium, ammonium salts). , calcium and magnesium). In another embodiment, exemplary immunogenic compositions, e.g., vaccine compositions, of the present invention comprise DNA encoding one or more of the polypeptides described above, such that the polypeptide is generated in situ. As noted above, the polynucleotide can be administered within any of a variety of delivery systems known to those skilled in the art. In fact, numerous gene delivery techniques are well known in the field, such as those described by Rolland, Crit. Rev. Therap. Drug Carrier Systems 1 5: 143-198, 1,998 references cited there. Suitable polynucleotide expression systems will, of course, contain the regulatory DNA regulatory sequences necessary for expression in a patient (such as a suitable promoter and termination signal). Alternatively, bacterial delivery systems can involve the administration of a bacterium (such as Bacillus-Calmette-Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface or secretes said epitope. Therefore, in certain embodiments, the polynucleotides encoding immunogenic polypeptides described herein are introduced into mammalian host cells suitable for expression, using any of a number of known viral base systems. In an illustrative embodiment, retroviruses provide a convenient and effective platform for gene delivery systems. A selected nucleotide sequence encoding a polypeptide of the present invention can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to a subject. A number of illustrative retroviral systems have been described (e.g., U.S. Patent No. 5,219,740; Miller and Rosman (1989) Bio Techniques 7: 980-990; Miller, AD (1990) Human Gene Therapy 1: 5-14; Scarpa et al. (1991) Virology 180: 849-852; Burns et al. (1993) Proc. Nati. Acad. Sci. USA 90: 8033-8037; and Boris-Lawrie and Temin (1993) Cur. Opin. Genet. 3: 102-109 In addition, a number of illustrative adenovirus-based systems have also been described.Unlike the retroviruses that integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis. Haj-Ahmad and Graham (1986) J. Virol. 57: 267-274; Bett et al. (1993) J. Virol. 67: 5911-5921; Mittereder et al. (1994) Human Gene Therapy 5: 717-729; Seth others (1994) J. Virol. 68: 933-940; Barr et al. (1994) Gene Therapy 1: 51-58; Berkner, K.L. (1988) BioTechniques 6: 616-629; and Rich others (1993) Human Gene Therapy 4: 461-476). Several vector systems of adeno-associated virus (AAV) have also been developed for polynucleotide delivery. AAV vectors can be easily constructed using techniques well known in the art. See, for example, patents of E. U. A. Nos. 5,173,414 and 5,139,941; International Publication Nos. WO 92/01070 and WO 93/03769; Lebkowski et al. (1988) Molec. Cell. Biol .. 8: 3988-3996; Vincent and others (1990) Bacines 90 (Cold Spring Harbor Laboratory Press); Carter, B. J. (1992) Current Opinion in Biotechnology 3: 533-539; Muzyczka, N. (1992) Current Topics in Microbiol. And Immunol. 158: 97-129; Kotin, R. M. (1994) Human Gene Therapy 5: 793-801; Sheliing and Smith (1994) Gene Therapy 1: 165-169; and Zhou et al. (1994) J. Exp. Med. 179: 1867-1875. Additional viral vectors for delivering the polynucleotides encoding polypeptides of the present invention through gene transfer include those derived from the rash virus family, such as bird virus and bird poxivirus. By way of example, vaccinia virus recombinants expressing the novel molecules can be constructed as follows. The DNA encoding a polypeptide is first inserted into an appropriate vector, so that it remains adjacent to a vaccine promoter and flanking vaccine DNA sequences, such as the sequence encoding thymidine kinase (TK). This vector is then used to transfect cells that are simultaneously infected with vaccine. The homologous recombination serves to insert the vaccine promoter plus the gene encoding the polypeptides of interest into the viral genome. The resulting recombinant, TK.sup - (-), can be selected by culturing the cells in the presence of 5-bromo deoxyuridine and collecting viral plaques resistant thereto. Conveniently, a vaccine-based infection / transfection system can be used to provide inducible, transient expression or co-expression of one or more polypeptides described herein in host cells of an organism. In this particular system, the cells are first infected in vitro with a vaccine virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase presents the specific character exq uisito since it only transcribes templates that carry T7 promoters. After infection, the cells are transfected with the polynucleotide or polynucleotides of interest, activated by a T7 promoter. The polymer expressed in the cytoplasm of recombinant vaccinia virus transcribes the transfected DNA to the RNA, which is then translated into the polypeptide through the host translation machine. The method provides transient, high-level clitoplasmic production of large quantities of RNA and its products of translation, see, for example, Elroy-Stein and Moss, Proc. Nati Acad. Sci. USA (1990 87: 6743-6747; Fuerst et al., Proc. Nati. Acad. Sci. USA (1986) 83: 8122-8126.Alternatively, bird oxiviruses, such as poultry and canary viruses. can also be used to supply the coding sequences of interest.Drug recombinant oxiviruses, which express immunogens of mammalian pathogens, are known to confer protective immunity when administered to non-bird species. Bird epoxiviruses are particularly desirable in humans and other mammalian species, since members of the bird poxivirus genus can only replicate productively in susceptible bird species and thus do not infect mammalian cells. Recombinant bird poxivirus are known in the art and employ genetic recombination, as described above with respect to the production of vaccinia virus See, for example, WO 91/12882; WO 89/03429 and WO 92/03545. Any number of alphavirus vectors can also be used to deliver the polynucleotide compositions of the present invention, such as those vectors described in the patents of E. U. A. Nos. 5,843,723; 6,015,686; 6,008,035 6,015,694. Certain vectors based on Venezuelan equine encephalitis (VEE) can also be used, examples of which can be found in the patents of E. U. A. Nos. 5,505,947 5,643,576. In addition, molecular conjugate vectors, such as the adenovirus chimeric vectors described by Michael et al., J. Biol. Chem. (1993) 268: 6866-6869 and Wagner et al., Proc. Nati Acad. Sci. USA (1992) 89: 6099-6103, for the delivery of gene according to the invention. Further illustrative information on these and other known viral base delivery systems can be found in, for example, Fisher-Hoch et al., Proc. Nati Acad. Sci. USA 86: 317-321, 1989; Flexner and others, Ann. N. Y. Acad. Sci. 569: 86-103, 1989; Flexner et al., Vaccine 8: 17-21, 1996; U.A.A. Nos. 4,603,112, 4,769,330 and 5,017,487; WO 89/01973; U.A. Patent No. 4,777,127; GB 2,200,651; EP 0,345,242; WO 91/02805; Berkner, Biotechniques 6: 616-627, 1988; Rosenfield et al., Science 252: 431-434, 1991; Kolls et al., Proc. Nati Acad. Sci. USA 91: 215-219, 1994; Kass-Eisler et al., Proc. Nati Acad. Sci. USA 90: 11498-11502, 1993; Guzman et al., Circulation 88: 2838-2848, 1993; and Guzmán et al., Cir. Res. 73: 1202-1207, 1993. In certain embodiments, a polynucleotide can be integrated into the genome of a target cell. This integration can be in a specific site and orientation through homologous recombination (gene replacement), or it can be integrated in a random, non-specific site (gene increase). In yet other embodiments, the polynucleotide can be stably maintained in the cell as an episomal segment, separated from DNA. These segments of polynucleotide or "episome" encode sequences sufficient to allow maintenance and replication independent of or in synchronization with the host cell cycle. The manner in which the expression construct is delivered to a cell and when the polynucleotide remains in the cell depends on the type of expression construct employed. In another embodiment of the invention, a polynucleotide is administered / delivered as "naked" DNA, for example, as described by Ulmer et al., Science 259: 1745-1794, 1993, and reviewed by Cohen, Science 259: 1691-1692 , 1993. The absorption of naked DNA can be increased by covering the DNA on biodegradable beads, which are efficiently transported to the cells. In still another embodiment, a composition of the present invention can be delivered through a particle bombardment aspect, much of which has been described. In an illustrative example, acceleration of gas-driven particle can be achieved with devices such as those manufactured by Powderject Pharmaceuticals PLC (Oxford, UK) and Powderject Bacines Inc. (Madison, Wl), some examples of which are described in the patents of US Nos. 5,846,796; 6,010,478; 5,865,796; 5,584,807; and EP Patent No. 0500799. This aspect offers a needle free delivery aspect, wherein a dry powder formulation of microscopic particles, such as polynucleotide or polypeptide particles, is accelerated at high speed within a jet of helium gas generated by a hand-held device, which emits the particles towards a target tissue of interest. In a related embodiment, other devices and methods that may be useful for injection without gas-operated needle of the compositions of the present invention include those provided by Bioject, Inc. (Portland, OR), some examples of which are described in U.S. Patent Nos. 4,790,824; 5,064,413; 5,312,335; 5,383,851; 5,399,163; 5,520,299, and 5,993,412). According to another embodiment, the pharmaceutical compositions described herein will comprise one or more immunostimulants in addition to the immunogenic polynucleotide, polypeptide, antibody, T cell and / or APC compositions of this invention. An immunostimulant refers essentially to any substance that enhances or potentiates an immune response (mediated by antibody and / or cell) to an exogenous antigen. A preferred type of immunostimulant comprises an auxiliary. Many auxiliaries contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a stimulant of immune responses. Such as lipid A, proteins derived from Bortadella pertussis or Mycobacterium tuberculosis. Certain auxiliaries are commercially available, for example, as Incomplete Auxiliary and Freund's Complete Assistant (difco Laboratories, Detroit, Ml); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); AS-2 (SmithKine Beechman, Philadelphia, PA); aluminum salts such as gel aluminum hydroxide (alum) or aluminum phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated tyrosine acylated sugars; cationic or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid and quil A. Cytokines, such as GM-CSF, interleukin-2, -7, -12 and other similar growth factors can also be used as adjuvants. Within certain embodiments of the invention, the adjuvant composition is preferably one that induces a predominantly Th1-type immune response. High levels of cytokines of the Th1 tip (eg, IFN- ?, TNFa, I L-2 and I L-12) tend to favor the induction of immune responses mediated by cell to a administered antigen. In contrast, high levels of Th-type cytokines (eg, IL-4, IL-5, IL-6 and IL-10) tend to favor the induction of moral immune responses. After the application of a vaccine as provided here, a patient will support an immune response that includes Th1 and Th2 type responses. In a preferred embodiment, wherein a predominantly Th1-type response, the level of Th1-type cytokines will increase to a degree greater than the level of Th-type cytokines. The levels of these cytokines can easily be determined using standard assays. For a review of the cytokine families, see Mosmann and Coffman, Ann. Rev. Immunol. 7: 145-17 1989. Certain preferred auxiliaries to produce a response predominantly of the Th 1 type include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid, together with an aluminum salt. MPL® auxiliaries are available from Corixa Corporation (Seattl WA, see, for example, U.A.A. Nos. 4,436.72 4,877.61 1; 4,866,034 and 4,912,094 patents). Oligonucleotides containing CpG (where the CpG dinucleotide is not methylated) also induce a predominantly Th 1 type response. Such oligonucleotides are well known and are described in, eg, WO 96/02555, WO 99/33488 and US Pat. 6,008,200 and 5,856,462 Immunostimulatory DNA sequences are also described by, for example, Sato et al., Scienc 273: 352, 1996. Another preferred aid comprises a saponin, t as Quil A, or its derivatives, including QS21 and QS7 (Aquil Biopharmaceuticals Inc., Framingham, MA), saponins, digitonin, Gypsophila or Chenopodirum quinoa Other preferred formulations include more than one saponin in the auxiliary combinations of the present invention, for example, combinations of at least t of the following group comprising QS21 , QS7, Quil A, β-escin, digitonin Alternatively, saponin formulations can be combined with vaccine carriers composed of chitosan or other polymers. olicathionic, particles of polylactide and polylactide-c-glycolide, polymer matrix based on poly-N-acetylglucosamin Particles composed of polsaccharides or polysaccharide chemically modified, liposomes and particles based on lipid particles composed of glycerol monoesters, etc. Saponins can also be formulated in the presence of cholester to form particulate structures such as ISCOMs liposomes. In addition, the saponins can be formulated together with a polyoxyethylene ether or ester, either in a solution that is not in particles or in suspension, or in a particulate structure such as a pocilaminar liposome or ISCO. Saponins can also be formulated with excipients such as Carbopol® to increase the viscosity, or can be formulated in a dry powder form with a polyacrylic excipient such as lactose. In a preferred embodiment, the auxiliary system includes a combination of a lipid A monophosphorium and a saponin derivative, such as the combination of QS21 and the auxiliary 3D MPL as described in WO 94/00153, or a reactogenic composition, wherein QS21 is quenched with cholesterol, as described in WO 96/33739. Other preferred formulations comprise an oil in water emulsion and tocopherol. Another particularly preferred auxiliary formulation employing QS21, auxiliary 3D-MPL® and tocopherol in an oil-in-water emulsion described in WO 95/17210. Another improved helper system involves the combination of oligonucleotide containing CPG and a saponi derivative particularly the combination of CPG and QS21 is described in 00/091 59. Preferably, the formulation further comprises an oil in water emulsion and tocopherol. Additional exemplary auxiliaries for use in the pharmaceutical compositions of the invention include Montanide IS 720 (Seppic, France), SAF (Chiron, California, United States ISCO MS (CS L), MF-59 (Chiron), the SBAS series of auxiliaries (eg, SBAS-2 or SBAS-4, available from Smith KIine Beecha Rixensart, Belgium), Detox (In hanzyn®; Corixa, Hamilton, MT), R 529 (Corixa, Hamilton, MT) and other 4-phosphate aminoalkyl glucosamin ida (AG Ps), such as those described in the patent application of US Pat. No. Pending Series No. 08/853, 826 and 09 / 074,720, the descriptions of which are incorporated herein by reference. in its entirety, and polyoexethylene ether auxiliaries such as those described in WO 99/52549 A. Other preferred auxiliaries include auxiliary molecules of the general formula: (1): HO (CH2CH2O) nAR, wherein, n is 1-50, A is a bond or -C (O) -, R is alkyl of 1 to 5 carbon atoms or phenalkyl of 1 to 50 carbon atoms One embodiment of the present invention consists of a vaccine formulation comprising a polyoxyethylene ether of the general formula (I), wherein n is between 1 and 50, preferably 4-24, m and p, preferably 9; and the R component is alkyl of 1 to 5 carbon atoms, preferably 4 to 20 carbon atoms, most preferably alkyl of 12 carbon atoms, and A is link. The concentration of polyoxyethylene esters should be on the scale of 0.1-20%, preferably 0.1-10% and most preferably on the 0.1-1% scale. The preferred polyoxyethylene ethers are selected from the following group: polyoxyethylene-9-lauryl ether polyoxyethylene-9-steroyl ether, polyoxyethylene-8-steroyl ether, polyoxyethylene 4-lauryl ether, polyoxyethylene-35-lauryl ether and polyoxyethylene-23-lauryl ether Polyoxyethylene ethers such as polyoxyethylene lauryl ether described in the Merck index (12th edition: entry 7717). These auxiliary molecules are described in WO 99/52549. The polyoxyethylether according to the general formula (I) above, if desired, can be combined with another auxiliary. For example, a referred auxiliary combination d is preferably with CPG as described in the pending UK patent application GB 9820956.2. According to another embodiment of this invention, an immunogenic composition described herein is supplied to the host via antigen presenting cells (APCs such as dendritic cells, macrophages, B cells, monocytes, other cells that can be engineered to be APC). These cells can, but do not need to be genetically modified to increase the capacity for the presentation of the antigen, to improve the activation and / or maintenance of the T cell, to have anti-tumor effects per se and / or to be immunologically compatible with the receptor (it is say, haploid H LA coincident tip.) APCs cells can usually be isolated from any of a variety of fluids and organ biological, including tumoral and peritumoral tissues, and can be autologous, halogenic, syngeneic or xenogeneic cells. Certain preferred embodiments of the present invention use dendritic cells or progenitors thereof with antigen-presenting cells. Dendritic cells are highly potent APC (Banchereau and Steinman, Nature 392: 245-251 1998) and have been shown to be effective as a physiological aid to produce prophylactic or therapeutic antitumor immunity (see Timmerman and Levy, Ann. Rev. Med. 50- 507-529, 1999). In general, dendritic cells can be identified based on their typical form (in situ estelato, marked cytoplasmic processes (dendrite) visible in vitro), their ability to absorb, process antigens with high efficiency and their ability to activate T cell responses. natural. Dendritic cells, of course, can be engineered to express specific cell surface receptors or ligands that are not commonly found on dendritic cells in vivo or ex vivo, said modified dendritic cells are contemplated by the present invention. As an alternative dendritic cell, s can use dendritic cells loaded with secreted vesicle antigen (termed exosomes) within a vaccine (see Zitvogel et al., Nature Med. 4: 594-600, 1998). progenitors can be obtained from peripheral blood, bone marrow, infiltration cells from tumor cells peritumoral infiltration, lymph nodes spleen, skin, umbilicaj cord blood, or any other suitable fluid tissue. For example, dendritic cells can be differentiated by adding a combination of cytokines such as GM-CSF, IL-4, I L-13 and / or TNFa to cultured monocyte cultures of peripheral blood. Alternatively, CD34 positive cells harvested from peripheral blood, umbilical cord blood or bone marrow can be differentiated into dendritic cells by adding GM-CSF, IL-3, TNFa, CD40 ligand, LPS, ligand flt3 to the culture medium combinations. and / or other compounds that induce differentiation, maturation and proliferation of dendritic cells. Dendritic cells are conveniently characterized as "immature" and "mature" cells, which allow a simple way to discriminate between two well-characterized phenotypes. However, this nomenclature should not be constructed to exclude all possible intermediate stages of differentiation. Immature dendritic cells are characterized as APC with high capacit for antigen absorption and processing, which correlates with high expression of Fc receptor? and receiver of crafty. Mature phenoti is typically characterized by low expression of these markers, but high expression of cell surface molecules responsible for T cell activation, such as MHC class I and class II, adhesion molecules (eg, CD54 and CD 1 and costimulatory molecules (for example, CD40, CD80, CD86 and 1 BB).

APCs cells can generally be transfected with a polynucleotide of the invention (or portion or variant thereof) so that the encoded polypeptide, or an immunogenic portion thereof, is expressed on the surface of the cell. Dich transfection may be present ex vivo, and a pharmaceutical composition comprising said transfected cells may then be used for therapeutic purposes, as described herein. Alternatively, a gene delivery vehicle that activates a dendritic cell or other antigen-presenting cell can be administered to a patient, resulting in transfection occurring in vivo. In vivo and ex vivo dendritic cell transfection, for example, can generally be performed using any of the methods known in the art, such as those described in WO 97/24447, or the ge gun appearance described by Mahvi et al. Immunology and cell Biology 75: 456-46 1997. Antigen loading of dendritic cells can be achieved by incubating dendritic cells or progenitor cells with tumor polypeptide, AD N (naked or within a plasmid vector) or RNA; or with recombinant antigen-expressing bacteria or viruses (e.g., vaccine, adenovirus or lentivirus virus vectors). Prior to loading, the polypeptide can be covalently conjugated to an immunological pattern that provides T cell aids (eg, a carrier molecule Alternatively, a dendritic cell can be pulsed with an unconjugated immunological standard, separately or in presence of polypeptide. Although any suitable vehicle known to those skilled in the art can be employed in the pharmaceutical compositions of this invention, the type of vehicle will typically vary depending on the mode of administration. The compositions of the present invention can be formulated for any suitable form of administration, including, for example, topical, oral, nasal, mucosal, intravenous, intracranial, subcutaneous and intramuscular administration. The vehicles for use within said pharmaceutical compositions are biocompatible and are also biodegradable. In certain embodiments, the formulation preferably provides a relatively constant level of active component release. In other embodiments, however, a rapid rate of release m may be desired immediately after administration. The formulation of such compositions is within the level of ordinary skill in the art using known techniques. Illustrative carriers useful in this regard include poly (lactide-co-glycolide) microparticle, polyacrylate, latex, starch, dextran cells, and the like. Other illustrative delayed release vehicles include supramolecular biovectors, which comprise a non-liquid hydrophilic nucleus (e.g., entangled polysaccharide or oligosaccharide) and, optionally, an outer cation comprising an amphiphilic compound, such as phospholipid (see , for example, patent of E. U.A. No. 5, 151, 254 PCT applications WO 94/20078, WO 94/23701 and WO 96/06638). The amount of active compound contained within a sustained release formulation depends on the site of implantation, the expected rate and duration of release, and the nature of the condition that will be treated or avoided. In another illustrative embodiment, biodegradable microspheres (eg, polylactate polyglycolate) are used as carriers for the compositions of this invention. Suitable biodegradable microspheres are described, for example, in the patents of E. U. A. Nos. 4,897,268; 5,075.10 5,928,647; 5,811,128; 5,820,883; 5,853,763, 5,814,344, 5,407,609 5,942,252. For many applications, modified hepatitis core protein vehicle systems as described in WO 99/40934, and references cited therein will also be useful. Another illustrative vehicle / delivery system employs a vehicle comprising protein-particle complexes, such as those described in the patent of US Pat. No. 5,928,647, which are capable of inducing a restricted cytotoxic T lymphocyte T-type I response in a host. The pharmaceutical compositions of the invention will generally also comprise one or more pH regulators (for example salt buffered at its neutral pH or salt regulated at its pH c phosphate), carbohydrates (e.g. glucose, mannose, sucrose dextran). , mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bacteriostats, chelating agents such as EDTA or glutathione, auxiliaries (for example, aluminum hydroxide), solutes which render the formulation isotonic or hypotonic isotonic with the blood of a receptor suspension agents, thickening agents and / or preservative Alternatively, the compositions herein invention can be formulated as a lyophilisate. The pharmaceutical compositions described herein can be present in single dose or multiple dose containers, such as sealed vials or vials. Said containers are typically sealed in such a way as to preserve the sterility and stability of the formulation until use. In general, the formulations can be stored as suspensions, solutions or emulsions and oily or aqueous vehicles. Alternatively, a pharmaceutical composition can be stored in a freeze-dried condition that requires only the addition of a sterile liquid vehicle immediately before use. The development of suitable treatment dosage regimens for using the particular compositions described aq in a variety of treatment regimens, including, for example, parenteral administration and formulation, intranasal intranasal and intramuscular, is well known in the art, some of which are briefly discussed below for general purposes of illustration. In certain applications, the pharmaceutical compositions described herein may be delivered through administration. oral to an animal. As such, these compositions can be formulated with an inert diluent or with an assimilable comestible carrier, or they can be enclosed in a hard or soft protection gelatin capsule, or they can be compressed into tablets, they can be incorporated directly with the food of the diet.

The active compounds can also be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, t-bone capsules, capsules, iodides, suspensions, syrups, wafer and the like (see, for example, Mathiowitz et al., Nature 1997, Mar 27; 386 (6623): 410-4; Hwang et al., Crit Rev Ther Drug Carrier Si 1998; 15 (3): 243-84; US Patent 5,641,515; EA Patent 5,580,579 and US Patent 5,792,451; The troches, pills, capsules and the like may also contain any of a variety of additional components, for example, a binder, such as tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate, a disintegrating agent such as corn starch, potato starch, algic acid and the like; a lubricant, such as magnesium stearate; a sweetening agent, such as sucrose, lactose, saccharin may add, or a flavoring agent such as peppermint, peppermint oil, or cherry flavor. When the dosage unit form is a capsule, it may contain, in addition to the previously illustrated material, a liquid carrier. Various other material may be present as coatings or otherwise modify the physical form of the unit dose. For example, tablets, pills Capsules can be covered with shellac, sugar or both. Of course, any material used to prepare any dose unit must be pharmaceutically pure and substantially non-toxic in the amounts used. In addition, the active compounds can be incorporated into the preparation and sustained release formulations. Typically, these formulations will contain at least about 0.1% active compound or more, although the percentage of the active ingredient (s), of course, can be varied conveniently from about 1 or 2% about 60% or 70% or more of the weight or volume of the total formulation. Naturally, the amount of the active compound (in each therapeutically useful composition can be prepared so that an adequate dose will be obtained in any given dosage unit of the compound.) Factors such as solubilized bioavailability, biological half-life, route of administration, product storage vine, as well as other pharmacological considerations will be contemplated by a person skilled in the art when preparing said pharmaceutical formulations, and as such, a variety of dosage and treatment regimens may be desired. . For oral administration, the compositions of the present invention may alternatively be incorporated with one or more excipients in the form of a mouth rinse, dentifrice, oral tablet, oral spray, or orally administered sublingual formulation. Alternatively, the active ingredient may s incorporated in an oral solution such as one containing sodium borat, glycerin and potassium bicarbonate, or dispersed in toothpaste, or adding in a therapeutically effective amount a composition which may include water, binders, abrasive 5 flavoring agents, foaming agents and humectant Alternatively, the compositions can be designed to a tablet or form of solution that can be placed under the tongue • otherwise dissolve in the mouth. In certain circumstances, it will be desirable to supply 10 pharmaceutical compositions described herein in parenteral form intravenously, intramuscularly or even intraperitoneally. Dich aspects are well known to those experts in the technical • Some aspects are also described in, for example, patent E.U.A. 5,543, 158; patent of E. U.A. 5,641, 515 and U.S. Patent 15 5,399,363. In certain embodiments, solutions of the active compounds can be prepared as a free base or pharmacologically acceptable salt in water conveniently mixed with a surfactant such as hydroxypropylcelluloses. Dispersions can also be prepared in glycerol, glycol 20 polyethylene liquids, and mixtures thereof and in oils. In ordinary conditions of storage and use, these preparations will generally contain a preservative to prevent the growth of microorganisms. The illustrative pharmaceutical forms suitable for a 25 injectable include sterile aqueous solutions or dispersions sterile powders for the extemporaneous preparation of sterile injectable dispersion solutions (see, for example, U.S. Patent No. 5,466,468). In all cases, the form must be sterile and must be fluid to the extent that there is an easy ability to place the syringe. It must be stable under storage manufacturing conditions and must be preserved against the action of micro-organisms, such as bacteria and fungi. The vehicle may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example , propylene glycol glycol and liquid polyethylene glycol, and the like), their suitable mixtures, and / or vegetable oils. An appropriate fluidity can be maintained, for example, through the use of a coating, such as lecithin, through the maintenance of the required particle size in the case of dispersion and / or through the use of surfactants. The prevention of the action of microorganisms can be facilitated through various antibacterial and antifungal agents, for example, parabens, chlorobutanol phenol, sorbic acid, thimerosal and the like. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chlorur. The prolonged action of the injectable compositions can be produced through the use in the compositions of delaying absorption agents, for example, aluminum monostearate and gelatin. In one embodiment, for parenteral administration in an aqueous solution, the solution should be suitably regulated and its pH if necessary and the liquid diluent must first become isotonic with enough saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, a sterile aqueous medium that can be employed will be known to those skilled in the art in view of the present disclosure. For example, a dose can be dissolved in 1 ml of an isotonic NaCl solution and added to either 1000 ml of fluid hypodermoclysis or injected into the proposed infusion site (see for example, "Remington's Pharmaceutical Sciences", 15th edition pages 1035- 1038 and 1570-1580). Some variation in the dose will necessarily occur depending on the condition of the subject being treated. In addition, for administration to humans, the preparations of course, will preferably satisfy the sterility, pyrogenicity and general safety and purity standards as required by the standards of the FDA biologists office. In another modality of the invention, the compositions described herein can be formulated in a neutral or salt form. Illustrative pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with non-organic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, oxalic , tartaric, mandélico and similar. The salts formed with the free carboxyl groups can also be derived of inorganic bases such as, for example, sodium, potassium ammonium, calcium, or ferric hydroxides, and organic bases such as isopropylamine, trimethylamine, histidine, procaine and the like. After the formulation, the solutions will be administered in a manner compatible with the formulation of dose and in such a quantity that they are therapeutically effective. The vehicles may further comprise any and all solvents, dispersion media, vehicles, extender coatings, antibacterial and antifungal agents, isotonic and absorption delay agent, pH regulators, vehicle solutions, suspensions, colloids, and the like. The use of said means and agents for pharmaceutical active substances is well known in the art. Except for any conventional agent medium that is compatible with the active ingredient, use in the therapeutic compositions is contemplated. They also incorporate supplemental active ingredients into the compositions. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce a desired allergic or similar reaction when administered to a human. In certain embodiments, the pharmaceutical compositions may be delivered through inhalation intranasal sprays and / or other aerosol delivery vehicles. The method for delivering gels, nucleic acids and peptide compositions directly to the lungs through aerosol sprays - 171 have been described in, for example, the patent of E. U.A. No. 5,756,353 and the U.A. No. 5,804,212. Also, drug delivery using intranasal microparticle resins (Takenaga et al., J. Controlled Release 1998 March 2 5 52 (1-2): 81 -7) and lysophosphatidyl-glycerol compound (US patent No. 5,725,871) also they are well known in the pharmaceutical industry. Also, the illustrative transmucosal drug supply in the form of a polytetrafluoroethylene support matrix is described in the U.A. Do not 10 5,780,045. In certain embodiments, liposomes, nanocapsules, microparticles, lipid particles, vesicles and the like are used for the introduction of the compositions of the present invention into suitable host / organism cells. In particular, the 15 compositions of the present invention can be formulated by delivery already encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like. Alternatively, the compositions of the present invention can be linked, either covalently or non-covalently, to the surface of 20 said carrier vehicles. The formation and use of liposomes and liposome-like preparations as potential drug carriers is generally known to those skilled in the art (see, for example, Lasic, Biotechnology Trains, July 1998; 16 (6): 307-21; Takakura, 25 Nippon Tinsho, March 1998; 56 (3): 691 -5; Chandran and others, Indian J. Exp. Biol., August 1997; 35 (8): 801 -9; Margalit, Crit. Rev. Ther. Drug Carrier Syst. nineteen ninety five; 12 (2-3): 233-61; patent of E.U.A. No. 5,567,434; patent of E. U.A. No. 5,552, 157; patent of E. U.A. No. 5,565,213; patent of E.U.A. No. 5,738,868 and US patent. No. 5,795,587, each specifically incorporated herein by reference in its entirety). Liposomes have been used successfully with a number of cell types that are normally difficult to transfect through other methods, including T cell suspensions, primary hepatocyte culture and PC 12 cells (Renneisen et al., J. Biol. Chem. September 1990, 25; 265 (27): 16337-42; Muller et al., DNA Cell Biol. April 1990; 9 (3): 221 -9). In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, various drugs, radiotherapeutic agents, enzymes, viruses, transcription factors, alloestheric effectors and the like, in a variety of cultured cell lines and animals. In addition, the use of liposomes does not appear to be associated with autoimmune response or unacceptable toxicity after systemic delivery. In certain embodiments, liposomes are formed from phospholipids which are dispersed in an aqueous medium and spontaneously form double-layered concentric multilamellar vesicles (also called multilamellar vesicles (MLVs).

Alternatively, in other embodiments, the invention provides pharmaceutically acceptable nanocapsule formulations of the compositions of the present invention. Nanocapsules can generally trap compounds in a stable and reproducible form (see, for example, Quintanar-Guerrero et al., Drug Dev. Ind. Pharm., December 1998; 24 (12): 1 1 13-28). To avoid side effects due to intracellular polymer overload, said ultrafine particles (size around 0.1 μm) can be designed using polymer capable of being degraded in vivo. Said particles can be made as described, for example, by Couvreur et al., Crit. Rev. Ther. Drug. Carrier Syst. 1988; 5 (1): 1 -20; zur Muhlen et al., Eur. J. Pharm. Biopharm. March 1998; 45 (2): 149-55; Zambux et al., J. Controlled Reeléase, January 2, 1998; 50 (1 -3); 31 -40; and patent of E.U.A. No. 5, 145,684.

Therapeutic Methods for Cancer In other aspects of the present invention, the pharmaceutical compositions described herein can be used for the treatment of cancer, in particular for the immunotherapy of prostate cancer. Within such methods, the pharmaceutical compositions described herein are administered to a patient, typically a warm-blooded animal, preferably a human being. A patient may or may not be suffering from cancer. Accordingly, the above pharmaceutical compositions can be used to prevent the development of a cancer or to treat a patient with cancer. The pharmaceutical compositions and vaccines can be administered either before or after surgical removal of primary tumors and / or treatment such as administration of radiotherapy or conventional chemotherapeutic drugs. As discussed above, the administration of the pharmaceutical compositions can be by any suitable method, including administration via intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, intradermal, anal, vaginal, topical and other oral routes. Within certain embodiments, immunotherapy can be active immunotherapy, wherein the treatment is based on in vivo stimulation of the endogenous host immune system to react against tumors with the administration of immune response modifying agents (such as polypeptides and polynucleotides as provided). here). Within other modalities, immunotherapy can be passive immunotherapy, where the treatment involves the supply of agents with established immune reactivity to the tumor (such as cells and effector antibodies) that can directly or indirectly mediate the antitumor effects and do not necessarily depend on a intact host immune system. Examples of effector cells include T cells as described above, T lymphocytes (such as CD8 + cytotoxic T lymphocytes and T CD4 + helper tumor infiltration lymphocytes), killer cells (such as cells natural killers and killer cells activated by lysophosin), B cells and antigen-presenting cells (such as dendritic cells and macrophages) that express a polypeptide provided herein. The T cell receptors and antibody receptors specific for the polypeptides presented herein can be cloned, expressed and transferred to other vectors or cells for adoption immunotherapy. The polypeptides provided herein may also be used to generate antibodies, or anti-idiotypic antibodies (as described above and in U.S. Patent No. 4,918,164) for passive immunotherapy. Effector cells can generally be obtained in sufficient amounts for adoption immunotherapy through in vivo growth, as described herein. Culture conditions for expanding individual antigen-specific effector cells to several thousand billions in number with the retention of antigen recognition in vivo are well known in the art. Such in vitro culture conditions typically use intermittent stimulation with antigen, usually in the presence of cytosines (such as I L-2) and feeder cells that are not dividing. As noted above, the immunoreactive polypeptides as provided herein, can be used to rapidly expand antigen-specific T cell cultures in order to generate a sufficient number of cells for immunotherapy. In particular, the antigen-presenting cells, such as dendritic cells, macrophage, monocyte, fibroblasts and / or B cells can be pulsed with immunoreactive polypeptides or transfected with one or more polynucleotides using standard techniques well known in the art. For example, antigen-presenting cells can be transfected with a polynucleotide having an appropriate promoter to increase expression in a recombinant virus or other expression system. Effector cells cultured for use in therapy must be able to grow and widely distribute, and survive long-term in vivo. Studies have shown that cultured effector cells can be induced to grow in vivo and survive long-term in substantial numbers through repeated stimulation with antigen supplemented with IL-2 (see, for example, Cheever et al., Immunological Reviews 157: 177, 1997). Alternatively, a vector expressing a polypeptide presented herein can be introduced into the antigen-presenting cells taken from a patient and clonally propagated ex vivo for transplantation to the same patient. The transfected cells can be reintroduced to the patient using any means known in the art, preferably in sterile form via intravenous, intracavity, intraperitoneal or intratumoral administration. The routes and frequencies of administrations of the compositions described herein, as well as the dosage will vary from individual to individual, and can be easily established using standard techniques. In general, the pharmaceutical compositions and vaccines can be administered by injection (eg, intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (eg, by aspiration or orally). Preferably, between 1 and 10 doses may be administered over a period of 52 weeks. Preferably, 6 doses are administered, at intervals of one month and booster vaccinations are periodically provided. Alternative protocols for individual patients may be appropriate. A suitable dose is an amount of a compound which, when administered as described above, is capable of promoting an antitumor immune response and is at least 10-50% above the basal level (ie, untreated). Said response can be verified by measuring antitumor antibodies in a patient or through vaccine-dependent generation of cytolytic effector cells capable of killing tumor cells of the patient in vitro. Such vaccines should also be able to elicit an immune response that leads to an improved clinical outcome (eg, more frequent remissions, complete or partial or longer disease-free survival) in vaccinated patients, as compared to unvaccinated patients. In general, for pharmaceutical compositions and vaccines comprising one or more polypeptides the amount of each polypeptide present in a dose, ranges from about 25 μg to 5 mg per kg of the host. The appropriate dose sizes will vary with the size of the patient, but will typically be on the scale of approximately 0.1 ml a approximately 5 ml. In general, an appropriate dose and treatment regimen provide the active compound (s) in an amount sufficient to provide a therapeutic and / or prophylactic benefit. This response can be verified by establishing an improved clinical outcome (for example, more frequent remissions, complete or partial or longer disease-free survival) in treated patients, as compared to untreated patients. Increases in pre-existing immune responses to a tumor protein generally correlate with an improved clinical outcome. Said immune responses can generally be evaluated using standard proliferation, cytotoxicity or cytosine assays, which can be performed using a sample obtained from a patient before and after treatment.

Cancer Detection and Diagnostic Compositions. Methods and Methods In general, a cancer can be detected in a patient based on the presence of one or more prostate tumor proteins and / or polynucleotide encoding said proteins in a biological sample (e.g., blood, serum, sputum, urine). , and / or tumor biopsies) obtained from the patient. In other words, said proteins can be used as markers to indicate the presence or absence of a cancer, such as prostate cancer. In addition, said proteins may be useful for the detection of cancers The binding agents provided herein generally allow detection of the level of antigen that binds to the agent in the biological sample. Polynucleotide primers and probes can be used to detect the level of mRNA that encodes a tumor protein, which is also indicative of the presence or absence of a cancer. In general, a prostate tumor sequence must be present at a level that is at least three times higher in tumor tissue than in normal tissue. There are a variety of assay formats known to those skilled in the art for using a binding agent to detect polypeptide markers in a sample. See, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988. In general, the presence or absence of a cancer in a patient can be determined by (a) contacting a biological sample obtained from a patient with a binding agent; (b) detecting in the sample a level of polypeptide that binds to the binding agent; and (c) comparing the level of polypeptide with a predetermined cut-off value. In a preferred embodiment, the assay involves the use of the immobilized binding agent on a solid support to bind to and remove the polypeptide from the remainder of the sample. The bound polypeptide can then be detected using a detection reagent which contains a reporter group and specifically binds to the binding agent / polypeptide complex. Said detection reagents may, for example, comprise a binding agent which specifically binds to a polypeptide or an antibody or other agent that specifically binds to the binding agent, such as an anti-immunoglobulin, protein G, protein A or a lectin. Alternatively, a competitive assay may be used, wherein a polypeptide is labeled with a reporter group and allowed to bind to the immobilized binding agent after incubation of the binding agent in the sample. The degree to which the components of the sample inhibit the binding of the labeled polypeptide to the binding agent is indicative of the reactivity of the sample with the immobilized binding agent. Suitable polypeptides for use within such assays include full length prostate tumor proteins and polypeptide portions thereof where the binding agent binds, as described above. The solid support can be any material known to those skilled in the art to which the tumor protein can be attached. For example, the solid support can be a test cavity in a microtiter plate or a nitrocellulose membrane or any other suitable membrane. Alternatively, the support may be a bead or a disc, such as glass, fiberglass, latex, or a plastic material such as polystyrene or polyvinyl chloride. The support can also be a magnetic particle or a fiber optic sensor, such as those described in, for example, U.A. No. 5,359,681. The binding agent can be immobilized on the solid support using a variety of techniques known to those skilled in the art, which They are widely described in the patent and scientific literature. In the context of the present invention, the term "immobilization" refers to both non-covalent association, such as adsorption, such as covalent binding (which may be a direct bond between the agent and the functional group on the support or may be a bond as an entanglement agent). Immobilization by adsorption to a cavity in a microtiter plate or to a membrane is preferred. In such cases, the adsorption can be achieved through the contact of the binding agent, in a suitable pH regulator, with the solid support for an adequate amount of time. The contact time varies with temperature, but is typically between about 1 and about 1 day. In general, when contacting a cavity of a microtiter plate (such as polystyrene or polyvinyl chloride) with an amount of binding agent in the range of about 10 ng to about 10 μg, and preferably about 100 ng to about 1 μg, it is sufficient to immobilize an adequate amount of binding agent. The covalent attachment of the binding agent to a solid support can generally be achieved by first reacting the support with a bifunctional reagent which will react both with the support and with a functional group, such as a hydroxyl or amino group, in the binding agent. . For example, the binding agent may be covalently bound to the supports having an appropriate polymer coating using benzoquinone or through condensation of an aldehyde group in the support with an amine and an active hydrogen in the binding pattern (see, for example, Pierce Immunotechnology Catalog and Handbook, 1991, in A12-A13). In certain embodiments, in assay in a sandwich assay of two antibodies. This assay can be performed by first contacting an antibody that has been immobilized to a solid support, commonly the microtiter plate cavity, with the sample, such that the polypeptides within the sample can bind to the immobilized antibody. The unbound sample is then removed from the immobilized polypeptide-antibody complexes and a detection reagent (preferably a second antibody capable of binding to a different site on the polypeptide) containing a reporter group is added. The amount of detection reagent remaining attached to the solid support is then determined using a method appropriate to the specific report group. More specifically, once the antibody is immobilized on the support as described above, the remaining protein binding sites on the support are typically blocked. Any suitable blocking agent known to those skilled in the art, such as bovine serum albumin or Tween 20 ™ (Sigma Chemical Co., St. Louis, MO). The immobilized antibody is then incubated with the sample, and the polypeptide is allowed to bind to the body. The sample can be diluted with a suitable diluent such as saline regulated at its pH with phosphate (PBS) before incubation. In general, an appropriate contact time (i.e., incubation time) is a period of time that is sufficient to detect the presence of the polypeptide of a sample obtained from an individual with prostate cancer. Preferably, the contact time is sufficient to achieve a binding level that is at least about 95% of that achieved in equilibrium between the bound and unbound polypeptide. Those skilled in the art will recognize that the time necessary to achieve equilibrium can be easily determined by analyzing the level of binding that occurs over a period of time. At room temperature, an incubation time of approximately 30 minutes is generally sufficient. The unbound sample can then be removed by washing the solid support with an appropriate pH regulator, such as PBS containing 0.1% Tween 20 ™. The second antibody, which contains a report group, can then be added to the solid support. Preferred report groups include those presented above. The detection reagent is then incubated with the immobilized antibody-polypeptide complex for a sufficient amount of time to detect the bound polypeptide. Generally an appropriate amount of time can be determined by analyzing a level of binding that occurs over a period of time. Then, the unbound detection reagent is removed and the bound detection reagent is detected using the report group. He The method used to detect the report group depends on the nature of the report group. For reactive groups, scintillation or autoradiographic counting methods are generally appropriate. The spectroscopic methods can be used to detect dyes, luminescent groups and fluorescent groups. Biotin can be detected using avidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups can usually be detected through the addition of a substrate (usually for a specific period of time), followed by spectroscopic analysis or other analysis of reaction products. To determine the presence or absence of a cancer, such as prostate cancer, the signal detected from the report group that remains attached to the solid support is generally compared to a signal corresponding to a predetermined cutoff value. In a preferred embodiment, the cut-off value for the detection of a cancer is the average average signal obtained when the immobilized antibody is incubated with samples from cancer patients. In general, a sample that generates a signal that is three standard deviations above the predetermined cut-off value, is considered positive for cancer. In an alternative preferred embodiment, the cut-off value is determined using a Receiver Operator Curve, according to the method of Sackett et al., Clinical Epidemiology: A Basic Science for Clinical Medicine, Littie Brown and Co., 1985, p. 106-7. In summary, in this modality, the cut-off value can be determined from a graph of pairs of true positive regimes (that is, sensitivity) and false positive regimes (100% of specific character) that correspond to each possible cut-off value. for the result of the diagnostic test. The cutoff value on the graph that is closest to the upper left corner, (that is, the value that encloses the largest area) is the most accurate cutoff value, and a sample that generates a signal that is larger than The cut-off value determined by this method can be considered positive. Alternatively, the cut-off value can be shifted to the left along the graph, to minimize the false positive regime, or to the right, to minimize the false negative regime. In general, a sample that generates a signal is greater than the cutoff value determined by this method is considered positive for a cancer. In a related embodiment, the assay is performed in a flow or strip test format, wherein the binding agent is immobilized on a membrane, such as nitrocellulose. In the flow test, the polypeptides in the sample bind to the immobilized binding agent as the sample passes through the membrane. A second labeled binding agent is then attached to the polypeptide-binding agent complex as a solution containing the second binding agent that flows through the membrane. The detection of the second bound binding agent can be perform then as described above. In the strip test format, one end of the membrane to which the binding agent is attached is immersed in a solution containing the sample. The sample migrates along the membrane through the region containing the second binding agent and into the area of the immobilized binding agent. The concentration of the second binding agent in the area of the immobilized antibody indicates the presence of a cancer. Typically the concentration of the second binding agent in that site generates a pattern, such as a line, that can be read visually. The absence of such pattern indicates a negative result. In general, the amount of binding agent immobilized on the membrane is selected to generate a visually discernible pattern when the biological sample contains a level of polypeptide that could be sufficient to generate a positive signal in the sandwich assay of two antibodies, in the format discussed above. Preferred binding agents for use in such assays are antibodies and their antigen-binding fragments. Preferably, the amount of antibody immobilized on the membrane ranges from about 25 ng to about 1 μg, and most preferably from about 50 ng to about 500 ng. Such tests can typically be performed with a very small amount of biological sample.

Of course, there are numerous assay protocols that are suitable for use with the tumor proteins or binding agents of the present invention. The above descriptions are intended to be illustrative only. For example, it will be apparent to those skilled in the art that the above protocols can be readily modified to use tumor polypeptides to detect antibodies that bind to said polypeptides in a biological sample. The detection of said tumor protein-specific antibodies can be correlated with the presence of a cancer. A cancer also, or alternatively, can be detected based on the presence of T cells that specifically react with a tumor protein in a biological sample. Within certain methods a biological sample comprising CD4 + and / or CD8 + T cells isolated from a patient is incubated with a tumor polypeptide, a polynucleotide encoding said polypeptide and / or an APC cell that expresses at least an immunogenic portion of said polypeptide, and the presence or absence of specific activation of T cells is detected. Suitable biological samples include, but are not limited to, isolated T cells. For example, T cells can be isolated from a patient through routine techniques (such as through Ficoll / Hypaque density gradient centrifugation of peripheral blood lymphocytes). T cells can be incubated in vitro for 2-9 days (typically 4 days) at 37 ° C with polypeptide (e.g., 5-25 μg / ml). It may be desirable to incubate another aliquot of a T cell sample in the absence of a tumor polypeptide to serve as a control. For CD4 + T cells, activation it is preferably detected by evaluating the proliferation of T cells. For CD8 + T cells, activation is preferably detecting cytolytic activity. A level of proliferation that is at least twice as high as and / or a level of cytolytic activity that is at least 20% greater than in disease-free patients, indicates the presence of a cancer in the patient. As noted above, a cancer also, or alternatively, can be detected based on the level of mRNA encoding a tumor protein in a biological sample. For example, at least two oligonucleotide primers can be employed in a polymerase chain reaction (PCR) -based assay to amplify a protein from a tumor cDNA derived from a biological sample, wherein at least one of the primers of oligonucleotide is specific for "i.e., hybridizes to" a polynucleotide that encodes the tumor protein. The amplified cDNA is then separated and detected using techniques well known in the art, such as gel electrophoresis. Similarly, oligonucleotide probes that specifically hybridize to a polynucleotide encoding a tumor protein in a hybridization assay can be used to detect the presence of the polynucleotide encoding the tumor protein in a biological sample. To allow hybridization under test conditions, the oligonucleotide primers and probes must comprise a nucleotide oligonucleotide sequence that has at least about 60%, preferably at least about 75%, and most preferably at least about 90% identity with a portion of a polynucleotide encoding a tumor protein of the invention, which is at least 10 nucleotides, and preferably at least 20 nucleotides, in length. Preferably, the oligonucleotide primers and / or probes hybridize to a polynucleotide encoding a polypeptide described herein under moderately severe conditions, as defined above. Oligonucleotide primers and / or probes that can be usefully employed in the diagnostic methods described herein preferably have a length of at least 10-40 nucleotides. In a preferred embodiment, the oligonucleotide primers comprise at least 10 contiguous nucleotides, most preferably at least contiguous nucleotides, of a DNA molecule having a sequence as described herein. Techniques for both PCR-based assays and hybridization assays are well known in the art (see, for example, Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263, 1987; Erlich ed. , PCR Technology, Stockton Press, NY, 1989. A preferred assay employs RT-PCR, where PCR is applied in conjunction with reverse transcription, typically RNA is extracted from a biological sample, such as a tissue biopsy, and is reverse transcribed to produce DNA molecules, PCR amplification using at least one specific primer generates a cDNA molecule, which can be separated and visualized using, for example, gel electrophoresis. Amplification can be performed on biological samples taken from a patient's test, and from an individual who does not have cancer. The amplification reaction can be performed in several dilutions of cDNA extending to two orders of magnitude. An increase of double or greater in the expression in several dilutions of the patient's test sample as compared to the same dilutions of the non-cancerous sample is typically considered positive. In another embodiment, the compositions described herein can be used as markers for cancer progression. In this embodiment, assays as described above for the diagnosis of a cancer may be performed over time, and the change in the level of reactive polypeptide (s) or polynucleotide (s) is evaluated. For example, the tests can be performed every 24-72 hours for a period of 6 months to a year and then carried out as necessary. In general, a cancer is progressing in those patients where the level of polypeptide or nucleic acid detected increases with time. In contrast, cancer does not progress when the level of polypeptide or reactive polynucleotide, whether it remains constant or decreases with time. Certain in vivo diagnostic assays can be performed directly on a tumor. One of these trials involves putting in contact with tumor cells with a binding agent. The attached binding agent can then be detected directly or indirectly through a report group. Said binding agents can also be used in histological applications. Alternatively, polynucleotide probes can be used within said applications. As noted above, to improve sensitivity, multiple tumor protein markers can be analyzed within a given sample. It will be apparent that the specific binding agents for different proteins provided herein can be combined within a single assay. In addition, multiple initiators or probes can be used concurrently. The selection of tumor protein markers can be based on routine experiments determining combinations that result in optimal sensitivity. In addition, or alternatively, assays for tumor proteins provided herein can be combined with assays with other known tumor antigens. The present invention also provides equipment for use within any of the above diagnostic methods. Said kits typically comprise two or more components necessary to perform the diagnostic assay. The components can be compounds, reagents, containers and / or equipment. For example, a container within a kit may contain a monoclonal antibody or fragment thereof that specifically binds to a tumor protein. These antibodies or fragments may be provided attached to a support material, as described above. One or more additional containers can enclose elements, such as reagents or pH regulators will be used in the assay. Said equipment also, or alternatively, may contain a detection reagent as described above that contains a reportable group suitable for direct or indirect detection of the antibody binding. Alternatively, one can design and equipment to detect the level of mRNA encoding a tumor protein in a biological sample. Such kits generally comprise at least one oligonucleotide primer or probe, as described above, which hybridizes to a polynucleotide encoding a tumor protein. Said oligonucleotide can be used, for example, within a PCR or hybridization assay. Additional components that may be present within such kits include a second oligonucleotide and / or diagnostic reagent or container to facilitate the detection of a polynucleotide encoding a tumor protein. The following Examples are offered by way of illustration and not by way of limitation.

EXAMPLES EXAMPLE 1 ISOLATION AND CHARACTERIZATION OF POLIPEPTIDES PROSTATE SPECIFIC This Example describes the isolation of certain prostate-specific polypeptides from a collection of prostate tumor cDNAs. A collection of human prostate tumor cDNA expression was constructed from poly A + RNA of prostate tumor using a Superscript Plasmid System for cDNA Synthesis and the Plasmid Cloning kit (BRL Life Technologies, Gaithersburg, MD 20897) following the manufacturer's protocol. Specifically, the prostate tumor tissues were homogenized with a poltron (Kinematica, Switzerland) and the total RNA was extracted using the Trizol reagent (BRL Life Technologies) as directed by the manufacturer. The poly A + RNA was then purified using an oligotex spin column mRNA purification kit from Qiagen (Qiagen, Santa Clarita, CA 91355) according to the manufacturer's protocol. The primary chain structure cDNA was synthesized using the Notl / Oligo-dT18 primer. The double stranded structure cDNA was then synthesized, ligated with the EcoRI / BAXI adapters (I nvitrogen, San Diego, CA) and digested with Notl. After the size fractionation with columns of Chroma Spin-1000 (Clontech, Palo Alto, CA), the cDNA was ligated to the EcoRI / Notl site of pCDNA3.1 (nvitrogen) and transformed to DH20B cells of E. coli ElectroMax E (BRL Life Technologies) through electroporation . Using the same procedure, a collection of normal human pancreatic cDNA expression was prepared from a combination of 6 tissue specimens (Clontech). The cDNA collections were characterized by the determination of the number of independent colonies, the percentage of clones that the insert carries, the average insert size and through sequence analysis. The prostate tumor collection contained 1.64 x 107 independent colonies, with 70% of the clones having one insert and an average insert size being 1745 base pairs. The normal pancreatic cDNA library contains 3.3 x 106 independent colonies, with 69% of the clones having inserts and average insert size being 1 120 base pairs. For both collections, the sequence analysis showed that most of the clones had a full-length DNA sequence and were synthesized from mRNA, with mammalian rRNA and mitochondrial DNA contamination. The subtraction of the cDNA library was performed using the anterior prostate tumor and the AD Nc collections of normal pancreas, as described by Hara et al. { [Blood, 84: 189-199, 1994) with some modifications. Specifically, a collection of AD Nc substratum specific for prostate tumor was generated as follow. The normal pancreatic cDNA library (70 μg) was digested with EcoRI, Notl and Sful, followed by a Klenow fragment fill-in reaction of DNA polymerase. After the phenol-chloroform extraction and ethanol precipitation, the DNA was dissolved in 100 μl of H 2 O, denatured with heat and mixed with 100 μl (100 μg) of Photoprobe biotin (Vector Laboratories, Burlingama, CA). According to the manufacturer's recommendations, the resulting mixture was irradiated with a 270 W sun lamp on ice for 20 minutes. Additional Photoprobe biotin and the biotinylation reaction were added. After extraction with butanol 5 times, the DNA was precipitated with ethanol and dissolved in 23 μl of H2O to form the activating DNA. To form the fingerprint DNA, 10μg of the prostate tumor collection were digested with BamHl and Xhol, extracted with phenol-chloroform and passed through Chroma-spin-400 columns (Clontech). After precipitation with ethanol, the fingerprint DNA was dissolved in 5 μl of H2O. The fingerprint DNA was mixed with 15 μl of activator DNA and 20 μl of 2 x hybridization buffer. (1.5 M NaCl / 10 mM EDTA / 50 mM HEPES pH 7.5 / 0.2% sodium dodecyl sulfate), covered with mineral oil, and completely denatured with heat. The sample was immediately transmitted to a water bath at 68 ° C and incubated for 20 hours (long hybridization [LH]). The reaction mixture was then subjected to a streptavidin treatment followed by extraction with phenol / chloroform. This procedure was repeated three more times. The subtracted DNA was precipitated, dissolved in 12 μl of H 2 O, mixed with 8 μl of activator DNA and 20 μl of 2 x hybridization buffer and subjected to hybridization at 68 ° C for 2 hours (short hybridization [SH ]). After removal of the biotinylated double-stranded structure DNA, the subtracted cDNA was ligated with the BamHI / Xhol site of chloramphenicol-resistant pBCSK + (Stratagene, La Jolla, CA 92037) and transformed into DH10B cells of E. coli ElectroMaxE a through electroporation to generate a collection of subtracted cDNA specific for prostate tumor (referred to as "prostate subtraction 1"). To analyze the subtracted cDNA library, the plasmid DNA was prepared from 100 independent clones, randomly chosen from the specific collection of subtracted prostate tumor and grouped based on the size of the insert. Representative cDNA clones were further characterized by DNA sequencing with Perkin Elmer automatic sequencer / Applied Biosystems Automated Sequencer Model 373A Division (Foster City, CA). The 6 cDNA clones, hereinafter referred to as F1 -13, F 1 -12, F1-16, H 1 -1, H 1 -9 and H 1 -4, are shown to be abundant in the cDNA library specific of subtracted prostate. The 3 'and 5' cDNA sequences determined for F 1 -12 are provided in S EC ID NO: 2 and 3, respectively, the cDNA sequences determined for Fl -13, F1 -16, H 1 -1, H 1 -py H 1 -4 being provided in SEQ ID NO: 1 and 4-7, respectively.

The cDNA sequences for the isolated clones were compared with the known sequences in the gene bank using the databases of EMBL and GenBank (release 96). Four of the prostate tumor cDNA clones, F1-13, F1-16, and H1-4 were determined to encode the following previously identified proteins: prostate specific antigen (PSA), human glandular kallikrein, expression enhancement gene of human tumor, and subunit II of mitochondrion cytochrome C oxidase. It was found that H1-9 is identical to a human autonomous replication sequence previously identified. No important homologies were found for the cDNA sequence for F1-12. Consequent studies lead to the isolation of a full length cDNA sequence for F1-12 (also referred to as P504S). This sequence is provided in SEQ ID NO: 107, with the corresponding predicted amino acid sequence being provided by SEQ ID NO. 108. The splice or cDNA binding variants of P504S are provided in SEQ ID NO. 600-605. To clone less abundant prostate tumor specific genes, subtraction of the cDNA library was performed by subtracting the cDNA collection from the prostate tumor described above with the normal pancreatic cDNA library, and with the three more abundant genes in the prostate tumor cDNA collection subtracted previously: human glandular kallikrein, prostate specific antigen (PSA), and cytochrome C oxidase subunit II of mitochondria. Specifically, 1 μg of each cDNA and human glandular kallikrein, PSA and cytochrome C oxidase subunit II of mitochondria in pCDNA3.1 were added to the activator DNA and the subtraction was performed as described above to provide a second collection of subtracted cDNA from hereinafter referred to as the "specific cDNA collection of subtracted prostate tumor with tip". Twenty-two cDNA clones were isolated from the specific subtracted prostate tumor cDNA collection. The 3 'and 5' sequences determined for the clones are described as J1-17, L1-12, N1-1862, L1-13, J1-19, J1-25, J1-24, K1-58, K1-63, L1-4 and L1-14 are supplied as SEQ ID NOS: 8-9, 10-11, 12-13, 14-15, 16-17, 18-19, 20-21, 22-23, 24-25, 26-27, and 28-29 respectively. The 3 'cDNA sequences determined for the clones described as: J1-12, J1-16, J1-21, K1-48, K1-55, L1-2, L1-6, N1-1858, N1-1860, N1 -1861, N1-1864 are supplied in the sequences SEQ ID NOS: 30-40, respectively. The comparison of these sequences with those in the gene bank as described above, reveal important homology to the three to five most abundant species of DNA, (J1-17, L1-12 and N1-1862; SEQ ID NOS. 9, 10-11, and 12-13, respectively). Of the two remaining most abundant species, one (J1-12; SEQ ID NO: 30) was found to be identical to the associated surfactant protein human lung identified previously, and the other (K1-48; SEQ ID NO: 33) was determined to have some homology to R. norvegicus epimerase of 2-arylpropionyl-CoA. Of the 17 less abundant cDNA clones isolated from the cDNA collection speci fi ed from tip subtracted prostate tumor, it was found that four (J1-16, K1-55, L1-6 and N1-1864; SEQ ID NOS: 31, 34, 36 and 40, respectively) were identical to the sequences previously identified, two (J2-21 and N1-1860; SEQ ID NOS: 32 and 38, respectively) were found to show some homology to the non-human sequences, and two (L1-2, and N1-1861; SEQ ID NOS: 35 and 39, respectively) were found to show some homology to known human sequences. No significant homologies were found to the polypeptides: J1-13, J1-19, J1-24, J1-25, K1-58, K1-63, L1-4, L1-14 (SEQ ID NOS: 14-15, 16 -17, 20-21, 18-19, 22-23, 24-25, 26-27, 28-29, respectively). Subsequent studies are directed to the isolation of full-length cDNA sequences for J1-17, L1-12 and N1-1862 (SEQ ID NOS: 109-111, respectively). The corresponding predicted amino acid sequences are provided by SEQ ID NOS; 112-114. L1-12 is also referred to as P501S, A variant of splicing of cDNA from P501S is provided in SEQ ID NO: 606.

In a further experiment, four additional clones were identified by the collection of subtracted prostate tumor cDNA with normal prostate cDNA prepared from a combination of three normal prostate poly A + RNAs (termed as "prostate subtraction 2"). The cDNA sequences determined by these three clones, hereinafter referred to as U1-3064, U1-3065, V1-3692 and 1A-3905, are provided in SEQ ID NO: 69-72, respectively. The comparison of the determined sequences with these and the gene bank revealed no significant homology to U1-3065. A second spike subtraction (referred to as "prostate subtraction with spike 2") was performed by subtracting the spike prostate tumor-specific cDNA collection with normal pancreatic cDNA collection and also with a spike with PSA, J1- 17, pulmonary surfactant-associated protein, mitochondrial DNA, cytochrome c oxidase subunit II, N1-1862, autonomous replication sequence, L1-12 and improved tumor expression gene. Four additional clones, hereinafter referred to as V1-3686, R1-2330, 1B-3976 and V1-3679, were isolated. The cDNA sequences determined for these clones are provided in SEQ ID NO. 73-76, respectively. Comparison of these sequences with those in the gene bank revealed unimportant homology for V1-3686 and R1-2330. Further analysis of these three prostate subtractions described above (prostate subtraction 2, prostate tumor-specific cDNA collection subtraction with peak, and prostate subtraction 2) resulted in the identification of 16 additional clones, termed 1G- 4736, 1G-4738, 1G-4741, 1G-4744, 1G-4734, 1H-4774, 1H-4781, 1H-4785, 1H-4787, 1H- 4796, 11-4810, 11-4811, 1J-4876, 1K-4884 and 1K-4896. The cDNA sequences determined for these clones are provided in SEQ ID NOS: 77-92, respectively. Comparison of these sequences with those in the gene bank as described above, revealed unimportant homologies to 1G-4741, 1G-4734, 11-4807, 1J-4876 and 1K-4896 (SEQ ID NOS: 79, 81, 87, 90, and 92, respectively). Additional analysis of the isolated clones was directed to the determination of extended cDNA sequences for 1G-4736, 1G-4738, 1G-4741, 1G-4744, 1H-4774, 1H-4781, 1H-4785, 1H-4796 , 11-4807, 1J-4876, 1K-4884 and 1K-4896, provided in SEQ ID NOS: 179-188 and 191-193, respectively, and the determination of additional partial cDNA sequences for 11-4810 and 11-4811 , supplied in SEQ ID NOS: 189 and 190, respectively. Additional studies with subtraction with prostate peak 2 resulted in the isolation of three more clones. Their sequences were determined as described above and compared with the most recent GenBank. The three clones were found to have homology to known genes, which are protein enriched with Cistern, KIAA0242, and KIAA0280 (SEQ ID NO: 317, 319, and 320, respectively). Further analysis of these three clones through Synteni micro-array (Synteni, Palo Alto, CA) demonstrated that all three clones were over-expressed in most BPH prostate and prostate tumors, as well as in most tissues of normal prostate tested, but low expression in all other normal tissues. Additional subtraction was performed through subtraction of a normal prostate cDNA library with normal pancreatic cDNA (termed "prostate subtraction 3"). This led to the identification of six additional clones named 1 G-4671, 1 G-4762, 1 H-4766, 1 H-4770, 1 H-4771 and 1 H-4772 (SEQ ID NOS: 93-98). The comparison of these sequences with those of the gene bank revealed non-important homologies to 1 G-4761 and 1 H-4771 (SEQ ID NOS: 93 and 97, respectively). Additional analysis of the isolated clones led to the determination of extended cDNA sequences for 1 G-4761, 1 G-4762, 1 H-4766 and 1 H-4722 supplied by SEQ ID NOS. 194-196 and 199, respectively, and to the determination of additional partial cDNA sequences for 1 H-4770 and 1 H-4771, given in SEQ ID NOS: 197 and 198, respectively. Subtraction of a collection of prostate tumor cDNA, prepared from a combination of poly A + RNA from three patients with prostate cancer, with collection of normal pancreatic cDNA (prostate subtraction 4) led to the identification of eight clones , designated as 1 D-4297, 1 D-4309, 1 D.1 -4278, 1 D-4288, 1 D-4283, 1 D-4296 and 1 D-4280 (SEQ ID NOS: 99-107). These sequences were compared with those in the gene bank as described above. No significant homologies were found at 1 D-4283 and 1 D-4304 (SEC I D NOS: 103 and 1 04, respectively). Additional analysis of the isolated clones led to the determination of extended cDNA sequences for 1 D-4309, 1 D.1 -4278, 1 D-4288, 1 D-4283, 1 D-4304.304, 4296 and 1 D-4280 provided in SEQ ID NOS: 200- 206, respectively. The cDNA clones isolated on prostate subtraction 1 and prostate subtraction 2, described above, were amplified by colony PCR and their expression levels of mRNA in prostate tumor, normal prostate and in several other normal tissues was determined using micro disposition (Synteni, Palo Alto, CA). In summary, the PCR amplification products were dotted on the slides in a layout format, each product occupying a unique location in the layout. The mRNA was extracted from the tissue sample to be tested, reverse transcribed, and the fluorescently labeled cDNA probes were generated. The micro-arrangements were tested with the labeled DNA probes, the screened slides and the fluorescence intensity was measured. The intensity correlated with the intensity of hybridization. We found that two clones (referred to as P509S and P510S) were overexpressed in normal prostate and prostate tumor and expressed at low levels in all other normal tissues tested (liver, pancreas, skin, bone marrow, brain, breast, adrenal gland, bladder, testes, salivary glands, large intestine, kidney, ovary, lung, spinal dorsal, skeletal muscle and colon). The determined cDNA sequences of P509S and P510S are provided in SEQ ID NO: 223 and 224, respectively. The Comparison of these sequences with those of the gene bank as described above, revealed some homology to previously identified ESTs. Additionally, the studies are directed to the isolation of the full-length cDNA sequence for P509S. This sequence provided in SEQ ID NO: 332, with the corresponding predicted amino acid sequence being provided in SEQ ID NO. 339. Two full length cDNA sequences variant for P510S are provided in SEQ ID NO: 535 and 536, with the corresponding predicted amino acid sequence being given in SEQ ID NOs: 537 and 538, respectively. Additional splice variants of P510S are provided in SEQ ID NOs: 598 and 599.

EXAMPLE 2 DETERMINATION OF SPECIFIC CHARACTERIZATION OF SPECIFIC PROSTATE POLYPEPTIDES Using gene-specific primers, the mRNA expression levels for the representative prostate-specific polypeptides F1-16, H1-1, J1-17 (also referred to as P502S), L1- 12 (also referred to as P501S), F1-12 (also referred to as P504S) and N1-1862 (also referred to as P503S) were examined in a variety of normal and tumor tissues using RT-PCR. In summary, the total RNA was extracted from a Variety of normal and tumor tissues using the Trizol reagent as described above. First the synthesis of the chain structure was performed using 1 -2 μg of the total RNA with Superscript II reverse transcriptase (BRL Life Technologies) at 42 ° C for one hour. The cDNA was then amplified through PCR with gene-specific primers. To ensure the semi-quantitative nature of the RT-PCR, β-actin was used as an internal control for each of the tissues examined. First, serial dilutions of the cDNA of the first strand structure were prepared and the RT-PCR assays were performed using β-actin specific primers. A dilution was then selected that allows the linear scale amplification of the ß-actin template and which is sensitive enough to reflect the differences in the initial copy numbers. Using these conditions, β-actin levels were determined for each reverse transcription reaction of each tissue. DNA contamination was minimized by treating DNase and ensuring a negative PCR result when using the primary chain structure cDNA that was prepared without the addition of reverse transcriptase. The levels of mRNA expression were examined in four different types of tumor tissue (prostate tumor from 2 patients, breast tumor from 3 patients, colon tumor, lung tumor), and 16 different normal tissues, including prostate, colon , kidney, liver, lung, ovary, pancreas, skeletal muscle, skin, stomach, testicles, bone marrow, and brain. Fl-16 was found to be expressed at high levels in prostate tumor tissue, normal colon and prostate tumor, and at low levels in the liver, skin and testes, with no detectable expression in the other tissues examined. H1-1 was found expressed at high levels in prostate tumor, lung tumor, breast tumor, normal prostate, normal colon, and normal brain, and lower levels in lung, pancreas, skeletal muscle, skin, small intestine, bone marrow spinal and was not detected in other tissues tested. J1-17 (P502S) and L1-12 (P501S) appear as being over-expressed specifically in prostate, with both genes being expressed at high levels in prostate tumor, and normal prostate but at low undetectable levels in all other tissues examined . N1-1862 (P503S) was found to be expressed in 60% of prostate tumors and detectable in normal colon and kidney. The results of RT-PCR in this manner indicate that F1-16, H1-1, H1-17 (P502S), N1-1862 (P503S) and L1-12 (P501S) are both prostate-specific or are expressed in highly elevated levels actively in the prostate. Additional RT-PCR studies showed that F1-12 (P504S) is overexpressed in 60% of prostate tumors, detectable in normal kidney but not detectable in all other tissues tested. Similarly, R1-2330 showed that they are overexpressed in 40% of prostate tumors, detectable in normal kidney and liver, but not detectable in all other tissues tested. U1-3064 was found to be overexpressed in 60% of tumors of prostate, and also expressed in breast and colon tumors, but not detectable in normal tissues. The characterization of RT-PCR of R1 -2330, U1 -3064 and 1D-4379 showed that these three antigens are overexpressed in prostate and prostate tumors. The Northern analysis with four prostate tumors, two normal prostate samples, two BPH prostates, and kidney, liver, lung, pancreas, skeletal muscle, brain, stomach, testes, small intestine and normal bone marrow, showed that L 1 - 12 (P501 S) is overexpressed in normal prostate and prostate tumors, while it is undetectable in other normal tissues tested. J 1 - 17 (P502S) was detected in two prostate tumors and not in the other tissues tested. N 1 -1862 (P503S) was found to be overexpressed in three prostate tumors and is expressed in prostate, colon, and normal kidney, but not in the other tissues tested. F1 -12 (P504S) was found to be highly expressed in two prostate tumors and undetectable in all other tissues tested. The microtiter technology described above was used to determine the expression levels of the representative antigens described herein in prostate tumor, breast tumor, adrenal gland, bladder, skeletal muscle and colon. L-12 (P501 S) was found to be overexpressed in normal prostate and prostate tumor, with some expression being detected in normal skeletal muscle. Both J 1 -12 and F1 -12 (P504S) are they found themselves to be overexpressed in prostate tumor, with expression being low or undetectable in all other tissues tested. N 1 -1862 (P503S) was found to be expressed at high levels in prostate and normal prostate tumor, and at low levels in large intestines and normal colon, with expression being undetectable in all other tissues tested. N 1 -1862 (P503S) was found to be expressed at high levels in normal prostate and prostate tumor, and at low levels in normal large bowel and normal colon, with expression being undetectable in all other tissues tested. R1 -2330 was found to be overexpressed in normal prostate and prostate tumor and not expressed at low levels in all other tissues tested. 1 D-4279 was found to be overexpressed in normal prostate and prostate tumor, expressed at low levels in normal spine and undetectable in all other tissues tested. The additional microarray analysis is specifically directed to the extent to which P501 S (SEQ ID NO: 1 10) was expressed in breast tumor and revealed moderate overexpression not only in breast tumor, but also in metastatic breast tumor (2/31), with expression of negligible to low in normal tissues. These data suggest that P501 S can be overexpressed in chest tumors as well as in prostate tumors. The expression levels of 32 ESTs (expressed sequence tags) described by Vasmatzis et al., (Proc. Nati.

Acad. Sci. USA 95: 300-304, 1998) in a variety of normal tumors and tissues were examined through micro technology. disposition as described above. Two of these clones (referred to as P 1000C and P 1001 C) were found to be overexpressed in normal prostate and prostate tumors, and were expressed at low to non-detectable levels in all other tissues tested (normal aorta, thymus , Resting and activated PBMC, epithelial cells, spine, adrenal gland, fetal tissues, skin, salivary glands, large intestine, bone marrow, liver, lung, dendritic cells, stomach, lymph nodes, brain, heart, small intestine, muscle Skeletal, colon and kidney The cDNA sequences determined by P 1000C and P1001 C are supplied by SEQ ID NO: 384 and 472, respectively The sequence of P1001 C was found to show some homology to the human mRNA previously isolated from the JM27 protein The subsequent comparison of the sequence SIC ID NO: 384 with sequences in the public databases led to the identification of a full-length cDNA sequence of P1000C (SEQ ID NO: 768), which encodes 492 amino acid sequences. The analysis of the amino acid sequence used in the PSROT I I program led to the identification of a putative transmembrane domain from amino acids 84-100. The cDNA sequence of the P 1000C open reading frame, including the stop codon, is provided in SEQ ID NO: 787, with the reading frame opened without the stop codon being given in SEQ ID NO: 788. The sequence of full length amino acid of P1000C is provided in SEQ ID NO: 789. SEQ ID NO: 790 and 791 represent amino acids 1 -100 and 100-492 of P 1000C, respectively. The expression of the polypeptide encoded by the full-length cDNA sequence for F1-12 (also referred to as P504S; SEQ ID NO: 108) was investigated by immunohistochemical analysis. Rabbit anti-P503S polyclonal antibodies against the full-length P504S protein were generated by standard techniques. The subsequent isolation and characterization of the polyclonal antibodies was also performed by techniques well known in the art. Immunohistochemical analysis showed that the P504S polypeptide was expressed in 100% of the prostate carcinoma samples tested (n = 5). The rabbit anti-P504S polyclonal antibody did not appear to mark benign prostate cells with the same granular cytoplasmic staining, but rather with light nuclear staining. Analysis of normal tissues revealed that the encoded polypeptide was found to be expressed in some, but not all, normal human tissues. Positive cytoplasmic staining with polyclonal anti-P504S rabbit antibody was found in normal human kidney, liver, brain, colon, and lung-associated macrophages, while the heart and bone marrow were negative. These data indicate that the P504S polypeptide is present in prostate cancer tissues, and that there are quantitative and qualitative differences in the staining between benign prostatic hyperplasia tissues and prostate cancer tissues, suggesting that this polypeptide can be selectively detected in prostate tumors and therefore be useful in the diagnosis of prostate cancer.

EXAMPLE 3 ISOLATION AND CHARACTERIZATION OF SPECIFIC PROSTATE POLIPETIDES THROUGH SUBSTRACTION PCR-BASED A collection of cDNA subtraction containing Normal prostate cDNA subtracted with ten other normal tissue ssDNAs (brain, heart, kidney, liver, lung, ovary, placenta, skeletal muscle, spleen, and thymus) and then subjected to a first round of PCR amplification were purchased. of Clontech. This collection was subjected to a second round of PCR amplification, following the manufacturer's protocol. The resulting cDNA fragments were subcloned into the vector pT7Blue T-vector (Novagen, Madison, Wl) and transformed into XL-1 Blue MRF 'E. coli (Stratagene). DNA isolated from independent clones and sequenced using an automatic sequencer Perkin Elmer / Applied Biosystems Division Automated Sequencer Model 373A. Fifty-nine positive clones were sequenced. Comparison of the DNA sequences of these clones with those in the gene bank, as described above, revealed non-important homologies to these 25 clones, hereinafter referred to as P5, P8, P9, P18, P20, P30, P34, P36, P38, P39, P42, P49, P50, P53, P55, P60, P64, P65, P73, P75, P76, P79 and P84. The cDNA sequences determined for these clones are given in SEQ ID NO: 41 -45, 47-52 and 54-65, respectively. P29, P47, P68, P80 and P82 (SEQ ID NO: 46, 53, and 66-68, respectively) were found to show some degree of homology to previously identified DNA sequences. As for the knowledge of the inventors, none of these sequences have previously been shown to be present in the prostate. Other studies employing the sequence of SEQ ID NO: 67 as a probe in full-length cloning methods resulted in the isolation of three cDNA sequences which appear to be P80 splice variants (also known as P704P). These sequences are provided in SEC I D NO: 620-622. Other studies using the PCR-based methodology described above resulted in the isolation of more than 180 additional clones, of which 23 clones were found to show non-important homologies to known sequences. The cDNA sequences determined for these clones are given in SEQ ID NO: 1 1 5-123, 127, 131, 1 37, 145, 147-151, 153, 156-158 and 160. It was found that 23 clones (SEQ. ID NO: 124-126, 128-130, 132-1 36, 138-144, 146, 152, 155 and 1 59) showed something of homology to previously identified ESTs. Ten additional clones (SEQ ID NO: 161-170) were found to have some degree of homology to known genes. Large cDNA clones containing the P20 sequence represent splice variants of a gene designated as P703P. The DNA sequence determined for the variants designated as DE1, DE13 and DE14 are provided in SEQ ID NO: 171, 175 and 177, respectively, with the corresponding predicted amino acid sequences being supplied by SEQ ID NO. 172, 176 and 178, respectively. The cDNA sequence determined from an extended P703 splice is provided in SEQ ID NO: 225. The DNA sequences for the splice variants designated as DE2 and DE6 are given in SEQ ID NOS: 173 and 174, respectively. The levels of mRNA expression for representative clones in tumor tissues (prostate (n = 5), breast (n = 2), colon and lung) normal tissues (prostate (n = 5), colon, kidney, liver, lung ( n = 2), ovary (n = 2), skeletal muscle, skin, stomach, small intestine, and brain), and activated and non-activated PBMC were determined by RT-PCR as described above. The expression was examined on a sample of each type of tissue unless otherwise indicated. P9 was found to be highly expressed in normal prostate, and prostate tumor, compared to all normal tissues tested except for normal colon which showed comparable expression. P20, a portion of the P703P gel, was found highly expressed in normal prostate and prostate tumor, compared to the 1 2 normal tissues tested. A modest increase in P20 expression in breast tumor (n = 2), colon tumor and lung tumor was seen compared to all normal tissues except lung (1 of 2). Increased expression of P 1 8 was found in normal prostate, prostate tumor and breast tumor, compared to other normal tissues except lung and stomach. A modest increase in P5 expression was observed in normal prostate compared to most other normal tissues. However, some high expressions were seen in normal lung and PB MC. High expression was also observed in P5 in prostate tumors (2 of 5), breast tumor, and a tumor of pu lmon tumor. For P30, similar expression levels were seen in normal prostate and prostate tumor, compared to six in twelve of the other normal tissues tested. Increased expression was seen in breast tumors, a sample of lung tumor and a colon tumor sample, and also in PB MC standard l. P29 was found to be overexpressed in prostate tumor (5 out of 5) and standard prostate l (5 out of 5) compared to most normal tissues. However, the ubiquitous expression of P29 was observed in normal colon and normal lung (2 of 2), P80 was found to be overexpressed in prostate tumor (5 of 5) and normal rstate (5 of 5) compared with all the other tissues tested, with increased expression also seen in colon tumor. Other studies gave as a result the Islamization of twelve, additional clones hereafter referred to as 10-d8, 10-h10, 11-cß, 7-g6, 8-b5, 8-b6, 8-d4, 8-d9, 8-g3, 8-h11, 9-f12, and 9-f3. The DNA sequences determined for 10-d8, 10-h11, 11-c8, 11-c8, 8-d4, 8-d9, 8-h11, 9-f12 and 9-f3 are provided in SEQ ID NO: 207, 208, 209, 216, 217, 220, 221 and 222, respectively. The sequences of forward and reverse ANDs determined by 7-g6, 8-b5, 8-b6, and 8-g3 are provided by SEQ ID NO: 210 and 211; 212 and 213; 214 and 215; and 218 and 219, respectively. The comparison of these sequences with those in the gene bank revealed unimportant homologies to the 9-f3 sequence. Clones 10-d8, 11-c8, and 8-h11 were found to show some homology to previously isolated ESTs, whereas 10-h10, 8-b5, 8-b6, 8-d4, 8-d9, 8- g3 and 9-f12 were found to show some homology with previously identified genes. The additional characterization of 7-G6 and 8-G3 showed identity with the known PAP and PSA genes, respectively. The levels of mRNA expression for these clones was determined using the micro-array technology described above. Clones 7-G6, 8-G3, 8-B5, 8-B6, 8-D4, 8-D9, 9-F3, 9-F12, 9-H3, 10-A2, 10-A4, 11-C9 and 11-F2 was found to be overexpressed in normal prostate and prostate tumor, with expression in other tissues tested being low or undetectable. Increased expression of 8-F11 was seen in normal prostate and prostate tumor, bladder, skeletal muscle, and colon. Increased expression of 10-H10 was seen in prostate and prostate tumor normal, bladder, lung, colon, brain and large intestine. Increased expression of 9-B 1 was seen in prostate tumor, breast tumor, and normal prostate, salivary glands, large intestine, and skin, with increased expression of 1 1 -C8 being seen in prostate tumor, and normal prostate and large intestine. A cDNA fragment derived from the normal prostate subtraction based on PCR, described above, was found to be prostate-specific through micro-array technology, previously described RT-PCR. The cDNA sequence determined for this clone (referred to as 9-A1 1) is provided in SEQ ID NO: 226. The comparison of this sequence with those public databases revealed 99% identity to the known HOXB 13. Other studies carry to the isolation of clones 8-C6 and 8-H7. The cDNA sequences determined by these clones are provided in SEQ ID NO: 227 and 228 respectively. These sequences were found to show some homology to previously isolated ESTs. The PCR-based hybridization methodologies were used to obtain longer cDNA sequences for clone P20 (also referred to as P703P), producing three additional cDNA fragments that progressively extend the 5 'end of the gene. These fragments, designated as P703PDE5, PT703P6.26 and P703PX-23 (SEQ ID NO: 326, 328 and 330, with the corresponding amino acid sequences predicted to be supplied in SEQ ID NO: 327, 329, and 331, respectively), contain an additional 5 'sequence. P703PDE5 was recovered through the classification of a cDNA library (# 141 -26) with a portion of P703P as a probe. P703P6.26 was recovered from a mixture of three prostate tumor ssDNA and P703PX_23 was recovered from the cDNA library (# 438-48). Together, the additional sequences include all putative mature serine proteases together with part of the putative signal sequence. The full-length DNA sequence for P703P is provided in SEQ ID NO: 524, with the corresponding amino acid sequences being provided in SEQ ID NO: 525. The following regions of P703P were predicted using computer algorithms to represent CTL epitopes of binding to HLA A2 potentials: amino acids 164-172 of SEQ ID NO: 525 (SEQ ID NO: 723); amino acids 160-168 of SEQ ID NO: 525 (SEQ ID NO: 724); amino acids 239-247 of SEC I D NO: 525 (SEQ ID NO: 725); amino acids 1 18-126 of SEQ ID NO: 525 (SEQ ID NO: 726); amino acids 1 12-120 of SEC I D NO: 525 (SEQ ID NO: 727); amino acids 1 55-164 of SEQ ID NO: 525 (SEQ ID NO: 728); amino acids 1 17-126 of SEQ ID NO: 525 (SEQ ID NO: 729); amino acids 164-173 (SEQ ID NO: 730); amino acids 1 54-163 (SEQ ID NO: 525 (SEQ ID NO: 731); amino acids 163-172 of SEQ ID NO: 525 (SEQ ID NO: 732): amino acids 58-66 of SEQ ID NO: 525 (SEQ ID NO: 732); NO: 733); amino acids 59-67 of SEQ ID NO: 525 (SEQ ID NO: 734).

P703P was found to show some homology to the proteases previously identified, such as thrombin. The thrombin receptor has been shown to be preferentially highly expressed in metastatic breast carcinoma cells and breast carcinoma biopsy samples. It was shown that the introduction of thrombin receptor antisense cDNA inhibits the invasion of metastatic breast carcinoma cells in cultures. Antibodies to the thrombin receptor inhibit thrombin receptor activation and platelet activation induced by thrombin. In addition, peptides resembling the ligand domain in receptor captivity inhibit the activation of platelets through thrombin. P703P plays an important role in prostate cancer through an activated prostate receptor on the cancer cell or on stromal cells. Potential trypsin-like protease activity of P703P can either activate a protease-activated receptor on the cancer cell membrane to promote tumorgenesis or activate a protease-activated receptor on adjacent cells (such as stromal cells) to secrete factors of growth and / or proteases (such as matrix metalloproteinases) that can promote angiogenesis, invasion and tumor metastasis. P703P in this way promotes tumor progression and / or metastasis through activation of the activated protease receptor. Polypeptides and antibodies that block the interaction of the P703P receptor, therefore, can be usefully employed in the treatment of cancer. prostate. To determine whether the expression of P703P increased with the increased severity of Gleason score, a d indicator of tumor stage, a quantitative PCR analysis was performed on prostate tumor samples with a Gleason score scale of 5 a > 8. The mean level of expression of P703P s increased with the Gleason rank increase, indicating that the expression of P703P can be correlated with the increased severity of the disease. Other studies using a PCR-based subtraction collection of a combination of prostate tumor subtracted against a combination of normal tissues (referred to as JP subtraction: PCR) resulted in the isolation of 13 additional clones, 7 of which did not share no important homology with known GenBank sequences. The cDNA sequences determined for these 7 clones (P71 1 P, P712P, novel 23, P744P, P775P, P710P and P768P) are provided in SEQ ID NO: 307-31 1, 31 1 and 315, respectively. The remaining six clones (SEC I D NO: 316 and 321 -325) were shown to share some homology with the known genes. Through microdisposition analysis, the thirteen clones showed an overexpression of three or more in prostate tissues, including prostate tumors, BPH and normal prostate as compared to normal non-prostate tissues. Clones P71 1 P, P71 2P, 23 novel and P768P showed overexpression in the majority of prostate tumors and tissues with BPH tested (n = 29), and in most normal prostate tissues (n = 4), but in the background they reduced the expression levels in all normal tissues. The clones, P744P, P775P, and P710P showed comparatively low expression and expression in few prostate tumors and BPH samples, with negative expression at low in normal prostate. Other studies led to the isolation of an extended cDNA sequence for P712P (SEQ ID NO: 552). The amino acid sequences encoded by 16 predicted open reading frames present within the sequence of SEQ ID NO: 553 are provided in SEQ ID NO: 553-568. The full-length cDNA for P71 1 P was obtained using the partial sequence of SEQ ID NO: 307 to classify a collection of prostate cDNA. Specifically, a collection of directionally cloned prostate cDNA was prepared using standard techniques. One million colonies of this collection were plated on LB / Amp plates. They used nylon membrane filters to raise these colonies, and the cDNAs that were collected through these filters were denatured and interlaced to the filters through ultraviolet light. The P71 1 P cDNA fragment of SEQ ID NO: 307 was radiolabelled and used to hybridize with these filters. Positive samples were selected and cDNAs prepared and sequenced using an automatic Perkin Elmer / Applied Biosystems sequencer. The determined full length sequence of P71 1 P is provided in SEQ ID NO: 382, with the corresponding predicted amino acid sequence being supplied by SEQ ID NO: 383. Using PCR-based and hybridization-based methodologies, additional cDNA sequence information was derived for two previously described clones, 1 1 -Cp and 9- F3, hereinafter referred to as P707P and P714P, respectively (SEQ ID NO: 333 and 334). After comparison with the most recent GenBank, P707P was found to be a variant of the gene splicing HoxB13 known. In contrast, no significant homology was found for P714P. Other studies that use the sequence of SEQ ID NO: 334 as a probe in standard full-length cloning methods, resulted in an extended cDNA sequence for P714P. This sequence is provided in SEQ ID NO: 619. This sequence was found to show some homology to the gene encoding the human ribosome L23A protein. Clones 8-B3, P89, P98, P130 and P201 (as described in US Patent Application No. 09 / 020,956, filed February 9, 1998) were found to be contained within a contiguous sequence, termed as P705P (SEQ ID NO: 335, with the predicted amino acid sequence provided in SEQ ID NO: 336), which determined to be a splice variant of the known NKX3.1 gene. Other studies on P775P resulted in the isolation of four sequences Additional (SEQ ID NO: 473-476) which are all splice variants of the P775P gene. The sequence SEQ ID NO: 474 was found to contain two open reading frames (ORFs). The amino acid sequences predicted by these ORFs are provided in SEQ ID NO: 477 and 478. The cDNA sequence of SEQ ID NO: 475 was found to contain an ORF which encodes the amino acid sequence of SEQ ID NO: 479. cDNA sequence of SEQ ID NO: 473 was found to contain four ORFs. The predicted amino acid sequences encoded by these ORFs are provided in SEQ ID NO: 480-483. Additional splice variants of P775P are provided in SEQ ID NO: 593-597. Subsequent studies led to the identification of a genomic region on chromosome 22q 1 1 .2 known as the Cat Eye Syndrome region, which contains the five prostate genes P740P, P712P, P774P, P775P and B305D. The relative location of each of these five genes within the genomic region are shown in Figure 10. This region may therefore be associated with malignancies and other potential tumor genes may be contained within this region. These studies also lead to the identification of a potential open reading frame (ORF) for P775P (provided in SEQ ID NO: 533), which encodes the amino acid sequence of SEQ ID NO: 534. The comparison of the SEQ ID clone NO: 325 (designated as P558S) with sequences in the DNA databases of GenBank and GeneSeq showed that P558S is identical to the prostaglandin-specific transglutaminase gene, which is known to have two forms. The full length sequences of the two forms are provided in SEQ ID NOs: 630 and 631, with the corresponding amino acid sequences being provided by SEQ ID NOs: 632 and 633, respectively, the cDNA sequence of SEQ ID NO: 631 has a base pair insert 15, resulting in an amino acid insert 5 in the corresponding amino acid sequence (SEQ ID NO: 633). This insert is not present in the sequence of SEQ ID NO: 630. Other studies on P768P (SEQ ID NO: 315) direct the identification of the putative full length open reading frame (ORF). The cDNA sequence of the ORF with stop codon is provided in SEQ ID NO: 764: The cDNA sequence of the ORF without stop codon is provided in SEQ ID NO: 765, with the corresponding amino acid sequence being provided by SEQ ID NO. : 766. This sequence was found to show 86% identity to the rat calcium transporter protein, indicating that P768P can represent a human calcium transport protein. The locations of transmembrane domains within P768P were predicted using the PSORT I I computer algorithm. Six transmembrane domains were predicted at amino acid positions 1 18-134, 172-188, 21 1 -227, 230-246, 282-298 and 348-364. The amino acid sequences of SEQ ID NO: 767-772 represent amino acids 1 -134, 135-188, 189-227, 228-246, 247-298, and 299-51 1 of P768P, respectively.

EXAMPLE 4 SYNTHESIS OF POLIPEPTIDES The polypeptides can be synthesized in a Perkin Elmer / Applied Biosystems 430A peptide synthesizer using FMOC chemistry with HPTU activation (O-Benzotriazole-N, N, N ', N'-tetramethyluronium Hexafluorophostat). A Gly-Cys-Gly sequence can be linked to the amino terminus of the peptide to provide a method of conjugation, binding to an immobilized surface, or labeling the peptide. Cleavage of the peptides from solid support can be carried out using the following cleavage mixture: trifluoroacetic acid: eta ndiol, thioanisole: water: phenol (40: 1: 2: 2: 3). After cleavage for two hours, the peptides can be precipitated in cold methyl-t-butyl ether. The peptide pellets can then be dissolved in water containing 0.1% trifluoroacetic acid (TFA) and lyophilized before purification through C18 reverse phase HPLC. A gradient of 0% -60% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) can be used to elute the peptides. After lyophilization of the pure fractions, the peptides can be characterized using electroaspersion and other types of mass spectrometry and through amino acid analysis.

EXAMPLE 5 ADDITIONAL ISOLATION AND CHARACTERIZATION OF SPECIFIC PROSTATE POLYPEPTIDES THROUGH PCR-BASED SUBSTRACTION A collection of cDNA generated from primary prostate tumor mRNA as described above was subtracted with normal prostate cDNA. The subtraction was performed using a PCR-based protocol (Clontech), which was modified to generate larger fragments. Within this protocol, the tester and cDNA of double-acting chain structure were digested separately with 5 restriction enzymes that recognize 6 restriction sites of nucleotide (Mlul, Mscl, Pvull, Sali and Stul). This digestion resulted in an average cDNA size of 600 bp, instead of the average size of 300 bp that results from digestion with Rsa I according to the Clontech protocol. This modification did not affect the efficiency of subtraction. Then, two tester populations were created with different adapters, and the actuator collection remained without the adapter. The tester and actuator collections were then hybridized using excess drive cDNA. In the first hybridization step, the driver was hybridized separately, with each of the two populations of tester cDNA. This resulted in populations of (a) cDNAs from unhybridized tester, (b) tester cDNAs hybridized to other cDNAs, (c) tester cDNAs hybridized to the action of ANDcs, and (d) unhybridized tester cDNAs. The two separate reactions were then combined, and rehybridized in the presence of additional denatured driving cDNA. After this second hybridization, in addition to the populations of (a) to (d), a fifth population (e) was generated in which the tester cDNA with an adapter was hybridized to the tester cDNA with the second adapter. Accordingly, the second hybridization step resulted in an enrichment of differentially expressed sequences, which can be used as templates for PCR amplification with specific adapter primers. The ends were then filled, and the PCR amplification was performed using specific adapter primers. Only population (e), which contains tester cDNA that did not hybridize to the driver cDNA, was exponentially amplified. A second step of PCR amplification was then performed, to reduce the above and further enrich the differentially expressed sequences. This PCR-based subtraction technique normalizes substantially expressed cDNAs so that rare transcripts that are overexpressed in prostate tumor tissue may be recoverable. These transcriptions could be difficult to recover through subtraction methods traditional In addition to the known genes that are overexpressed in prostate tumor, another 77 clones were identified. The sequences of these partial cDNAs are provided in SEQ ID NO: 29 to 305. Most of these clones did not have significant homology to the database sequences. The exceptions were JPTPN23 (SEQ ID NO: 231, similarity to pork valosin-containing protein), JPTPN30 (SEQ ID NO: 234, similarity to proteasome subunit rat ARMn), JPTPN45 (SEQ ID NO: 243; isocitrate dehydrogenase dependent on cytosolic NADP from rat norvegicus), JPTPN46 (SEQ ID NO: 244; DNA sequence similarity to H8 DNA 4 d4 of human subclone), JP1 D6 (SEQ ID NO: 265; similarity to light A chain of dynein G. gallus), JP8D6 (SEQ ID NO: 288, similarity to RG016J04 of the human BAC clone); J P8F5 (SEQ ID NO: 289; similarity to DNA sequence H8 3 b5 of human subclone); and JP8E9 (SEQ ID NO: 299; similarity to the human Alu sequence). Other studies using PCR-based subtraction collection consisting of subtraction of prostate tumor combination against a normal prostate combination (referred to as PT-PN PCR subtraction) yielded three additional clones. Comparison with the cDNA sequences of these clones with the most recent release of Gen Bank revealed unimportant homologies to the two clones designated as P715P and P767P (SEQ ID NO: 312 and 314). The remaining clone was found showing some homology to the known gene KIAA0056 (SEQ ID NO: 318). Using microarray analysis to measure the levels of mRNA expression in various tissues, all three clones were found to be over-expressed in prostate tumors and BPH tissues. Specifically, clone P715P was overexpressed in the majority of prostate tumors and BPH tissues by a factor of three or greater, elevated expression seen in most normal prostate samples and in fetal tissue, but expression from negative to low in all other normal tissues. Clone P767P was overexpressed in several prostate tumors and BPH tissues, with moderate expression levels in half of normal prostate samples, and background to low expression in all other normal tissues tested. Further analysis, through micro-arrangement as described above, of the PT-PN PCR subtraction collection and the subtraction collection of DNA containing prostate tumors subtracted with a combination of normal tissue cDNAs, led to the isolation of 27 clones additional (SEQ ID NO: 340-365 and 381) which determined to be overexpressed in prostate tumor. Clones of SEC I D NO: 341, 342,, 345, 347, 349, 351, 355-359, 361, 362 and 364 were also found to be expressed in normal prostate. The expression of all 26 clones in a variety of normal tissues was found to be low or undetectable, with expression of P544S (SEQ ID NO: 356) which was found to be expressed in the small intestine. Of the 26 clones, 1 1 (SEC I D NO: 340-349 and 362) it was found that they show some homology to the sequences previously identified. No significant homologies were found to the clones of SEQ ID NO: 350, 351, 353-361, and 365. The comparison of the sequence of SEQ ID NO: 362 with the sequences in the DNA databases of GenBank and GeneSeq showed that this clone (designated as P788P) is identical to Access No. X27262 of GeneSeq. which encodes a protein found in Access No. Y00931 of GeneSeq. The full-length cDNA sequence of P788P is provided in SEQ ID NO: 634, with the corresponding predicted amino acid being provided by SEQ ID NO: 635. Subsequently, a full-length cDNA sequence for P788P containing polymorphisms not found in the Sequence of SEQ ID NO: 634, was cloned multiple times through PCR amplification from cDNA prepared from several RNA templates of three individuals. This determined cDNA sequence of this polymorphic variant of P788P is provided in SEQ ID NO: 636, with the corresponding amino acid sequence being provided in SEQ ID NO: 637. The sequence of SEC I D NO: 637 differs from that of SEC I D NO: 635 by six amino acid residues. The P788P protein has 7 potential transmembrane domains with an extracellular N-terminal region. Other studies on the clone of SEQ ID NO: 352 (referred to as P790P) lead to the isolation of the sequence of Full length cDNA of SEQ ID NO: 526. The corresponding predicted amino acid is provided in SEQ ID NO: 527. Data from two quantitative PCR experiments indicated that P790P is overexpressed in 1 1/15 prostate tumor samples tested and it is expressed at low levels in the spine, with no expression being seen in all other normal tissues tested. Data from other PCR experiments and microarray experiments showed overexpression in normal prostate and prostate tumor with little or no expression in other tissues tested. P790P was subsequently found to show significant homology to the previously identified G protein-coupled prostate tissue receptor. Further studies on the clone of SEQ ID NO: 354 (referred to as P776P) led to the isolation of an extended cDNA sequence, provided in SEQ ID NO: 569. The cDNA sequences determined from three additional splice variants of P776P are provided in SEQ ID NO: 570-572. The amino acid sequences encoded by two predicted open reading frames (ORFs) contained within SEQ ID NO: 570, an ORF contained within SEQ ID NO: 571, and 1 predicted ORFs contained within SEQ ID NO: 569, are provided in SEQ ID NO: 573-586, respectively. Other studies lead to the isolation of the full length sequence for the clone of SEC I D NO: 570 (provided in SEC I D NO: 737). The full-length cloning efforts on the clone of SEC I D NO: 571 lead to isolation of two sequences (provided in SEQ ID NOs: 738 and 739), representing an individual clone, which is identical with the exception of a polymorphic insertion / deletion at position 1293. Specifically, the clone of SEQ ID NO: 739 (referred to as as clone F1) has a C at position 1293. The clone of SEQ ID NO: 738 (referred to as clone F2) has an individual base pair deletion at position 1293. The amino acid sequences encoded by 5 open reading frames located within SEQ ID NO: 737 are provided in SEQ ID NO: 740-744, with the predicted amino acid sequences encoded by the clone of SEQ ID NO: 738 and 739 being provided in SEQ ID NO: 745-750. Comparison of the cDNA sequences for clones P767P (SEQ ID NO: 314) and P777) (SEQ ID NO: 350) with the sequences in the human EST database of GenBank showed that the two clones correspond to many EST sequences in common, suggesting that P767P and P777P may represent the same gene. A DNA consensus sequence derived from a DNA sequence aligned to P767P, P777P and multiple EST clones is provided in SEQ ID NO: 587. The amino acid sequences encoded by three putative ORFs located within SEQ ID NO: 587 are provided in SEQ ID NO: 588-590. The clone of SEC I D NO: 342 (designated as P789P) was found to show homology to the previously identified gene. The full length AD Nc sequence for P789PP and the corresponding amino acid sequence are provided in SEC I D NO: 735 and 736, respectively.

EXAMPLE 6 INITIATION OF MICE PEPTIDE AND PROPAGATION OF LINES CTL 6.1. This Example illustrates the preparation of a CTL cell line specific for cells expressing the P502S gene. Mice expressing the transgene for human HLA A2Kb (supplied by Dr L. Sherman, The Scripps Research Institute, La Jolla, CA) were immunized with the peptide P2S # 12 (VLGWVAEL; SEQ ID NO: 306), which is derived from the P502S gene (also referred to herein as J1-17, SEQ ID NO: 8), as described by Theobald et al., Proc. Nati Acad. Sci. USA, 92: 11993-11997, 1995, with the following modifications. Mice were immunized with 100 μg of P2S # 12 and 120 μg of a l-Ab binding peptide derived from hepatitis B virus protein emulsified in Freund's incomplete adjuvant. These mice were sacrificed three weeks later and individual cell suspensions were prepared using a nylon mesh. The cells were then resuspended at 6 x 106 cells / ml in complete medium (RPMI-1640; Gibco, BRL, Gaithersburg, MD) containing 10% FCS, 2 mM glutamine (Gibco, BRL), sodium pyruvate (Gibco, BRL), non-essential amino acids (Gibco, BRL), 2 x 10"5 M 2 -mercaptoethanol, 50 U / ml penicillin and streptomycin, and were cultured in the presence of LPS blasts pulsed with P2S # 12 (5 mg / ml P2S # 12 and 10 mg / ml ß2-microglobulin) irradiated (3000 radias) (A2 transgenic spleen cells cultured in the presence of 7 μg / ml dextran sulfate and 25 μg / ml). μg / ml of LPS for 3 days). Six days later, cells (5 x 10 5 / ml) were further stimulated with 2.5 x 10 6 / ml of peptide-pulsed irradiated EL4A2Kb cells (20,000 radias) (Sherman et al., Science, 258: 815-818, 1992). and 3 x 106 / ml of A2 transgenic spleen feeder cells. The cells were cultured in the presence of 20 U / ml of I L-2. Cells were continued re-stimulating on a weekly basis as described, in the preparation of the line cloning. Line P2S # 1 12 was cloned by limiting dilution analysis with EL4 A2Kb tumor cells pulsed with peptide (1 x 10 4 cells / well) as stimulators and A2 transgenic spleen cells as feeders (5 x 10 5 cells / well) grown in the presence of 30 U / ml of I L-2. On day 14, the cells were again stimulated as before. On day 21, the clones that were growing were isolated and kept in culture. Several of these clones demonstrated significantly high reactivity (lysis) against human fibroblasts (expressing HLA A2Kb) transduced with P502S against control fibroblasts. An examples is presented in Figure 1. These data indicate that P2S # 12 represents a naturally processed epitope of the P502S protein that is expressed in the context of the molecule H LA A2Kb h umana. 6. 2. This Example illustrates the preparation of murine CTL lines and CTL clones specific for cells expressing the P501 S gene. These series of experiments were performed similarly to that described above. Mice were immunized with peptide P 1 S # 10 (SEQ ID NO: 337) which was derived from the P501 S gene (also referred to herein as L1-12, SEQ ID NO: 1 10). Peptide P1 S # 10 was derived through analysis of the polypeptide sequence predicted for P501 S for potential HLA-A2 binding sequences as defined through the published HLA-A2 binding motifs (Parker, KC, and others, J. Immunol. 152: 163, 1994). Peptide P 1 S # 10 was synthesized as described in Example 4, and empirically tested for binding to HLA-A2 using a T cell-based proficiency test. Predicted A2 binding peptides were tested for their ability to compete with the presentation of specific peptide H LA-A2 for a restricted CTL clone of HLA-A2 (D 150M58), which is specific for the flu binding peptide HLA-A2 fluM58. D 150M58 CTL secretes TNF in response to self-representation of the fluM58 peptide. In the competition assay, the peptides tested at 100-200 μg / ml were added to the cultures of D 150M58 CTL in order to bind HLA-A2 in the CTL. After thirty minutes, the CTL cultured with test peptides, or control peptides, were tested for their antigen dose responses to the fluM58 peptide in a TNF bioassay standard. As shown in Figure 3, peptide P1S # 10 competes with the restricted HLA-A2 presentation of fluM58, demonstrating that peptide P1S # 10 binds HLA-A2. Mice expressing the transgene for human HLA A2Kb were immunized as described by Theobald et al., (Proc. Nati, Acad. Sci. USA, 92: 11993-11997, 1995) with the following modifications. Mice were immunized with 62.5 μg of P1S # 10 and 120 μg of the l-Ab binding peptide derived from hepatitis B virus protein emulsified in Freund's incomplete adjuvant. Three weeks later these mice were sacrificed and individual cell suspensions were prepared using a nylon mesh. The cells were then resuspended at 6 x 10 6 cells / ml in complete medium (as described above) and cultured in the presence of LPS blasts pulsed with P1S # 10 (2 μg / ml P1S # 10 and 10 mg / ml ß2-microglobulin) irradiated (3000 radias) (A2 transgenic spleen cells cultured in the presence of 7 μg / ml dextran sulfate and 25 μg / ml LPS for 3 days). Six days later, the cells (5 x 10 5 / ml) were further stimulated with 2.5 x 10 6 / ml of peptide-pulsed irradiated EL4A2Kb cells (20,000 radias) as described above and 3 x 106 / ml of A2 transgenic spleen feeder cells. The cells were cultured in the presence of 20 U / ml of IL-2. Cells were continued re-stimulating on a weekly basis in the preparation of the line cloning. After three rounds of in vitro stimulation, a line was generated that recognized Jurkat A2Kb targets pulsed by P1S # 10 and Jurkat targets transduced by P501S as shown in Figure 4. The specific CTL line of P1S # 10 was cloned by limiting dilution analysis with EL4 A2Kb tumor cells pulsed with peptide (1 x 104 cells / cavity) as stimulators and transgenic A2 spleen cells as feeders (5 x 105 cells / well) grown in the presence of 30 U / ml of IL-2. On day 14, the cells were again stimulated as before. On day 21, viable clones were isolated and kept in culture. As shown in Figure 5, five of these clones demonstrated specific cytolytic reactivity against Jurkat A2Kb targets transduced by P501S. These data indicate that P1S # 10 represents a naturally processed epitope of the P501 protein that is expressed in the context of the human HLA A2.1 molecule.

EXAMPLE 7 INITIATION OF IN VIVO CTL USING IMMUNIZATION OF NUDED DNA WITH A PROSTATE ANTIGEN The prostate-specific L1-12 antigen, as described above, is also referred to as P501S. HLA A2Kb Tg mice (supplied by Dr L. Sherman, The Scripps Research Institute, La Jolla, CA) were immunized with 100 μg of P501S in the vector VR1012 both intramuscularly and intradermally. The mice were immunized three times, with a Two-week interval between immunizations. Two weeks after the last immunization, the immune spleen cells were cultured with Jurkat transduced stimulator cells A2Kb-P501S. The CTL lines were stimulated weekly. After two weeks of in vitro stimulation, the CTL activity was evaluated against the transduced P501S targets. Two of the 8 mice developed strong anti-P501S CTL responses. These results demonstrated that P501S contains at least one CTL epitope restricted by naturally processed HLA-A2.

EXAMPLE 8 ABILITY OF HUMAN T CELLS TO RECOGNIZE SPECIFIC PROSTATE POLIPEPTIDES This Example illustrates the ability of T cells specific for a prostate tumor polypeptide to recognize a human tumor. Human CD8 + cells were initiated in vitro to peptide P2S-12 (SEQ ID NO: 306) derived from P502S (also referred to as J1-17) using dendritic cells according to the protocol of Van Tsai et al. (Critical Review in Immunology 18 : 65-75, 1998). The resulting CD8 + cell microcultures were tested for their ability to recognize the P2S-12 peptide presenting by analogous fibroblasts or fibroblasts which were transduced to express the P5023S gene in the ELISPOT assay of? -interferon (see, Lalvani et al., J. Exp. Med. 186: 859-865, 1997). Briefly, titrated T cell numbers were assayed in duplicate on 104 fibroblasts in the presence of 3 μg / ml of human B2 microglobulin and 1 μg / ml of P2S-12 peptide or control E75 peptide. In addition, T cells were tested simultaneously on analogous fibroblasts transduced with the P502S gene or a control, fibroblasts transduced with HER-2 / new. Before the assay, the fibroblasts were treated with 10 ng / ml of β-interferon for 48 hours to over-regulate MHC class I expression. One of the microcultures (# 5) demonstrated strong recognition of both peptide pulsed fibroblasts as well as transduced fibroblasts in the ELISPOT assay of? -interferon. Figure 2A demonstrates that there is a strong increase in the number of β-interferon sites with increased numbers of T cells in fibroblasts pulsed with the peptide P2S-12 (solid bars) but not with the control peptide E75 (open bars). This shows that the ability of T cells to specifically recognize the P2S-12 peptide. As shown in Figure 2B, this microculture also demonstrated an increase in the number of β-interferon spots with increased numbers of T cells on transduced fibroblasts to express the P502S gene but not the ER-2 / neu gene. These results provide additional confirmatory evidence that the P2S-12 peptide is a naturally-processed epitope of the P502S protein. In addition, this also shows that it exists in the repertoire of human T cells, high affinity of T cells that are able to recognize this epitope. These T cells are also capable of recognizing human tumors which express the P502S gene.

EXAMPLE 9 PRODUCTION OF CTL RESPONSES SPECIFIC TO PROSTATE ANTIGEN IN HUMAN BLOOD This Example illustrates the ability of prostate-specific antigen to produce a CTL response in the blood of normal humans. Dendritic antigen (DC) cells were differentiated from PBMC-derived monocyte cultures from normal donors through growth for 5 days in RPMI medium containing 10% human serum, 50 ng / ml GMCSF and 30 ng / ml IL -4. After culturing, the dendritic cells were infected overnight with recombinant P501S expression vaccine virus at M.O. I. of 5 and matured for 8 hours through the addition of 2 micrograms / ml of the CD40 ligand. The virus was inactivated by UV irradiation, CD8 + cells were isolated through positive selection using magnetic beads, and initiation cultures were initiated in 24-well plates. After 5 minutes of stimulation cycles using retrovirally transcribed antigenic fibroblasts to express P501S and CD80, the CD8 + lines were identified as producing specifically interferon-gamma when stimulated with transduced fibroblasts P501 S. The specific activity of P501 S of the B-LCL cell line transduced with P501 S. Line 3_A-1 was shown to specifically recognize B-LCL transduced antologo to express P501 S, but not B-LCL antologo transduced with EGFP, as measured through toxicity assays (release of 51 Cr) and production of interferon-gamma (Interferon-gamma Elispot; see above and Lalvani et al., J. Exp. Med. 186: 859-865, 1997). The results of these tests are presented in Figures 6A and 6B.

EJ EMPLO 10 I NDENTIFICATION OF U N EPITOPO CTL NATURALLY PROVIDED WHAT CONTENT WITHIN THE PROSTATE SPECIFIC P703P ANTIGEN The p5 9-mer peptide (SEQ ID NO: 338) was derived from the P703P antigen (also referred to as P20). The p5 peptide is an immunogenic in human HLA-A2 donors and is a naturally processed epitope, the antigen-specific CD8 + T cells can be initiated following repeated in vitro stimulations with pulsed monocytes with p5 peptide. These CTLs specifically recognize target cells transduced with P703P and pulsed with p5 in both ELI SPOT (as described above) and chromium release assays. Additionally, immunization of transgenic mice HLA-A2Kb with p5 leads to the generation of CTL lines which recognize a variety of transduced target cells HLA-A2Kb or H LA-A2 expressing P703P. Initial studies showed that p5 is a naturally processed epitope in transgenic HLA-A2Kb mice. Transgenic HLA-A2Kb mice were immunized subcutaneously in the footpad with 100 μg of p5 peptide together with 140 μg of hepatitis B virus core peptide (a Th peptide) in an incomplete Freund's assistant. Three weeks after the immunization, the spleen cells of the immunized mice were stimulated in vitro with LPS blasts pulsed with peptide. CTL activity was determined through chromium release assay five days after primary in vitro stimulation. Retrovirally transduced cells expressing the control antigen P703P and HLA-2AKb were used as targets. The CTL lines that specifically recognize both the pulsed targets with p5 and the targets expressing P703P were identified. Human in vitro initiation experiments demonstrated that the p5 peptide is immunogenic in humans. Dendritic cells (CD) were differentiated from PBMC-derived monocyte cultures from normal human donors through culture for 5 days in an RPM I medium containing 10% human serum, 50 ng / ml GM-CSF h umano and 30 ng / ml of human IL-4. After culturing, the dendritic cells were pulsed with 1 μg / ml peptide p5 and cultured with CD8 + T cells enriched with PBMC. The CTL lines were re-stimulated on weekly bases with monocytes pulsed with p5. Five to six weeks after the CTL cultures, CTL recognition of target cells pulsed with p5 was demonstrated. CTL additionally showed to recognize transduced human cells to express P703P, demonstrating that p5 is a naturally processed epitope. Studies that identify an additional peptide epitope (referred to as peptide 4) derived from prostate tumor-specific P703P antigen that is capable of being recognized through Cd4 T cells on the surface of cells in the context of HLA class II molecules It was done as follows. The amino acid sequence for peptide 4 is provided in SEQ ID NO: 638, with the corresponding cDNA sequence being supplied by SEQ ID NO: 639. 20 overlapping 15-mer peptides were generated by 10 amino acids and carboxy-terminal fragment derivatives of P703P, using standard procedures. Dendritic cells (DC) were derived from normal human donor PBMC using GM-CSF and IL-4 through standard protocols. CD4 T cells were generated from the same donor as the dendritic cells using MACS beads and negative selection. The dendritic cells were pulsed overnight with combinations of 15-mer peptides, with each peptide at a final concentration of 0.25 microgram / ml.

The pulsed dendritic cells were washed and placed on a plate at 1 x 1 04 cells / well in 96-well V-shaped bottom plates and the purified CD4 T cells were added at 1 x 105 / well. The cultures were supplemented with 60 ng / ml of IL-6 and 10 ng / ml of I L-12, and incubated at 37 ° C. The cultures were re-stimulated as above on weekly bases using dendritic cells generated and pulsed as above, as antigen presenting cells, supplemented with 5 ng / ml of IL-7 and 10 u / ml of IL-2. After 4 cycles of in vitro stimulation, 96 lines (each line corresponding to a cavity) were tested for specific proliferation and cytosine production in response to the stimulation combinations with an irrelevant combination of mamaglobin-derived peptides being used as a control. A line (designated as 1 -F9) was identified from combination # 1 as demonstrating specific proliferation (measured by 3H proliferation assays) and cytosine production (measured through ELI SA interferon-gamma assays) in response to the # 1 combination of P703P peptides. This line was further tested for specific recognition of the peptide combination, specific recognition of individual peptides in the combination, and comparison analysis with H LA to identify the relevant restrictive allele. Line 1 -F9 was found to proliferate specifically and produce interferon-gamma in response to the # 1 combination of peptide, and also to peptide 4 (SEC I D NO: 638).

Peptide 4 corresponds to amino acids 126-140 of SEQ ID NO: 327. Peptide titration experiments were conducted to determine the sensitivity of line 1 -F9 for the specific peptide. The line was found to respond specifically to peptide 4 at concentrations as low as 0.25 ng / ml, indicating that T cells are very sensitive and thus probably have high affinity to the epitope. To determine the HLA restriction of the P703P response, a panel of antigen presenting cells (APC) was generated that was partially compared to the donor used to generate the T cells. The APC was pulsed with the peptide and used in proliferation and cytosine assays along with line 1 -F9. The APC compared to the donor in the alleles H LA-DRB0701 and HLA-DBQ02 was able to present the peptide to the T cells, indicating that the specific response of P703P is restricted to one of these alleles. Antibody blocking assays were used to determine whether the restricted allele was HLA-DR0701 or HLA DQ02. The anti-HLA-DR block antibody L243 or an irrelevant isotope compared to lgG2a were added to the T cells and APC cultures pulsed with the peptide RMPTVLQCVNVSVVS (SEQ ID NO: 638) at 250 ng / ml. Interferon-gamma standard and proliferation assays were performed. While the control antibody had no effect on the ability of T cells to recognize pulsed APC with peptide in both anti-HLA-DR antibody assays completely blocked the ability of T cells to specifically recognize pulsed APC with peptide. To determine whether the peptide epitope RMPTVLQCVNVSVVS (SEQ ID NO: 638) was naturally processed, the ability of line 1 -F9 to recognize APC pulsed with the recombinant P703P protein was examined. For these experiments a number of sources of recombinant P703P was used: P703P derived from E. coli; P703P derived from Pichia and P703P derived from baculovirus. The irrelevant protein controls used were L3E derived from E. coli, a specific lung antigen) and baculovirus-derived mammaglobin. In the interferon-gamma ELISA assays, line 1 -F9 was able to efficiently recognize both the E. coli forms of P703P and P703P derived from recombinant Pichia, while P703P derived from baculovirus was efficiently recognized less. Subsequent Western staining analysis revealed that the P703P protein preparations E. coli and Pichia were intact while the baculovirus P703P preparation was approximately 75% degraded. In this way, the peptide RMPTVLQCVNVSVVS (SEQ ID NO: 638) of P703P is a naturally processed peptide epitope derived from P703P and presented to T cells in the context of HLA-DRB-0701. In other studies, twenty-four 15-mer peptides overlapped by 10 amino acids and derivatives of the N-terminal fragment of P703P (corresponding to amino acids 27-1 54 of SEQ ID NO: 525) were generated by standard procedures and their abilities to be recognized by CD4 cells were determined essentially as described above. The dendritic cells were pulsed overnight with combinations of the peptides with each peptide at a final concentration of 10 micrograms / ml. A large number of individual CD4 T cell lines (65/480) demonstrated significant proliferation and release of cytosine (IFN-gamma) in response to P703P peptide combinations but not to the control peptide combination. The CD4 T cell lines which showed specific activity were stimulated on an appropriate combination of P703P peptides and re-processed on individual peptides of each combination as well as a peptide dose titration of the peptide combination in a release assay. I FN-gamma and in a proliferation assay. 16 immunogenic peptides were recognized through T cells of the total set of peptide antigens tested. The amino acid sequences of these peptides are provided is SEQ ID NO: 656-671, with the corresponding cDNA sequences being provided in SEQ ID NO: 640-655, respectively. In some cases, the peptide reactivation of the T cell line can be mapped to an individual peptide, however some can be mapped to more than one peptide in each combination. Those T cell lines that exhibit a representative pattern of recognition of each peptide combination with an affinity Reasonable for the peptide were chosen for further analysis (I-1 A, -6A; I I-4C, -5E; II I-6E, IV-4B; -3F, -9B, -10F, V-5B, -4D and -10F). These T cell lines were re-stimulated on the appropriate individual peptide and re-processed on pulsed dendritic cells with a truncated form of the recombinant P703P protein made in E. coli (amino acids 96-254 of SEQ ID NO: 525), Full length P703P made in the baculovirus expression system, and a fusion between the influenza virus NS 1 and P703P made in E. coli. Of the T cell lines tested, the line 1-1A specifically recognized for the truncated form of P703P (E. coli) but not otherwise recombinant for P703P. This line also recognized the peptide used to produce T cells. The 2-4C line that recognizes the truncated form of P703P (E. coli) and the full length form of P703P made in baculovirus, as well as the peptide. The remaining T cell lines tested were either peptide specific only (I I-5E, I I-6F, IV-4B, IV-3F, IV-9B, IV-10F, V-5B and V-4D) or they were not responsive to any tested antigen (V-10F). These results showed that the peptide sequence RPLLAN DLMLI KLDE (SEQ ID NO: 671); corresponding to amino acids 1 10-124 of SEQ ID NO: 525) recognized by the T cell line 1-1 A and the SVSESDTI RSISIAS peptide sequences (SEQ ID NO: 668, corresponding to amino acids 125-139 of SEQ ID NO: 668) NO: 525) and IS IASQCPTAGNSCL (SEQ ID NO: 667; corresponding to amino acids 1 35- 149 of S EC ID NO: 525) recognized by the IT cell line I-4C may be epitopes naturally processed from the P703P protein.

EXAMPLE 11 EXPRESSION OF AN ANTIGEN DERIVED FROM CHEST TUMOR IN PROSTATE The isolation of B305D antigen from breast tumor through differential display is described in the patent application of E. U.A. No. 08 / 700,014, filed August 20, 1996. Several different splice forms of this antigen were isolated. The cDNA sequences determined for these splice forms are provided in SEQ ID NO: 366-375, with the predicted amino acid sequences corresponding to the sequences of SEQ ID NO: 292, 298 and 301-303 being provided in SEQ ID NO: 299-306, respectively. In other studies, a splice variant of the cDNA sequence of SEQ ID NO: 366 was isolated, which was found to contain an additional guanine residue at position 884 (SEQ ID NO: 530), leading to a displacement of frame in an open reading frame. The determined DNA sequence of this ORF is provided in SEC I D NO: 531. This frame shift generates a protein sequence (provided in SEQ ID NO: 532) of 293 amino acids that contain the common C-terminal domain after B305D isoforms but which differs in the N-terminal region. The expression levels of B305D in a variety of tumor and normal tissues were examined by real-time PCR and Northern analysis. The results indicate that P305D is highly expressed in breast tumor, prostate tumor, normal prostate and normal testes, with the expression being low or not detectable in all other tissues examined (colon tumor, lung tumor, ovarian tumor, and normal bone marrow, colon) , kidney, liver, lung, ovary, skin, small intestine, stomach). Using real-time PCR on a panel of prostate tumors, the expression of B305D in prostate tumors showed that it increases with an increased Gleason score, demonstrating that the expression of B305D increases as advances in prostate cancer.

EXAMPLE 12 GENERATION OF IN VITRO HUMAN CTL USING ENTIRE GENE STARTING AND STIMULATION TECHNIQUES WITH THE SPECIFIC PROSTATE ANTIGEN P501S Using whole gene initiation in vitro with dendritic cells infected with P501S vaccine (see, for example, Yee et al., The Journal of Immunology, 157 (9); 4079-86, 1996), the lines of CTL cells were derived that specifically recognize antigenic fibroblasts transduced with P501S (also known as L1-12), as determined by ELISPOT analysis of interferon-? as described above. Using a panel of B-LCL lines paired with HLA transduced with P501S, these CTL lines showed to be probably restricted from monocyte-derived cultures from PMBCs from normal human donors through growth for 5 days in an RPMI medium containing 10% human serum, 50 ng / ml GM-CSF and 30 ng / ml human IL-4. After culturing, the dendritic cells were infected overnight with recombinant P501 S vaccine virus at a multiplicity of infection (M.O.I.) of five, and matured overnight through the addition of 3 μg / ml CD40 ligand. The virus was inactivated through UV irradiation. The CD8 + T cells were isolated using a magnetic bead system, and the initiated cultures were initiated using standard culture techniques. Cultures were stimulated every 7-10 days using analogous primary fibroblasts transduced retrovirally with P501 S and CD80. After the stimulation cycles, the CD8 + T cell lines were identified as specifically producing interferon-? when they were stimulated with anthologous fibroblasts transduced by P501 S and CD80. A panel of B-LCL lines of HLA inequality transduced with P501 S were generated to define the restriction allele of the response. Through the measurement of interferon-? in an ELI SPOT assay, the specific response of P501 S showed to be probably restricted by the H LA B alleles. These results demonstrated that the CTL response of CD8 + to P501 S can be produced. To identify the recognized epitope (s), AD Nc coding P501 S was fragmented through various digests of restriction, and subcloned into a retroviral expression vector pBI B-KS. The retroviral supernatants were generated through the transfection of the Phoenix-Ampho auxiliary packaging line. The supernatants were then used to transduce Jurkat / A2Kb cells for CTL sorting. The CTL was classified in ELISPOT assays of I FN-gamma against these A2Kb targets transduced with the "collection" of P501 S fragments. The initial fragments of P501 S / H3 and P501 S / F2 were sequenced and found to encode the amino acids 106-553 and amino acids 136-547, respectively, of SEQ ID NO: 1 13. A truncation of H3 was made to encode amino acid residues 106-351 of SEQ ID NO: 13, which was unable to stimulate CTL, as well as locating the epitope to amino acid residues 351 -547. Additional fragments encoding amino acids 1 .472 (Fragment A) and amino acids 1 -351 (Fragment B) were also constructed. Fragment A but not Fragment B stimulated CTL as well as localized the epitope of amino acid residues 351 -472. Overlapping 20-mer and 18-mer peptides representing this region were tested through Jurkat / A2Kb cells pulsed against CTL in an I FN-gamma assay. Only the peptides P501 S-369 (20) and P501 S-369 (18) stimulated the CTL. The 9-mer and 1 0-mer peptides representing this region were synthesized and similarly tested. Peptide P501 S-370 (SEC I D NO: 539) was the minimum 9-mer giving a strong response. Peptide P501 S-376 (SEC I D NO: 540) also gave a weak response, suggesting that it can represent a cross-reaction epitope. In subsequent studies, the ability of primary human B cells transduced with P501 S to initiate restricted Ciase I MHC, specific P501 S, autologous CD8 T cells were examined. The primary B cells were derived from PBMC from a homozygous HLA-A2 donor through culture in CD40 ligand and IL-4, transduced at a high frequency with recombinant P501 S in the vector pBI B, and selected with bastocidin-S. For in vitro initiation, CD8 + T cells were grown with analogous CD40 ligand + IL-4 derived, B cells transduced with P501 S in a 96-well microculture format. These CTL microcultures were re-stimulated with B cells transduced with P501 S and then analyzed for specificity. After this initial classification, with an important signal above the background where they were cloned on B cells transformed with EBV antologo (BLCL), they were also transduced with P501 S. Using I FN-gamma ELISPOT for detection, several of these clones CD8 T cells were found to be specific for P501 S, as demonstrated through reactivity to BLCL / P501 S but not BLCL transduced with the control antigen. It was further demonstrated that the specificity of anti-P501 S CD8 T cells is restricted by H LA-A2. First, antibody block experiments with anti-HLA-A, B, C monoclonal antibody (W6.32), anti-HLA-B monoclonal antibody, C (B 1.23.2) and a monoclonal control antibody showed that only Anti-H antibody LA-A, B, C blocked the recognition of BLCL antologo expressing P501S. Second, the anti-P501S CTL also recognized an HLA-A2 comparison, heterologous BLCL transduced with P501S, but not the corresponding control BLCL transduced with EGFP. A restricted class I peptide epitope, CD8, naturally processed from P501S was identified as follows. Dendritic cells (DC) were isolated through Percol gradient followed by differential adhesion, and cultured for 5 days in the presence of an RPMI medium containing 1% human serum, 50 ng / ml GM-CSF and 30 ng / ml IL-4. After culturing, the dendritic cells were infected for 24 hours with adenovirus expressing P501S at an MOI of 10 and matured for an additional 24 hours through the addition of 2 μg / ml of the CD40 ligand. CD8 cells were enriched through the subtraction of CD4 + populations, CD14 + and CD16 + of PBMC with magnetic beads. Started cultures containing 10,000 dendritic cells expressing P501S and 100,000 CD8 + T cells per well were configured in 96-well V-bottom plates with RPMI containing 10% human serum, 5 ng / ml I-L-2 and 10 ng / ml of IL-6. Cultures were stimulated every 7 days using retrovirally transduced antigenic fibroblasts to express P501S and CD80, and treated with IFN-gamma for 48-72 hours to over-regulate MHC Class I expression. 10 u / ml IL-2 was added. at the time of stimulation and on days 2 and 5 after stimulation. After 4 stimulation cycles, a line of CD8 + cell specific of P501 S (designated as 2A2) was identified as producing IFN-gamma in response to P501 S / CD80 treated with IFN-gamma expressing antologous fibroblasts, but is not responding to P703P / CD80 treated with I FN-gamma expressing Antibody fibroblasts in the trial? -I FN Elispot. Line 2A2 was cloned into 96-well plates with 0.5 cell / cavity or 2 cell / cavity in the presence of 75,000 PBMC / well, 10,000 B-LCL / well, 30 ng / ml OKT3 and 50 u / ml IL-2 . Twelve clones were isolated that showed strong P501 S specificity in response to transduced fibroblasts. A fluorescence activated cell sorting (FACS) analysis was performed on specific P501 S clones using CD3, CD4, and CD8 specific antibodies conjugated to PercP, FITC, and PE respectively. Consistent with the use of CD8-rich T cells in the initiation cultures, it was determined that the specific clones of P5401 S are CD3 +, CD8 + and CD4-. To identify the relevant P501 S epitope recognized by P501 S specific CTL, combinations of 18-20 mer or 30-mer peptides were loaded which extended most of the amino acid sequence of P501 S, on B-LCL antólogos and were tested in? -I FN Elispot assays for the ability to stimulate two specific CTL clones of P501 S, designated as 4E5 and 4E7. A combination, composed of five 18-20 mer peptides that extended amino acids 41 1-486 of P501 S (SEC I D NO: 1 13), was found to be recognized by both specific clones of P501 S. To identify the specific 18-20 mer peptide by the clones, each of the 18-20 merque peptides comprising the positive combination was individually tested in? -I FN Elispot assays for the ability to stimulate the two clones CTL specific for P501 S, 4E5 and 4E7. Both 4E5 and 4E6 specifically recognize a 20-mer peptide (SEQ ID NO: 710; cDNA sequence provided in SEQ ID NO: 71 1) that extended amino acids 453-472 of P501 S. Since the minimum epitope recognized by T cells CD8 + is always almost any 9 or 10-mer peptide sequence, the 10-mer peptides that extend the complete sequence of SEQ ID NO: 710 were synthesized as they differ by an amino acid. Each of these 10-mer peptides was tested for the ability to stimulate two specific P501 S clones, (referred to as 1 D5 and 1 E 12). A 10-mer peptide (SEQ ID NO: 712; cDNA sequence provided in SEQ ID NO: 713) was identified as specifically stimulating the specific clones of P501 S. This epitope extends amino acids 463-472 of P501 S. This sequence it defines a minimal 10-mer epitope of P501 S that can be naturally processed and in which CTL responses can be identified in normal PBMC. Thus, this epitope is a candidate for use as a portion of a vaccine, and as a therapeutic and / or diagnostic reagent for prostate cancer. To identify the class I restriction element for the sequence derived from P501 S of SEC I D NO: 71 2, blocking and inequality analyzes of H LA were performed. In the trials? -I FN Elispot, the specific response of clones 4A7 and 4E5 to fibroblasts transduced by P501 S were blocked through pre-incubation with 25 ug / ml of W6 / 32 (blocking antibody pan). These results demonstrated that the specific response of SEC I D NO: 712 is restricted to an HLA-B or HLA-C allele. For the HLA inequality analysis, B-LCL antologous (HLA-A1, A2, B8, B51, Cwl, Cw7) and heterologous B-LCL (HLA-A2, A3, B18, B51 Cw5, Cw14) that share the allele HLAB51 were pulsed for one hour with 20 ug / ml of the peptide of SEQ ID NO: 712, washed and tested in? -I FN Elispot assays for the ability to stimulate clones 4E7 and 4E5. Antibody blocking assays were also performed with B 1 .23.2 (blocking antibody HLA-B / C). The specific response of SEQ ID NO: 712 was detected using both autologous B-LCL (D326) and heterologous B-LCL (D107), and in addition the responses were blocked through pre-incubation with 25 ug / ml of blocking antibody B 1 .23.2 HLA-B / C. Together these results showed that the specific response of P501 S to the peptide of SEC I D NO: 712 is restricted to the HLA-B51 class I allele. Molecular cloning and sequence analysis of the HLA-B51 allele of D3326 revealed that the HLA-B51 subtype of D326 is H LA-B51 01 1. Based on the epitope derived from P501 S 10-mer of SEQ ID NO: 712, two 9-mer sequences with S EC ID NO: 714 and 71 5 were synthesized and tested in Elispot assays for the ability to stimulate two CTL clones. specific to P501 S derivatives of line 2A2. The 10-mer peptide of SEQ ID NO: 712, as well as the 9-mer peptide of SEQ ID NO: 715, but not the 9-mer peptide of SEQ ID NO: 714, were capable of P501 S-specific CTL stimulation. to produce IFN-gamma. These results demonstrated that the peptide of SEQ ID NO: 715 is an epitope derived from P501 S recognized by CTL specific for P501 S. The DNA sequence encoding the epitope of SEQ ID NO: 715 is provided in SEQ ID NO: 716 To identify the restricted class I allele for the peptide derived from P501 S of the specific response of SEQ ID NO: 712 and 715, each of the HLA B and C alleles were cloned from the donor used in the in vitro initiation experiment . Sequence analysis indicated that the relevant alleles were HLA-B8, HLA-B51, HLA-Cw01 and HLA-Cw07. Each of these alleles was subcloned into an expression vector and co-transfected together with the P501 S gene into the VA-1 3 cells. The transfected VA-13 cells were then tested for the ability to specifically stimulate the specific CTL of P501 A in ELISPOT trials. The VA-13 cells transfected with P501 S and HLA-B51 were able to stimulate specific CTL of P501 S to secrete gamma-IFN. The VA-13 cells transfected with H LA-B51 alone or P501 S + HLA alleles were not able to stimulate specific CTL of P501 S. These results demonstrated that the restriction allele for the specific response of P501 S is the HLA- allele. B51 Sequence analysis revealed that the allele subtype of relevant restriction is HLA-B5101 1. To determine if the specific CTL of P501 S can recognize prostate tumor cells expressing P501 S, line of P501 S positive of LnCAP and CRL2422 (both express "moderate" amounts of mRNA of P501 S and protein), and PC- (expressing low amounts of P501 S mRNA and protein), but the cell line of P501 S negative DU-145 were retrovirally transduced with the allele HLA-B5101 1 that was cloned from the donor used to generate the specific CTL of P501 S. The transduced cells of selected HLA-B5101 1 or EGFP or tumor were treated with gamma-interferon and androgen (for over-regulated stimulating functions and P501 S, respectively) and used gamma-assays. interferon Elispot with the specific CTL clones of P501 S 4E5 and 4E7. The untreated cells were used as a control. Both 4E5 and 4E7 efficiently and specifically recognized LnCAP and CRL2422 cells that were transduced with the HLA-B5101 allele 1, but not the same cell lines transduced with EGFP. Additionally, both CTL clones specifically recognized PC-3 cells transduced with HLA-B5101 1, but not the P501 S negative tumor cell line DU-145. Treatment with gamma-interferon or androgen did not improve the ability of CTL to recognize tumor cells. These results demonstrate that CTL specific for P501 S, generated through complete gene initiation in vitro specifically recognizes and efficiently prostate tumor cell lines expressing P501 S. A naturally processed CD4 epitope of P501 S was identified as follows. CD4 cells specific for P501 S were prepared as described above. Series of 16 overlapping peptides were synthesized to extend approximately 50% of the amino terminal portion of the P501 S gene (amino acids 1 -325 of SEQ ID NO: 13). For initiation, the peptides were combined into combinations of 4 peptides, pulsed at 4 μg / ml into dendritic cells (DC) for 24 hours, with TN F-alpha. The dendritic cells were then washed and mixed with negatively-selected CD + T cells in 96-well U-bottom plates. The cultures were re-stimulated weekly on fresh dendritic cells loaded with peptide combinations. After a total of 4 stimulation cycles, the cells were allowed to stand for an additional week and were tested for pulsed APC specificity with peptide combinations using? -I FN ELISA assays and proliferation. For these trialsAdherent monocytes loaded with any relevant peptide combination at 4 ug / ml or an important peptide at μg / ml were used as APC. The cell lines that showed both specific cytosine secretion and proliferation were then tested for recognition of individual peptides that were present in the combination. The T cell lines can be identified from combinations A and B that recognize individual peptides of these combinations. From combination A, lines Ad9 and AE10 specifically recognized peptide 1 (SEQ ID NO: 719) and line AF5 recognized peptide 39 (SEQ ID NO: 718). From combination B, line BC6 can be identified as recognizing peptide 58 (SEQ ID NO: 717). Each of these lines were stimulated in the specific peptide and tested for specific recognition of peptide in a titration assay as well as cell lysates generated through infection of HEK 293 cells with adenovirus expressing any P501S or important antigen. For these assays, APC-adherent monocytes were pulsed with 10, 1, or 0.1 μg / ml of individual P501S peptides and the dendritic cells were pulsed overnight with a 1: 5 dilution of adenovirally infected cell lysates. Lines AD9, AE10 and Af5 retained significant recognition of the peptides derived from P510S even at 0.1 mg / ml. In addition, the AD9 line demonstrated significant specific activity (folded stimulation index 8.1) for lysates from cells infected with adenovirus P501S. These results demonstrated that high affinity CD4 T cell lines can be generated towards epitopes derived from P501S, and that at least one subset of these T cells specific for the sequence derived from P501S of SEQ ID NO: 719 are specific for an epitope which is processed naturally through human cells. The cDNA sequences encoding the sequences of a acid of SEC I D NO: 717-719 are provided in SEQ ID NO: 720-722, respectively. To further characterize the specific activity of P501 S of AD9, the line was cloned using anti-CD3. Three clones, named 1 A1, 1 A9 and 1 F5, were identified that were specific for peptide P501 S-1 (SEQ ID NO: 719). To deter the HLA restriction allele for the specific response of P501 S, each of these clones was tested on the class II blocking antibody and HLA inequality assays using proliferation and gamma-interferon assays. In the antibody blocking assays and gamma-interferon production measurement using ELISA assays, the ability of these three clones to recognize APC pulsed by peptide was specifically blocked through co-incubation with any class II pan blocking antibody or an HLA-DR blocking antibody, but not with HLA-DQ or an irrelevant antibody. Proliferation assays performed simultaneously with the same cells confirmed these results. These data indicate that the specific response of P501 S of the clones is restricted by an HLA-DR allele. Other studies showed that the restriction allele for the specific response of P501 S is H LA-DRB 1501.

EXAMPLE 13 IDENTIFICATION OF SPECIFIC PROSTATE ANTIGENS THROUGH MICRO DISPOSAL ANALYSIS This Example describes the isolation of certain prostate-specific polypeptides from a collection of prostate tumor cDNAs. A collection of human prostate tumor cDNA as described above was classified using microarray analysis to identify clones exhibiting at least one over-expression of three folds in prostate tumor and / or normal prostate tissue, compared to tissues normal non-prostate (not including testicles). 372 clones were identified, and 319 were successfully sequenced. The quadrill presents a summary of these clones, which are shown in SEQ ID NOs: 385-400. Of these sequences SEQ ID NO: 386, 389, 390 and 392 correspond to novel genes, and SEQ ID NOs: 393 and 396 correspond to sequences previously identified. The others (SEQ ID NOs: 385, 387, 388, 391, 395, and 397-400) correspond to known sequences, as shown in Table 1.

TABLE 1 Summary of Prostate Tumor Antigens CGI-82 showed 4.06 times of overexpression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 43% of prostate tumors, 25% normal prostate, not detected in other normal tissues tested. L-iditol-2 dehydrogenase showed 4.94 fold over expression in prostate tissues as compared to other normal tissues tested. The transcription factor Ets PDEF showed 5.55 times over-expression of prostate tissues as compared to the other normal tissues tested. It was over expressed in 47% of prostate tumors, 25% of normal prostate and was not detected in other normal tissues tested. hTGR1 showed 9.1 1-fold over expression in prostate tissues as compared to the other normal tissues tested. Over-expressed in 63% of tumors of prostate and was not detected in normal tissues tested including normal prostate. KIAA0295 showed 5.59 times over expression in prostate tissues as compared to the other normal tissues tested. It is over-expressed in 47% of prostate tumors, low in non-detectable normal tissues tested including normal prostate tissues. Prostatic acid phosphatase showed over 9, 14 fold expression in prostate tissues as compared to other normal tissues tested, and was not detected in other normal tissues tested. Transglutaminase showed 14.84 fold on expression in prostate tissues as compared to the other normal tissues tested. It was overexpressed in 30% of prostate tumors, 50% of normal prostate and was not detected in the other normal tissues tested. High-density lipoprotein binding protein (HDLBP) showed 28.06 fold over expression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 79% of prostate tumors, 75% of normal prostate and was not detected in the other normal tissues tested. CG I-69 showed 3.56 times over expression in prostate tissues as compared to other normal tissues tested. This is a low abundant gene, detected in more than 90% of prostate tumors, and in 75% of normal prostate tissues. The expression of this gene in normal tissues was very low. KIAA0122 showed 4.24 times over expression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 57% of prostate tumors, it was undetectable in all other tissues normal tested including normal prostate tissues. Bangui 19142.2 showed 23.23 times over expression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 97% of prostate tumors and 100% of normal prostate. It was undetectable in the other normal tissues tested. Wang 5566.1 showed 3.31 times over expression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 97% of prostate tumors, 75% in normal prostate and also over expressed in normal bone marrow, pancreas, and activated PBMC. The novel clone 23379 (also referred to as P553S) showed 4.86 fold over expression in prostate tissues as compared to the other normal tissues tested. It was detectable in 97% of prostate tumors and 75% of normal prostate, and is undetectable in all other normal tissues tested. The novel clone 23399 showed 4.09 times on expression in prostate tissues as compared to the other normal tissues tested. It was over expressed in 27% of prostate tumors and was undetectable in all other normal tissues tested including normal prostate tissues. The novel clone 23320 showed 3.15 fold over expression in prostate tissues as compared to the other normal tissues tested. It was undetectable in all prostate tumors and 50% of normal prostate tissues. It was also expressed in normal colon and trachea. Other normal tissues did not express this gene at a high level. Full-length cloning studies Subsequent studies on P553S, using standard techniques, revealed that this clone is an incomplete splice of P501 S. The cDNA sequences determined for four P553S splice variants are provided in SEQ ID NO: 623-626. An amino acid sequence encoded by SEQ ID NO: 626 is provided in SEQ ID NO: 627. The cDNA sequencer of SEQ ID NO: 623 was found to contain two open reading frames (ORFs). The amino acid sequences encoded by these two ORFs are provided in SEQ ID NOs: 628 and 629.

EXAMPLE 14 I D ENTIFICATION OF P ESTICID ES D ECTIC F ESTS THROUGH ELECTRONIC SUBSTRACTION This Example describes the use of an electronic subtraction technique to identify specific prostate antigens. The potential prostate-specific genes present in the GenBank human EST database were identified by electronic subtraction traces (similar to that described by Vasmatizis et al., Pro'c. Nati Acad. Sci. USA 95: 300-304, 1998). The sequences of EST clones (43,482) derived from various prostate collections were obtained from the public human EST database of Gen Bank. Each prostate EST sequence was used as a search sequence in a BLASTN search (National Center for Biotechnology Information) against the human EST database. All comparisons considered identical (comparison sequence length> 100 base pairs, density of identical comparisons over this region> 70%) were grouped (aligned) together in a group. Groups containing more than 200 ESTs were discarded since they probably represent repetitive elements or highly expressed genes such as aqs for ribosomal proteins. If two or more groups or clusters share common ESTs, those groups or clusters were grouped together within a "supergroup", resulting in 4,345 prostate supergroups. The records for the 479 human cDNA collections represented in the GenBank release were downloaded to create a database for these cDNA collection records. These 479 cDNA collections were grouped into three groups: More (collections of normal prostate and prostate tumor, and breast cell line collections, where the expression was desired), Less (collections of other normal tissues, in where the expression was not desired), and Others (collections of fetal tissue, infant tissue, tissues found only in women, non-prostate tumors, and cell lines different from prostate cell lines, where expression was considered as irrelevant). A summary of these collections groups is presented in Table I I.

TABLE II Collections of Prostate cDNA and ESTs Each supergroup was analyzed in terms of ESTs within the supergroup. The tissue source of each EST clone was well-known and used to classify the supergroups into four groups: Type 1 EST clones found only in the Más group collections; no expression was detected in the collections of Less and Other groups; EST clones of Type 2 derived only from the collections of the Más and Others groups; no expression was detected in the Minus group; EST clones of Type 3 derived from the collections of the Más, Menos, or Others group, but the number of ESTs derived from the Más group is greater than both the Menos group and the Others group; and the Type 4 EST clones derived from the collections of the Más, Menos and Otros groups, but the number derived from the Más group is greater than the number derived from the Menos group. This analysis identified 4,345 breast groups (see Table III). Of these groups, 3, 172 EST clones were ordered from Research Genetics, Inc. and were received as frozen glycerol stocks in 96-well plates.

TABLE III Summary of the Prostate Group The EST clone inserts were amplified with PCT using PCT primers linked to amino for the Synteni microarray analysis. When more than one PCR product was obtained for a particular clone, the PCR product was not used for expression analysis. In total, 2,528 clones from the electronic subtraction method were analyzed through microarray analysis to identify electronic subtraction chest clones that have high tumor levels against normal tissue mRNA. These classifications were made using Synteni micro-arrangement (Palo Alto, CA), according to the manufacturer's instructions (and essentially as described). by Schena et al., Proc. Nati Acad. Sci. USA 93: 10614-10619, 1996 and Heller et al., Proc. Nati Acad. Sci. USA 94: 2150-2155, 1997). Within these analyzes, the clones were analyzed in the wafer, which was then tested with fluorescent probes generated from normal prostate and tumor cDNAs, as well as from several other normal tissues. The slides were scanned and the fluorescent intensity was measured. Clones with an expression ratio greater than 3 (ie, the level in mRNA of prostate tumor and normal prostate was at least three times the level of mRNA from other normal tissues) were identified as specific prostate sequences ( IV). The sequences of these clones are provided in SEQ ID NO: 401 -453 with certain novel sequences shown in SEQ ID NO: 407, 413,, 416-419, 422, 426, 427 and 450.

TABLE IV Specific clones of Prostate tumor SEC ID NO: Designation Sequence Comments 401 22545 P 1 000C previously identified 402 22547 P704P previously identified 10 15 20 25 10 15 20 25 Other studies on the clone of SEQ ID NO: 407 (also referred to as P1020C) led to the isolation of an extended cDNA sequence provided in SEQ ID NO: 591. This extended cDNA sequence was found to contain an open reading frame encoding the predicted amino acid sequence of SEQ ID NO: 592. The P1020C cDNA and the amino acid sequences were found to show some similarity to the human endogenous retroviral pol HERV-K gene and protein.

EXAMPLE 15 ADDITIONAL IDENTIFICATION OF SPECIFIC ANTIGENS OF PROSTATE THROUGH MICRO DISPOSAL ANALYSIS This Example describes the isolation of additional prostate-specific polypeptides from the prostate tumor cDNA library. A collection of prostate tumor cDNA expression Human as described above was classified using micro-disposition analysis to identify clones that exhibit at least three times the overexpression in prostate tumor and / or normal prostate tissue, as compared to normal non-prostate tissues (not including testes) . 142 clones were identified and sequenced. Certain of these clones are shown in SEC I D NO: 454-467. Of these sequences, SEC I D NO: 459-460 represents novel genes. The other SEQ ID NOs: 454-458 and 461-467 correspond to known sequences. Comparison of the cDNA sequence determined from SEQ ID NO: 461 with Genbank database sequences using the BLAST program revealed homology to previously identified transmembrane protease serine 2 (TMPRSS2). The full length cDNA sequence for this clone is provided in SEQ ID NO: 751, with the corresponding amino acid sequence being provided in SEQ ID NO: 752. The cDNA sequence encoding the first 209 amino acids of TMPRSS2 is provided in SEC ID NO: 753, with the first 209 amino acids being provided in SEQ ID NO: 754. The sequence of SEQ ID NO: 462 (referred to as P835P) was found to correspond to previously identified clone FLJ 13518 (Access AK023643; SEQ ID NO: 774), which does not have an associated open reading frame (ORF). This clone was used to search the Genseq DNA database and compare a clone previously identified as a G-protein coupled receptor protein (Access DNA A09351 Genseq; Genseq amino acid) Access Y92365), which is characterized through the presence of 7 transmembrane domains. Sequences of the fragments between these domains are provided in SEQ ID NO: 788-785, with SEQ ID NO: 778, 780, 782, and 784 representing extracellular domains and SEQ ID NO: 779, 781, 783, and 785 representing domains intracellular SEQ ID NO: 778-785 represent amino acids 1-28, 53-61, 83-103, 124-143, 165-201, 226-238, 263-272 and 297-381, respectively of P835). The full-length cDNA sequence for P835P is provided in SEQ ID NO: 773. The cDNA sequence of the P835P open reading frame, including the stop codon, is provided in SEQ ID NO: 775, with the reading frame opened no stop codon being provided in SEQ ID NO: 776 and the corresponding amino acid sequence being provided in SEQ ID NO: 777.

EXAMPLE 16 ADDITIONAL CHARACTERIZATION OF THE SPECIFIC ANTIGEN OF PROSTATE P710P This Example describes the full-length cloning of P710P. The prostate cDNA library described above was classified with the P710P fragment described above. One million colonies were plated on LB / ampicillin plates. Nylon membrane filters were used to developing these colonies and the cDNAs collected through these filters were then denatured and entangled through UV light. The P710P fragment was radiolabelled and used for hybridization with the filters. Positive cDNA clones were selected and their cDNAs were recovered and sequenced through an automatic sequencer from Perkin Elmer / Applied Biosystems Sequencer Division. Four sequences were obtained, and presented in SEQ ID NO: 468-471. These sequences appear to represent different splice variants of the P710P gene. The subsequent comparison of the cDNA sequences of P710P with those of Genbank revealed the homology to the DD3 gene (accession numbers of Genbank AF103907 and AF103908). The DD3 cDNA sequence is provided in SEQ ID NO: 618.

EXAMPLE 17 EXPRESSION OF PROTEIN OF SPECIFIC ANTIGENS PROSTATE This example is the expression and purification of prostate-specific antigens in E. coli, baculovirus, mammalian and yeast cells. a) Expression of P501S in E. coli Expression of the full-length form of P510S was attempted by first cloning P510S without the leader sequence (amino acid) 36-553 of SEQ ID NO: 113) current below the first 30 amino acids of M. tuberculosis antigen Ra12 (SEQ ID NO: 484) in pET17b. Specifically, P501S DNA was used to perform the PCR using the primers AW025 (SEQ ID NO: 485) and AW003 (SEQ ID NO: 486). AW025 is a sense cloning primer that contains a Hindlll site. AW003 is an antisense cloning primer that contains an EcoRl site. DNA amplification was performed using 5 μl of 10X Pfu pH buffer, 1 μl of 20 mM dNTPs, 1 μl of each of the PCR primers at a concentration of 10 μM, 40 μl of water, 1 μl of polymerase of Pfu DNA (Stratagene, La Jolla, CA) and 1 μl of DNA at 100 ng / μl. Denaturation at 95 ° C was performed for 30 seconds, followed by 10 cycles at 95 ° C for 30 seconds, at 60 ° C for 1 minute and at 72 ° C for 3 minutes, 20 cycles at 95 ° C for 30 seconds, 65 ° for 1 minute and for 72 ° C for 3 minutes, and finally through 1 cycle at 72 ° C for 10 minutes. The PCR product was cloned into Ra12m / pET17b using Hind 111 and EcoRl. The sequence of the resulting fusion constructed (designated as Ra12-P501 S-F) was confirmed by DNA sequencing. The built merger was transformed into BL21 (DE3) pLysE, pLysS and CodonPlus E.coli (Stratagene) and grown overnight in LB broth with kanamycin. The resulting culture was induced with IPTG. The protein was transferred to the PVDF membrane and blocked with 5% nonfat milk (in PBS-Tween pH regulator), washed three times and incubated with antibody labeled anti-His mouse (Clontech) for one hour, the membrane was washed three times and probed with protein A HRP (Zymed) for 30 minutes. Finally, the membrane was washed three times and cultured with ECL (Amersham). No expression was detected through Western staining. Similarly, no expression was detected through Western staining when the fusion of Ra12-P501S-F was used for expression in BL21CodonPlus by phage CE6 (Invitrogen). A fragment of N-terminal P501S (amino acids 36-325 of SEQ ID NO: 113) were cloned downstream of the first 30 amino acids of the M. tuberculosis antigen Ra12 in pET17b as follows. P501S DNA was used to perform the PCR using the primers AW025 (SEQ ID NO: 485) and AW027 (SEQ ID NO: 487). AW027 is an antisense cloning primer that contains the EcoRI site and a stop codon. The cDNA amplification was performed essentially as described above. The resulting PCR product was cloned into Ra12 in pET17b at the Hindlll and EcoRl sites. The constructed fusion (designated as Ra12-P501 S-N) was confirmed through DNA sequencing. The constructed Ra12-P501S-N fusion was used for expression in BL21 (DE3) pLys, pLysS and CodonPlus, essentially as described above. Using Western staining analysis, the protein bands were observed at the expected molecular weight of 36 kDa. Some high molecular weight bands were also observed, probably due to the aggregation of the recombinant protein. No expression was detected through Western staining when the Ra12-P501 S-N fusion was used for BL21 CodonPlus expression by phage CE6. A constructed fusion comprising a portion of C-terminal P501 S (amino acids 257-553 of SEQ ID NO: 13) located downstream of the first 30 amino acids of the M. tuberculosis antigen Ra 12 (SEQ ID NO. : 484). The P501 S DNA was used to perform the PCR using the primers AW026 (SEQ ID NO: 488) and AW003 (SEQ ID NO: 486). AW026 is a sense cloning primer that contains the Hindl l l site. The DNA amplification was performed essentially as described above. The resulting PCR product was cloned into Ra 12 in pET17b at the Hind 111 and EcoRl sites. The sequence for the built fusion (referred to as Ra 12-P501 S-C) was confirmed. The constructed fusion of Ra 12-P501 S-C was used for expression in BL21 (DE3) pLysE, pLysS, and CodonPlus, as described above. A small amount of protein was detected through Western staining, with some molecular hair aggregates that were also observed. The expression was also detected through Western staining when the Ra 12-P501 S-C fusion was used for expression in BL21 CodonPlus induced by phage CE6. A constructed fusion comprising a fragment of P501 S (amino acids 36-298 of SEQ ID NO: 13) located downstream of M. tuberculosis tuberculosis Ra 12 (SEQ ID NO: 705) is Prepared as follows. P501S DNA was used to perform the PCR using the primers AW042 (SEQ ID NO: 716) and AW053 (SEQ ID NO: 707). AW042 is a sense cloning primer that contains the EcoRl site. AW053 is an antisense initiator with stop and Xhol sites. The DNA amplification was performed essentially as described above. The resulting PCR product was cloned into Ra12 in pET17b at the EcoRI and Xho I sites. The resulting constructed fusion (designated as Ra12-P501S-E2) was expressed in B834 (DE3) host cells pLys S E. coli, in a TB medium for 2 hours at room temperature. The expressed protein was purified by washing the inclusion bodies and running on a Ni-NTA column. The purified protein remained soluble in the pH buffer containing 20 mM of Tris-HCl (pH 8), 100 mM of NaCl, 10 mM of β-Me and 5% of glycerol. The determined cDNA and amino acid sequences for the expressed fusion protein are provided in SEQ ID NOs: 708 and 709, respectively. b) Expression of P501S in Baculovirus The Bac-a-Bac baculovirus expression system (BRL Life Technologies, Inc.) was used to express the P501 protein in insect cells. The full-length P501S (SEQ ID NO: 113) was amplified by PCR and cloned into the Xbal site of donor plasmids pFactBacl. Recombinant bacmid and baculovirus were prepared according to the manufacturer's instructions. The recombinant baculovirus was amplified in Sf9 cells and the materials High-titration viral supply were used to infect five high cells (Invitrogen) to make the recombinant protein. The identity of the full length protein was confirmed through N-terminal sequencing of the recombinant protein and through Western staining analysis (Figure 7). Specifically, 0.6 million cells were infected Five high in 6-well plates with either the control virus not related BV / ECD_PD (lane 2), with the recombinant baculovirus for P501 S at different amounts or MOIs (lanes 4-8) , or did not become infected (lane 3). The cell lysates were run on SDS-PAGE under reducing conditions and analyzed by Western staining with the anti-P501 S monoclonal antibody P501 S-10E3-G4D3 (prepared as described below). Lane 1 is the molecular weight marker of biotinylated protein (BioLabs). The localization of recombinant P501 S in the insect cells was investigated as follows. The insect cells on expressing P501 S were fractionated into nucleus, mitochondria, membrane and cytosol fractions. Equal amounts of protein were analyzed for each fraction through Western staining with a monoclonal antibody against P501 S. Due to the fractionation scheme, both fractions of nuclei and mitochondria contain some plasma membrane components. However, the membrane fraction is basically free of mitochondria and nucleus. P501 S was found to be present in all fractions containing the membrane component, suggesting that P501S can be associated with plasma membrane of insect cells by expressing the recombinant protein. c) Expression of P501S in Mammalian Cells The full length P501S (553 amino acids; NO: 113) was cloned into several mammalian expression vectors, including pCEP4 (Invitrogen), pVR1012 (Vical, San Diego, CA) and a modified form of the retroviral vector bPMN, designated as pBIB. Transfection of P501S / pCEP4 and P501 S / pVR1012 in HEK293 fibroblasts was carried out using the Fugene transfection reagent (Boehringer Mannheim). Briefly, 2μl of the Fugene reagent was diluted in 100 μl of serum free medium and incubated at room temperature for 5-10 minutes. This mixture was added to 1 ug of the P501S plasmid DNA, briefly mixed and incubated for 30 minutes at room temperature. The Fugene / DNA mixture was added to the cells and incubated for 24-48 hours. Expression of recombinant P501S in transfected HEK293 fibroblasts was detected through Western staining media using a P501S monoclonal antibody. Transfection of p501S / pCEP4 in CHO-K cells (American Type Culture Collection, Rockville, MD) was performed using the GenePorter transfection reagent (Gene Therapy Systems, San Diego, CA). Briefly, 15 μl of GenePorter was diluted in 500 μl of serum free medium and incubated at room temperature for 10 minutes. The mixture of GenePorter / medium was added to 2 μg of plasmid DNA that was diluted in 500 μl of serum-free medium, mixed briefly, and incubated for 30 minutes at room temperature. The CHO-K cells were dried in PBS to remove serum proteins, and the GenePorter / DNA mixture was added and incubated for 5 hours. The transfected cells were then fed in an equal volume of 2x medium and incubated for 24-28 hours. FACS analysis of P501 S temporarily infected CHO-K cells, demonstrating surface expression of P501 S. Expression was detected using rabbit polyclonal antiserum raised against peptide P501 S, as described below. The flow cytometric analysis was performed using a FaCScan (Becton Dickinson), and the data was analyzed using the Cell Quest program. d) Expression of P501 S in S. cerevisiae P501 S was expressed in yeast, directed on membranes, using the prepro a signal sequence of yeast. The natural signal sequence and the first luminal domain of P501 S was detected in order to preserve the natural positioning of the expressed P501 S protein. Specifically, the preprope signal sequence of S. cerevisae linked to amino acids 55-553 of SEQ ID NO: 13 with a His tagged end was cloned into the plasmid pRIT15068 with the CUP 1 promoter and transfected into strain Y1790 of S. cervisiae. The strain Y1790 is Leu + and His-. The expression of the protein was induced through the addition of either 500 μM or 250 μM CuS04 at 30 ° C in a minimal medium supplemented with histidine. The cells were harvested 24 hours after induction. The extracts were prepared through growing cells at a concentration of OD600 5.0 in 50 mM citrate phosphate pH regulator (pH 4.0) plus 130 mM NaCl supplemented with protease inhibitors. The cells were separated using glass beads and centrifuged for 20 minutes at 15,000 g. The recombinant protein was found to be 100% associated with the pellet. Expression of the recombinant protein (molecular weight 63 kD) was demonstrated through Western blot analysis, using the anti-P501 monoclonal antibody S 10E-D4-G3 described below. The amino acid sequence of the expressed protein is provided in SEQ ID NO: 792. Fermentation procedures for the production of recombinant protein labeled to prepro-P501 S-His in S. cerevisiae (strain Y1790-promoter inducible CUP 1) were evaluated as follows. 100 μl of a master seed containing 2.5 × 10 8 cells / ml of S. cerevisiae transformed Y 1790 was spread on solid medium FSC004AA. The composition of the FSC004AA medium is as follows: glucose 10 g / l; Na2Mo04.2H2O 0.0002 g / l; folic acid 0.000064 g / l; KH2P04 g / l; MnS04. H2O 0.0004 g / l; Inositol 0.064 g / l; MgSO4.7H2O 0.5 g / l; H3BO3 0.0005 g / l; Pyridoxine 0.008 g / l; CaCl2.2H2 = 0.1 g / l; K 1 0.0001 g / l; Thiamine 0.008 g / l; NaCI 0.1 g / l; CoCl2.6H2O 0.00009 g / l; Niacin 0.000032 g / l; FeCI3.6H2O 0.0002 g / l; Riboflavin 0.000016 g / l; Pantothenate Ca 0.008 g / l; CuS04.5H20 0.00004 g / l; Biotin 0.000064 g / l; para-aminobenzoic acid 0.000016 g / l; ZnS04.7H2O 0.0004 g / l; (NH 4) 2 SO 4 5 g / l; agar 18 g / l; Histidine 0.1 g / l. Two plates were incubated for 26 hours at 30 ° C. These solid pre-cultures were harvested in 5 ml of FSC007AA liquid medium and 0.5 ml (or 9.3 x 107 cells) of this suspension was used to inoculate 2 pre-liquid cultures. The composition of the FSC007AA medium is as follows: glucose 10 g / l; Na2O .2H2O 0.0002 g / l; folic acid 0.000064 g / l; KH2PO4 1 g / l; MnSO4.H2O 0.0004 g / l; Inositol 0.064 g / l; MgSO4.7H2O 0.5 g / l; H3BO30,0005 g / l; Pyridoxine 0.008 g / l; CaCl2.2H2O 0.1 g / l; Kl 0.0001 g / l; thiamin 0.008 g / l; NaCl 0.1 g / l; CoCl2.6H2O 0.00009 g / l; Niacin 0.000032 g / l; FeCI3.6H2O 0.0002 g / l; Riboflavin 0.000016 g / l; Pantothenate Ca 0.008 g / l; CuS04.5H20 0.00004 g / l; Biotin 0.000064 g / l; para-aminobenzoic acid 0.000016 g / l; ZnSO4.7H2O 0.0004 g / l; (NH 4) 2 SO 45 g / l; Histidine 0.1 g / l. These pre-cultures were operated for 20 hours in 2-liter flasks containing 400 ml of the FSC007AA medium in order to obtain an OD of 1.8. The other characteristics of these pre-cultures are as follows: pH 2.8; glucose 2.3 g / l; ethanol 3.4 g / l. The best time for pre-cultures for strain Y1790 was determined in preliminary experiments. The liquid pre-cultures containing 400 ml of the medium and inoculated with several volumes of Master Seed (0.25, 0.5, 1 or 2 ml) were monitored in order to identify the best size and time of inoculation. Glucose, ethanol, pH, OD and cell number (determined through flow cytometry) were followed between 16 and 23 hours of culture. The glucose and maximum biomass termination were obtained after 20 hours of incubation with 0.5 inoculation. These conditions were adopted to transfer the pre-culture to fermentation. In total, 800 ml of pre-culture was used to inoculate a 20 liter fermentor containing 5 liters of the FSC002AA medium. 3 ml of irradiated antifoam was added before inoculation. The composition of the FSC002AA medium is as follows: (NH4) 2SO 6.4 g / l; Na2MoO4.2H2O 2.05 mg / l; folic acid 0.54 mg / l; KH2PO48.25 g / l; MgSO4.H2O 4.01 mg / l; inostiol 540 mg / l; MgSO4.7H2O 4.69 g / l; H3BO3 5.17 m / l; pyridoxine 68 mg / l; CaCl.2H2O 0.92 g / l; K1 1.03 mg / l; thiamin 68 mg / l; NaCl 0.06 g / l; CoCl2.6H2O 0.92 mg / l; Niacin 0.27 mg / l; HCl 1 ml / l; FeCl3.6H2O 9.92 mg / L; Riboflavin 0.13 mg / l; CuSO4.5H2O 0.41 mg / l; Glucose 0.14 g / l; Pantothenate Ca 68 mg / l; ZnSO4.7H2O 4.1 mg / l; Biotin 0.54 mg / l; para-aminobenzoic acid 0.13 mg / l; Histidine 0.3 g / l. The carbon source (glucose) is supplemented through continuous feeding of the FFB004AA medium. The composition of the FFB004AA medium is as follows: glucose 35 g / l; Na2MoO .2H2O 5.15 mg / l; folic acid 1.36 mg / l; KH2PO420.06 g / I; MnSO4.H2O 10.3 mg / I; inositol 1350 mg / l; MgSO4.7H2O 11.7 g / l; H3BO3 12.9 m / l; pyridoxine 170 mg / l; CaCl.2H2O 2.35 g / l; K1 1.03 mg / l; thiamine 170 mg / l; NaCI 0. 15 g / l; CoCl2.6H2O 2.3 mg / l; Niacin 0.67 mg / l; HCl 2.5 ml / l; FeCl3.6H2O 24.8 mg / l; Riboflavin 0.33 mg / l; CuSO4.5H2O 1.03 mg / l; biotin 1.36 mg / l; Pantothenate Ca 170 mg / l; ZnS0 .7H20 10.3 mg / l; para-aminobenzoic acid 0.33 mg / l; Histidine 5.35 g / l. The residual glucose concentration was kept very low (D50 mg / l) in order to minimize the production of ethanol through fermentation. This was achieved by limiting the development of microorganisms using a limited glucose feeding scale. The standard biomass content (OD 80-90) was achieved in the fermentation after the growth phase of 44 hours. The CUP1 promoter was then induced through the addition of 500 μM of CuSO4 in order to produce the P501S antigen. The addition of CuSO4 was followed by the accumulation of ethanol (up to 6 g / l) and the glucose feed scale was then reduced in order to consume the ethanol. Copper available for the microorganism was monitored through Cu test ion concentration in supernatant broth using a spectrophotometric copper assay (DETC method). The fermentation was then supplemented with CuSO4 through the induction phase in order to maintain its concentration between 150 and 250 μM in the supernatant. The biomass achieved an OD of 100 at the end of the induction. The cells were harvested after 8 hours of induction. The cell homogenate was prepared and analyzed through SDS-PAG E and Western staining using standard protocols. A larger protein band with expected molecular weight of 62KD was detected through Western staining using anti-P501 S monoclonal antibodies. Western staining analysis also showed that the major 62KD band was progressively produced 30 minutes after induction in, and reached a maximum after 3 hours. It seems that no more antigen was produced between 3 and 12 hours of induction. The number of passages through a French Press necessary to extract all the antigen from the cells was evaluated. One, three and five passages and total cell lysates were tested, supernatants and pellets of cell lysates were analyzed. Three passages through a French Press were sufficient to completely extract the antigen. The antigen was present in the insoluble fraction. e) Expression of P703P in Baculovirus The cDNA for full length P703P-DE5 (SEQ ID NO: 326), together with several flanking restriction sites, was obtained through digestion of plasmid pCDNA703 with restriction endonucleases Xba and Hind III . The resulting restriction fragment (approximately 800 base pairs) was ligated to the transfer plasmid pFastVacl which was digested with the same restriction enzymes. The sequence of the insert was confirmed through DNA sequencing. The transfer plasmid Recombinant pFBP703 was used to make recombinant bacmi DNA and baculovirus using Bac-a-Bac Baculovirus expression system (BRL Life Technologies). Five Alta cells were infected with the BVP703 recombinant virus, as described above, to obtain the recombinant P703P protein. e) Expression of P788P in E. coli A truncated N-terminal portion of P788P (residues 1 644 of SEQ ID NO: 777, referred to as P788P-N) fused with a C-terminal 6xHis Tag was expressed in E. coli, as follow. The P788P Adm. Was amplified using primers AW080 and AW081 (SEC I D NO: 672 and 673). AW080 is a sense cloning initiator with an Ndel site. Aw081 is an antisense cloning primer with an XhoI site. The P788P amplified with PCR, as well as the vector pCRX1, were digested with Ndel and Xhol. The vector and the insert were ligated and transformed into NovaBlue cells. The colonies were randomly classified for insertion and then sequencing. Clone P788P # 6 was confirmed to be identical to the designed construction. The constructed expression of P788P-N # 6 / pCRX1 was transformed into competent E.coli BL21 CodonPlus-RIL cells. After induction, most of the cells grew well, reaching an OD600 or greater than 2.0 after 3 hours. The SDS-PAG E stained with coomassie showed an over-expressed band of approximately 75 kD. Western blot analysis using a 6xHis Tag antibody confirmed that the band was P788P-N. The cDNA sequence for P788P-N is provided in SEQ ID NO: 674, with the corresponding amino acid sequence being provided in SEQ ID NO: 675. f) Expression of P510S in E. coli The P510S protein has 9 potential transmembrane domains and is predicted to be located in the plasma membrane. The C-terminal protein of this protein, as well as the third predicted extracellular domain of P510S were expressed in E. coli as follows. The constructed expression designated as Ra 12-P510S-C was designed to have a 6 HisTag at the N-terminus, followed by the M. tuberculosis antigen Ra12 (SEQ ID NO: 676) and then the C-terminal portion of P510S (amino acid residues 1 176-1261 of SEQ ID NO: 538). The full-length P510S was used to amplify the P510S-C fragment through PCR using the primers AW056 and AW057 (SEQ ID NOs: 677 and 678, respectively). AW056 is a sense cloning primer with an EcoRl site. AW057 is an antisense initiator with stop and Xhol sites. The fragment of amplified P501 S and Ra 1 2 / pCRX1 were digested with EcoRI and Xhol and then purified. The insert and the vector were ligated together and transformed into NovaBlue. The colonies were randomly classified for the insert and sequences. For expression of the protein, the expression construct was transformed into competent E. coli cells. BL21 (DE3) CodonPlus-RIL. A classification of mini-induction was performed to optimize expression conditions. After induction, the cells grew well, achieving an OD 600 nm greater than 2.0 after 3 hours. SDS-PAGE of Coomassie staining showed a highly over-expressed band of approximately 30 kD. However, this is greater than the expected molecular weight, the Western staining analysis was positive, showing this band as the protein containing His tag. Optimized culture conditions are as follows. Culture diluted overnight / culture during the day (LB + kanamycin + chloramphenicol) in 2xYT (with kanamycin and chloramphenicol) at a ratio of 25 ml culture to 1 liter 2xYT. They were allowed to grow at 37 ° C until OD600 = 0.6. An aliquot was taken as sample T0. 1 mM of IPTG was added and allowed to grow at 30 ° C for 32 hours. Take a T3 sample, spin the cells and store at -80 ° C. The cDNA and amino acid sequences for Ra12-P510S-C constructed are given in SEQ ID NOs: 679 and 682, respectively. The expression construct of P510S-C was designed to have a 5 'aggregate start codon and a glycine codon (GGA) and then the C-terminal terminal fragment of P510S followed by the frame 6x histidine tag and the codon of arrest of vector pET28b. The cloning strategy is similar to that used for Ra l 2-P510S-C, except that the PCR primers used are those shown in SEC I D NO: 685 and 686, respectively, and the Ncol / Xhol cut in pET28b was used. He initiator of SEQ ID NO: 685 created to a Ncol 5 'site and added to the start condom. The antisense primer of SEQ ID NO: 686 created an XhoI site in the P510S C terminal fragment. The clones were confirmed by sequencing. For protein expression, the expression construct was transformed into competent E. coli BL21 (DE3) CodonPlus-RIL cells. An OD600 or greater than 2.0 was obtained 30 hours after induction. SDS-PAGE stained with Coomassie showed an over band expressed at approximately 11 kD. Western staining analysis confirmed that the band was P510S-C, as well as N-terminal protein sequencing. The optimized culture conditions are as follows: culture diluted overnight / culture during the day (LB + kanamycin + chloramphenicol) and 2X of YT (+ kanamycin and chloramphenicol) at a ratio of 25 ml of culture to 1 liter of 2x YT , and allowed to grow at 37 ° C until an OD 6000 of about 0.5 was reached. Take an aliquot as shown by T0. Add 1 mM of IPTG and leave in growth at 30 ° C for 3 hours. The cells were rotated and stored at 80 ° C until purification. The cDNA and amino acid sequences for the P510S-C construct are shown in SEQ ID NOs: 680 and 683, respectively. The predicted third extracellular domain of P510S (P510S-E3; amino acid residues 328-676 of SEQ ID NO: 538) was expressed in E. coli as follows. The P510S fragment was amplified through PCR using the primers shown in SEQ ID NO: 687 and 688. The primer of SEQ ID NO: 687 is a sense primer with a Ndel site for use in the ligation of pPDM. The primer of SEQ ID NO: 688 is an antisense primer with an added XhoI site for use in ligation to pPDM. The resulting fragment was cloned into pPDM at the Ndel and Xhol sites. The clones were confirmed through sequencing. For protein expression, the clone was transformed into competent cells of E. coli BL21 (DE3) CodonPlus-RIL. After induction, a CD600 or greater than 2.0 was achieved after 3 hours. SDS-PAGE stained with coomassie showed an over band expressed at approximately 38 kD, and N-terminal sequencing confirmed at the N-terminus to be that of P510S-E3. The optimized culture conditions are as follows: dilution of culture overnight / culture during the day (LB + kanamycin + chloramphenicol) and 2x YT (kanamycin and chloramphenicol) at a ratio of 25 ml culture to 1 liter 2x YT. Allow to grow at 37 ° C until OD 600 equals 0.6. Take an aliquot as shown by T0. Add 1 mM of IPTG and let rise at 30 ° C for 3 hours. Take a T3 sample, spin the cells and store at -80 ° C until purification. The cDNA and amino acid sequences for the construction of P501S-E3 are provided in SEQ ID NO: 681 and 684, respectively. q) Expression of P775S in E. coli The P775P antigen contains multiple open reading frames (ORF). The third ORF, which encodes the SEC ID protein NO: 483, has the best reason score. An expression fusion construct containing the M. tuberculosis antigen Ra12 (SEQ ID NO: 676) and P775P-ORF3 with an N-terminus 6x His Tag was prepared as follows. P775P-ORF3 was amplified using sense PCR primers of SEQ ID NO: 689 and the antisense PCR primer of SEQ ID NO: 690. The amplified PCR fragment of P775P and Ra 12 / pCRX1 were digested with EcoRI restriction enzymes and Xhol. The vector and the insert were ligated and then transformed into NovaBlue cells. The colonies were randomly classified for the insert and then the sequencing. A clone having the desired sequence was transformed into competent E. coli BL21 cells (DE3). Two hours after the induction, the cell density was maximized at OD600 of about 1.8. The SDS-PAGE taken with coomassie showed an over band expressed at approximately 31 kD. Western staining using the 6x HisTag antibody confirmed that the band was Ra 12-P775P-ORf3. The cDNA and amino acid sequences determined for the fusion construct are provided in SEQ ID NO: 691 and 692, respectively. h) Expression of a P703P H is Taa fusion protein in E. coli The cDNA for the P703P coding region was prepared by PCR using the primers of SEQ ID NOs: 693 and 694. The PCR product was digested. with EcoRi restriction enzyme, gel purified and cloned to the modified vector pET28 with a His tag frame, which had been digested with the Eco72l and EcoRl restriction enzymes. The correct construction was confirmed by DNA sequence analysis and then transformed into E. coli expression host cells BL21 (DE3) pLys S. The amino acid and cDNA sequences for the expressed recombinant P703P are provided in SEQ ID NO: 695 and 696, respectively.

Expression of a P705P His Taq fusion protein in E. coli Ei cDNA for the coding region of P705P s prepared by PCR using the primers of SEQ ID NOs 697 and 698. The PCR product was digested with restriction enzyme. EcoRi, gel purified and cloned to the modified vector pET28 with His tag framework, which had been digested with the restriction enzymes Eco72l and EcoRl. The correct construction was confirmed through DNA sequence analysis and then transformed into E. coli expression host cells BL21 (DE3) pLys S. The amino acid sequences and cDNA for the expressed recombinant P705P are provided in SEQ ID NO: 699 and 700, respectively. i) Expression of a P711P His Taq fusion protein in E. coli The cDNA for the coding region of P711P s was prepared by PCR using the primers of SEQ ID NO: 701 and 702. The PCR product was digested with enzyme of EcoRi restriction, gel purified and cloned to the modified vector pET28 with a His tag frame, which had been digested with the enzymes of Eco72l and EcoRl restriction. The correct construction was confirmed through DNA sequence analysis and then transformed into E. coli expression host cells BL21 (DE3) pLys S. The amino acid and cDNA sequences for the expressed recombinant P71 1 P are provided in SEQ ID NO. NO: 703 and 704, respectively.

EJ EMPLO 18 PREPARATION AND CHARACTERIZATION OF ANTIBODIES AGAINST SPECIFIC PROSTATE POLYPEPTIDES a) Preparation and Characterization of Polyclonal Antibodies against P703P. P504S v P509S Polyclonal antibodies against P703P, P504S and P509S were prepared as follows. Each prostate tumor antigen expressed in a recombinant E. coli expression system was grown overnight in LB broth with the appropriate antibiotic at 37 ° C in a shaking incubator. The next morning, 10 ml of overnight culture was added to 500 ml at 2x YT plus appropriate antibiotics in a 2 liter diverted Erlenmeyer flask. When the Optical Density (at 560 nm) of the culture reached 0.4-0.6, the cells were induced with IPTG (1 mM). Four hours after induction with I PTG, the cells were harvested by centrifugation. The cells were then washed with pH regulated saline with phosphate and they were centrifuged again. The supernatant was discarded and either the cells were frozen for future use or processed immediately. 20 ml of lysis buffer was added to the cell pellets and swirled. To break the E. coli cells, this mixture was then run through the French press at a pressure of 1124.8 kg / cm2. The cells were then centrifuged again and the supernatant and the pellet were verified by SDS-PAGE for the division of the recombinant protein. For proteins located in the cell pellet, the pellet was resuspended in 10 mM Tris pH 8.0, 1% CHAPS and the inclusion body pellet was washed and centrifuged again. This procedure was repeated twice more. The washed inclusion body pellet was solubilized with either 8 M urea or 6 M guanidine hydrochloride containing 10 mM tris ph 8.0 plus 10 mM imidazole. The solubilized protein was added to 5 ml of nickel chelate resin (Qiagen) and incubated for 45 minutes at one hour at room temperature with continuous agitation. After the incubation, the resin and protein mixture was emptied through a disposable column and the flow was collected. The column was then washed with 10-20 column volumes of the solubilization pH regulator. The antigen was then eluted from the column using 8M urea, 10 mM Tris pH 8.0 and 300 mM imidazole and collected in 3 ml fractions. An SDS-PAGE gel was run to determine which fractions to combine for future purification. As the final step of purification, a strong anion exchange resin such as HiPrepQ (Biorad) with the appropriate pH regulator and the above combined fractions were loaded onto the column. Each antigen was eluted from the column with an increased salt gradient. The fractions were collected while the column ran and another SDS-PAGE gel ran to determine which fractions of the column to combine. The combined fractions were dialyzed against 10 mM Tris pH 8.0. The proteins were then placed in jars after filtration through a 0.22 micron filter and the antigens were frozen until needed for immunization. 400 micrograms of each prostate antigen was combined with 100 micrograms of muramildipeptide (MDP). Every four weeks the rabbits were reinforced with 100 micrograms mixed with an equal volume of Freund's Incomplete Auxiliary (IFA). Seven days, after each reinforcement, the animal was bled. Serum was generated through incubation of the blood at 4 ° C for 12-14 hours followed by centrifugation. 96-well plates were covered with antigen by incubation with 50 microliters (typically 1 microgram) of recombinant protein at 4 ° C for 20 hours. 250 microliters of BSA blocking buffer was added to the wells and incubated at room temperature for 2 hours. Plates were washed 6 times with PBS / 0.01% Tween. The rabbit serum was diluted in PBS. Fifty milliliters of diluted serum was added to each well and incubated at room temperature for 30 minutes.

The plates were washed as described above before adding 50 microliters of goat anti-rabbit horseradish peroxidase (HRP) at a dilution of 1: 10000 and incubated at room temperature for 30 minutes. The plates were washed again as described above and 100 microliters of TMB microcavity peroxidase substrate was added to each well. After 15 minutes of incubation in the dark at room temperature, the colorimetric reaction was stopped with 100 microliters of 1 N H2SO4 and read immediately at 450 nm. All polyclonal antibodies showed immunoreactivity to the appropriate antigen. b) Preparation v Characterization of Antibodies against P501 S A murine monoclonal antibody directed against the carboxy terminus of the prostate specific antigen P501 S was prepared as follows. A truncated fragment of P501 S (amino acids 355-526 of SEQ ID NO: 13) was generated and cloned into the vector pET28b (Novagen) and expressed in E. coli as a thioredoxin fusion protein with a histidine tag. . the trx-P501 S fusion protein was purified through nickel chromatography, digested with thrombin to remove the trx fragment and further purified by the acid precipitation method followed by reverse phase HPLC. The mice were immunized with truncated P501 S protein. The bleeding of mice serum that potentially contains anti-P501 S polyclonal serum was tested for specific reactivity of P501 S using ELISA assays with purified P501 S and trx-P501 S proteins. Serum bleeds that appear to specifically react with P501 S were then classified for P501 S reactivity through Western analysis. Mice containing a specific component of P501 S were sacrificed and the spleen cells were used to generate anti-P501 S antibody producing hybridomas using standard techniques. Hybridoma supernatants were tested for specific reactivity of P501 S initially through ELISA, and subsequently through FACS analysis of reactivity with transduced P501 S cells. Based on these results, a monoclonal hybridoma designated 10E3 was selected for cloning additional. A number of subclones were generated, tested for specific reactivity to P501 S using ELISA and categorized for the IgG isotype. The results of this analysis are shown in Table V below. Of the 16 subclones tested, the monoclonal antibody 10E3-G4-D3 was selected for further study.

TABLE V Isotype analysis of murine anti-P501 S monoclonal antibodies The specificity of 10E3-G4-D3 for P501 S was examined through FACS analysis. Specifically, the cells were configured (2% formaldehyde, 10 minutes), permeabilized (0.1% saponin, 10 minutes) and stained with 10E3-G4-D3 at 0.5-1 pg / ml, followed by incubation with an antibody. Ig of goat anti-mouse conjugated with secondary FITC, (Pharmingen, San Diego, CA). The cells were then analyzed by FITC fluorescence using an Excalilbur fluorescence activated cell sorter. For FACS analysis of transduced cells, B-LCL was retrovirally transduced with P501S. For the analysis of infected cells, B-LCL was infected with a vaccine vector expressing P501S. To demonstrate the specificity in these assays, B-LCL transduced with a different antigen (P703P) and non-infected B-LCL vectors were used. 10E-G4-D3 showed that it binds with B-LCL transduced with P501S and also with B-LCL infected with P501S, but not with any uninfected cells or cells transduced by P703P. To determine whether the epitope recognized by 10E-G4-D3 was found on the surface or in an intracellular compartment of cells, B-LCL was transduced with P501S or HLA-B8 as a control antigen and either stabilized and permeabilized as described. previously described or stained directly with 10E-G4-D3 and analyzed as above. The specific recognition of P501S by 10E-G4-D3 was found to require permeabilization, suggesting that the epitope recognized by this antibody is intracellular. The reactivity of 10E-G4-D3 with three prostate tumor cell lines Lncap, PC-3 and DU-145, which are known as expressing high, medium and very low levels of P501S, respectively, were examined by permeabilization of cells and treated as described above. The high reactivity of 10E-G4-D3 was seen with Lncap instead of PC-3, which in its moment showed higher reactivity than DU-145. These results are in accordance with real-time PCR and demonstrate that the antibody specifically recognizes P501S in these tumor cell lines and that the epitope recognized in prostate tumor cell lines is also intracellular. The specific character of 10E-G4-D3 was also demonstrated by Western staining analysis. The lysates of tumor lines of Lncap, DU-145 and PC-3 cells of HEK293 cells transfected temporarily with P501S and of non-transfected HEK293 cells were generated. Western blot analysis of these lysates with 10E-G4-D3 revealed a band of 46 kDa immunoreactivity in Lncpa, PC-3 and HEK cells transfected with P501S, but not in DU-145 cells or non-transfected HEK293 cells. The expression of P501S mRNA is consistent with these results since the semi-quantitative PCR analysis revealed that the P501S mRNA is expressed in Lncap, at a lower level but detectable in PC-3 and not at all in DU-145 cells. Bacterially expressed and purified recombinant P501S (designated as P501SStr2) was recognized by 10E-G4-D3 (23 kDa), as full-length P501S which is temporarily expressed in HEK293 cells using any expression vector VR1012 or pCEP4. Although the predicted average molecular weight of P501S is 60.5 kDa, both P501S transfected or "native" runs at a slightly lower mobility due to its hydrophobic nature. The immunohistochemical analysis was performed on tumor of prostate and a panel of sections of normal tissue (prostate, adrenal, chest, cervix, colon, duodenum, gallbladder, ileum, kidney, ovary, pancreas, parotid gland, skeletal muscle, spleen and testicles). The tissue samples were placed in a formalin solution for 24 hours and embedded in paraffin before being sliced into sections of 10 microns. The tissue sections were permeabilized and incubated with 10E-G4-D3 antibody for one hour. The anti-mouse HRP tag followed by incubation with chromogen DAB was used to visualize the immunoreactivity of P501 S. P501 S was found to be highly expressed in both normal prostate and prostate tumor tissue, but it was not detected in any of the other tissues tested. To identify the epitope recognized by 10E-G4-D3, an epitope mapping method was purchased. A series of overlapping 13-20-21 mers were synthesized (5 amino acids overlapped; SEQ ID NO: 489-501) that extended the fragment of P501 S used to generate 10E-G4-D3. Flat-bottomed 96-well microtiter plates were coated with either the peptides or the P501 S fragment used to immunize the mice, at 1 microgram / ml for 2 hours at 37 ° C. The cavities were then aspirated and blocked with pH regulated saline with phosphate containing 1% (w / v) BSA for 2 hours at room temperature, and subsequently washed in PBS containing 1% Tween 20 (PBST). The purified antibody 1E-G4-D3 was added to 2 times of dilution (1000 ng - 16 ng) in PBST and incubated for 30 minutes at room temperature. ambient. This was followed by a 6-fold wash with PBST and subsequently incubation with donkey anti-mouse IgG conjugated with the fragment H RP (H + L) Affinipure F (ab ') (Jackson Immunoresearch, West Grove, PA) at 1: 20000 for 30 minutes. The plates were then washed and incubated for 15 minutes in tetramethyl benzidine. The reactions were stopped by the addition of 1 N of sulfuric acid and the plates were read at 450 nm using an ELISA plate reader. As shown in Figure 8, the reactivity was seen with the peptide of SEQ ID NO: 496 (corresponding to amino acids 439-459 of P501 S) and with the P501 S fragment but not with the remaining peptides, demonstrating that the epitope recognized by 10E-G4-D3 is located at amino acids 439-459 of SEQ ID NO: 1 13. In order to further evaluate the tissue specificity of P501 S, immunohistochemical analyzes of micro-array were performed on approximately 4700 different human tissues comprising all major organs as well as neoplasms derived from these tissues. 65 of these human tissue samples were of prostate origin. The tissue sections of 0.6 mm in diameter were composed with formalin and embedded in paraffin. Samples were pre-treated with H I ER using 10 mM citrate pH regulator pH 6.0 and boiled for 10 minutes. The sections were stained with n 10E-G4-D3 and the immunoreactivity of P501 S was visualized with HRP. The 65 normal tissue samples (5 normal, 55 non-prostate tumors treated, 5 refractory hormone prostate tumors) were positive, showing distinct perinuclear staining. All other tissues examined were negative for expression of P501 S. c) Preparation v Characterization of Antibodies against P503S A fragment of P503S (amino acids 1 13-241 of SEQ ID NO: 14) was expressed and purified from bacteria essentially as described above for P501 S and used to immunize both rabbits and mice. The mouse monoclonal antibodies were isolated using standard hybridoma technology as described above. Rabbit monoclonal antibodies were isolated using Selected Lymphocyte Antibody Method (SLAM) technology at Immgenics Pharmaceuticals (Vancouver, BC, Canada). Table VI below lists the monoclonal antibodies that were developed against P503S.

TABLE VI The DNA sequences encoding the complementary determinant regions (CDRs) for rabbit monoclonal antibodies 20D4 and JA1 were determined and are provided in SEQ ID NO: 502 and 503, respectively. In order to better define the epitope binding region of each of the antibodies, sets of overlapping peptides extending amino acids 109-213 of SEQ ID NO: 1 were generated. These peptides were used for the epitope map of anti-P503S monoclonal antibodies through ELISA as follows. The recombinant fragment of P503S that was used as the immunogen was used as a positive control. 96-well plates were coated with any peptide or recombinant antigen at 20 ng / cavity overnight at 4 ° C. Plates were aspirated and blocked with pH regulated saline with phosphate containing 1% (w / v) PSA for 2 hours at room temperature then washed with PBS containing 0.1% Tween 20 (PBST). The purified rabbit monoclonal antibodies diluted in PBST were added to the wells and incubated for 30 minutes at room temperature. This was followed by washing 6 times with PBST and incubation with Protein A conjugated with HRP at a dilution of 1: 2000 for 30 more minutes. Plates were washed 6 times in PBST and incubated with tetramethylbenzidine (TMB) substrate for an additional 15 minutes. The reaction was stopped by the addition of 1 N of sulfuric acid and the plates were read at 450 nm using an ELISA plate reader. ELISA with mouse monoclonal antibodies were performed supernatants of tissue cultures running net in the assay. All antibodies were bound to the recombinant fragment P503S, with the exception of the SP2 negative control supernatant. 20D4, JA1 and 1D 12 were strictly attached to peptide # 2101 (SEQ ID NO: 504), which corresponds to amino acids 1 51-169 of SEQ ID NO: 1 14. I C3 bound to peptide # 21 02 ( SEQ ID NO: 505), which corresponds to amino acids 165-184 of SEQ ID NO: 1 14. 9C 12 was attached to peptide # 2099 (SEQ ID NO: 522), which corresponds to amino acids 120-139 of SEQ ID NO: 1 14. The other antibodies were bound to regions that are not examined in these studies.

After epitope mapping the antibodies were tested by FACS analysis on a cell line stably expressing P503S to confirm that the antibodies bound to the cell surface epitopes. Cells stably transfected with a control plasmid were used as a negative control. The cells were stained in vivo with a non-fixative, 0.5 ug of anti-P503S monoclonal antibody was added and the cells were incubated on ice for 30 minutes before being washed twice and incubated with a goat anti-rabbit antibody labeled with FITC or secondary mouse for 20 minutes. After being washed twice, the cells were analyzed with an Excalibur fluorescent activated cell sorter. Monoclonal antibodies 1 C3, 1 D 12, 9C12, 20D4, and JA1, but not 8D3, were found to bind to a cell surface epitope of P503S. In order to determine which tissues express P503S, immunohistochemical analysis was performed, essentially as described above, on a panel of normal tissues (prostate, adrenal, chest, cervix, colon, duodenum, gallbladder, ileum, kidney, ovary). , pancreas, parotid gland, skeletal muscle, spleen and testes), anti-mouse antibody labeled HRP or anti-rabbit followed by incubation with TMB was used to visualize the immunoreactivity of P503S. P503S was found to be highly expressed in prostate tissues, with low levels of expression being observed in cervix, colon, ileum, and kidney, and was not observed no expression in adrenal, breast, duodenum, gallbladder, ovary, pancreas, parotid gland, skeletal muscle, spleen and testes. Western staining analysis was used to characterize the specific character of the anti-P503S monoclonal antibody. SDS-PAGE was performed on recombinant P503S (rec) expressed in and purified from bacteria and / or lysates of HEK293 cells transfected with full-length P503S. The protein was transferred to nitrocellulose and then Western blotted with each of the anti-P503S monoclonal antibodies (20D4, JA1, 1 D12, 6D12 and 9C12) at an antibody concentration of 1 ug / ml. The protein was detected using horse radish peroxidase (HRP) conjugated with any of the monoclonal antibodies of goat anti-mouse or protein A-sepharose. Monoclonal antibody 20D4 detected the appropriate molecular hair of 14 kDa of recombinant P503S (amino acids 1 13-241) and of 23.5 kDa species in lysates of EK293 H cells transfected with full length P503S. Other P503S monoclonal antibodies exhibited similar specificity through Western staining. d) Preparation and Characterization of Antibodies against P703P Rabbits were immunized with either a truncated form (P703Ptrl; SEQ ID NO: 172) or a full-length mature form (P703PN; SEQ ID NO: 523) of recombinant P703P protein expressed in and purified from bacteria as described earlier. A purified polyclonal affinity antibody was generated using immunogen P703PII or P703Ptrl bound to a solid support. Rabbit monoclonal antibodies were isolated using SLAM technology in Immegenic Pharmaceuticals. Table VII below lists both the monoclonal and polyclonal antibodies that were generated against P703P.

TABLE VII The DNA sequences encoding the regions of complementarity determination (CDRs) for the rabbit monoclonal antibodies 8H2, 7H8 and 2D4 were determined and are provided in SEQ ID NO: 506-508, respectively. Epitope map studies were performed as described above. It was found that the antibodies monoclonal 2D43y 7H8 specifically bind to the peptides of SEQ ID NO: 509 (corresponding to amino acids 145-159 of SEQ ID NO: 172) and SEQ ID NO: 510 (corresponding to amino acids 1 1-25 of SEQ ID NO: 172), respectively. The monoclonal antibody 2594 was found to bind the peptides of SEQ ID NO: 51-1 -514 with the polyclonal antibody 9427 by binding to the peptides of SEQ ID NO: 515-517. The specific character of the anti-P703P antibodies was determined through Western blot analysis as follows. SDS-PAGE was performed on (1) bacterially expressed recombinant antigen; (2) lysates of EK293 H cells and Ltk - / - cells either untransfected or transfected with a plasmid expressing full length P703P; and (3) isolated supernatant of those cell cultures. The protein was transferred to nitrocellulose and then stained by Western blotting using the anti-P703P # 2594 polyclonal antibody at an antibody concentration of 1 ug / ml. The protein was detected using horseradish peroxidase (RP) conjugated to an anti-rabbit antibody. A 35 kDa immunoreactive band could be observed with recombinant P703P. The recombinant P703P operates at a slightly higher molecular weight, since its epitope is labeled. In lysates and supernatants of cells transfected with full-length P703P, a 30 kDa band corresponding to P703P was observed. To ensure the specificity, lysates of EK293 H cells stably transfected in control plasmid were also tested and were negative for expression of P703P. Other anti-P703P antibodies showed similar results. Immunohistochemical studies were performed as described above, using the anti-P703P monoclonal antibody. It was found that P703P is expressed at high levels in normal prostate tissue and prostate tumor, but was not detectable in all other normal tissues tested (breast tumor, lung tumor, and kidney tumor). e) Preparation and Characterization of Antibodies against P504S Full length P504S (SEQ ID NO: 108) was expressed and purified from bacteria essentially as described above for P501S and used to develop rabbit monoclonal antibodies using Antibody Method technology of Selected Lymphocyte (SLAM) in Immgenics Pharmaceuticals (Vancouver, BC, Canada). The anti-P504S 13H4 monoclonal antibody was shown through Western blotting that binds both expressed recombinant P504S and P504S in tumor cells. The studies of i? Munohistochemistry using 13H4 to determine the expression of P504S in various prostate tissues was performed as described above. A total of 104 cases, including 65 cases of prostate cancer with radical prostatectomies (PC), 26 cases of prostate biopsies and 13 cases of benign prostate hyperplasia (BHP) were stained with the monoclonal antibody anti-P504S 13H4. P504S showed strong cytoplasmic granular staining in 64/65 (98.5%) of PCs in prostatectomies and 26/26 (100%) of PCs in prosthetic biopsies. P504S stained strongly and dysfunctionally in carcinomas (4+ in 91.2% of PC cases, 3+ in 5.5%, 2+ in 2.2% and 1 + in 1.1%) and high-grade prostatic intraepithelial neoplasia (4+ in all cases). The expression of P504S did not vary with the Gleason classification. Only 17/91 (18.7%) of NP / BHP cases around PC and 2/13 (15.4%) of BPG cases were focal (1 +, not 2+ to 4+ in all cases) and positive weekly for P504S in large glands. The expression of P504S was not found in small atrophic glands, postatropic hyperplasia, base cell hyperplasia, and transient cell metaplasm in both biopsies and prostatectomies. P504S was thus found to be over expressed in all Gleason classifications of prostate cancer (98.5 to 100% sensitivity) and exhibited only focal positives in large normal glands in 19/104 ^ of cases (82.3% specificity). These findings indicate that P504S can be usefully employed for the diagnosis of prostate cancer.

EXAMPLE 19 CHARACTERIZATION OF CELL SURFACE EXPRESSION AND LOCALIZATION OF CROSSOSOME SPECIFIC PROSTATE ANTIGEN P501 S This Example describes studies demonstrating that prostate specific antigen P501 S is expressed on surface cells, together with studies to determine the probable chromosomal location of P501 S. The P501 S protein (SEQ ID NO: 13) is predicted to have 1 1 transmembrane domains. Based on the discovery that the epitope recognized by the monoclonal antibody anti-P501 S 10E-G4-D3 (described above in Example 17) is intercellular, it was predicted that the following transmembrane determinants could allow the prediction of extracellular domains of P501 S. Figure 9 is a schematic representation of the P501 S protein showing the predicted location of the transmembrane domains and the intracellular epitope described in example 17. The underlined sequences represent the predicted transmembrane domains, the staining sequence represents the predicted extracellular domains and the sequence in italics represent the predicted intracellular domains. The sequence that is both bold and underlined represents the sequence used to generate polyclonal rabbit serum. The location of the domains of transmembrane was predicted using HHMTOP as described by Tusnady and Simón (Principies Governing Amino Acid Composition of Integral Membrane Proteins; Applications to Topology Prediction, J. Mol. Biol. 283: 489-506, 1998). Based on Figure 9, the P501S domain flanked by the transmembrane domains corresponding to amino acids 274-295 and 323-342 is predicted to be extracellular. The peptide of SEQ ID NO: 518 corresponds to amino acids 306-320 of P501S and lies in the predicted extracellular domain. The peptide of SEQ ID NO: 519, which is identical to the peptide of SEQ ID NO: 518 with the exception of the substitution of histidine with an asparginine, was synthesized as described above. A Cys-Gly was added to the C-terminus of the peptide to facilitate conjugation to the carrier protein. The cleavage of the peptide from the solid support was carried out using the following division mixture: trifluoroacetic acid: thioanthiol; sun: water: f enol (40: 1: 2: 2: 3). After division for 2 hours, the peptide was precipitated in cold ether. The peptide pellet was then dissolved in 10% w / v acetic acid and lyophilized before purification through C18 reverse phase hplc. A gradient of 5-60% acetonitrile (containing 0.5% TFA) in water (containing 0.05% TFA) was used to elute the peptide. The purity of the peptide was verified by hplc and mass spectrometry, and it was determined to be > 95% The purified peptide was used to generate rabbit polyclonal antiserum as described above. Surface expression of P501 S was examined through FACS analysis. The cells were stained with the polyclonal anti-P501 S peptide serum at 10 μg / ml, washed, incubated with a goat anti-rabbit Ig antibody conjugated with secondary FITC (ICN), washed and analyzed for fluorescence. FITC using an Excalibur fluorescent activated cell sorter. For FACS analysis of transduced cells, B-LCL was retrovirally transduced with P501 S. To demonstrate the specificity in these assays, B-LCL transduced with an irrelevant (P703P) or non-transduced antigen was titrated in parallel. For the FACS analysis of prostate tumor cell lines, Lncap, PC-3 and DU-145 were used. The prostate tumor cell lines were disassociated from tissue culture plates using cell dissociation medium and stained as above. All samples were treated with propidium iodide (Pl) before the FACS analysis, and the data were obtained from cells excluding Pl (ie, intact and non-permeabilized). The polyclonal rabbit serum generated against the peptide of SEC I D NO: 519 showed that it specifically recognizes the surface of transduced cells to express P501 S, demonstrating that the epitope recognized by the polyclonal serum is extracellular. To determine bioquimically if P501 S is expressed on cell surface, the peripheral membrane of Lncap cells were isolated and subjected to Western staining analysis.

Specifically, Lncap cells were used using a dounce homogenizer in 5 ml homogenization buffer (250 mM sucrose, 10 mM HEPES, 1 mM EDTA, pH 8.1, 1 complete protease inhibitor tablet (Boehringer Mannheim)) . The lysate samples were rotated at 1000 g for 5 minutes at 4 ° C. The supernatant was then rotated at 8000 g for 10 minutes at 4 ° C. The supernatant of the 8000 g spin was recovered and rotated at 100,000 g for 30 minutes at 4 ° C to recover the peripheral membrane, the samples were then separated through SDS-PAGE and Western staining with 10E3 mouse monoclonal antibody. -D4-D3 (described above in Example 17) using the conditions described above. The recombinant purified P501 S, as well as the HEK293 cells transfected with an expressed P501 S were incubated as positive controls for P501 S detection. The LCL cell lysate was included as a negative control. P501 S can be detected in total cell lysate Lncap, the 8000 g fraction (internal membrane) and also in the 100,000 g fraction (plasma membrane). These results indicate that P501 S is expressed at, and located on, the peripheral membrane. To demonstrate that the polyclonal rabbit antiserum generated to the peptide of SEQ ID NO: 519 specifically recognizes this peptide as well as the corresponding native peptide of SEQ ID NO: 518, the analyzes of ELI SA were performed. For these analyzes, 96-well flat-bottom micro-plate plates were covered with any peptide of SEQ ID NO: 519, the larger peptide of SEQ ID NO: 520 extending the entire predicted extracellular domain, the peptide of SEQ ID NO: 521 which represents the epitope recognized by the specific antibody of P501S 10E3- G4-D3, or the P501S fragment (corresponding to amino acids 355-526 of SEQ ID NO: 113) that does not include the immunization peptide sequence, at 1 μg / ml for 2 hours at 37 ° C. the cavities were aspirated, blocked with saline regulated at pH with phosphate containing 1% (w / v) BSA for 2 hours at room temperature and subsequently washed in PBS containing 0.1% Tween 20 (PBST). Purified anti-P501S polyclonal rabbit serum was added to 2 times the dilutions (1000 ng - 125 ng) in PBST and incubated for 30 minutes at room temperature. This was followed by washing 6 times with PBST and incubation with goat anti-rabbit IgG fragment conjugated with HRP (H + L) Affinipuer F (ab ') at 1: 20000 for 30 minutes. The plates were then washed and incubated for 15 minutes in tetramethyl benzidine. The reactions were stopped through the addition of 1N sulfuric acid and the plates were read at 450 nm using an ELISA plate reader. As shown in Figure 11, the anti-P501 S polyclonal rabbit serum specifically recognizes the peptide of SEQ ID NO: 519 used in the immunization as well as the larger peptide of SEQ ID NO: 520, but does not recognize the peptides derived from irrelevant P501S and fragments. In other studies, rabbits were immunized with peptides derived from the P501 S sequence and were predicted to be both extracellular and intracellular, as shown in Figure 8. The polyclonal rabbit serum was isolated and the polyclonal antibodies in the serum were purified, as described above, to determine the Specific reactivity with P501 S, FACS analysis was used using any B-LCL transduced with P501 S or the irrelevant antigen P703P, of B-LCL infected with vaccine virus expressing P501 S. For surface expression, dead or non-intact cells were excluded from the analysis as described above. For intracellular staining, the cells were composited and permeabilized as described above. The polyclonal rabbit serum generated against the peptide of SEQ ID NO: 548, which corresponds to amino acids 181 -198 of P501 S, was found to recognize a surface epitope of P501 S. The polyclonal rabbit serum generated against the peptide of SEQ ID NO: 551, which corresponds to amino acids 543-553 of P501 S, was found to recognize an epitope that is both potentially intracellular and extracellular since in different experiments the intact or permeabilized cells were recognized by the polyclonal serum. Based on similar deductive reasoning, the sequences of SEQ ID NOs: 541 -547, 549 and 550, which correspond to amino acids 109-122, 539-553, 509-520, 37-54, 342-359, 295 -323, 217-274, 143-160 and 75-88, respectively of P501 S, can be considered to be potential surface epitopes of P501 S recognized by antibodies.

In other studies, mouse monoclonal antibodies were analyzed against amino acids 296 to 322 for P501 S, which are predicted to be an extracellular domain. A / J mice were immunized with P501 S / adenovirus, followed by subsequent boosts with recombinant E. coli protein. and with peptide 296-322 (SEQ ID NO: 755) coupled with KLH. Mice were subsequently used for splenic B cell fusions to generate anti-peptide hybridomas. The 3 resulting clones, named as 4F4 (lgG 1, kappa), 4G5 (lgG2A, kappa) and 9B9 (lgG 1, kappa) grew for the production of antibodies. The 4G5 mAb was purified by running the supernatant over a Protein A-sepharose column followed by elution of antibody using 0.2M glycine, pH 2.3. The purified antibody was neutralized through the addition of 1 M Tris, pH 8, and pH regulator exchanged in PBS. For ELISA analysis, 956-well plates were coated with peptide P501 S 296-322 (referred to as P501 -argo), an irrelevant P775 peptide, P501 SN, P501 TR2, P501 S-long-KLH, peptide P501 S 306- 319 (designated as P501 -corto) -KLH or the irrelevant 2073-KLH peptide, all at a concentration of 2 ug / ml and left in incubation for 60 minutes at 37 ° C. After the cover, the plates were washed 5X with PBS + 0.1% Tween and then blocked with PBS, 0.5% BSA, 0.4% Tween 20 for 2 hours at room temperature. After the addition of the supernatants or purified mAB, the plates are incubated for 60 minutes at room temperature. Plates were washed as above and secondary antibody bound to donkey anti-mouse IgH was added and incubated for 30 minutes at room temperature, followed by a final wash as above. The TMB peroxidase substrate was added and incubated for 15 minutes at room temperature in the dark, the reaction was stopped through the addition of 1 N of H2SO4 and the OD was read at 450 nM. The three hybrid clones secreted mAB which recognized the peptide 296-322 and the recombinant protein P501 N. For the FACS analysis, the HEK293 cells were temporarily transfected with an expression construct of P501 S / VR1012 using the Fugene 6 reagent. After two After harvesting, the cells were harvested and washed, then incubated with purified 4G5 mAB for 30 minutes on ice. After several washes in PBS, 0.5% BSA, 0.01% azide, goat anti-mouse Ig-FITC was added to the cells and incubated for 30 minutes on ice, the cells were washed and resuspended in pH regulator of water including 1% propidium iodide and subjected to FACS analysis. The FACS analysis confirmed that amino acids 296-322 of P501 S are in an extracellular domain and there is surface area of expressed cells. The chromosomal location of P501 S was determined using the GeneBridge 4 Radiation Irbid panel (Research Genetics). The PCR primers of SEC I D NO: 528 and 529 were used in PCR with DNA combinations of the hybrid panel of according to the manufacturer's directions. After 38 cycles of amplification, the reaction products were separated on a 2% agarose gel and the results were analyzed through the Whitehead Institute / MIT Center for Genome Research web server (http: //www-qenome.wi .mit.edu / cqi-bin / contjq / rhmapper.pl) to determine the probable chromosomal location. Using this technique, P501 S was mapped to the long arm of chromosome 1 to Wl-9641 between q32 and q42. This region of chromosome 1 has been linked to the susceptibility of prostate cancer in hereditary prostate cancer (Smith et al., Science, 274: 1371-1374, 1996 and Berthon et al. Am. J. Hum. Genet. 62: 1416- 1424, 1998). These results suggest that P501 S may play a role in the malignancy of prostate cancer.

EXAMPLE 20 REGULATION OF THE EXPRESSION OF SPECIFIC ANTIGEN OF PROSTATE P501 S Modulation of the steroid hormone (androgenic) is a common treatment modality in prostate cancer. The expression of a number of specific antigens of prostate tissues have previously been shown to respond to androgen. The sensitivity of the prostate specific antigen P501 S to androgen treatment was examined in a tissue culture system as follows.

LNCaP prostate tumor cell line cells were plated at 1.5 x 10 6 cells / T75 flask (for RNA isolation) or 3 x 10 5 cells / cavity of a 6-well plate (for FACS analysis) and grown for overnight in an RPMI 1640 medium containing 10% carbon-bare fetal calf serum (BRL Life Technologies, Gaithersburg, MD). Cell culture was continued for a further 72 hours in RPMI 1640 medium containing 10% carbon / naked fetal calf serum, with 1 nM synthetic androgen methyltrienolone (R1881, New England Nuclear) added at several points. The cells were then harvested for RNA isolation and FACS analysis at 0, 1, 2, 4, 8, 16, 24, 28, and 72 hours after androgen addition. FACS analysis was performed using anti-P501S 10E3-G4-D3 antibody and permeabilized cells. For Northern analysis, 5-10 micrograms of total RNA was processed in a denatured formaldehyde gel, transferred to a Hibond nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ), entangled and stained with methylene blue. The filter was then prehybridized with Church pH buffer (250 mM Na2HPO4, 70 mM H3PO4, 1 mM EDTA, 1% SDS, 1% BSA at pH 7.2) at 65 ° C for one hour. The P501S DNA was labeled with 32P using a randomly initiated DNA labeling kit from High Initiator (Boehringer Mannheim). The unincorporated label was removed using columns of MicroSpin 5300-HR (Amersham Pharmacia Biotech). The DNA filter was then hybridized with fresh pH Church buffer containing labeled cDNA overnight, washed with 1 X SCP (0.1 M NaCl, 0.03 M Na2H PO4.7H2O 0.001 M Na2EDTA), 1% sarcosyl ( n-lauroyl sarcosine) and exposed to an X-ray film. When using both analyzes, FACS and Northern, message P501 S and protein levels were found to increase in response to androgen treatment.

EXAMPLE 20 PREPARATION OF FUSION PROTEINS OF SPECIFIC PROSTATE ANTIGENS The example describes the preparation of a P703P prostate-specific antigen fusion protein and a truncated form of the known prostate antigen PSA. The truncated form of PSA has 21 amino acids around the active serine site. The expression construct for the fusion protein also has a restriction site at the 3 'end, immediately before the stop codon, to aid in the addition of cDNA for additional antigens. The full-length cDNA for PSA was obtained by RT-PCR of a combination of RNA from human prostate tissues using the primers of SEQ ID NO: 607 and 608, and cloned into the vector pCR-Blunt l-TOPO . The resulting cDNA used as a template to make two different PSA fragments through PCR with two sets of primers (SEQ ID NO: 609 and 610; and SEQ ID NO: 61 1 and 612). PCR products having an expected size were used as templates to make the truncated form of PSA through PCR with the primers of SEQ ID NO: 61 1 and 613, which generated PSA (delta 208-218 in amino acids). The cDNA for the mature form of P703P with 6X histidine tag at the 5 'end was prepared by PCR with P703P and the primers of SEQ ID NOs: 614 and 615. The cDNA for fusion of P703P with the form truncated PSA (referred to as FOPP) was then obtained by PCR using the modified P703P cDNA and the truncated form of PSA cDNA as templates and the primers of SEQ ID NOs: 614 and 615. The FOPP cDNA was cloned into the Ndel site and the Xhol site of the PCRX1 expression vector, and was confirmed by DNA sequencing. The cDNA sequence determined for the FO PP fusion construct is provided is SEQ ID NO: 616, with the amino acid sequence being provided in SEQ ID NO: 617. The FOPP fusion was expressed as a single recombinant protein in E. coli. as follows. The expression plasmid pCRXI FOPP was transformed into E. coli strain BL21 -CodonPlus RI L. The transformant was shown to express the FOPP protein after induction with 1 μM of I PTG. Culture of the corresponding expression clone was inoculated in 25 ml of LB broth containing 50 ug / ml kanamycin and 34 ug / ml chloramphenicol, it grew at 37 ° C to an OD600 of about 1, and was stored at 4 ° C overnight. The culture was diluted in 1 liter of TB LB containing 50 ug / ml of kanamycin and 34 ug / ml of chloramphenicol, and grown at 37 ° C to an OD 600 of 0.4. IPTG was added to a final concentration of 1 mM, and the culture was incubated at 30 ° C for 3 hours. The cells were pelleted through setting at 5,000 RPM for 8 minutes. To purify the protein, the cell pellet was suspended in 25 ml of 10 mM Tris-Cl pH 8.0, 2 mM PMSF, complete protease inhibitor and 15 ug of lysozyme. The cells were used at 4 ° C for 30 minutes, sound was added several times and the lysate was centrifuged for 30 minutes at 10,000 x g. The precipitate, which contains the inclusion body, was washed twice with 10 mM Tris-Cl pH 8.0 and 1% CHAPS. The inclusion body was dissolved in 40 ml of 10 mM Tris-Cl pH 8.0, 100 mM sodium phosphate and 8 M urea. The solution was added to 8 ml of Ni-NTA (Qiagen) for one hour at room temperature. The mixture was emptied into a 25 ml column and washed with 50 ml of 10 mM Tris-CI pH 6.3, 1000 mM sodium phosphate, 0.5% DOC and 8 M urea. The bound protein was eluted with 350 mM imidazole, 10 mM Tris-Cl pH 8.0, 100 mM sodium phosphate and 8 M urea. The fractions containing the FOPP proteins were combined and dialyzed extensively against 10 mM Tris-Cl pH 4.6, aliquoted and stored at -70 ° C.

EXAMPLE 21 CHARACTERIZATION OF REAL-TIME PCR OF THE SPECIFIC PROSTATE ANTIGEN P501 S IN PERIPHERAL BLOOD OF PATIENTS WITH PROSTATE CANCER Circulating epithelial cells were isolated from fresh blood of normal individuals and patients with metastatic prostate cancer, isolated mRNA and cDNA prepared using procedures Real-time PCR Real-time PCR was performed with the Taqman ™ procedure using both gene-specific primers and probes to determine gene expression levels. The epithelial cells were enriched with blood samples using a method of separation of immunomagnetic beads (Dynal, A.S., Oslo, Norway). The isolated cells were used and the magnetic beads were removed. The lysate is then processed for isolation of poly A + mRNA using magnetic beads coated with Oligo (dT) 25. After washing the beads in pH buffer, the beads / poly A + RNA were suspended in 10 mM Tris HCl pH 8.0 and subjected to reverse transcription. The resulting cDNA was subjected to real-time PCR using gene-specific primers. The content of Beta-actin was also determined and used for normalization. Samples with copies of P501 S greater than the mean of normal samples + 3 standard derivations were considered positive Real-time PCR in blood samples were performed using the Taqman ™ procedure but extending to 50 cycles using forward and reverse primers and probes specific for P501S. Of the 6 samples tested, 6 were positive for P501S. No P501S signal was observed in the 4 normal blood samples tested.

EXAMPLE 22 EXPRESSION OF SPECIFIC P703P AND P501S PROSTATE ANTIGENS IN SCID MOUSE PASSAGE PROSTATE TUMORS When the effectiveness of antigens in the treatment of prostate cancer was considered, the continuous presence of antigens in tumors during androgen ablation therapy is important. The presence of the prostate specific antigens P703P and P501S in prostate tumor samples developed in SCID mice in the presence of testosterone was evaluated as follows. Two prostate tumors that had been metastasized to the bone were removed from the patient, implanted in SCID mice and grown in the presence of testosterone. Tumors were evaluated for cRNA expression of P703P, P501S and PSA using quantitative real-time PCR with the green SYBR assay method. The expression of P703P and P501S in a prostate tumor was used as a positive control and the absence in normal bowel and heart normal as negative controls. In both cases, the specific mRNA was present in the last passage tumors. Since bone metastasis developed in the presence of testosterone, this implies that the presence of these genes can not be lost during androgen ablation therapy.

EXAMPLE 23 THE MONOCLONAL ANTIBODY ANTI-P503S IN HIBE THE GROWTH OF IN VIVO TUMOR The ability of the anti-P503S 20D4 monoclonal antibody to suppress tumor formation in mice was examined as follows. Ten SCID mice were injected subcutaneously with HEK293 cells expressing P503S. Five mice received 150 micrograms of 20D4 intravenously on day 0 (tumor cell injection time), day 5 and day 9. The glove tumor size was measured 50 days. Of the five animals that received nothing of 20D4, three formed detectable tumors after approximately two weeks which continued to grow through the study. In contrast, none of the five mice that received 20D4 formed tumors. These results demonstrate that Mab 20D4 anti-P503S displays potent antitumor activity in vivo.

EXAMPLE 24 CHARACTERIZATION OF A CLONE OF T-CELL RECEIVER FROM A SPECIFIC CELL CLONE OF P501S T cells have a limited life. However, the cloning of T cell receptor (TCR) chains and subsequent transfer essentially allows the infinite propagation of the specific character of the T cell. The cloning of tumor-antigen TCR chains allows the transfer of the specific character of isolated T cells. of patients sharing the TCR MHC restriction allele. said T cells can then be expanded and used in adoption transfer determinations to introduce the specificity of tumor antigen in patients carrying the tumor expressing the antigen. The alpha and beta chains of the T cell receptor of a CD8 T cell clone specific for the P501S prostate specific antigen were isolated and sequenced as follows. The total mRNA of 2 x 10 6 cells of clone CTL 4E5 (described above in Example 12) was isolated using the Triazole reagent and the cDNA was synthesized, to determine the Va and Vb sequences in this clone, a panel of Va and V was synthesized. Vb of subtype-specific primers and was used in RT-PCR reactions with cDNA generated from each of the clones. The RT-PCR reactions showed that each of the clones expressed a common Vb sequence corresponding to the subfamily Vb7. Further, using cDNA generated from the clone, the expressed Va sequence was determined to be Va6. To clone the complete TCR alpha and beta chains of clone 4E5, primers that extend the primer and PCR nucleotides encoding the terminator were designed. The primers were as follows: TCR Valpha-6 5 '(sense): GGATCC-- GCCFCCACC - ATGTCACTTTCTAGCCTGCT (SEQ ID NO: 756), BamHl site Kozak alpha TCR sequence, 3' TCR alpha (antisense): GTRCGAC - TCAGCTGGACCACAGCCGCAG (SEC ID NO: 757) site I left constant TCR alpha sequence, TCR Vbeta-7. 5 '(sense): GGATCC- GCCGCCACC- ATGGGCTGCAGGCTGCTCT (SEQ ID NO: 758) BamHl site Kozak sequence TCR alpha TCR beta 3 '(antisense): GTCGAC-TCAGAAATCCTTTCTCTTGAC (SEQ ID NO: 759) site SalI constant beta TCR sequence. The standard 35-cycle RT-PCR reactions were stabilized using cDNA synthesized from the CTL clone and the previous primers, using the heat-stable polymerase PWO (Roche, Nutley, NJ). The resulting specific bands (approximately 850 bp for alpha and approximately 950 for beta) were ligated into the blunt PCR vector (Invitrogen) and transformed into E. coli. E. coli was transformed with plasmids containing full length alpha and beta chains and identified, and large-scale preparations of the corresponding plasmids were generated. Plasmids containing full-length PCR alpha and beta chains were subjected to sequencing. The reactions of sequencing demonstrated the cloning of full-length alpha and beta PCR chains with the cDNA sequence determined for the Vb and Va chains shown in SEQ ID NO: 760 and 761, respectively. The corresponding amino acid sequences are shown in SEQ ID NO: 762 and 762, respectively. The Va sequence is shown through the nucleotide sequence alignment being 99% identical (3.47 / 348) to Vb6.2 and the Vb is 00% identical to Vb7 (336/338). From the foregoing it will be appreciated that, although the specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the invention is not limited except by the appended claims.

Claims (10)

1. An isolated polynucleotide comprising a sequence selected from the group consisting of: (a) sequences provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382, and 384-476, 524, 526, 530, 531, 533, 535, 536 , 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737 -739, 751, 753, 764, 765, 773-776 and 786-788; (b) complements of the sequences provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381 , 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655 , 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (c) sequences consisting of at least 20 contiguous residues of a sequence provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (d) sequences that hybridize to a sequence provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618- 626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786- 788 under moderately severe conditions; (e) sequences having at least 75% identity with a sequence of SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; (f) sequences having at least 90% identity to a SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335 , 340-375, 381, 382 and 384-476, 524, 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634 , 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788; and (g) variants of degeneracy of a sequence provided in SEQ ID NO: 1-111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524, 526, 530, 53, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618-626, 630, 631, 634, 636, 639-655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788.

2. An isolated polypeptide comprising the sequence of amino acid selected from the group consisting of: (a) sequences listed in SEQ ID NO: 1 12-1 14, 172, 176, 178, 327, 329, 331, 336, 339, 376-380, 383, 477-483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551, 553-568, 573-586, 588-591, 592, 627-629, 632, 633, 635, 637, 638, 656-671, 675, 683, 684, 710, 712, 714, 715, 717-719, 723-734, 736, 740-750, 752, 754, 755, 766-772, 777-785 and 789- 791; (b) sequences having at least 70% identity in a sequence of SEQ ID NO: 1 12-1 14, 172, 176, 178, 327, 329, 331, 336, 339, 376-380, 383, 477- 483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551, 553-568, 573-586, 588-591, 592, 627-629, 632, 633, 635,637, 638, 656-671, 675, 683, 684, 710, 712, 714, 715, 717-719, 723-734, 736, 740-750, 752, 754, 755, 766-772, 777-785 and 789- 791; (c) sequences having at least 90% identity in a sequence of SEQ ID NO: 1 12-1 14, 172, 176, 178, 327, 329, 331, 336, 339, 376-380, 383, 477- 483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551, 553-568, 573-586, 588-591, 592, 627-629, 632, 633, 635,637, 638, 656-671, 675, 683, 684, 710, 712, 714, 715, 717-719, 723-734, 736, 740-750, 752, 754, 755, 766-772, 777-785 and 789- 791; (d) sequences encoded by a polynucleotide of claim 1; (e) sequences having at least 70% identity to a sequence encoded by a polynucleotide of the claim 1; and (f) sequences having at least 90% identity to a sequence encoded by a polynucleotide of claim 1.

3. An expression vector comprising a polynucleotide according to claim 1 operably linked to a control sequence. expression.

4. A host cell transformed or transfected with an expression vector according to claim 3.

5. An isolated antibody, or its antigen-binding fragment that specifically binds to a polypeptide of claim 2.

6. A method for detecting the presence of a cancer in a patient, comprising the steps of: (a) obtaining a biological sample from the patient; (b) contacting the biological sample with a binding agent that binds to a polypeptide of claim 2; (c) detecting in the sample an amount of polypeptide that binds to the binding agent; and (d) comparing the amount of polypeptide with a predetermined cut-off value and hence determining the presence of a cancer in the patient.

7. A fusion protein comprising at least one polypeptide according to claim 2.

8. The fusion protein according to the claim 7, wherein the fusion protein comprises a sequence selected from the group consisting of: (a) sequences derived from SEQ ID NO: 682, 692, 695 699, 703, and 709; and (b) sequences encoded by SEQ ID NO: 679, 691, 696 700, 704, and 708.

9. An oligonucleotide that hybridizes to a sequence illustrated in SEQ ID NO: 1 -1,1,15-171, 173-175, 177, 179-305 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384-476, 524 526, 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593-606, 618 626, 630, 631, 634, 636, 639-655, 674, 680, 681, 71 1, 713, 716, 720 722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788 under moderate conditions severe A method for stimulating and / or expanding specific cells for a tumor protein, comprising contacting T cells with at least one component selected from the group consisting of: (a) polypeptides according to claim 2; (b) polynucleotides according to claim 1; and (c) antigen presenting cells expressing a polypeptide according to claim 1, under conditions and for a time sufficient to allow stimulation and / or expansion of T cells. 1. A population of isolated T cells comprising cells T prepared according to the method of claim

10. 12. A composition comprising a first component selected from the group consisting of physiologically acceptable and immunostimulatory vehicles, and a second component selected from the group consisting of: (a) polypeptides according to claim 2; (b) polynucleotides according to claim 1; (c) antibodies according to claim 5; (d) fusion proteins according to claim 7; (e) T cell populations according to claim 1; and (f) antigen presenting cells expressing a polypeptide according to claim 2. 13. A method for stimulating an immune response in a patient, comprising administering to the patient a composition of claim 12. 14. A method for treatment of a cancer in a patient, comprising administering to the patient a composition of claim 12. 15. A method for determining the presence of a cancer in a patient, comprising the steps of: (a) obtaining a biological sample from the patient; patient; (b) contacting the biological sample with an oligonucleotide according to claim 9; (c) detecting in a sample, an amount of a polynucleotide that hybridizes to the oligonucleotide; and (d) comparing the amount of polynucleotide that hybridizes to the oligonucleotide with a predetermined cut-off value, and hence determining the presence of cancer in the patient. 16. A diagnostic kit comprising at least one oligonucleotide according to claim 9. 17. A diagnostic kit comprising at least one antibody according to claim 5., and a detection reagent, wherein the detection reagent comprises a report group. 18. A method for inhibiting the development of a cancer in a patient, comprising the steps of: (a) incubating CD4 + and / or CD8 + T cells isolated from a patient with at least one component selected from the group consisting of: i) polypeptides according to claim 2; (ii) polynucleotides according to claim 1; and (iii) antigen presenting cells expressing a polypeptide of claim 2, so that the T cells proliferate; and (b) administering to the patient an effective amount of the proliferated T cells, thus inhibiting the development of a cancer in the patient.