CZ20022756A3 - Compositions and methods for treating and diagnosis of prostate cancer - Google Patents

Abstract

Compositions and methods for the therapy and diagnosis of cancer, particularly prostate cancer, are disclosed. Illustrative compositions comprise one or more prostate-specific polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly prostate cancer.

Description

Compositions and methods for treating and diagnosing prostate cancer

Technical field

In general, the invention relates to the treatment and diagnosis of cancer, such as prostate cancer. In particular, the invention relates to polypeptides comprising at least a portion of a prostate-specific protein and polynucleotides encoding such polypeptides. Such polypeptides and polynucleotides are useful in pharmaceutical compositions such as vaccines and other compositions for the diagnosis and treatment of prostate cancer.

BACKGROUND OF THE INVENTION

Cancer is a major health problem worldwide, although some progress has been made in cancer detection and therapy, a vaccine or other successful method for prevention or treatment is not commercially available. Conventional therapies, which are generally based on a combination of chemotherapy or surgery and radiation, appear to be disproportionate in many patients.

Prostate cancer is the most common form of male cancer, affecting an estimated 30% of men over the age of 50. Worldwide clinical evidence suggests that human prostate cancer has the ability to metastasize to bones, and this disease inevitably progresses to androgen-dependent bone fragility, leading to patient death. This disease is currently the second cause of cancer death in men in the United States of America.

Despite extensive research in the treatment of this disease, prostate cancer remains difficult to treat. The usual treatment is based on surgery and / or radiation therapy, but these methods are ineffective in a significant percentage of cases. Two previously identified prostate-specific proteins (prostate spe2 »»))> 1) i 1)>)> 1

I t)) ->

Ific) 1)>>>) cific antigen [PSA] and prostatic acid phosphatase [PAP]) have limited therapeutic and diagnostic efficacy- For example, PSA levels are not always related to the existence of prostate cancer and do not indicate a degree of metastasis.

Despite strenuous research into the therapy of these and other cancers, prostate cancer remains difficult to diagnose and difficult to treat effectively. Therefore, there is a need for ever-improved methods of detecting and treating such cancers. The present invention fulfills the present requirements and brings further advances compared to the present state.

SUMMARY OF THE INVENTION

The present invention provides an isolated polynucleotide comprising a sequence selected from the group consisting of (a) the sequences of SEQ ID NOs: 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788;

Cb) sequence comparators in SEQ ID NO = 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680 , 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788;

Cc) a sequence consisting of at least 20 contiguous residues of the sequence in SEQ ID NO ^; 1 to 111, 115 to 171, 173 to 175, 177, rt - < - &gt;&gt; S &lt; - &gt; »S Í J J <4 4 4 4 4 4 4

Ί »Λ i I> 5 ·)> 1 i N» »)» 7> 1>) »» 7 7) 7> 7) 7) »

7 7 7) 7

179 to 305, 307 to 315 , 326 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530 533 535 536 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631 634, 636, 639 to 655, 674, 680 , 681, 711, 713 716, 720- 722, 735, 737-739, 751, 753, 764, 765, 773-7 ; 776 and 786 to 788;

(d) sequences that hybridize to the sequence of SEQ ID NC1:

1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631 , 634 , 636, 639-655 674, 680, 681, 711 713, 716, 720-7 722, 735, 737-739, 751, 753, 764, 765, 773 to 776 and 786 to 788 at moderately strict under-

mínek;

(Ce) a sequence having at least 75% identity to SEQ ID NO:

1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328 330 332 to 335 , 340 to 375, 381, 382 and 384 to 476, 524, 526 530 531, 533 535 536 552 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634 , 636, 639-655 674, 680, 753, 681,711 764 765 713, 716, 773-776 720 to 722, and 786 to 788 735, 737-739, 751,

(f) a sequence having at least 75% identity to SEQ ID NO: 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375 , 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788

Cg) generating variants of the sequence in SEQ ID NO: I _and Z 111, 115-171, 173-175, 177, 179-305, 307-315, 326, 328, 330, 332-335, 340-375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to

- 4 ϊ> i> ») 1) 1 11

J r) · »1) 11 11» »» »» »1) 1) 1) 1) 1)) 1 ¹ » »» »» »» 1 »))» ->

606,618 to 626, 630, 631, 634, 636 639 up to 655, 674, 680 681, 711, 713 716 720 to 722, 735, 737 to 739, 751 753 764, 765, 773 to 776 and 786-788.

According to a preferred embodiment, the polynucleotide compositions of the invention are expressed at least about 10%, more preferably at least about 30% and even more preferably at least about 50% of the prostate tissue samples tested at a rate of at least about 2 times, preferably at least about 5 times and most preferably at least about 10 times greater than other normal tissues.

The invention also relates to polynucleotide compositions comprising an amino acid sequence that is encoded by the polynucleotide sequence described above.

The invention further relates to polypeptide compositions comprising an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 112 to 114, 172, 176, 178,

327, 329, 331 336, 339, 376 to 380, 383, 477 to 483, 496, 504, 505, 519 520, 522, 525, 527, 532 537 to 551 , 553 to 568, 573 to 586, 588 to 590, 592, 627 to 629, 632, 633, 635, 637, 638, 656 až 671, 675 683 684 710 712, 714, 715,

717-719, 723-734, 736, 740-750, 752, 754, 755, 766-772, 777-785 and 789-791.

According to certain preferred embodiments, the polypeptides and / or polynucleotides of the invention are immunogenic, i.e., capable of eliciting an immune response, particularly a humoral and / or cellular immune response, as will be explained below.

The invention also relates to fragments, variants, and / or derivatives of the polypeptide and / or polynucleotide sequences, wherein the fragments, variants, and / or derivatives preferably have an immunugenic activity of at least about 50%, preferably at least about

-70%, and most preferably at least about 90%, with respect to the immunogenic activity of the polypeptide sequence set forth in SEQ ID NO: 112-114, 172, 176, 178, 327, 329, 331, 336, 339, 376-

380, 383,477 to 483, 496, 504, 505, 519, 520 522, 525, 527, 532, 534,537 to 551, 553 až 568, 573-586, 588 až 590, 592, 627 to 629, 632, 633 , 635, 637, 638, 656 to 671, 675, 683,

684, 710, 712, 714, 715, 717 to 719, 723 to 734, 736, 740 to 750, 752, 754, 755, 766 to 772, 777 to 785 or 789 to 791, or the polypeptide sequences encoded by the polynucleotide sequence set forth in SEQ ID NOs: 1 _and g 111, 115 _and g 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720-722, 735, 737-739, 751, 753, 764, 765, 773-776 and 786-788.

The invention further relates to polynucleotides that encode the above-described polypeptide, expression vectors containing such polynucleotides, and host cells transformed or transfected with such expression vectors.

The invention also relates to pharmaceutical compositions comprising a polypeptide or polynucleotide as described above and a physiologically acceptable carrier.

The invention relates to pharmaceutical compositions, for example, vaccine compositions for prophylactic or therapeutic use. Such compositions generally comprise an immunogenic polypeptide or polynucleotide of the invention and an immunostimulant, for example an adjuvant, together with a physiologically acceptable carrier.

The invention further relates to pharmaceutical compositions comprising a Ca) antibody or antigen-binding fragment thereof that specifically binds to or is a fragment of the invention, Cb) a physiologically acceptable carrier.

The invention further relates to pharmaceutical compositions comprising (a) an antigen-providing cell that expresses the polypeptide described above, (b) a pharmaceutically acceptable carrier or excipient. For example, dendritic cells, macrophages, monocytes, fibroblasts and B cells are mentioned as antigen presenting cells.

The invention relates, in turn, to pharmaceutical compositions comprising a Ca) antigen-providing cell that expresses the polypeptide described above and Cb) an immunostimulant.

The invention further relates to fusion proteins comprising at least one of the above-described polypeptides as well as polynucleotides encoding such fusion proteins, usually in the form of pharmaceutical compositions, for example vaccine compositions, containing a physiologically acceptable carrier and / or immunostimulant. The fusion proteins may comprise several immunogenic polypeptides or portions / variants thereof as described above, and may further comprise one or more polypeptide segments to facilitate and / or promote the expression, purification and / or immunogenicity of the polypeptides or polypeptides.

The invention also relates to a method of stimulating an immune response of a patient, in particular a T cell response of a human patient, by administering the pharmaceutical composition of the invention. The patient may be affected by prostate cancer, the method involving direct treatment of the disease or prevention in patients who could be at risk of the disease.

The invention also relates to a method of inhibiting the development of cancer in a patient, comprising administering to the patient a pharmaceutical composition of the invention. The patient may be affected by prostate cancer, the method comprising the direct treatment or prevention of a disease that could be at risk for the disease.

The invention also relates to a method for removing tumor cells from biological samples, comprising contacting a biological sample comprising T cells that react specifically with the polypeptide of the invention, wherein contacting is performed under conditions and for a sufficient time to allow removal of cells expressing the cells. polypeptide from the sample.

The invention also relates to a method of inhibiting the development of cancer in patients by administering to a patient a biological sample as described above.

The invention also relates to a method of stimulating and / or expanding T cells specific for a polypeptide of the invention, wherein T cells are contacted with one or more agents selected from the group consisting of: Ci) a polypeptide as described above, Cii) a polynucleotide encoding said polypeptide and an antigen-providing cell that expresses such a polypeptide under conditions and for a sufficient period of time to allow T cell stimulation and / or repulsion. The invention also relates to isolated T cell populations comprising T cells prepared as described above.

The invention also relates to a method of inhibiting the development of cancer, comprising administering to a patient an effective amount of a T cell population as described above.

The invention also relates to a method of inhibiting the development of cancer, comprising the steps of: Ca) incubating CD4 + and / or CD8 ⁺ T cells isolated from patients having one or more members selected from (i) a polypeptide comprising at least one immunogenic portion of the polypeptide according to the invention, Cii) a polynucleotide encoding such a polypeptide, Ciii) an anti8 gene providing a cell that expresses such a polypeptide, and Cb) and administering to the patient an effective amount of proliferated T cells thereby preventing cancer development in the patient. Proliterated cells may or may not be cloned prior to administration to a patient.

The invention also relates to a method for determining the existence or absence of cancer, particularly prostate cancer, in a patient, wherein Ca) contacts a biological sample from a patient with a binding agent that binds the above polypeptide; and (cc) comparing the amount of polypeptide to a predetermined value to determine the existence or non-existence of a patient's cancer. According to a preferred embodiment, the binding agent is an antibody, more preferably a monoclonal antibody.

The invention also relates to methods of monitoring cancer progression in a patient. Such a method comprises Ca) contacting a biological sample from a patient first with a binding agent that binds the above polypeptide, Cb) detecting in the sample the amount of polypeptide that binds to the binding agent, Cc) repeating steps Ca) and Cb) using the biological and Cd) comparing the amount of polypeptide detected in step Cc) with the amount of polypeptide in step Cb) and thereby monitoring the progression of the patient's cancer.

The invention also relates to a method for determining the existence or absence of cancer in a patient comprising Ca) contacting a biological sample from a patient with an oligonucleotide that hybridizes to a polypeptide of the invention, Cb) detecting in the sample an amount of polynucleotide, preferably mRNA that hybridizes to an oligonucleotide and Cc) comparing the amount of polynucleotide that hybridizes to the oligonucleotide at a predetermined value and thereby determining the existence or absence of cancer in the patient. According to an embodiment of the method, the amount of mRNA is determined by means of a palymerase chain

- * · ""·>*> * · «HP> t» »f« ^y »« * »» »·· example using at least one oligonucleotide primer that hybridizes to a polynucleotide of the invention or a complement of such a polynucleotide. In another embodiment, the amount of mRNA is determined by a hybridization technique using an oligonucleotide probe that hybridizes to a polynucleotide of the invention or to a complement of such a polynucleotide.

Similarly, the invention relates to the monitoring of cancer progression in which Ca) contacts a biological sample of a patient with an oligonucleotide that hybridizes to a polynucleotide of the invention, Cb) detects the amount of polynucleotide that hybridizes to an oligonucleotide and Cc) repeats step C a) and Cb) using a biological sample of the patient after a period of time; and Cd) comparing the amount of polynucleotide detected in step Cc) with the amount of polynucleotide detected in step Cb) and monitoring the progression of the patient's cancer therefrom.

The invention also relates to antibodies, for example monoclonal antibodies, that bind to a polypeptide of the invention and a diagnostic kit comprising such antibodies. The diagnostic kits comprise at least one oligonucleotide probe or primer described above.

The invention is explained in more detail by the following detailed description and drawings.

List of figures in drawings

Giant. 1 illustrates the ability of T cells to kill fibroblasts expressing a representative prostate-specific P502S polypeptide as compared to control fibroblasts. The percentage of lysis is shown as a series of effectors: target dose as indicated. On the x-axis, the ratio effector = target, on the y-axis, the percentage of lysis.

Giant .

Giant.

Giant.

A and 2B illustrate the ability of T cells to recognize cells expressing a representative prostate-specific P502S polypeptide. In any case, the number of gamma-interferon spots is given for different numbers of responders. Figure 2A shows values for fibroblasts pulsed with P2S-12 peptide compared to fibroblasts pulsed with control E75 peptide. Fig. 2B shows values for fibroblasts expressing P502S as compared to fibroblasts expressing HER-2 / neu. In both cases, the x-axis is the number of responders and the y-axis the number of gamma-interferon spots.

shows a peptide competitive binding assay demonstrating that P1tt10 peptide derived from P5O1S binds HLA-A2. The P1tt10 peptide inhibits HLA-A2 restricted presentation of the fluM58 peptide to the CTL clone D15OM58 in a TNF releasing bioassay. The D15OM58 CTL is specific for the HLA-A2 binding fluM58 influenza matrix peptide.

illustrates the ability of T cell lines, generated from PlStt10 immunized mice, to specifically lyse PlStt10-pulsed Jurkat A2Kb targets and P501S -randuced Jurkat A2Kb targets in comparison to EGFP-transduced Jurkat A2Kb. Percent lysis is shown as a series of effector ^: target ratio as indicated. The x-axis shows the effector: target ratio, and the y-axis the percentage of lysis.

illustrates the ability of a T cell clone to recognize and undergo specific lysis of Jurkat A2Kb cells expressing a representative prostate-specific P5O1S polypeptide, thus demonstrating that the PlStt10 peptide may be a natural epitope of the P5O1S polypeptide. The x-axis shows the culture fraction, the y-axis the percentage of lysis.

Giant. 6A and 6B are diagrams explaining the specificity of CD8 cell

11 (C3A-1) for a representative prostate specific antigen CP501S ?. Figure 6A shows the results of the ⁵¹ Cr release assay. The percentage of specific lysis is shown as a series of effector: target ratio. Giant. 6B shows the production of gamainterferon 3A-1 by autologous B-LCL stimulated cells transduced with P5O1S at the indicated effector: target ratio. The x-axis always shows the effector: target ratio, the y-axis in Fig. 6A is the percentage of specific lysis, Fig. 6B. ING gamma spots.

Giant. 7 is a Western blot showing expression of P501S in baculovirus.

Giant. 8 illustrates the results of the epitope mapping study P501S.

Giant. 9 schematically depicts the P501S protein showing the location and transmembrane domains and predicted intracellular and extracellular domains.

The underlined sequences represent the predicted trans-membrane domains, the bold sequences represent the predicted extracellular domains, and the italicized sequences represent the predicted intracellular domains. The underlined and bold sequences is the sequence used to generate polyclonal rabbit serum. The location of the transmembrane domains was predicted using the HHMTOP described by Tusnady and Simon (Principles Governing Amino Acid Composition of Integral Membrane Proteins: Application to Topology Prediction, J. Mol. Biol. 283, 489-506, 1998j).

Giant. 10 is a genomic map showing the location of the prostate genes P775P, P704P, B305D, P712P, and P774P in the Cat Eye region

Chromosome Syndrome 22q11.2.

Giant. 11 shows the results of an ELISA assay to determine the specificity of a rabbit polyclonal antiserum against P501S. The x-axis is ng of mouse polyclonal serum and the y-axis is O.D. 450

SEQ ID NO: 1 Yippee determined SEQ ID NO: 2 Yippee determined SEQ ID NO: 3 Yippee determined SEQ ID NO: 4 Yippee determined SEQ ID NO: 5 Yippee determined SEQ ID NO: 6 Yippee determined SEQ ID NO: 7 Yippee determined SEQ ID NO: 8 Yippee determined SEQ ID NO: 9 Yippee determined SEQ ID NO: 10 Yippee determined SEQ ID NO: 11 Yippee determined SEQ ID NO: 12 Yippee determined SEQ ID NO: 13 Yippee determined SEQ ID NO: 14 Yippee determined SEQ ID NO: 15 Dec Yippee determined SEQ ID NO: 16 Yippee determined SEQ ID NO: 17 Yippee determined SEQ ID NO: 18 Yippee determined SEQ ID NO: 19 Dec Yippee determined SEQ ID NO: 20 May Yippee determined SEQ ID NO: 21 Yippee determined SEQ ID NO: 22nd Yippee determined SEQ ID NO: 23 Yippee determined SEQ ID NO: 24 Yippee determined SEQ ID NO: 25 Yippee determined SEQ ID NO: 26 Yippee determined SEQ ID ΝΟ- 27 Mar: Yippee determined SEQ ID ΝΟ: 28 Yippee determined SEQ ID NO: 29 Yippee determined SEQ ID NO: 30 Yippee determined SEQ ID NO: 31 Yippee determined SEQ ID NO: 32 Yippee determined SEQ ID NO: 33 Yippee determined

cDNA sequence for Fl-13.

3 ' cDNA sequence for Fl-12. 5 ' cDNA sequence for Fl-12. 3 ' cDNA sequence for Fl-16. 3 ' cDNA sequence for Hl-1. 3 ' cDNA sequence for Hl-9. 3 ' cDNA sequence for Hl-4. 3 ' cDNA sequence for Jl-17. 5 ' cDNA sequence for Jl-17. 3 ^J cDNA sequence for Ll-12. 5 ' cDNA sequence for Ll-12- 3 ’ cDNA sequence for Nl-1862 5 ’ cDNA sequence for Nl-1862 3 ' cDNA sequence for Jl-13. 5 ' cDNA sequence for Jl-13. 3 ' cDNA sequence for Jl-19. 5 ' cDNA sequence for Jl-19. 3 ' cDNA sequence for Jl-25. 5 ' cDNA sequence for Jl-25. 5 ^J cDNA sequence for Jl-24. 3 ' cDNA sequence for Jl-24. 5 ' cDNA sequence for Kl-58. 3 ' cDNA sequence for Kl-58. 5 ' cDNA sequence for K1-63- 3 ’ cDNA sequence for Kl-63- 5 ' cDNA sequence for Ll-4. 3 ' cDNA sequence for Ll-4. 5 ' cDNA sequence for Ll-14. 3 ’ cDNA sequence for Ll-14. 3 ' cDNA sequence for Jl-12. 3 ' cDNA sequence for Jl-16. 3 ' cDNA sequence for Jl-21- 3 ’ cDNA sequence for Kl-48.

SEQ ID NO: 34 is fixed 3 'cDNA sequence for K1-55. SEQ ID NO: 35 is fixed 3 'cDNA sequence for LI-2. SEQ ID NO: 36 is fixed 3 ^J cDNA sequence for L1-6. SEQ ID NO: 37 is fixed 3 'cDNA sequence for N1-1858. SEQ ID NO: 38 is fixed 3 'cDNA sequence for N1-1860. SEQ ID NO: 39 is fixed 3 'cDNA sequence for NI-1861. SEQ ID NO: 40 is fixed 3 'cDNA sequence for N1-1864. SEQ ID NO: 41 is fixed cDNA sequence for P5. SEQ ID NO: 42 is fixed cDNA sequence for P8. SEQ ID NO: 43 is fixed cDNA sequence for P9. SEQ ID NO: 44 is fixed cDNA sequence for P18. SEQ ID NO: 45 is fixed cDNA sequence for P20. SEQ ID NO: 46 is fixed cDNA sequence for P29. SEQ ID NO: 47 is fixed cDNA sequence for P30. SEQ ID NO: 48 is fixed cDNA sequence for P34. SEQ ID NO: 49 is fixed cDNA sequence for P36. SEQ ID NO: 50 is fixed cDNA sequence for P38. SEQ ID NO: 51 is fixed cDNA sequence for P39. SEQ ID NO: 52 is fixed cDNA sequence for P42. SEQ ID NO: 53 is fixed cDNA sequence for P47. SEQ ID NO: 54 is fixed cDNA sequence for P49. SEQ ID NO: 55 is fixed cDNA sequence for P5Q. SEQ ID NO ^: 56 is fixed cDNA sequence for P53. SEQ ID NO: 57 is fixed cDNA sequence for P55. SEQ ID NO: 58 is fixed cDNA sequence for P60. SEQ ID NO: 59 is fixed cDNA sequence for P64. SEQ ID NO: 60 is fixed cDNA sequence for P65- SEQ ID NO: 61 is fixed cDNA sequence for P73. SEQ ID NO: 62 is fixed cDNA sequence for P75. SEQ ID NO: 63 is fixed cDNA sequence for P76. SEQ ID NO: 64 is fixed cDNA sequence for P79. SEQ ID NO: 65 is fixed cDNA sequence for P84. SEQ ID NO: 66 is fixed cDNA sequence for P68. SEQ ID NO: 67 is fixed cDNA sequence for P8Q (referred to as

also as P704P).

SEQ ID NO: 68 the cDNA sequence for P82 is determined. SEQ ID NO: 69 the cDNA sequence for U1-3064 is determined. SEQ ID NO: 70 the cDNA sequence for U1-3065 is determined. SEQ ID NO: 71 the cDNA sequence for VL-3692 is determined. SEQ ID NO: 72 the cDNA sequence for 1A-3905 is determined. SEQ ID NO: 73 the cDNA sequence for VL-3686 is determined. SEQ ID NO: 74 the cDNA sequence for R1-2330 is determined. SEQ ID NO: 75 the cDNA sequence for 18-3976 is determined. SEQ ID NO: 76 the cDNA sequence for VI-3679 is determined. SEQ ID NO: 77 the cDNA sequence for 10-4736- SEQ ID NO: 78 the cDNA sequence for 1G-4738 is determined. SEQ ID NO: 79 the cDNA sequence for 1G-4741 is determined. SEQ ID NO: 80 the cDNA sequence for 1G-4744- SEQ ID NO: 81 the cDNA sequence for 1G-4734 is determined. SEQ ID NO: 82 the determined cDNA sequence for 1H-4774. SEQ ID NO: 83 the determined cDNA sequence for 1H-4781. SEQ ID NO: 84 the determined cDNA sequence for 1H-4785. SEQ ID NO: 85 the determined cDNA sequence for 1H-4787. SEQ ID NO: 86 the determined cDNA sequence for 1H-4796. SEQ ID NO: 87 the determined cDNA sequence for 11-4807. SEQ ID NO: 88 the cDNA sequence for 11-4810 is determined. SEQ ID NO: 89 the determined cDNA sequence for 11-4811. SEQ ID NO: 90 the cDNA sequence for 1J-4876- is determined SEQ ID NO: 91 the cDNA sequence for 1K-4884 is determined. SEQ ID NO: 92 the cDNA sequence for 1K-4896 is determined. SEQ ID NO: 93 the cDNA sequence for 1G-4761 is determined. SEQ ID NO: 94 the cDNA sequence for 16-4762 is determined. SEQ ID NO: 95 the determined cDNA sequence for 1H-4766. SEQ ID NO: 96 the determined cDNA sequence for 1H-4770. SEQ ID NO: 97 the determined cDNA sequence for 1H-4771. SEQ ID NO: 98 the determined cDNA sequence for 1H-4772. SEQ ID NO: 99 the cDNA sequence for 1D-4297 is determined. SEQ ID NO: 100 ALIGN! the cDNA sequence for 1D-4309 is determined. SEQ ID NO: 101 the cDNA sequence for ID1-4278 is determined. SEQ ID NO: 102 the cDNA sequence for 1D-4288 is determined.

^{15 Dec}

SEQ ID NO: 103 Yippee determined cDNA sequence for 1D-4283. SEQ ID NO: 104 Yippee determined cDNA sequence for ID-4304. SEQ ID NO: 105 Yippee determined cDNA sequence for 1D-4296 SEQ ID NO: 106 Yippee determined cDNA sequence for 1D-4280 SEQ ID NO: 107 Yippee determined fully cDNA length i sequence

Fl-12 (also referred to as P504S).

SEQ ID NO: 108 is the predicted amino acid sequence for

Fl-12.

SEQ ID NO = 109 is the determined full-length cDNA sequence for J1-17. SEQ ID NO; no is determined for the full length cDNA sequence for L1-12.

Also referred to as P501S).

SEQ ID NO: 1i is the determined full-length cDNA sequence for N1-1862 (also referred to as P503S).

SEQ ID NO: 112 is the predicted amino acid sequence for J1-17.

SEQ ID NO: lig is the predicted amino acid sequence for L1-12 (also referred to as P501S).

SEQ ID NO: 114 is the predicted amino acid sequence for N1-1862 (also referred to as P503S).

SEQ ID NO: 115 Yippee determined cDNA sequence for P89- SEQ ID NO: 116 Yippee determined cDNA sequence for P90. SEQ ID NO: 117 Yippee determined cDNA sequence for P92. SEQ ID NO: 118 Yippee determined cDNA sequence for P95. SEQ ID NO: 119 Yippee determined cDNA sequence for P98. SEQ ID NO: 120 Yippee determined cDNA sequence for P102- SEQ ID NO: 121 Yippee determined cDNA sequence for P110. SEQ ID NO: 122 Yippee determined cDNA sequence for Plil. SEQ ID NO: 123 Yippee determined cDNA sequence for P114. SEQ ID NO: 124 Yippee determined cDNA sequence for P115. SEQ ID NO: 125 Yippee determined cDNA sequence for P116. SEQ ID NO: 126 Yippee determined cDNA sequence for P124. SEQ ID N0- ‘ 127 Yippee determined cDNA sequence for P126. SEQ ID NO: 128 Yippee determined cDNA sequence for P130. SEQ ID NO: 129 Yippee determined cDNA sequence for P133- SEQ ID NO: 130 Yippee determined cDNA sequence for P138.

SEQ ID NO: 131 Yippee determined cDNA sequence for P143. SEQ ID NO: 132 Yippee determined cDNA sequence for P151. SEQ ID NO: 133 Yippee determined cDNA sequence for P156. SEQ ID NO: 134 Yippee determined cDNA sequence for P157. SEQ ID NO: 135 Yippee determined cDNA sequence for P166. SEQ ID NO: 136 Yippee determined cDNA sequence for P176. SEQ ID NO: 137 Yippee determined cDNA sequence for P178. SEQ ID NO: 138 Yippee determined cDNA sequence for P179. SEQ ID NO: 139 Yippee determined cDNA sequence for P185. SEQ ID NO: 140 Yippee determined cDNA sequence for P192. SEQ ID NO: 141 Yippee determined cDNA sequence for P201- SEQ ID NO: 142 Yippee determined cDNA sequence for P204. SEQ ID NO: 143 Yippee determined cDNA sequence for P208. SEQ ID NO: 144 Yippee determined cDNA sequence for P211. SEQ ID NO: 145 Yippee determined cDNA sequence for P213. SEQ ID NO: 146 Yippee determined cDNA sequence for P219. SEQ ID NO: 147 Yippee determined cDNA sequence for P237. SEQ ID NO: 148 Yippee determined cDNA sequence for P239. SEQ ID NO: 149 Yippee determined cDNA sequence for P248 SEQ ID NO: 150 Yippee determined cDNA sequence for P251. SEQ ID NO: 151 Yippee determined cDNA sequence for P255. SEQ ID NO: 152 Yippee determined cDNA sequence for P256. SEQ ID NO: 153 Yippee determined cDNA sequence for P259. SEQ ID NO: 154 Yippee determined cDNA sequence for P260- SEQ ID NO: 155 Yippee determined cDNA sequence for P263. SEQ ID NO: 156 Yippee determined cDNA sequence for P264. SEQ ID NO: 157 Yippee determined cDNA sequence for P266. SEQ ID NO: 158 Yippee determined cDNA sequence for P270. SEQ ID NO: 159 Yippee determined cDNA sequence for P272. SEQ ID NO: 160 Yippee determined cDNA sequence for P27.8. SEQ ID NO: 161 Yippee determined cDNA sequence for P105. SEQ ID NO: 162 Yippee determined cDNA sequence for P107. SEQ ID NO: 163 Yippee determined cDNA sequence for P137. SEQ ID NO: 164 Yippee determined cDNA sequence for P194. SEQ ID NO: 165 Yippee determined cDNA sequence for PI 95.

-, 17 -

SEQ ID NO: 166 Yippee determined cDNA sequence for P196. SEQ ID NO: 167 Yippee determined cDNA sequence for P220. SEQ ID NO: 168 Yippee determined cDNA sequence for P234. SEQ ID NO: 169 Yippee determined cDNA sequence for P235. SEQ ID NO: 170 Yippee determined cDNA sequence for P243. SEQ ID NO: 171 Yippee determined cDNA sequence for P702P-DE1.

SEQ ID NO-172 is the predicted amino acid sequence for P703P-DE1.

SEQ ID NO: 173 Yippee determined cDNA sequence for P703P-DE1. SEQ ID NO: 174 Yippee determined cDNA sequence for P703P-DE5. SEQ ID NO NO: 175 Yippee determined cDNA sequence for P702P-DE13. SEQ ID NO: 176 Yippee predicted am i nokyse1 i new sequence for P703P- DE13- SEQ ID NO- ' 177 Yippee determined cDNA sequence for P702P-DE14. SEQ ID NO: 178 Yippee predicted amino acid sequence for

P703P-DE14SEQ ID NO: 179 is the determined extended sequence for 16-4736. SEQ ID NO ^: 180 is the determined extended cDNA sequence for

16-4738

SEQ ID NO: 181 is the determined extended cDNA sequence for 16-4741

SEQ ID NO-182 is the determined extended cDNA sequence for

10- 4744

SEQ ID NO: 183 is the determined extended cDNA sequence for 1H-4774

SEQ ID NO: 184 is the determined extended cDNA sequence for 1H-4781

SEQ ID NO: 185 is the determined extended cDNA sequence for 1H-4785

SEQ ID NO: 186 is the determined extended cDNA sequence for 1H-4787

SEQ ID NO: 187 is the determined extended cDNA sequence for 1H-4796

SEQ ID NO ^: 188 is the determined extended cDNA sequence for

11- 4807

SEQ ID NO: 189 je the determined 3 * cDNA sequence for 11-4810. SEQ ID NO: 190 is the determined 3 'cDNA sequence for 11-4811. SEQ ID NO: 191 je determined extended cDNA sequence for 1J-4876- SEQ ID NO: 1K-4884 192 is determined extended cDNA sequence for SEQ ID NO: 193 is determined extended cDNA sequence for 1K-4896 SEQ ID NO: 194 is determined extended cDNA sequence for 1G-4761. SEQ ID NO: 195 is determined extended cDNA sequence for 1G-4762 SEQ ID NO: 196 je determined extended cDNA sequence for 1H-4766. SEQ ID NO: 197 is the determined 3'cDNA sequence for 1H-4770. SEQ ID NO: 198 is the determined 3'cDNA sequence for 1H-4771. SEQ ID NO: 199 je determined extended cDNA sequence for 1H-4772. SEQ ID NO: 200 is determined extended cDNA sequence for 1D-4309. SEQ ID NO: 201 je determined extended cDNA sequence for

ID.1-4278.

SEQ ID NO: ID-4288. 202 is fixed extended cDNA sequence for SEQ ID NO: 203 is fixed extended cDNA sequence for 1D-4283. SEQ ID NO: 204 is fixed prod1oužená cDNA sequence for 1D-4304 SEQ ID NO: 205 is fixed prod1oužená cDNA sequence for 1D-4296 SEQ ID NO: 206 is fixed extended cDNA sequence for 1D-4280 SEQ ID NO: 207 is fixed cDNA sequence for 10-d8fwd. SEQ ID NO: 208 is fixed cDNA sequence for 10-10H10con. SEQ ID NO: 209 is fixed cDNA sequence for 11-C8rev.

* Γ ^; * <^^ · «^ χ · ^: ίί4 ^ * ίίίί.ΐ ^ ί '** ϊίώΐ'-Μ: -> *. ??>-'>:« ishn-i <..-: ·

SEQ ID NO: 210 Yippee determined cDNA sequence for 7.g6fwd. SEQ ID NO: 211 Yippee determined cDNA sequence for 7.g6rev. SEQ ID NO: 212 ie determined cDNA sequence for 8-b5fvd. SEQ ID NO: 213 ie determined cDNA sequence for 8-b5rev. SEQ ID NO: 214 ie determined cDNA sequence for 8-b6fvd. SEQ ID NO: 215 ie determined cDNA sequence for 8-b6rev. SEQ ID NO: 216 ie determined cDNA sequence for 8-d4fwd. SEQ ID NO: 217 ie determined cDNA sequence for 8-d9rev. SEQ ID NO: 218 ie determined cDNA sequence for 8-g3fwd. SEQ ID NO: 219 ie determined cDNA sequence for 8-g3rev. SEQ ID NO: 220 ie determined cDNA sequence for 8-hllrev SEQ ID NO: 221 ie determined cDNA sequence for g-f12fwd SEQ ID NO: 222 ie determined cDNA sequence for g-f3rev. SEQ ID NO: 223 ie determined cDNA sequence for P509S- SEQ ID NO: 224 ie determined cDNA sequence for P510S- SEQ ID NO: 225 ie determined cDNA sequence for P703DE5. SEQ ID NO: 226 ie determined cDNA sequence for 9-A11-. SEQ ID NO: 227 ie determined cDNA sequence for 8-C6. SEQ ID NO: 228 ie determined cDNA sequence for 8-H7- SEQ ID NO: 229 Ie determined cDNA sequence for JPTPN13. SEQ ID NO: 230 ie determined cDNA sequence for JPTPN14 SEQ ID NO: 231 ie determined cDNA sequence for JPTPN23. SEQ ID NO: 232 Ie determined cDNA sequence for JPTPN24. SEQ ID NO: 233 ie determined cDNA sequence for JPTPN25. SEQ ID NO: 234 Yippee determined cDNA sequence for JPTPN3O. SEQ ID NO: 235 ie determined cDNA sequence for JPTPN34. SEQ ID NO: 236 ie determined cDNA sequence for JPTPN35. SEQ ID NO: 237 Yippee determined cDNA sequence for JPTPN36. SEQ ID NO’- 238 ie determined cDNA sequence for JPTPN38. SEQ ID NO: 239 Yippee determined cDNA sequence for JPTPN39. SEQ ID NO: 240 Yippee determined cDNA sequence for JPTPN40. SEQ ID NO: 241 Yippee determined cDNA sequence for JPTPN41. SEQ ID NO: 242 Yippee determined cDNA sequence for JPTPN42. SEQ ID NO: 243 Yippee determined cDNA sequence for JPTPN45. SEQ ID NO: 244 ie determined cDNA sequence for JPTPN46.

SEQ ID NO: 245 le determined cDNA sequence for JPTPN51. SEQ ID NO: 246 Yippee determined cDNA sequence for JPTPN56. SEQ ID NO: 247 Yippee determined cDNA sequence for JPTPN64. SEQ ID NO: 248 Yippee determined cDNA sequence for JPTPN65. SEQ ID NO: 249 Yippee determined cDNA sequence for JPTPN67. SEQ ID NQ: 250 Yippee determined cDNA sequence for JPTPN76 SEQ ID NO: 251 Yippee determined cDNA sequence for JPTPN84. SEQ ID NO: 252 Yippee determined cDNA sequence for JPTPN85- SEQ ID NO: 253 Yippee determined cDNA sequence for JPTPN86. SEQ ID NO: 254 Yippee determined cDNA sequence for JPTPN87. SEQ ID NO: 255 Yippee determined cDNA sequence for JPTPN88. SEQ ID N0-- 256 Yippee determined cDNA sequence for JP1F1- SEQ ID NO: 257 Yippee determined cDNA sequence for JP1F2- SEQ ID NO: 258 Yippee determined cDNA sequence for JP1C2. SEQ ID NO: 259 Yippee determined cDNA sequence for JP1B1. SEQ ID NO: 260 Yippee determined cDNA sequence for JP1B2. SEQ ID NO: 261 Yippee determined cDNA sequence for JP1D3. SEQ ID NO: 262 Yippee determined cDNA sequence for JP1A4- SEQ ID NO: 263 Yippee determined cDNA sequence for JP1F5. SEQ ID NO: 264 Yippee determined cDNA sequence for JP1E6: SEQ ID NO: 265 Yippee determined cDNA sequence for JP1D6. SEQ ID N0 ^: 266 Yippee determined cDNA sequence for JP1B5. SEQ ID NO: 267 Yippee determined cDNA sequence for JP1A6- SEQ ID NO: 268 Yippee determined cDNA sequence for JP1E8. SEQ ID NO: 269 Yippee determined cDNA sequence for JP1D7. SEQ ID NO: 270 Yippee determined cDNA sequence for JP1D9. SEQ ID NO: 271 Yippee determined cDNA sequence for JP1C10. SEQ ID NO: 272 Yippee determined cDNA sequence for JP1A9. SEQ ID NO: 273 Yippee determined cDNA sequence for JP1F12 SEQ ID NO: 274 Yippee determined cDNA sequence for JP1E12. SEQ ID NO: 275 Yippee determined cDNA sequence for JP1D11. SEQ ID NO: 276 Yippee determined cDNA sequence for JP1C11. SEQ ID NO: 277 Yippee determined cDNA sequence for JP1C12. SEQ ID NO: 278 Yippee determined cDNA sequence for JP1B12. SEQ ID NO: 279 Yippee determined cDNA sequence for JP1A12.

-, 21 -

SEQ ID NQ: 280 Yippee determined cDNA sequence for JP8G2. SEQ ID NO: 281 Yippee determined cDNA sequence for JP8H1. SEQ ID NO: 282 Yippee determined cDNA sequence for JP8H2. SEQ ID NO: 283 Yippee determined cDNA sequence for JP8A3. SEQ ID NO: 284 Yippee determined cDNA sequence for JP8A4. SEQ ID NO: 285 Yippee determined cDNA sequence for JP8C3. SEQ ID NO: 286 Yippee determined cDNA sequence for JP8G4- SEQ ID NO: 287 Yippee determined cDNA sequence for JP8B6. SEQ ID NO: 288 Yippee determined cDNA sequence for JP8D6. SEQ ID NO: 289 Yippee determined cDNA sequence for JP8F5. SEQ ID NO: 290 Yippee determined cDNA sequence for JP8A8. SEQ ID NO: 291 Yippee determined cDNA sequence for JP8C7. SEQ ID NO: 292 Yippee determined cDNA sequence for JP8D7. SEQ ID NO: 293 Yippee determined cDNA sequence for JP8D8. SEQ ID NO: 294 Yippee determined cDNA sequence for JP8E7. SEQ ID NO: 295 Yippee determined cDNA sequence for JP8F8. SEQ ID NO: 296 Yippee determined cDNA sequence for JP8G8. SEQ ID NO: 297 Yippee determined cDNA sequence for JP8B10. SEQ ID NO: 298 Yippee determined cDNA sequence for JP8C1Q. SEQ ID NO: 299 Yippee determined cDNA sequence for JP8E9. SEQ ID NO: 300 Yippee determined cDNA sequence for JP8E10- SEQ ID NO: 301 Yippee determined cDNA sequence for JP8F9. SEQ ID NO: 302 Yippee determined cDNA sequence for JP8H9. SEQ ID NO: 303 Yippee determined cDNA sequence for JP8C12. SEQ ID NO: 304 Yippee determined cDNA sequence for JP8E11. SEQ ID NO: 305 Yippee determined cDNA sequence for JP8E12. SEQ ID NO: 306 Yippee determined cDNA sequence for # 12. SEQ ID NO: 307 Yippee determined cDNA sequence for P711P. SEQ ID NO: 308 Yippee determined cDNA sequence for P712P. SEQ ID NO: 309 Yippee determined cDNA sequence for CL0NE23. SEQ ID NO: 310 Yippee determined cDNA sequence for P774P. SEQ ID NO: 311 Yippee determined cDNA sequence for P775P. SEQ ID NO: 312 Yippee determined cDNA sequence for P715P. SEQ ID NO: 313 Yippee determined cDNA sequence for P710P. SEQ ID NO: 314 Yippee determined cDNA sequence for P767P.

SEQ ID NO: 315 is fixed cDNA sequence for P768P. SEQ ID NO- ' 316 to 325 are determined cDNAs sequence for previously isolated genes. SEQ ID NO: 326 is fixed cDNA sequence for P703PDE5. SEQ ID NO: 327 is fixed cDNA sequence for P703PDE5. SEQ ID NO: 328 is fixed cDNA sequence for P703P6.26. SEQ ID NO: 329 is fixed cDNA sequence for P703P6.26. SEQ ID NO: 330 is fixed cDNA sequence for P703PX-23- SEQ ID NO: 331 is fixed cDNA sequence for P703PX-23 SEQ ID NO: 332 is fixed fully cDNA sequence length

P509S.

SEQ ID NO-333 is the determined extended cDNA sequence for

P707P (also referred to as 11-C9).

SEQ ID NO: 334 Yippee determined cDNA sequence for P714P. SEQ ID NO: 335 Yippee determined cDNA sequence for P705P. SEQ ID NO: 336 Yippee determined cDNA sequence for P705P (also referred to as 9-F3). SEQ ID NO: 337 Yippee determined cDNA sequence for P1S # 1O- SEQ ID NO: 338 Yippee amino acid sequence of peptide p5. SEQ ID NO: 339 Yippee the predicted amino acid sequence of P509S SEQ ID NO: 340 Yippee determined cDNA sequence for P778P. SEQ ID NO: 341 Yippee determined cDNA sequence for P786P. SEQ ID NO: 342 Yippee determined cDNA sequence for P789P. SEQ ID NO: 343 Yippee determined cDNA sequence for clone showing homologi i ke Homo sapiens MM46 mRNA. SEQ ID NO: 344 Yippee determined cDNA sequence for clone showing homologi i ke Homo sapiens THF-alpha stimulated ABC protein (ABC50) mRNA SEQ ID NO: 345 Yippee determined cDNA sequence for kone showing homologi i ke Homo sapiens mRNA for E-cadherin. SEQ ID NO: 346 Yippee determined cDNA sequence for clone showing

homology to human nuclear-encoded mitochondrial serine hydroxymethyl transferase (SHMT).

SEQ ID NQ ^: 347 is the determined cDNA sequence for a clone showing homology to Homo sapiens natural resistance associated with the macrophage protein 2 (NRAMP25.

SEQ ID NO: 348 is the determined cDNA sequence for a clone showing homology to Homo sapiens phosphoglucomutase-derived protein (CPGMRP).

SEQ ID NO: 349 is the determined cDNA sequence for a clone showing homology to human mRNA for the p40 proteosome subunit.

SEQ ID NO: 350 Yippee determined cDNA sequence for P777P. SEQ ID NO: 351 Yippee determined cDNA sequence for P779P. SEQ ID NO: 352 Yippee determined cDNA sequence for P790P. SEQ ID NO: 353 Yippee determined cDNA sequence for P784P. SEQ ID NO: 354 Yippee determined cDNA sequence for P776P. SEQ ID NO: 355 Yippee determined cDNA sequence for P780P. SEQ ID NO: 356 Yippee determined cDNA sequence for P544P. SEQ ID NO: 357 Yippee determined cDNA sequence for P745P. SEQ ID NO: 358 Yippee determined cDNA sequence for P782P. SEQ ID NO: 359 Yippee determined cDNA sequence for P783P. SEQ ID NO: 360 Yippee determined cDNA sequence for unknown 17984. SEQ ID NO: 361 Yippee determined cDNA sequence for P787P. SEQ ID NO: 362 Yippee determined cDNA sequence for P787P. SEQ ID NO: 363 Yippee determined cDNA sequence for unknown 17994. SEQ ID NO: 364 Yippee determined cDNA sequence for P781P. SEQ ID NO: 365 Yippee determined cDNA sequence for P785P. SEQ ID NO: 366 to 375 cDNAs were determined sequence for

splicing variant B3O5D.

SEQ ID NO = 376 is the predicted amino acid sequence encoded by SEQ ID NO = 366.

SEQ ID NO: 377 is a predicted amino acid sequence encoded by SEQ ID NO = 372.

SEQ ID NO: 378 is a predicted amino acid sequence encoded by SEQ ID NO: 373.

SEQ ID NO: 379 is the predicted amino acid sequence encoded by SEQ ID NO = 374.

SEQ ID NO: 380 is a predicted amino acid sequence encoded by SEQ ID NO = 375.

SEQ ID NO: 381 is the determined cDNA sequence for B716P.

- 24 of SEQ ID NO:

P711P. SEQ ID NO:

P711P. SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO- SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO NO: SEQ ID NO

PDEF.

SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO: SEQ ID NO:

P1020C} SEQ ID NO: SEQ ID NO ^; SEQ ID NO: SEQ ID NO:

382 the full length cDNA sequence for

383 is the predicted amino acid sequence for

384 Yippee cDNA sequence for P1000C. 385 Yippee cDNA sequence for CGI-82. 386 Yippee cDNA sequence for 23320. 387 Yippee cDNA sequence for CGI-69. 388 Yippee cDNA sequence for L-id1 t-ol-2-dehydrogenase 389 Yippee cDNA sequence for 23379. 390 Yippee cDNA sequence for 23381. 391 Yippee cDNA sequence for KIAA0122. 392 Yippee cDNA sequence for 23399. 393 Yippee cDNA sequence for previously isolated gene. 394 Yippee cDNA sequence for HCLBP. 395 Yippee cDNA sequence for transglutaminase. 396 Yippee cDNA sequence for previously isolated gene. 397 Yippee cDNA sequence for PAP. 398 i is the cDNA sequence for Ets transcription of the fact 399 Yippee cTNA sequence for hTGR. 400 Yippee cDNA sequence for KIAA0295. 401 Yippee cDNA sequence for 22545. 402 Yippee cDNA sequence for 22547. 403 Yippee cDNA sequence for 22548. 404 Yippee cDNA sequence for 22550. 405 Yippee cDNA sequence for 22551. 406 Yippee cDNA sequence for 22552. 407 Yippee cDNA sequence for 22553 Also Known As 408 Yippee cDNA sequence for 22558. 409 Yippee cDNA sequence for 22562. 410 Yippee cDNA sequence for 22565. 411 Yippee cDNA sequence for 22567. 412 Yippee cDNA sequence for 22568-

SEQ ID NO: 413 Yippee cDNA sequence for 22570. SEQ ID NO: 414 Yippee cDNA sequence for 22571. SEQ ID NO: 415 Yippee cDNA sequence for 22572. SEQ ID NO: 416 Yippee cDNA sequence for 22573. SEQ ID NO: 417 Yippee cDNA sequence for 22573. SEQ ID NO: 418 Yippee cDNA sequence for 22575. SEQ ID NO: 419 Yippee cDNA sequence for 22580. SEQ ID NO: 420 Yippee cDNA sequence for 22581. SEQ ID NO: 421 Yippee cDNA sequence for 22582. SEQ ID NO: 422 Yippee cDNA sequence for 22583. SEQ ID NO: 423 Yippee cDNA sequence for 22584. SEQ ID NO: 424 Yippee cDNA sequence for 22585. SEQ ID NO: 425 Yippee cDNA sequence for 22586. SEQ ID NO: 426 Yippee cDNA sequence for 22587. SEQ ID NO: 427 Yippee cDNA sequence for 22588. SEQ ID NO: 428 Yippee cDNA sequence for 22589. SEQ ID NO: 429 Yippee cDNA sequence for 22590. SEQ II) NO: 430 Yippee cDNA sequence for 22591. SEQ ID NO: 431 Yippee cDNA sequence for 22592. SEQ ID NO: 432 Yippee cDNA sequence for 22593. SEQ ID NO: 433 Yippee cDNA sequence for 22594. SEQ ID NO: 434 Yippee cDNA sequence for 22595. SEQ ID NO: 435 Yippee cDNA sequence for 22596. SEQ ID NO: 436 Yippee cDNA sequence for 22847. SEQ ID NO = 437 Yippee cDNA sequence for 22848. SEQ ID NO: 438 Yippee cDNA sequence for 22849. SEQ ID NO: 439 Yippee cDNA sequence for 22851. SEQ ID NO: 440 Yippee cDNA sequence for 22852. SEQ ID NO: 441 Yippee cDNA sequence for 22853. SEQ ID NO: 442 Yippee cDNA sequence for 22854. SEQ ID NO: 443 Yippee cDNA sequence for 22855. SEQ ID NO: 444 Yippee cDNA sequence for 22856. SEQ ID NO: 445 Yippee cDNA sequence for 22857. SEQ ID NO: 446 Yippee cDNA sequence for 23601. SEQ ID NO: 447 Yippee cDNA sequence for 23602.

SEQ ID NO: 448 Yippee cDNA sequence for 23605. SEQ ID NO: 449 Yippee cDNA sequence for 23606. SEQ ID NO: 450 Yippee cDNA sequence for 23612. SEQ ID NO: 451 Yippee cDNA sequence for 23614. SEQ ID NO: 452 Yippee cDNA sequence for 23618. SEQ ID NO: 453 Yippee cDNA sequence for 23622. SEQ ID NO: 454 Yippee cDNA sequence for f 01atehydrogenase. SEQ ID NO: 455 Yippee cDNA sequence for LIM protein. SEQ ID NO: 456 Yippee cDNA sequence for known gene. SEQ ID NO: 457 Yippee cDNA sequence for known gene. SEQ ID NO: 458 Yippee cDNA sequence for previously isolated gene. SEQ ID NO: 459 Yippee cDNA sequence for 23045. SEQ ID NO: 460 Yippee cDNA sequence for 23032. SEQ ID NO: 461 Yippee cDNA sequence for 23054. SEQ ID NO: 462 to 467 are cDNAs sequences for known genes. SEQ ID NO: 468 to 471 are cDNAs sequence for P710P. SEQ ID NO: 472 Yippee cDNA sequence for P1001C.

SEQ ID NO ^: 473 is the determined cDNA sequence for the first splice variant P775P (referred to as 27505).

SEQ ID NO - 474 is the determined cDNA sequence for the second splice variant P775P (referred to as 19947).

SEQ ID NO ^: 475 is the determined cDNA sequence for the third splice variant P775P (referred to as 19941).

SEQ ID NO: 476 is the determined cDNA sequence for the fourth splice variant P775P (referred to as 19937).

SEQ ID NO: 477 is the first predicted amino acid sequence encoded by SEQ ID NO: 474.

SEQ ID NO: 478 is the second predicted amino acid sequence encoded by SEQ ID NO: 474.

SEQ ID NO ^: 479 is a predicted amino acid sequence encoded by SEQ ID NO: 475.

SEQ ID NO: 480 is the first predicted amino acid sequence encoded by SEQ ID NO-473.

SEQ ID NO: 481 is the second predicted amino acid sequence encoded by SEQ ID NO: 473-27. SEQ ID NO: 482 is the third predicted amino acid sequence encoded by SEQ ID NO = 473.

SEQ ID NO: 483 is the fourth predicted amino acid sequence encoded by SEQ ID NO = 473.

SEQ ID NO: 484 is the first 30 amino acids of M.tuberculosis ant i gene Ral2. SEQ ID NO: 485 is the PCR primer AV025. SEQ ID NO: 486 is the PCR primer AV003. SEQ ID NO0-487 is the PCR primer AV027. SEQ ID NO: 488 is the PCR primer AV026. SEQ ID NO: 489-501 are the peptides used in the epitope- vého mapping. SEQ ID NO: 502 is the determined cDNA sequence of complementarity sta a novel region for an anti-P503S monoclonal antibody 20D4 SEQ ID NO: 503 is the determined cDNA sequence of complementarity sta a novel region for an anti-P503S monoclonal antibody JA1.

SEQ ID NOS: 504 and 505 are peptides used in an epitope mapping study

SEQ ID NO: 506 is the determined cDNA sequence of complementarity determining the region for the anti-P503P monoclonal antibody 8H2.

SEQ ID NO: 507 is the determined cDNA sequence of complementarity determining the region for the anti-P503P monoclonal antibody 7H8.

SEQ ID NO: 508 is the determined complementarity determining cDNA sequence for the anti-P503P monoclonal antibody 2D4.

SEQ ID NQ ^: 509 to 522 are peptides used in epitope mapping studySEQ ID NO: 523 is the mature form of P703P used to raise antibodies against P703P.

SEQ ID NO: 524 is the putative full-length cDNA sequence for P703P.

SEQ ID NO: 525 is a predicted amino acid sequence encoded by SEQ ID NO: 524.

SEQ ID NO: 526 is the full length cDNA sequence for P790P.

SEQ ID NO: 527 is the predicted amino acid sequence for 790P. SEQ ID NOs: 528 and 529 are PCR primers.

SEQ ID NO: 530 is the cDNA sequence of the splice variant of SEQ ID NO:

366.

SEQ ID NO: 531 is the open reading frame cDNA sequence of SEQ ID NO: 530.

SEQ ID NO ^: 532 is the predicted amino acid sequence of SEQ ID NO ^: 532. bathtub sequences SEQ ID NO - 531. SEQ ID NO - 533 is the cDNA sequence of the putative ORF P775P. SEQ ID NO: 534 is the predicted amino acid sequence bathtub sequences SEQ ID NO. SEQ ID NO: 535 is the first full length cDNA sequence for P510S. SEQ ID NO'- 536 is the second full length cDNA sequence for P510S. SEQ ID NO: 537 is the predicted amino acid sequence bathtub sequences SEQ ID NO: 535. SEQ ID NO: 538 is the predicted amino acid sequence bathtub sequences SEQ ID NO: 536. SEQ ID NO: 539 is peptide P501S-370. SEQ ID NO: 540 is peptide P501S-376. SEQ ID NO: 541 is up to 551 are epitopes of P501S. SEQ ID NO- 552 is an extended cDNA sequence for P712P. SEQ ID NO: 553 to 568 is the amino acid sequence encoded

a predicted open reading frame in SEQ ID NO: 552.

SEQ ID NO: 569 Yippee prod1oužená cDNA sequence for P776P. SEQ ID NO: 570 Yippee extended cDNA sequence for montage variant P776P, labeled as contig 6. SEQ ID NO-- 571 Yippee extended cDNA sequence for montage variant P776P, labeled as contig 7. SEQ ID NO: 572 Yippee extended cDNA sequence for montage

variant P776P, referred to as contig 14.

SEQ ID NO: 573 _e j amino acid sequence encoded by the first predicted ORF of SEQ ID NO: 570th

SEQ ID NO: 574 _e j amino acid sequence encoded by the second predicted ORF of SEQ ID NO: 570th

SEQ ID NO: 575 is the amino acid sequence encoded by the predicted ORF sequence of SEQ ID NO: 571.

SEQ ID NOs: 576 to 586 is the amino acid sequence encoded by the predicted ORF sequences of SEQ ID NO = 569.

«? 5ί *« ^ ί & ® »ήίίί®ί4ΐί, ί5ί <·>«.

SEQ ID NQ: 587 is the DNA consensus sequence of P767P and P777P sequences.

SEQ ID NOs: 588-590 are amino acid sequences encoded by the predicted ORF sequence of SEQ ID NO = 587.

SEQ ID NO: 591 Yippee extended cDNA sequence for P1020C. SEQ ID NO: 592 Yippee the predicted amino acid sequence encoded sequences SEQ ID NO: P1020C. SEQ ID NO: 593 Yippee splicing variant P775P known as

50748.

SEQ ID NO: 594 Yippee sestrihová variant P775P tagged as 50717 SEQ ID NO: 595 Yippee sestrihová variant P775P tagged as 45985 - SEQ ID NO: 596 Yippee sestrihová variant P775P tagged as

38769.

SEQ ID NO: 37922. 597 je sestrihová variant P775P tagged as SEQ ID NO: 598 Yippee sestrihová variant P775P tagged as 49274. SEQ ID NO: 599 Yippee sestrihová variant P510S tagged as

39487.

SEQ ID NO: 5167.16. 600 Yippee sestrihová variant P504S tagged as SEQ ID NO: 5167.1. 601 Yippee sestrihová variant P504S tagged as SEQ ID NO: 5163.46. 602 Yippee sestrihová variant P504S tagged as SEQ ID NO: 5163.42. 603 Yippee sestrihová variant P504S tagged as SEQ ID NO: 5163.34. 604 Yippee sestrihová variant P505S tagged as SEQ ID NO: 5163.17. 605 Yippee sestrihová variant P504S tagged as SEQ ID NO: 606 Yippee sestřihová variant P505S tagged as

10640.

SEQ ID NOS: 607 to 615 are the PCR sequences of prierf1.

SEQ ID NO ^: 616 is the determined cDNA sequence for the P703P and PSA fusion.

SEQ ID NO: 617 is the amino acid sequence for fusion of P703P and PSA.

SEQ ID NO: 618 is the cDNA sequence of the DD3 gene.

SEQ ID NO: 619 is an extended cDNA sequence for P714P.

SEQ ID NOs: 620-622 are cDNA sequences of splice variants

P704P.

SEQ ID NO: 623 is splice cDNA sequence variants P553S known as P553S-14 SEQ ID NO: 624 is splice cDNA sequence variants P553S known as P553S-12 SEQ ID NO-625 is splice cDNA sequence variants P553S known as P553S-10. SEQ ID NO: 626 is splice cDNA sequence variants P553S known as P553S-6. SEQ ID NO: 627 is and a new sequence coded sequences

SEQ ID NO: 626.

SEQ ID NO: 628 Yippee first amino acid sequence coded sequences SEQ ID NO: 623. SEQ ID NO: 629 Yippee the second am i nokyse1 i new sequence coded sequences SEQ ID NO - 623. SEQ ID NO: 630 Yippee first full length cDNA sequence for gene spe

specific for prostate transglutaminase (also referred to as P558S).

SEQ ID NO: 631 is the second full length cDNA sequence for the prostate transglutaminase specific gene

SEQ ID NO: 632 is am i nokyse1 i new sequence coded sequences SEQ ID NO : 630. SEQ ID NO: 633 is am i nokyse1 i new sequence coded sequences SEQ ID NO : 631. SEQ ID NO: 634 is full length cDNA sequence for P788P. SEQ ID NO- ' 635 is amino acid sequence coded sequences SEQ ID NO : 634.

SEQ ID NO: 636 is the determined cDNA sequence for the polymorphic variant P788P.

SEQ ID NO: 637 is SEQ ID NO: 636. the amino acid sequence encoded by the sequence SEQ ID NO: 638 je the amino acid sequence of peptide 4 of P703P. SEQ ID NO: 639 je the amino acid sequence that it encodes peptide 4 from P7O3P. SEQ ID NO: 640 to 655 are cDNA sequences encoding epitopes of P703P SEQ ID NO: 656 až 671 are the amino acid sequences of epitopes

P703P.

SEQ ID NOS: 672-673 are PCR primers.

SEQ ID NO ^; 674 is a cDNA sequence encoding the N-terminal portion of P788P expressed in E.coli.

SEQ ID NO: 675 is a cDNA sequence encoding an N-terminal portion of P788P expressed in E.coli.

SEQ ID NO: 676 is the amino acid sequence of M. tuberculosis antigen Ral2.

SEQ ID NOs ^: 677-678 are PCR primers.

SEQ ID NO: 679 Yippee cDNA sequence for Ral2-P51OS-C construct SEQ ID NO: 680 Yippee cDNA sequence for P510S-C construct. SEQ ID NO: 681 Yippee cDNA sequence for P510S-E3 construct. SEQ ID NO: 682 Yippee amino acid sequence for Ral2-P510S-

construct.

SEQ ID NO: 683 is the amino acid sequence for the P510S-C construct.

SEQ ID NO: 684 is the amino acid sequence for the P51OS-E3 construct.

SEQ ID NO: 685 to 690 are PCR primers. SEQ ID NO: 691 Yippee cDNA sequence for Ral2-P775P- -0RF3 kostrukt. SEQ ID NO: 692 Yippee amino acid sequence for Ral2 -P775P-0RF3

construct.

SEQ ID NOS: 693 and 694 are PCR primers.

SEQ ID NO ^: 695 is the determined amino acid sequence for P7O3P His tagged fusion protein.

SEQ ID NO: 696 is the determined cDNA sequence for P7O3P His linked fusion protein.

SEQ ID NOS: 697 and 698 are PCR primers.

SEQ ID NO: 699 is the determined amino acid sequence for P7O5P His linked fusion protein.

SEQ ID NO: 700 is the determined cDNA sequence for P705P His linked fusion protein.

SEQ ID NOS: 701 and 702 are PCR primers.

SEQ ID NO-703 is the determined amino acid sequence for P711P His linked fusion protein.

SEQ ID NO: 704 is the determined cDNA sequence for P711P His linked fusion protein.

SEQ ID NO: 705 is the amino acid sequence of M. tuberculosis antigen Ral2.

SEQ ID NOs 706 and 707 are PCR primers.

SEQ ID NO: 708 is the determined cDNA sequence for the Ral2-P501S-E2 construct.

SEQ ID NO: 709 is the determined amino acid sequence for the Ral2-P501S-E2 construct.

SEQ ID NO: 710 Yippee amino acid sequence for epítop P501S. SEQ ID NO: 711 Yippee DNA sequence encoding SEQ ID NO: 710. SEQ ID NO: 712 Yippee amino acid sequence for epitope P501S. SEQ ID NO: 713 Yippee DNA sequence encoding SEQ ID NO: 712. SEQ ID NO: 714 Yippee a peptide used in an epitope mapping study. SEQ ID NO: 715 Yippee amino acid sequence for epitope P501S. SEQ ID NO: 716 Yippee DNA sequence encoding SEQ ID NO ^: 715. SEQ ID NO: 717 to 719 are the amino acid sequences for CD4 epitopes P501S 1. SEQ ID NO: 720 to 722 are DNA sequences coding sequences

SEQ ID NOS: 717-719.

SEQ ID NOS: 723 to 734 are the amino acid sequences for the putative

CTL epitopes of P703P.

SEQ ID NO: 735 Yippee full length cDNA sequence for P789P. SEQ ID NO: 736 Yippee amino acid sequence encoded by SEQ 735. SEQ ID NO: 737 Yippee set full length of cDNA ; sequence for

fe ^: ^ fcSŘ! fcŠ <Miššiši «S (« V «i splice variant P776P called contig 6).

SEQ ID NOs: 738 to 739 are the determined full-length cDNA sequences for the splice variant P776P referred to as contig 7.

SEQ ID NOs: 74Q to 744 are the amino acid sequences encoded

SEQ ID NO: 737.

SEQ ID NOs- 745 to 750 are the amino acid sequences encoded by the splice variant P776P referred to as contig 7.

SEQ ID NO: 751 is a full length cDNA sequence for human transmembrane protease serine 2.

SEQ ID NO: 752 is the amino acid sequence encoded by SEQ ID NO: 751.

SEQ ID NO: 753 is the cDNA sequence encoding the first 209 amino acids of human transmembrane protease serine 2.

SEQ ID NO- · 754 is the first 209 amino acids of human transmembrane protease serine 2.

SEQ ID NO: 755 is the amino acid sequence of peptide 296 to 322 of P501S.

SEQ ID NOs: 756 and 759 are PCR primers.

SEQ ID NO: 760 is the determined T cell receptor Vb cDNA sequence for the P50β-specific T cell clone 4E5.

SEQ ID NO: 761 is the determined T cell receptor Va chain cDNA sequence for P501S-specific T cell clone 4E5.

SEQ ID 760. NO: 762 Yippee the amino acid sequence encoded by SEQ ID N0-- SEQ ID NO: 763 Yippee the amino acid sequence encoded by SEQ ID NO: 761- SEQ ID NO: 764 Yippee full length open reading frame for P768P

incorporating a stop codon.

SEQ ID NO: 765 is a full length open reading frame for P768P without a stop codon.

SEQ ID NO: 766 is the amino acid sequence encoded by SEQ ID NO = 765.

SEQ ID NOs: 767-772 are amino acid sequences for predicted domains of P768P.

SEQ ID NO: 773 is the full length cDNA sequence of P835P.

SEQ ID NO ^: 774 is the cDNA sequence of a previously identified clone

FLJ13581.

SEQ ID NO: 775 is the open reading frame cDNA sequence for P835P with a stop codon.

SEQ ID NO: 776 is the open reading frame cDNA sequence for P835P without stop codon.

SEQ ID NO: 777 is the full length amino acid sequence for P835P SEQ ID NOs: 778 to 785 are the amino acid sequence of the extracellular and intracellular domains of P835P.

SEQ ID NO: 786 is the full length cDNA sequence for P100OC.

SEQ ID NO: 787 is the cDNA sequence of the open reading frame for P100OC including the stop codon.

SEQ ID NO: 788 is the open reading frame cDNA sequence for P100OC without a stop codon.

SEQ ID NO: 789 is the full length amino acid sequence for

P1OOOC.

SEQ ID NO: 790 is amino acids 1 to 100 of SEQ ID NO: 789.

SEQ ID NOs- 791 are amino acids 100 to 492 of SEQ ID NO = 789.

SEQ ID NO: 792 is the amino acid sequence of a. Prepro-P501S recombinant protein.

The invention is further illustrated by the detailed description.

The invention is generally directed to compositions and their use in the therapy and diagnosis of cancer, particularly prostate cancer. As will be further elucidated, the illustrative compositions of the invention include, but are not limited to, polypeptides, particularly immunogenic polypeptides, polynucleotides encoding such polypeptides, antibodies and other binding agents, antigen presenting cells (SPCs), and immune system cells (e.g. for example, T cells}.

The practice of the invention employs, unless otherwise indicated, conventional methods of virology, immunology, microbiology, molecular biology and recombinant DNA techniques known to those skilled in the art, many of which are described below. Such techniques are also fully explained in the literature (for example, Sambrook et al., Melecular Cloning: A Laboratory Manual, 2nd Edition, 1989; Maniatis et al., Molecular Cloning; A Laboratory Manual, 1982; DNA Cloning; A Practical Approach, Vol. I & II, D. Glover, 01 Gonucleotide Synthesis, N. Gait, 1984; Nucleic Acid Hybridization, B. Hames & S. Higgins, 1985; Transcription and Translation, B Hames & S. Higgins, 1984; Animal Cell Culture, edited by R. Freshney, 1986; Perbal, A Practical Guide to Molecular Cloning, 1984).

The singular forms "a," "an" and "the" include plural referents unless the context excludes this.

Polypept. ID composition

The term polypeptide is used herein in the conventional sense of the term, i.e., as an amino acid sequence. Polypeptides are not limited to the specific length of the product; therefore, peptides, oligopeptides, and proteins are included in the definition of a polypeptide, and such terms may be used interchangeably unless otherwise specifically stated. This term does not refer to or include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, and phosphorylation, as well as other modifications known in the art, both naturally and unnaturally. The polypeptide may be an entire protein or a subsequence thereof. Of particular interest are polypeptides of the invention that are amino acid sequences containing epitopes, i.e., antigenic determinants substantially responsible for the immunogenic properties of the polypeptide and capable of eliciting an immune response.

Particularly illustrative polypeptides of the invention include polypeptides encoded by a polynucleotide sequence in any of the following sequences; SEQ ID NO = 1 to 111, 115 to

171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, or sequences that hybridize under moderately stringent or highly stringent conditions to a polynucleotide sequence from any of the following: SEQ ID NO = 1 to 111, 115 to 171, 173 to

175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332-355 340 up to 375, 381, 382 and 384 to 476, 524, 526, 530 533, 535, 536,552 , 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631,634 , 636, 639 to 655, 674, 680, 681, 711, 713 716,

720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788. In particular embodiments, the polypeptides of the invention comprise amino acid sequences selected from SEQ ID NOs: 112 to 114, 172, 176, 178, 327, 329, 331, 336, 339, 376 to 380, 383, 477 to 483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537 to 551, 553 to 568, 573 to 586, 588 to 590, 592, 627 to 629, 632, 633, 635, 637, 638, 656 to 671, 675, 683, 684, 710, 712, 714, 715, 717 to 719, 723 to 734, 736, 740-750, 752, 754, 755, 766-772, 777-785 and 789-791.

Polypeptides of the invention are sometimes referred to herein as prostate-specific proteins or prostate-specific polypeptides, which designation refers to their identification at least in part based on their overexpression in prostate tissue samples. Protein-specific proteins or prostate-specific polypeptides therefore generally relate to a polypeptide sequence of the invention or a polynucleotide sequence encoding such a polypeptide which is expressed by a substantial proportion of the prostate tissue sample, for example a proportion greater than about 20%, more preferably greater than about 30 more preferably greater than about 50% or even **

- '' • r »- ··» - - H. _t 4 ^. ^ «ιΜ ^^ ν * ι» ^^ ίβ ^^ Ο ^^ ®Ο ^ ®ίί5Β! »^^ ί ^ .ίί« Κ

37 larger prostate tissue test specimens at least two times, and preferably at least five times greater than the expression rate of other normal tissues as determined by the assays described below. The prostate-specific polypeptide sequence of the invention, based on increased expression in tumor cells, has of particular utility as both a diagnostic marker and a therapeutic target, as discussed below.

According to certain preferred embodiments, the polypeptides of the invention are immunogenic, i.e., detectably react in an immunoassay (such as an ELISA or T-cell stimulation assay) with antisera and / or T cells of a prostate cancer patient. Screening for immunogenic activity can be performed using methods well known to those skilled in the art. For example, such screening may be performed as described by Harlov and Lane (Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). In one illustrative case, the polypeptide can be immobilized on a solid support and contacted with the patient's serum to bind serum antibodies to the immobilized polypeptide. Unbound serum can then be removed and bound antibodies can be determined, for example, with ¹²⁵ J-labeled protein A.

The invention also encompasses immunogenic portions of the polypeptides of the invention. By immunogenic portion is meant herein a fragment of an immunogenic polypeptide of the invention that is itself immunologically reactive (i.e., specifically binds) to B-cells and / or surface T-cells of antigen receptors that recognize the polypeptide. Immunogenic portions can generally be identified using well known methods as summarized, for example, by Paul (Fundamental Immunology, 3rd Edition, pp. 243-247, Raven Press, 1993). Such methods include screening polypeptides for the ability to react with antigen-specific antibodies, antisera and / or T cell lines and / or clones. By antisera and antibodies is meant antigen-specific substances that specifically bind to an antigen (i.e., they react with a protein in an ELISA or other immunoassay and do not detectably detect unrelated proteins). Such antisera and antibodies may be prepared as described below using well known procedures.

According to one preferred embodiment, the immunogenic portion of a polypeptide of the invention is a portion that reacts with antisera and / or T cells to a degree that is not substantially lower than full length reactivity of the polypeptide (e.g., ELISA and / or T cell reactivity assay) . Preferably, the immunogenic activity of the immunogenic portion is at least about 50, preferably at least about 70%, and most preferably at least about 90%, of the full length immunogenicity of the polypeptide. In some cases, preferred immunogenic portions have been found to have immunogenic activity greater than the corresponding full length polypeptide, for example, greater than about 100% or 150%, or even greater immunogenic activity.

In some other cases, illustrative immunogenic portions may include peptides in which the N-terminal leader sequence and / or transmembrane domain is deleted. Other illustrative immunogenic portions comprise a small N-terminal or C-terminal deletion (e.g., 1 to 30 amino acids, preferably 5 to 15 amino acids) with respect to the mature protein.

In another embodiment, the polypeptide composition of the invention may also comprise one or more polypeptides that are immunologically reactive with T cells and / or antibodies generated against a polypeptide of the invention, particularly a polypeptide having the amino acid sequence described herein or an immunogenic fragment or immunogenic variant thereof.

In another embodiment, the invention relates to polypeptides which

39 comprising one or more polypeptides capable of eliciting T cells and / or antibodies that immunologically react with one or more of the polypeptides described herein or with one or more of the polypeptides encoded by adjacent amino acid sequences comprised in the polynucleotide sequences described herein or their immunogenic fragments or variants, or with one or more nucleic acid sequences that hybridize to one or more of these sequences under conditions of moderate or high stringency.

The invention also relates to polypeptide fragments comprising at least about 5, 10, 15, 20, 25, 50 or 100 or more contiguous amino acids, including all transient lengths of the polypeptide composition, such as in the sequences of SEQ ID NOs: 112-114 , 172, 176, 178, 327, 329, 331, 336, 339, 376-380, 383, 477-483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537-551 , 553 to 568, 573 to 586, 588 to 590, 592, 627 to 629, 632, 633, 635, 637, 638, 656 to 671, 675, 683, 684, 710, 712, 714, 715, 717 to 719 , 723 to 734, 736, 740 to 750, 752, 754, 755, 766 to 772, 777 to 785 and 789 to 791, or a sequence encoded by a polynucleotide sequence selected from the group consisting of:

1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 326, 328, 330. 332 to 335, 340 to 375, 381, 382 and 524 526 530 531, 533, 535, 536 552, 569 to 572 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 680, 681,711 713, 716, 720-7 722, 735, 737-7 753, 764, 765 773 to 776 and 786 to 788.

SEQ ID NO:

307 to 315 384 až 476, , 587, 591, 655, 674, 739, 751,

The invention also relates to variants of the polypeptide compositions described herein. The polypeptide variants generally encompassed by the invention generally exhibit at least about 70%. 75¾. 80¾. 85¾. 90¾. 91¾. 92¾. 93¾. 94¾. 95¾. 96¾. 97¾. 98¾ or 99¾ or even greater identity (determined as described below) along its length with the disclosed polypeptide sequence.

According to one preferred embodiment, the polypeptide fragments and variants of the invention are immunologically reactive with an antibody and / or T cells that react with a full-length polypeptide specifically described.

According to another preferred embodiment, the polypeptide fragments and variants of the invention have an immunogenic activity of at least about 50%, preferably at least about 70%, and most preferably at least about 90% or even more compared to the full length polypeptide sequence specifically described.

As used herein, the term polypeptide variant '' refers to a polypeptide that typically differs from a polypeptide specifically described herein by one or more substitutions, deletions, additions, and / or insertions. Such variants may occur naturally or may be generated synthetically, for example, by modifying one or more of the above polypeptide sequences of the invention and evaluating their immunogenic activity as described herein using any method known in the art.

For example, certain elucidative variants of the polypeptides of the invention include variants in which one or more portions, such as an N-terminal control or transmembrane domain, are deleted. Another explanatory variant is one in which a small portion (e.g., 1 to 30 amino acids, preferably 5 to 15 amino acids) is removed from the N-terminal and / or C-terminal mature protein.

In many cases, the variant contains conservative substitutions. "Conservative substitution" means a substitution in which one amino acid is replaced by another amino acid that has a similar property to that of a peptide chemist, with the secondary structure and hydropathic nature of the polypeptide substantially unchanged. As mentioned above, for ϋΛ, ΛϋΛΛΜΛΜΜΜΜ »Μ-Τ» »Κ 4,“.

)>)) · »>}>

))) 5 »>» »

»))»)

1) 1))

11 1 »»

Modifications in the structure of the polynucleotide and polypeptides of the invention are introduced, and always a functional molecule that encodes a variant or derivative of the polypeptide with desirable characteristics, e.g., immunogenic characteristics, is obtained. If it is desired to alter, the amino acid sequence of the polypeptide to generate an equivalent or even improved immunogenic variant or portion of the polypeptide of the invention will generally alter one or more codons encoding the DNA sequences of Table I.

For example, certain amino acids may be replaced by other amino acids in the protein structure without significantly losing the interactive binding capacity by structures such as antigen-binding regions of antibodies or. binding sites on substrate molecules. Since it is the interactive capacity and nature of the protein that defines protein biological functional activity, substitutions of certain amino acid sequences may be made in the protein sequence and indeed in their DNA-coding sequence, and nevertheless a protein with similar properties may be obtained. make various changes in the peptide sequences of the compositions of the invention or in the corresponding DNA sequences that encode said peptides without substantially losing their biological usefulness or activity.

Table I

Amino acids Codons alanine Ala AND GCA GCC GCG GCU cysteine Cys C UGC UGU aspartic acid Asp D GAC GAU glutamic acid Glu E GAA GAG phenylalanine Phe F UUG uuu glycine Gly G GGA GGC GGG GGU

and

histidine His H CSC HI isoleucine Ile AND ADA AUC AUU lysine Lys TO AAA. AAG leucine Leu L UUA UUG CUA CUC CUG CDU methionine Met M AUG asparagine Asn H AAC AAU proline For P CCA CCC CCG CCll glutamine Gin 0 CAA CAG arginine Arg R AGA AGG CGA CGC CGG CGU šeřin Ser WITH AGC- AGU UCA UCC UCG UCU threonine Thr T ACA ACC ACG ACU valine Wall IN GUA GUC GUG GUU tryptophan Trp IN UGG ryrosine Tyr y UAC UAU At implementation of such changes se can take in regard

the amino acid index. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally known in the art (CKyte and Doolittle, 1982). It is believed that the relative hydropathic nature of the amino acid contributes to the secondary structure of the resulting protein, which in turn defines the interaction of the protein with other molecules, such as enzymes, substrates, receptors, DNA, antibodies, and antigen. Each amino acid is labeled with a hydropathic index based on its hydrophobicity and charge characteristics (Kyte and Doolittle, 1982). These values are: isoleucine ¢ - + - 4,5), valine ¢ + 4,2), leucine ¢ + 3,8), phenylalanine ¢ + 2,8), cysteine / cystine ¢ + 2,5), methionine ¢ +1.9), alanih C + 1.8), glycine ¢ -0.4), threonine ¢ -0.7), lilac ¢ -0.8), tryptophan ¢ -0.9), tyrosine ¢ -1 , 3), proline ¢ -1.6), histidine ¢ -3.2), glutamate ¢ -3.5), glutamine ¢ -3.5), aspartate ¢ -3.5), asparagine ¢ -3.5 lysine ¢ -3,9) and arginine C-4,5).

It is known in the art that certain amino acids may be replaced by other amino acids having a similar hydropathic

index or early and yet result in a protein with similar biological activity, i.e. a biologically functionally equivalent protein is obtained. To make such amino acid substitution changes, their hydropathic indices of ± 2 are preferred, ± 1 in particular. preferred and ± 0.5 even more preferred. It is also known in the art that replacement of similar amino acids can be effected efficiently on a hydrophilicity basis. In particular, U.S. Pat. No. 4,554,10Ϊ discloses that the greatest local average hydrophilicity of a protein, driven by the hydrophilicity of its adjacent amino acids, is related to the biological properties of the protein.

As described in detail in U.S. Pat. No. 4,554,101, the following amino acid residues are assigned the following hydrophilicity values - arginine ¢ + 3.0), lysine ¢ + 3.0), aspartate ¢ + 3.0 + 1). , glutamate. 3,0 + 3.0 ± 1), lilac ¢ + 0.3), asparagine ¢ + 0.2), glutamine ¢ + 0.2), glycine (0), threonine ¢ -0.4), proline ' _s - S ¢ -0.5 + 1), alanine (-0.5), histidine ¢ -0.5), cysteine ¢ -1.0), methionine ¢ -1.3), valine ¢ -1.5), leucine ¢ -1.8), isoleucine ¢ -1.8), tyrosine ¢ -2.3), phenylalanine ¢ -2.5), tryptophan (-3.4). It will be appreciated that the amino acid may be replaced by another amino acid having a similar hydrophilicity value and yet a biologically equivalent and in particular immunologically equivalent protein may be obtained. In such changes, it is preferred to replace amino acids whose hydrophilicity values are within + 2, more preferably +1 and most preferably ± 0.5.

As mentioned above, amino acid substitution is therefore generally based on the relative similarity of the side chain amino acid substitutions, for example, their hydrophobicity, hydrophillicity, charge, size. Exemplary substitutes that take into account various of the above characteristics are well known to those skilled in the art and include: arginine and lysine, glutamate and aspartate, lilacs and threonine, glutamine and asparagine, and valine, leucine and isoleucine.

, 'H 44,)> »I> ·»)>

)>> t) 7 I)) i 7 »

Ί i i>

71 »

In addition, each polynucleotide may be modified to increase its stability in vivo. Possible modifications include, without limitation, the addition of flanking sequences at the ends or the use of phosphorothionate or 2-O-methyl rather than phosphodiesterase linkers in the backbone / or the inclusion of unconventional bases such as inosine, queosine and vyutosine as well as acetylforum, thiophore and other modified forms of adertine, cytidine, guanidine, thymine and uridine.

Further, amino acid substitution may be based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids are lysine and arginine, and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine and valine, glycine and alanine, asparagine and glutamine, and serine , threonine, phenylalanine and tyrosine. Other groups of amino acids that can provide conservative changes include C1-ala, pro, gly, glu, asp, gin, asn, ser, thr; C2) cys, ser, tyr, thr; C3) val, ile, leu, meta, ala, phe; (4) lys, arg, his and <5) phe, tyr, trp and his. The variant may also contain, or alternatively, non-conservative changes. In a preferred embodiment, the variant polypeptides differ from the native sequence by substitution, deletion, or addition of five or fewer amino acids. Variants may also be (or alternatively) modified, for example, by deletion or addition of amino acids that have minimal effect on the immunogenicity, secondary structure, and hydropathic nature of the polypeptide.

As mentioned above, the polypeptides may form a signal (or leader) sequence at the end of the N-terminus of the protein, which co-translationally or post-translationally directs the protein transfer. The polypeptide may also be conjugated to a linker or other sequence to facilitate synthesis, purification or identification of the polypeptide (e.g., poly-His), or to facilitate binding of the polypeptide.

solid state carrier. For example, the polypeptide may be conjugated to an immunoglobulin Fc region.

When comparing polypeptide sequences, two sequences are identified as identical if the amino acid sequence in both sequences is the same when compared to the maximum correspondence as further described below. Two sequences are typically compared by comparing the sequences through a comparison window to identify and compare local regions of sequence similarity. As used herein, a comparison window is understood to mean a segment of at least 20 contiguous positions, usually 30 to about 75, 40 to about 50, in which sequences can be compared to a reference sequence with the same number of contiguous positions when both sequences are optimally aligned.

Optimal alignment of sequences for comparison can be performed using the Megalign program in the Lasergene suite Of bioinformatics software (DNASTAR Inc, Madison, VI) using default parameters. This program includes several sorting schemes they have described: Dayhoff M.O. (A model of evolutionary change in proteins - Matrices for detecting distant realtionships. In Dayhoff, MO (Publisher) Atlas of Protein Sequence and Structure, National Biomedical Reseach Foundation, Washington DC, Vol. 5 (3) pp. 345-358 1978) Hein J. (Unified Approach to Alignement and Phylogenes, pp. 626-645, Methods in Enzymology vol. 183, Academic Press, Inc. San Diego, CA, 1990); Higgins D.G. and Sharp P.M. CABIOS 5: 151-153 (1989); Myers E.V. and Muller V. (CABIOS 4: 11-17, 1988); Robinson E.D. (Comb. Theor. 11, p.105, 1971); Santou Ni, Nes M. (Mol. Biol. Ecol. 1987, 4, 406-425); Sneath P.H.A. Sakal R. R. (Numerical Taxonomy-The Principles and Practice of Nuclear Taxonomy, Freeman Press, San Francisco, CA, 1973); Vilbur V.J. and Lipman D.J. (Proc. Natl. Acad. Sci USA 80: 726-730, 1983).

46, Otherwise, optimal sequence alignment for comparison can be performed by a local identity algorithm (Smith and Waterman Add. APL. Matli 2, p. 482, 1981), by a coined identity algorithm (Needleman and Wunch, J. Mod. Biol. 48, p. 443 (1970), search for similarity patterns (Pearson and Lipman, Proc. Mat. Acad-Sci. USA 85, p. 2444 (1988)), by numerically supplementing these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA v. Genetics Software Package, Genetics Computer Group (GCG, Science Dr., Madison, VI) or inspection.

One preferred example of algorithms suitable for determining percent sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms described by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1977) and Altschul et al. (J. Mol. Biol. 215: 403-410, 1990). The BLAST and BLAST 2.0 algorithms can be used, for example, with the parameters described herein to determine the identity of the polynucleotide and polypeptide sequences of the invention. BLAST analysis software is a commercial product (National Center for Biotechnology Information). For amino acid sequences, a ranking matrix can be used to calculate the cumulative result. The spreading of the word hits in each direction stops when the cumulative alignment drops out of the maximum X value; the compact early approaches near zero or below, due to the accumulation of one or more negat. including, but not limited to, residual alignments; or the end of a sequence is reached. The BLAST algorithm's V, T, and X parameters determine the sensitivity and alignment speed.

According to one method, the percent sequence identity is determined by comparing two optimally aligned sequences in the window by comparing at least 20 positions, wherein the portion of the polypeptide sequence in the comparison windows may comprise an addition or deletion (i.e., gaps) of 20% or less, usually 5-15 or 10-12 compared to reference sequences (which do not contain additions or deletions) for optimal alignment of the two sequences.

, * ´ τ, 47 - - ,; , · ’, Ι))) Λ i)» Ί) I ''. I ι ί i, '’*'

5 '

The percentage is calculated by determining the number of positions in which the amino acid residue is identical in both sequences to achieve the number of positions to be monitored, dividing the number of positions to be monitored by the total number of positions in the reference sequence (ie window size).

According to another illustrative embodiment, the polypeptide may be a fusion polypeptide that comprises a plurality of polypeptides described herein and an unrelated sequence, for example a known tumor protein. For example, the fusion partner may assist in the formation of T helper epitopes (immunological fusion partner), preferably T helper epitopes recognized by humans, or may assist in the expression of a protein (expression enhancer) in a higher yield than the native recombinant protein. Certain preferred helper partners are fusion partners that promote both immunological activity and expression. Other fusion partners may be selected to increase the solubility of the polypeptide or to allow the polypeptide to target the desired intracellular domain. Still other fusion partners include affinity tails that brown the purification of the polypeptide.

The polypeptides may be fusion polypeptides that comprise a plurality of polypeptides of the invention or comprise at least one polypeptide of the invention and an unrelated sequence as a tumor protein. For example, the fusion partner may assist in the case of a T helper epitope (immunological fusion partner), preferably a T helper epitope recognized by 1dmi, or may assist in the expression of the protein (expression enhancer) in higher yields than the native recombinant protein. Certain preferred fusion partners are immunological and expression promoting fusion partners. Other fusion partners may be selected to increase peptide solubility, or to allow targeting of a polypeptide to a desired intracellular region. Still other fusion partners include an affinity tag to facilitate purification of the polypeptide.

Fusion polypeptides can generally be prepared by methods known per se, including chemical conjugation. Preferably, the fusion polypeptide of the id expression is like a recombinant polypeptide, allowing the production of larger amounts with respect to the non-fusion polypeptides in the expression system. DNA sequences encoding the polypeptide components can be assembled separately and ligated into a suitable expression vector. The 3 'end of the DNA sequence encoding the polypeptide component is ligated with or without a polypeptide linker to the 5' end of the DNA sequence encoding the second polypeptide component so that the reading frames of the sequences are in phase. This allows translation into a single fusion polypeptide that retains the biological activity of both components of the polypeptides.

The polypeptide linker sequence can be used to separate the first and second polypeptide components at a sufficient distance to ensure that each polypeptide is folded into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion polypeptide by standard methods known in the art. A suitable peptide linker sequence may be selected based on the following factors: (1) its ability to adopt a flexible elongated conformation: (2) its inability to adopt a secondary structure that can acting with functional epitopes on the first and second polypeptides: and C3) the absence of hydrophobic or charged residues that could react with the polypeptide functional epitopes. A preferred peptide linker sequence comprises Gly, Asn, and Ser residues. Other near neutral amino acids, such as Thr and Ala, can also be used as linkers. Amino acid sequences that may suitably be used as linkers include those described by Maratea et al. CGene 40, pp. 39-46 (1985); Murphy et al. CProc. Nati. Acad. Sci. USA 83: 8258-8262 (1986)), which are described in U.S. Pat. No. 4,935,233 and U.S. Pat. No. 4,751,880. The linker sequence may be 1 to about 50 amino acids in length. Linkers are not required if the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate functional domains and prevent steric interference.

The ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for DNA expression are located only 5 'to the DNA sequence encoding the first polypeptides. Similarly, the stop codons required to terminate translation and transcription termination signals are only 3 ^J to the DNA sequence encoding the second polypeptide.

The fusion polypeptide may comprise a polypeptide described herein together with an unrelated immunogenic protein, such as an immunogenic protein capable of eliciting a feedback. Examples of such proteins include tetanus, tuberculosis and jaundice proteins (for example, Stout et al., Nev Engl. J. Med. 336, 86-91 (1997)).

In one preferred embodiment, the immunological fusion partner is derived from a Mycobacterium sp., Such as a Mycobacterium tuberculosis-derived Ral2 fragment. Ral2 compositions and methods of using them to promote expression and / or immunogenicity of heterologous polynucleotides / polypeptide sequences are described in U.S. Patent Application Serial No. 60 / 158,585. Essentially, Ral2 refers to a polynucleotide region that is a subsequence of Mycobacterium um tuberculosis MTB32A nucleic acid. MTB32A is a 32 KD molecular weight serine protease encoded by the gene in virulent and avirulent M. tuberculosis strains. The nucleotide sequence and the amino acid sequence of MTB32A are described in the literature (e.g., U.S. application Ser

30, the invention number 60 / 158,585; also Skeiky et al., Infection and Immun. 67, p. 1998-4007, 1999). The C-terminal fragments of the MTB32A coding sequence express highly and remain as soluble polypeptides during the purification process. In addition, Ral2 can promote the immunogenicity of the heterologous immunological polypeptides with which it is fused. One preferred Ra12 fusion polypeptide comprises a 14 KD C-terminal fragment corresponding to amino acid residues 192-323 of MTB32A. Other preferred Ral2 polynucleotides generally comprise at least about 15 consecutive nucleotides, at least about 30 nucleotides, at least about 60 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, or at least about 300 nucleotides that encode a portion of the Ral2 polypeptides. Ral2 polynucleotides may comprise a native sequence (for example, an endogenous sequence that encodes a Ral2 polypeptide or portion thereof) or may comprise a variant of such a sequence. Ral2 polynucleotide variants may contain one or more substitutions, additions, deletions, and / or insertions, wherein the biological activity of the encoded fusion polypeptide does not substantially diminish with respect to the fusion polypeptide comprising the native Ral2 polypeptide. Preferably, the variants have at least about 70µ identity, more preferably at least about 80µ identity, and most preferably at least about 90µ identity to a polynucleotide sequence that encodes a native Ral2 polypeptide or portion thereof.

According to another preferred embodiment, the immunological fusion partner is derived from protein I), a surface protein of Gram-negative Haemophilus influenza B (WO 91/18926). Preferably, the protein D derivative comprises approximately the first third of the protein (for example, the first N-terminal 100 to 110 amino acids) and the protein D derivative may be lipidated. According to certain preferred embodiments, the first 109 residues of the lipoprotein D fusion partner are incorporated at the N-terminus to provide polypeptides with additional exogenous T-cell epitopes and to increase expression levels in E. coli (thereby acting as an expression promoter). The lipid termination ensures optimal delivery of the antigen to the antigen-providing cells. Other fusion partners include the non-structural protein from influenza virus, NS1 (hemagglutinin). Generally, the N-terminal 81 amino acids are used, although different fragments may be used that include T-helper epitopes.

In another embodiment, the immunological fusion partner is a protein known as LYTA or a portion thereof (preferably a C-terminal protein). LYTA is derived from the microorganism Stroptococcus pneumoniae, which synthesizes N-acetyl-L-alaninamidase known as LYTA amidase (encoded by the LytA gene; Gene 43, 265-292, 1986). LYTA is autolysin. which specifically breaks down certain bonds in the peptidoglycan backbone. C-terminal domain of the LYTA protein is responsible for the affinity to the choline _r nebo.k some choline analogues such as DEAE for example. The property is used to develop E. coli C-LYTA expressing plasmids useful for expression of fusion proteins. Purification of the hybrid proteins containing the C-LYTA fragment at the amino terminus is described in the literature (Biotechnology 10, 795-798, 1992). In a preferred embodiment, the repeated portions of LYTA can be incorporated into the fusion protein. In the repeating region, starting from residue 178, the portion is incorporated by residues 188-305.

In the C-terminal portion, a repeat portion is particularly preferred

Another illustrative embodiment includes fusion polypeptides and polynucleotides that are. cloning, wherein the fusion partner comprises a target signal capable of directing the polypeptide to the endosomal / lysosomal compartment (U.S. Pat. No. 5,632,334). The immunogenic polypeptide of the invention, fused to this target signal, associates more effectively with MHC class II molecules and thereby provides enhanced in vivo stimulation of polypeptide-specific CD4 ⁺ T cells.

The polypeptides of the invention are recognized by any of a number of known methods and / or by recombinant methods, the recombinant methods being further described. Polypeptides, portions, and other variants generally less than about 150 amino acids can be generated by synthetic methods using well known methods in the art. In an illustrative example, such polypeptides are synthesized using any commercially available solid-phase technique, such as the Merrifield solid-phase synthesis method, wherein amino acids are sequentially added to a growing amino acid chain (Merrifield, J. Am. Chem. Soc. 85, p. 2149-2146 (1963). Equipment for automated polypeptide synthesis is commercially available (e.g., Perkin Elmer / Applied BioSystems Division, Foster City, CA) and can be used according to the manufacturer's instructions.

In general, the polypeptide compositions (including fusion polypeptides) of the invention are isolated. By "isolated polypeptide" is meant a polypeptide that is removed from its original environment. For example, a naturally occurring protein or polypeptide is isolated if separated from some or all of the coexisting material in the natural system. Preferably, such a polypeptide is also purified, for example, to at least about 90% purity, more preferably to at least about 95% purity, and most preferably to at least about 99% purity.

Polynucleotide compositions

The invention also relates to polynucleotide compositions. The terms "DNA and polynucleotide" are used interchangeably herein to refer to a DNA molecule that is isolated from all genomic DNA of particular species. By "isolated" it is meant herein that the polynucleotide is substantially free of other coding sequences and that the DNA molecule does not contain large portions of unrelated coding DNA, such as large chromosomal fragments or other functional genes or polypeptide coding regions. The term refers to a DNA molecule originally isolated and does not exclude genes or coding regions 53 later added to the segment synthetically.

Those of skill in the art will recognize that the polynucleotide compositions of the invention include genomic sequences, extragenoma and plasmid encoded sequences, and smaller engineered gene segments that express or may be adapted to express, for example, protein, polypeptides and peptides. Such segments may be naturally isolated or may be synthetically modified.

It is also known to those skilled in the art that the polynucleotides of the invention may be single stranded (coding or lacking Cantisnse3 information) or double stranded and may be DNA (genomic, cDNA or synthetic) or RNA molecules. RNA molecules may include HnRNA molecules that contain introns and correspond to a DNA molecule in a one-to-one method and RNA molecules that do not contain introns. Additional or non-coding sequences may or may not be included in the polynucleotide of the invention and the polynucleotide may or may not be bound to other molecules and / or carrier materials.

The polynucleotides may comprise a native sequence (i.e., an endogenous sequence that encodes a polypeptide / protein system of the invention or a portion thereof) or may comprise a sequence that encodes a variant or derivative, preferably an immunogenic variant or derivative of such a sequence.

The invention therefore also relates to polynucleotide compositions comprising some or all of the sequences listed in any one of SEQ ID NOs: 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722,

54,735, 737 to 739, 751, 753, 764, 765, 773 to 776, and 786 to 788, polynucleotide sequence complements from any of the following 2 sequences: SEQ ID NOs: 1 to 111, 115

to 171, 173 to 175, 177, 179 aš 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 a . 384 to 476, 524, 526, 530 531 533 535 536, 552, 569 a 572, 587, 591, 593 a 606,618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681 711 713 716 720 to 722, 735, 737 to 739, 751, 753, 764, 765 , 773 to 776 and 786 aš 788 and degenerate variants polynucleotide sequences from the group comprising SEQ ID NO: 1 to 111, 115 to 171 , 173 to 175, 177, 179 to 305, 307 to 315, 326 328 330, 332 to 335, 340 to 375, 381, 382 and 384 a 476, 524 526 530 531 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 606 626, 630, 631 634, 636, 639 to 655, 674, 680 681 711 713 716, 720 aš 722, 735, 737 to 739, 751, 753,764 , 765, 773 a 776 a 786 to 788. According to some

In preferred embodiments, the polynucleotide sequences described herein encode immunogenic polypeptides as described above.

In another embodiment, the invention relates to polynucleotide variants having substantially identity to sequences of the set

comprising SEQ ID NO: 1 to 111, 115 to 171, 173 to 173 175, 177, 179 to 305, 307 to 315, 326 328 330, 332 to 335, 340 to 340 375, 381, 382 and 384 to 476, 524 526 530 531 533 535 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680 681 711, 713, 716, 720 to 722,

735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, for example, with sequences having at least about 70%, sequence identity, preferably at least 75%, 80%, 85%, 90%, 95 %, 96%, 97%, 98%, or 99% or even greater identity compared to the polynucleotide sequence of the invention using the methods described herein (e.g., BLAST analysis using the parameters below). It will be appreciated by those skilled in the art that the values can be appropriately adjusted to determine the corresponding identity of the proteins encoded by the two nucleotide sequences, considering, for example, codon degeneration, amino acid similarity, reading frame position.

Generally, polynucleotide variants comprise one or more substitutions, additions, deletions, and / or insertions, preferably such that the immunogenicity of the encoded polypeptide by the polynucleotide variant is not substantially reduced with respect to the polypeptide encoded by the polynucleotide sequence specifically for the purposes of the invention. By variant is meant the inclusion of homologous genes of xenoge origin.

Additionally, the invention relates to polynucleotide fractions comprising different lengths of adjacent stretch sequences identical or complementary to one or more sequences of the invention. For example, polynucleotides of the invention comprise at least 10, 15, 20, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500, or 1000 contiguous nucleotides with one or more sequences included as well as all intermediate lengths between them. By the term "intermediate lengths" is meant any lengths between said values, such as 16, 17, 18, 19 and beyond; 21, 22, 23 and beyond; 30, 31, 32 and beyond; 50, 51, 52, 53 and beyond; 100, 101, 102, 103 and beyond; 150, 151, 152, 153 onwards; including all integers 200 to 500; 500 to 1000; etc.

In another embodiment, the invention relates to polynucleotide compositions that are capable of hybridizing under mild or high stringency conditions to a polynucleotide sequence or fragment thereof, or to a complementary sequence thereof. Hybrid techniques are well known in the art of molecular biology. For purposes of illustration, suitable moderately stringent conditions for testing hybridization of a polynucleotide of the invention with other polynucleotides include pre-washes in 5X SSC, 0.5% SDS, 1.0 m EDTA (pH 8.0); hybridization at 50-60 ° C, 5X SSC, overnight; followed by washing twice at 65 ° C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 56% SDS. Those skilled in the art will appreciate that the stringency of the hybridization can be easily manipulated, for example by varying the salt content of the hybridization solution and / or the temperature at which the hybridization is performed. For example, according to another embodiment, the high stringency hybridization conditions are the same as above, e

only raising the hybridization temperature to, for example, 60-65 ° C or 65-70 ° C. According to certain preferred embodiments, the polynucleotides described above, for example, polynucleotide variants, fragments, and hybridization sequences, encode polypeptides that are immunologically cross-reactive with the polypeptide sequence specifically described herein. In another preferred embodiment, such polynucleotides encode polypeptides having an immunogenic activity level of at least about 50%, preferably at least about 70%, and even more preferably at least about 90% with respect to the polypeptide sequence specifically described herein.

Polynucleotides of the invention, or fragments thereof, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, for example promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites or coding segments, so that their total length can vary considerably. Therefore, it is contemplated that a nucleic acid fragment of virtually any length with a total length, preferably limited in ease of preparation, and using a deliberately recombinant DNA protocol may be used. For example, elucidating polynucleotide segments with a total length of, for example, about 10,000, about 5,000, about 3,000, about 2000, about 1,000, about 500, about 200, about 100, about 50 base pairs (including all intermediate lengths) are considered useful in many embodiments of the invention. .

When comparing polynucleotide sequences, two sequences of 57 sequences are considered identical 'when the nucleotide sequence in the two sequences is the same in alignment to maximize correspondence, as will be explained. The comparison of the two sequences is generally performed by comparing the sequences through the comparison window to identify and compare local regions of sequence similarity. As used herein, a comparison window refers to a segment of at least about 20 adjacent positions, typically 30 to about 75, and preferably 40 to about 50, in which sequences can be compared to a reference sequence with the same number of adjacent positions after optimal alignment of the two sequences.

Optimal alignment. The sequences for comparison can be performed using the Megalign program in the Lasergene suite of bioinformatics software (DNASTAR Inc, Madison, WI) using default parameters. This program includes several sorting schemes they have described: Dayhoff M.O. (A Model of Evolutionary Change in Proteins - Matrices for Detecting Distant Re lations, in Dayhoff, .01.0. (Publisher) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC, Vol. 5 (3) p. 345-358 (1978); Hein J. (Unified Approach to Alignement and Phylogenes, pp. 626-645, Methods in Enzymology Vol 183, Academic Press, Inc. San Diego, CA, 1990); Higgins D.G. and Sharp P.M. CABIOS 5: 151-153 (1989); Myers E.W. and Muller W. (CABIOS 4: 11-17, 1988); Robinson E.D. (Corab. Theor. 11, 105 (1971)); Santou N., Nes M. (Mol. Biol. Ecol. 1987, 4, 406-425); Sneath P.H.A. and Sokal R. R. (Numeric Taxonomy-The Principles and Practice of Numerical Taxonomy, Freeman Press, San Francisco, CA, 1973): Wilbur W.J. and Lipman D.J. (Proc. Natl. Acad. Sci USA 80: 726-730, 1983).

Alternatively, optimal sequence alignment for comparison can be performed by a local identity algorithm (Smith and Waterman Add. APL. Math 2, p.482, 1981), by an ordered identity algorithm (Needleman and Wunch, J. Mod. Biol. 48, p. 443, 1970), fif58 suggestions for similarity patterns (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85, p. 2444, 1988), numerically supplementing these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group (GCG, Science Dr., Madison, HI) or Inspection,

One preferred example of algorithms suitable for determining percent sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms described by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1977) and Altschul et al. (J. Mol. Biol. 215: 403-410, 1990). Algorithms

BLAST and BLAST 2.0 can be used, for example, with the parameters described herein to determine the percent identity of the polynucleotide sequences of the invention. BLAST analysis software is a commercial product (National Center for Biotechnology Information). According to the illustrative example for nucleotide sequences, the cumulative early parameters M (rewarding early for a pair of measured residues; always greater than zero) and (penalty early for improperly joined residues; always less than zero) can be used. The spread of the word "hits" in each direction stops when: the early cumulative alignment falls off at X from the maximum value: the cumulative early approaching zero or below, due to the accumulation of one or more negative scoring residual alignments; or the end of a sequence is reached. The BLAST parameters T, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) using delay and wordlength (Wordlength "W") 11 and expectation (10) and the BL0SUM62 scoring matrix (Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89, 10915, 1989) alignment, (B) 50, expectation (E) 10, M = 5, N = -4 and comparison of the two chains.

Preferably, the percent sequence identity is determined by comparing two optimally aligned sequences in a comparison window of at least 20 positions, wherein the portion of the polynucleotide sequence in the 59 alignment windows may comprise an addition or deletion (i.e., a gap) of 20% or less, usually 5-15% or 10-10 12%, as compared to reference sequences (which do not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which the identical nucleic acid bases are in both sequences to achieve the number of positions of interest, dividing the number of positions of interest by the total number of positions in the reference sequence (i.e. window size) and multiplying the results by 100 to obtain the resulting percentage of sequence identity.

It is clear to those skilled in the art that, as a result of the degeneracy of the genetic code, there are numerous nucleotide sequences that encode the polypeptide described herein. Some of these polynucleotides have minimal homology to the nucleotide sequence of any native gene. However, polynucleotides that vary as a result of the codons used are of interest to the present invention. The present invention includes genes containing the polynucleotide sequences described herein. Alleles are endogenous genes that vary as a result of one or more mutations, such as deletions, additions and / or nucleotide substitutions. The resulting mRNA and protein may, but need not, have altered structure or function. Alleles can be identified by methods known per se (such as hybridization, amplification and / or comparison of database sequences).

Thus, the invention also relates to the use of mutagenesis, such as site-specific mutagenesis, for the preparation of immunogenic variants and / or derivatives of the polypeptides described herein. In this way, specific modifications can be made to the polypeptide sequences by mutagenesis of the polynucleotides encoding them. These methods are an advanced approach for preparing test sequence variants, for example by incorporating one or more considerations, by introducing one or more nucleotide sequence sequences into the polynucleotide.

- 60 i ',!)'>!>! 1.

u, i »1 i! ’·>

- ', (>>,.; i i »;»' - i: '>

'1' ’)> - ·. > · »->

Site-specific Butagenesis allows the production of mutants using specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of contiguous nucleotides to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction. The mutations can be used for selected polynucleotide sequences to improve, exchange, break down, modify or otherwise alter the properties of the polynucleotide itself and / or to alter the properties, activity, composition, stability or primary sequence of the coded polypeptide.

According to certain embodiments of the invention, the phlatogenesis of the polynucleotide sequences of the invention is contemplated to alter one or more properties of an encoded polypeptide, such as immunogenicity of a polypeptide into a vaccine. Techniques for site-specific matagenesis are well known in the art and widely used to generate variants of both polypeptides and polynucleotides. For example, site-specific mutagenesis is often used to alter a specific portion of a DNA molecule. According to such an embodiment, a primer comprising generally about 14 to about 25 nucleotides in length with about 5 to about 10 altered residues on both sides of the sequence junction is used.

It will be appreciated by those skilled in the art that site-specific mutagenesis often utilizes a phage vector that is both single-stranded and double-stranded. Typical vectors useful in site-directed mutagenesis include vectors such as M13 phage. These phages are readily available commercially and are well known to those skilled in the art. Double stranded plasmids are also routinely used for site-directed phiutagenesis, which eliminates the degree of gene transfer from plasmid to phage.

The site-directed mutagenesis of the invention is performed first to obtain a single-stranded vector or to melt two strands from a double-stranded vector that includes in its sequence a DNA sequence that encodes the desired peptide. The oligonucleotide primer carrying the desired mutated sequence is prepared generally synthetically. This primer is then conjugated to a single chain vector and subjected to DNA polymerizing enzymes, such as the E. coli polymerase I Klenow fragment, to terminate synthesis of the mutation-bearing chain. This creates a heteroduplex, with one strand encoding the original unmutated sequence and the other strand carrying the desired mutation. The heteroduplex vector is then used to transform suitable cells, for example E. coli cells, and cinemas are selected that include recombinant vectors carrying the mutated sequence alignment.

Preparation of sequence variants of selected peptide-encoding DNA segments using site-directed mutagenesis control is a means for producing potentially useful species and is not intended to be limiting, since there are other ways by which sequence variants of the peptides and DNA sequences encoding them can be obtained. For example, recombinant vectors encoding the desired peptide sequence can be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants. Specific details of such methods and protocols are described by Maloy et al. (1994), Segal (1974), Prokop and Bajpai (1991); Cuba (1994); and Maniatis et al. (1982).

By "oligonucleotide-directed mutagenesis" is meant herein a matrix-dependent process and vector-mediated propagation that results in an increase in the concentration of a specific nucleic acid molecule with respect to its initial concentration or an increase in the detectable signal concentration, such as amplification. The term "oligonucleotide-directed mutagenesis" refers to a method that includes a matrix-dependent extension of the primer molecule. By "matrix-dependent" is meant the synthesis of a nucleic acid of an RNA or a DNA molecule, wherein the sequence ^1! -, 03 -;

the rim of the newly synthesized nucleic acid strand is governed by well known complementary base pairing rules (e.g., Hatson, 1987). Typically, the vector-mediated methodology involves incorporating a nucleic acid fragment into a DNA or RNA vector, cloning the vector, and obtaining an insane nucleic acid fragment. Examples of such methods are described in particular in U.S. Pat. No. 4,237,224.

Another approach to producing polypeptide variants of the invention is recursive sequence recombination described in US 5837458. In this method, recurrent recombination and screening or selection cycles are performed to elicit individual polynucleotide variants of the invention having, for example, enhanced immunogenic activity.

According to another embodiment, the polynucleotide sequences described herein can advantageously be used as probes or primers for nucleic acid hybridization. Nucleic acid segments that contain a sequence region of at least about 15 contiguous nucleotides having the same sequence as the 15 nucleotide long contiguous sequences of the invention or a complementary sequence to the 15 nucleotide long contiguous sequences are considered to be of particular utility. Longer adjacent identical or complementary sequences, for example, sequences having approximately 20, 30, 40, 50, 100, 200, 500, 1000 (including all intermediate lengths) and even full sequence length, are also used in certain embodiments.

The ability of such nucleic acid probes to specifically hybridize to a particular sequence allows its use in detecting the presence of complementary sequences in a given sample. However, other uses are also contemplated, for example, as an information sequence for the preparation of mutant species of primers or primers for use in the preparation of other genetic conjugates. »(> I>>

(i))))))) in brief.

Polynucleotide molecules having sequence regions consisting of adjacent elongated nucleotides having, for example, 10 to 14, 15 to 20, 30, 50 or even 100 to 200 nucleotides (including intermediate lengths), identical or complementary to the polynucleotide sequence of the invention are of particular importance as hybridization probes for use in, for example, the Southern and Northern blotting methods. This allows analysis of the gene product or fragment thereof in different cell types as well as in different bacterial cells. The overall size of the fragment, as well as the size of the complementary stretch, depends upon the intended use or the use of a particular nucleic acid segment. Smaller fragments have generally been used in hybridization embodiments, wherein the length of the contiguous complementary region can vary, for example from about 15 to about 100 nucleotides, but greater contiguous complementarity of extension can be used according to the length of the complementary sequences to be determined.

The use of a hybridization probe of approximately 15 to 25 nucleotides in length makes it possible to create a duplex molecule that is both stable and selective. Molecules having flanking complementary sequences in lengths greater than 15 bases in length are generally preferred to increase stability and selectivity of the hybrid and thereby improve the quality and degree of specificity of the hybrid molecule. Generally, it is preferred to construct nucleic acid molecules having a gene complementary extension of 15 to 25 contiguous nucleotides or even longer.

Hybridization probes can be selected from any portion of any of the sequences of the invention. All of this is desirable for reviewing the sequences of the invention or for any continuous portion of sequences from about 15 to 25 nucleotides in length up to and including the full length of the sequence, if it is> -> 6 · ^ - '->>> » »>>>

>! (>.)) ') 1 * *)))>) 1) »>>>

1) interest ο used as a probe or primer. The choice of probe and primer sequences may be governed by various factors, for example, it may be desirable to use primers from the current end of the overall sequence.

Small polynucleotide segments or fragments can be readily prepared, for example, by direct synthesis of the fragment by chemical methods, as is commonly done using an automated oligonucleotide synthesizer. Also, fragments can be obtained using nucleic acid reproduction technology, such as PCR ™ technology according to U.S. Patent No. 4,683,202, by introducing selected sequences into recombinant vectors for recombinant production and other DNA recombinant methods generally known to those skilled in the art of molecular biology.

The nucleotide sequences of the invention can be used according to their ability to more selectively generate duplex molecules with complementary extension of the entire gene or fragment of the gene in question. Depending on the intended use, it is generally desirable to use different hybridization conditions to achieve different degrees of probe selectivity with respect to the target sequence. For applications requiring high selectivity, it is generally desirable to use relatively stringent conditions to form hybrids, for example, a relatively low amount of salt and / or a high temperature is chosen to achieve a salt concentration of about

0.02 M to about 0.15 M at a temperature of about 50 ° C to about 70 ° C. Such selective conditions do little, if any, tolerate the improper connection between the probe and the matrix or target chain and would be particularly suitable for isolating related sequences.

For some uses, for example, when it is desired to prepare mutants using a mutant primer chain hybridized to a backing matrix, less stringent (decreased) stringency hybridization conditions are generally needed to allow heteroduplex formation. In such a case, it may be desirable to use salts of, for example, about 0.15 M to about 0.9 M at a temperature of about 20 ° C to about 55 ° C. Cross-hybrid species may thus be more easily identified as positive hybridization signals with respect to control hybridization. . In many cases, it is generally appreciated that conditions may be much stricter by the addition of increasing amounts of formamide that serve to destabilize the hybrid duplex in the same manner as elevated temperature. Thus, the hybridization conditions can be readily manipulated, and generally the method can be selected according to the desired results.

In another embodiment, the invention relates to polynucleotide compositions comprising non-information-containing oligonucleotides (antisense). The non-informational igonucleotides are potent and target inhibitors of protein synthesis and thus represent a therapeutic approach in which a disease can be treated by inhibiting the synthesis of proteins that promote disease. The efficacy of non-information-containing oligonucleotides to inhibit protein synthesis is well established. For example, the synthesis of polygalacturonase and type 2 acetylcholine receptor muscarin is mediated by non-informational oligonucleotides directed to their corresponding mRNA sequences (U.S. Patent Nos. 5,739,119 and 5,757,829). Examples of non-information inhibition have been elucidated with the cyclin nuclear protein, the drug resistant gene (MDG1), ICAM-1, E-selectin, STK-1, the striatal GABAa receptor and human J2GF (Jaskulski et al., Science 240 (4858) pp. 1544-1546, July 10, 1988, Vasanthakumar and Ahmed, Cancer Commun.1 (4) pp. 225-232, 1989; Peris et al., Brain Res Mol Brain Res 57 (2), pp. 310-42 320,

July 15, 1998; U.S. Patent No. 5,801,154; 5,795,973; 5,718,709 and 5,610,288). Non-information constructs according to the publications inhibit and can be used to treat a plurality of abnormal cell proliferations, for example cancer, (U.S. Patent No. 5,747,470; U.S. Pat. No. 5,591,117; and U.S. Pat. No. 5,778,383).

Accordingly, in certain embodiments, the invention relates to oligonucleotide sequences that contain all or a portion of each sequence that is capable of specifically complementing or complementing the polynucleotide sequence described herein. In one embodiment, the non-information-containing oligonucleotides comprise DNA or derivatives thereof. In another embodiment, the oligonucleotides comprise RNA or derivatives thereof. According to a third embodiment, the oligonucleotides are modified DNAs containing a phosphorhiomodified backbone. According to a fourth embodiment, the oligonucleotide sequences comprise peptide nucleic acids or derivatives thereof. In any case, the preferred compositions comprise a sequence region that is complementary and more preferably substantially complementary and even more preferably perfectly complementary to one or more portions of the polynucleotides of the invention. Selection of a composition without information specific for a given sequence is based on the analysis of the selected target sequence and on the determination of secondary structure, T m, binding energy and relative stability. Non-information-containing compositions may be selected based on their relative inability to form dimers, hairpins, or other secondary structures that would reduce or prevent specific binding to the target mRNA in the host cell. Highly preferred mRNA target regions are regions on or near the AUG translation initiation codon and sequences that are substantially complementary to the 5 'mRNA regions. Secondary structural analyzes and target site selection can be performed using, for example, v.4 OLIGO primer analysis software and / or BLASTN 2.0.5 mandrel software algorithms (Altschul et al., Nucleic Acids Res. 25 (17), pp. 3389-3402). , September 1, 1997).

Using a non-informational release method using a MPG-terminated short peptide vector (27 residues)

I (>

m “ ¹ ' _t ¹ *> II i ->>> i) 1, t ·''*,,;; Is also contemplated. The MPG peptide comprises a hydrophobic domain derived from the HIV gp41 fusion sequence and a hydrophilic domain from the SV40 T-antigen nuclear localization sequence (Morris et al., Nucleic Acid Res., 25 (14), pp. 2730-2736, July 15, 1997). It has been demonstrated that some MPG peptide molecules coat an oligonucleotide without information content and can be released into mammalian cell culture media in less than one hour with relatively high efficiency (90%). Interaction with MPG strongly increases both the stability of the oligonucleotide to the nuclease and the ability to penetrate the plasma membrane.

According to another embodiment of the invention, the polynucleotide composition of the invention is used in the construction and preparation of ribozyme molecules for inhibiting the expression of the tumor polypeptides and proteins of the invention in tumor cells. Ribozymes are RNA protein complexes that cleave nucleic acids in a site-specific manner. Ribozymes have specific catalytic domains having endonuclease activity (Kim and Cech, Proc. Natl. Acad. Sci. USA 84 (24), 8788-8792, December 1987; Forster and Symons, Cell. 49 (2), p. 211-220, April 24, 1987). For example, a large number of ribozymes accelerate phosphorus transfer reactions with a high degree of specificity often by cleaving only one of a plurality of phosphoesters to a voligonucleotide substrate (Cech et al., Cell 27 (E Pt 2), pp. 487-496, December 1981; J. Mol Biol 216 (3), 585-610, December 1990, Reinhold-Hurek and Shub, Nature 257 (6374), pp. 173-176, May 14, 1992). This specificity is attributed to the requirement that the substrate bind through specific base-pairing interactions to the internal leader sequence (IGS) of the ribozymes prior to the chemical reaction.

Six basic varieties of naturally occurring enzymatic RNAs are currently known. Each can catalyze the hydrolysis of both RNA phosphodiester and trans bonds (and thus can cleave other RNA molecules) under physiological conditions. General ·>

-> 68, - (i) .-. >> I>

The enzymatic nucleic acids act by first binding to the target RNA. Dad binding occurs through a target binding portion of an enzymatic nucleic acid that is held in close proximity to the enzymatic portion of a molecule that acts to cleave the target RNA. Therefore, the enzymatic nucleic acid first recognizes and then binds the target RNA through complementary base pairing, and once bound at the correct site, acts enzymatically to cut off the target RNA. Strategic cleavage of such RNA disrupts its ability to directly synthesize the encoded protein. After the enzymatic nucleic acid binds and cleaves the RNA target, it releases from the RNA to look for another target and can repeatedly bind and cleave new targets.

The enzymatic nature of the ribozyme is preferable to many technologies such as non-information content technology (where the nucleic acid molecule simply binds to a nucleic acid target to block translation) since the ribozyme concentration required for therapeutic treatment is lower than the non-information content oligonucleotide. This ability is manifested by the ability of the ribozyme to enzymatically act. Therefore, a single ribozyme molecule is capable of cleaving multiple target RNA molecules. In addition, the ryozyme is a highly specific inhibitor with specificity of inhibition depending not only on the base spring mechanism of binding to the target RNA, but also on the mechanism of cleavage of the target RNA. A single improper linkage or base substitution near the cleavage site can perfectly eliminate the catalytic activity of the ribozyme. Such improper association in non-information molecules does not prevent their action (Woolf et al., Proc. Natl. Acad. Sci USA 89 (16), pp. 7305-7309, August 1992). Therefore, the specificity of ribozyme action is greater than that of an oligonucleotide with no information content binding the same RNA site.

The enzymatic nucleic acid molecule can be constructed as a hammer head, such as a hairpin, hepatitis virus, group 1 intron or RNaseP RNA (along with an RNA leader sequence) or as a Neurospora VS RNA motif. An example of a hammer head motif is described by Rossi et al. (Nucleic Acids Res. 20 (17), pp. 4559-4565, September 11, 1992). An example of hairpin motifs is described by Hampel et al. (European Published Application EP 0360257), Hampel and Tritz (Biochemistry 28 (12), pp. 4929-4933, June 13, 1989), Hampel et al. (Nucleic Acid REs. 18 (2), pp. 299-304, Jan. 25, 1990) and is also described in U.S. Patent No. 5,631,359. An example of the hepatitis S motif is described by Perrotta and Been (Biochemistry 31 (47), 11843-11852, December 1, 1992). An example of the RNaseP motif is described by Guerrier-Takada et al. (Cell 35 (3 Pt 2), pp. 849-857, December 1983). The Neurospora VS RNA ribozyme motif is described by Collins (Saville and Collins, Cell 61 (4), pp. 685-696, May 18, 1990; Saville and Collins, Proc. Natl. Acad. Sci USA 88 (19), pp. 8826-69). 8830, Oct. 1, 1999): Collins and Oliva, Biochemistry 32 (11), pp. 2795-2799, March 23, 1993) and an example of a Group I intron is described in U.S. Patent No. 4,970,771). According to the invention, it is important that the enzymatic nucleic acid molecule have a specific substrate binding site that is complementary to one or more target gene RNA regions and that they have nucleotide sequences within or surrounding the substrate binding site that /

it delivers the cleavage activity of the RNA molecule. Therefore, ribozyme constructs are not limited to specific motifs mentioned herein.

Ribozymes can be labeled according to the methods described in WO 93/23569 and WO 94/02595 and can be synthesized for in vitro and in vivo testing as described. Such ribozymes can also be optimized for release. Although specific examples exist, it is known that RNA target equivalents in other species may optionally be used.

Ribozyme activity can be optimized by varying the length of the% -, £ f WW - »4 WW fa f - * -, r, v - ti,.. S-N-R-ribozyme binding scaffold or by chemical synthesis of ribozymes with modifications that prevent their degradation by serum ribonucleases (for example, World Publication Nos. WO 92/07065; WO 93); European Patent Application Publication No. EP 92110298.4, US Patent No. 5,347,111 and World Published Application Publication No. WO 94/13688, which disclose various chemical modifications that may be made to the sugar moiety of enzymes. ^J RNA molecules), by modifications that promote their efficacy in cells and by removing stem II bases to shorten RNA synthesis time and reduce chemical requirements. ^x

Sul li van et al. (WO 94/02595) describes general methods for delivering enzymatic RNA molecules. Ribozymes can be administered to cells in a variety of ways known to those skilled in the art, including, but not limited to, encapsulation, iontophoresis, or incorporation into another carrier such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive crocodiles. For some cases, ribozymes can be directly delivered ex vivo to cells or tissues with or without the above carriers. Alternatively, the RNA / carrier combination can be delivered locally by direct inhalation, direct injection, or using a cathether, infusion pump or stent. Other routes of delivery include, but are not limited to, intravascular, intraauscular, subcutaneous or articular injection, aerosol inhalation, oral (tablet or pill), topical, systemic, ocular, intraperitoneal, and / or intrathecal. A more detailed description of ribozyme delivery and administration is in WO 92/23565.

Another way of accumulating high concentrations of ribozyme or ribozymes in cells is by incorporating ribozyme coding sequences into the DNA expression vector. The transcription of ribozyme sequences starts from the promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II) or RNA polymgrase III (pol III). Transcripts from pol II or pol III promoters are expressed to a high extent in all cells; The amount in the pol II promoter is determined by the cell type and depends on the nature of the gene regulatory sequences (e.g. enhancers, silencers) closely contained. Prokaryotic RNA polymerase promoters can also be used when the prokaryotic RNA polymerase enzyme is expressed in suitable ribozyme-expressing cells expressed from such promoters operating in mammalian cells. Such transcriptional units can be incorporated into a variety of vectors for introduction into mammalian cells, including, but not limited to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated vectors), or viral RNA vectors (such as retroviral vectors, Suede virus) forest and sidbis virus vector).

The invention also relates to peptide nucleic acid (PNA) compositions. PNA is DNA mimicking, with nucleobases bound to a pseudopeptide backbone (Good and Nielsen, Antisense Nucleic Acid Drug Dev. 7 (4), pp. 431-437, 1997). PNA can be used in a variety of methods that traditionally utilize RNA or DNA. Often, PNA sequences perform better in techniques than the corresponding RNA and DNA and have usefulness that do not have RNA and DNA. A review of PNAs and methods for their preparation, characteristics and uses has been described by Corey (Tends Biotechnol. 15, pp. 224-229, June 1997). According to certain embodiments, the PNA sequences may be prepared to be complementary to one or more portions of the ACE mRNA sequence, and the PNA means may be used to regulate, alter, break down or reduce the translation of ACE-specific mRNA and thereby alter the rate of ACE activity. in a host cell to which such PNA compositions are administered.

PNAs have 2-aminoethylglycine bonds replacing normal »7o3» ►> ·>

>)> y t>>)) Ί 1

1)

7>

) I i

-i y? t>

DNA phosphodiester backbone (Nielsen et al., Science 254 (5037), pp. 1497 to 1500, December 6, 1991; Hanvey et al., Science 258 (5087), pp. 1481 to 1485, November 27, 1992; Hyrup and Nielsen, Bioorg. Med. Chem. 4 (1), pp. 5-23, January 1994). This chemistry has three consequences: first, unlike NDA or phosphorothiooligonicleotides, PNAs are neutral molecules; secondly, PNAs are achiral, thereby avoiding stereoselective syntheses; third, PNA synthesis utilizes standard Boc and Fmoc protocols for solid phase peptide synthesis by any other means, including a modified Merrifield method, may be used.

PNA monomers or easy to prepare oligomers are commercially available (PerSeptive Biosystems, Framingham, MA). PNA syntheses according to either Boc or Fmoc protocols are simple using manual or automated protocols (Norton et al., Bioorg. Med. Chem. 3 (4), pp. 437-455, April 1995) Manual protocols themselves help produce chemically modified PNAs or the synthesis of a family of closely related PNAs.

As in the case of peptide synthesis, the success of the synthesis of a particular PNA depends on the properties of the selected sequence. For example, while in theory PNA may incorporate a combination of nucleotide bases, the presence of adjacent purines may result in the deletion of one or more residues from the product. Since this difficulty is contemplated, it is recommended to repeat the coupling of residues that have been added inefficiently for PNA production with adjacent purines. This is possible by purifying PNA by reverse phase high performance liquid chromatography to provide yields and product purity similar to that found in peptide synthesis.

Modification of the PNA for a given use can be accomplished by coupling amino acids during solid phase synthesis or by binding compounds that contain a carboxylic acid group to the exposed N-terminal amine. Or, PNAs can be modified after nucleic acid purification, isolation of transcriptionally active genes, blocking of transcription factor binding, genome digestion, biosensors, and in situ hybridization.

Identification of polynucleotides, characterization and expression

The polynucleotide compositions of the invention may be identified, prepared and / or handled by a variety of well established methods (generally Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Co. Spring Harbor, NY, 1989 and the like) publications). For example, a polynucleotide may be identified, as described in more detail below, by screening the microadd of cDNA for tumor-related expression (i.e., expression that is at least twice as high in the tumor as in normal tissue according to the representative assay described herein). Such screening can be carried out, for example, by the Affymetrix Micro Inc. (Santa Clara, CA) according to the manufacturer's instructions (essentially as described by Schen et al., Proc. Natl. Acad. Sci. USA 93: 10614-10619; 1996; and Heller et al., Proc. Natl. Acad. Sci USA

94, pp. 2150-2155 (1997). Alternatively, polynucleotides may be amplified from cDNAs prepared from cells expressing the proteins described herein, such as tumor cells.

There are numerous matrix-dependent methods to amplify target sequences of interest contained in a sample. One of the most well known methods of cross-linking is the polymerase chain reaction (PCR ™), which is described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159. Essentially, two primer sequences complementary to PCR are prepared in PCR ™. regions on opposite complementary strands of the target sequence. Excess deoxynucleotide triphosphates are added to the reaction mixture along with DNA polymerase (so-called Taq polymerase). If it is. the target sequence is included in the sample, the primers bind to the target, and the polymerase causes the polymerase to cause the target to bind to the target.

7.5 primers decompose along the target sequence by addition to nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primers dissociate from the target to form the reaction products, the excess primers bind to the target and the reaction product, and the process is repeated. Preferably, reverse transcription and PCR ™ amplification procedure can be performed to quantify the amount of amplified mRNA. Polymerase chain reaction methods are well known in the art.

Each of a number of other matrix-dependent methods, many of which are a variation of the PCR ™ amplification method, are already known and used in the art. By way of illustration, methods include a ligase chain reaction (called LCR) (e.g., European Published Application 320308 and US Patent 4,883,750); Qbeta replication (International PCT Publication No. PCT / US87 / 00880); enhancement of Strand Displacement Amplificati on (SDA); and Repair Chain Reacti on (RCR). Yet other enhancement methods are described in GB-A-2,202,328 and PCT / US89 / 01025. Other methods of enhancing nucleic acids include transcription-based enhancement systems (TAS) (International PCT Publication No. WO 88/10315), including nucleic acid sequence-based enhancement (NASBA) and 3SR. European Published Application EP 329 822 discloses a method of enhancing nucleic acid comprising cyclic synthesis of single stranded RNA (ssRNA), ssDNA, and double stranded DNA (dsDNA). International PCT Publication No. WO 89/06700 discloses a scheme for amplifying a nucleic acid sequence based on hybridization of a promoter / primer sequence to a target single-stranded DNA (ssDNA) followed by transcription of many RNA copies of the sequence. Other amplification methods, such as RACE (Frohman, 1990) and one-sided PCR (Ohara, 1989), are known to those skilled in the art.

_The amplified portions of the polynucleotide of the invention can be used to isolate the full length gene from a suitable library (e.g., a tumor cDNA library) using well known methods. In one such method, a library (cDNA or genomic) is screened using one or more polynucleotide probes or primers suitable for amplification. Preferably, the library is selected by size to include larger molecules. Randomly selected (primed) libraries may also be preferred to identify 5 genes of upstream regions of genes. Genome libraries are preferred to obtain introns and expand 5 sequences.

For hybridization methods, the partial sequence may be labeled (e.g., by translation of breaks or ³² P terminal tagging) in a known manner. The bacterial or bacteriophage library is then generally screened by hybridizing filters containing denatured bacteria colonies (or lawns containing phage plates) with a labeled probe (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, 1989). . Hybridization colonies or platelets are selected and expanded and the DNA isolated for further analysis. The cDNA clones can be analyzed to determine the amount of additional sequence, for example by PCR using a primer from a partial sequence and a primer from a vector. Restriction maps and partial sequences can be generated to identify one or more overlapping clones. The complete sequence can then be determined using methods known in the art, which may include generating a series of deletion clones. The resulting overlapping sequences may be grouped into a single contiguous sequence. A full-length cDNA molecule can be generated by ligating suitable fragments using known methods.

Alternatively, the above-described enhancement methods may be useful to obtain a full-length coding sequence from a partial cDNA sequence. One such amplification method is inverse

^7.7 PCR (Triglia et al., Nucl. Acids Res. 16, 8186, 1988), which uses restriction enzymes to generate a fragment in a known region of the gene. The fragment is circularized by intramolecular ligation and used as a template for PCR with divergent primers derived from a known region. According to an alternative embodiment, sequences adjacent to the partial sequence may be corrected by amplification with a primer to a linker sequence and a primer specific to a known region. The amplified sequences are generally subjected to a second round of amplification with the same linker primer and a second primer specific for the known region. A variant of this method that uses two primers that initiate elongation in opposite directions from the known sequence is described in WO 96/38591. Another such method is known as rapid amplification of cDNA ends (or RACE). The method comprises using an internal primer and an external primer that hybridizes to the A region poles or in a vector sequence to identify sequences that are 5 and 3 known sequences. Other methods include capture PCR (Lagerstrom et al., PCR Methods Applic. 1: 111-119, 1991) and valking PCR (Parker et al., Nucl. Acids. Res. 19, 3055-3060 (1991). Other methods using amplification can also be used to obtain a full-length cDNA sequence.

In some cases, full-length cDNA sequences can be obtained by analyzing the sequences in the expressed sequence tag (EST) database available at the gene bank. The search for overlapping ESTs can generally be performed using well known programs (for example, NCBI Blast searches), and such ESTs can be used to generate an adjacent full-length sequence. Full length DNA sequences can also be obtained by analysis of genomic fragments.

In another embodiment, the polynucleotide sequences or fragments thereof that encode the polypeptides of the invention or fusion proteins or functional equivalents thereof in recombinant DNA molecules can be used to directly express the polypeptide in the respective host cells. Due to the inherent degeneracy of the genetic code, it is possible to produce other DNA sequences that encode substantially the same or functionally equivalent amino acid sequence, and these sequences can be used to clone and express a given polypeptide.

As is known to those skilled in the art, it may be advantageous in certain circumstances to produce nucleotide sequences encoding a polypeptide having codons that do not occur naturally. For example, codons preferred by a particular prokaryotic or eukaryotic host may be selected to increase the level of protein expression or produce a recombinant DNA transcript having advantageous properties, such as a half-life that is longer than the half-life of the transcript generated by the naturally occurring sequence.

The polynucleotide sequences of the invention can be constructed using methods known in the art to alter polypeptide coding sequences for a variety of reasons including, but not limited to, changes that modify the cloning, processing, and / or expression of a gene product. For example, shuffling DNA by random fragmentation and PCR rearrangement of gene fragments and synthetic oligonucleotides can be used to construct a nucleotide sequence. In addition, site-directed mutagenesis can be used, for example, to incorporate new restriction sites, to alter glycosylation patterns, to change codon preference, to produce a cleavage variant, or to introduce a mutation.

According to another embodiment of the invention, the natural, modified or recombinant nucleic acid sequences may be linked

79 to heterologous sequences to encode a fusion protein. For example, in screening peptide libraries for inhibitors of polypeptide activity, it may be useful to encode a chimeric protein that can be identified by a commercially available antibody. The fusion protein may also be designed to contain a cleavage site located adjacent to the polypeptide coding sequence and heterologous protein sequences such that the polypeptide can be cleaved and purified remotely from the heterologous moiety.

The sequence encoding the polypeptide of interest may be synthesized in whole or in part using chemistry well known in the art (Caruthers MH et al., Nucl. Acids Res. Symp. Ser. 1980 pp. 215-223; Horn T. et al.). et al., Nucl. Acids Res. Symp. Ser., pp. 225-232, 1980). Alternatively, the protein may itself be produced by chemical methods to synthesize the amino acid sequence of a polypeptide or portion thereof. For example, peptide synthesis may be performed using solid phase methods (Roberge JY et al., Science 269, 202-204, 1995) and automated synthesis may be achieved, for example, using the ABI 431A Peptide Synthertiser (Perkin Elmer, Palo Alto, CA).

The recently synthesized peptide can be purified by preparative high performance liquid chromatography (e.g., Creighton T., Proteins, Structures and Molecular Principles, WH Freeman and CO., New York, N.Y.) or by comparable methods known in the art. The composition of the synthetic peptides can be confirmed by amino acid analysis or sequencing (e.g., by degradation of the Edman degradation procedure). In addition, the amino acid sequence of a polypeptide, or portion thereof, may be altered during direct synthesis and / or combined by chemical means with sequences of other proteins, or portions thereof, to form a variant polypeptide.

To express the desired polypeptide, the nectleotide sequences encoding the polypeptide or functional equivalents may be incorporated into a suitable expression vector, that is, a vector that contains the necessary elements for transcription and translation of the incorporated coding sequence. Methods well known to those skilled in the art can be used to construct expression vectors containing sequences encoding the polypeptide of interest and appropriate transcriptional and translational control elements. Such methods include recombinant DNA methods, synthetic methods, and genetic recombination in vivo. Such methods are described in the literature (e.g., Sambrook J. et al. Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press 1989, Plainview, NY: and Ausubel FM et al., Current Protocols in Molecular Biology, John Wiley & Sons, New. York, NY).

A variety of vector / host ite1 expression systems can be used to provide for the content and expression of polynucleotide sequences. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors, yeast transformed with yeast expression vector, cell insect systems infected with virus expressing vectors (e.g., baculovirus), plant cells transformed with virus expressing vectors (for example, cauliflower mosaic virus CaMV, tobacco mosaic virus, TMV) or bacterial expression vectors (e.g., T1 or pBR322 plasmids) or animal cell systems.

By "controls" or "regulatory sequences" contained in an expression vector is meant untranslated regions of vector enhancers, promoters, untranslated regions 5 and 3 that interact with host cell proteins to perform transcription and translation. The strength and specificity of these elements may vary. Depending on the vector and host system used, any number of suitable transcriptional and translational elements may be used, including constitutive and α84 leader promoters. For example, when bacterial systems are cloned, insertable promoters such as the BLZESCRIPT phagemid lacZ promoter (Stratagene, La Jolla, CA) or the PSP0RT1 plasmid (Gibco BRL, Gaithersburg, MD) can be used. In mammalian cell systems, promoters from mammalian genes or mammalian viruses are generally preferred. If it is desired to generate a cell line that contains multiple copies of a polypeptide coding sequence, SV40 or EBV based vectors with a suitable selectable marker may be advantageously used.

In bacterial systems, any of the expression vectors may be selected depending on the intended use for the expressed polypeptide. For example, if large amounts are needed, for example, to induce antibodies, vectors that direct the expression of a large number of fusion proteins that are being purified can be used. Such vectors include, but are not limited to, multifunctional E.coli cloning vectors and expression vectors such as BLUESCRIPT (Stratagene), in which a sequence encoding a polypeptide of interest can be linked to a vector in frame with amino-terminal Met sequences and subsequent seven β-galactosidase residues to form a hybrid protein; pIN vectors (Van Heeke, G. and Schuster, S. M., J. Biol. Chem. 264: 5503-5509, 1989). PGEX vectors (Promega, Madison, Wis.) Can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). Typically, such fusion proteins are soluble and are readily purified from lysed cells by adsorption on glutathione-agar beads followed by elution in the presence of glutathione. Proteins prepared in such systems can be engineered to contain heparin, thrombin, or XA protease cleavage site factors, such that the desired polypeptide can be released from the GST moiety at will.

In yeast, Saccharomyces cerevisiae, a variety of vectors can be used containing constitutive or introducing promoters such as or-factor, alcohol oxidase and PGH. An overview is given in the above literature (Ausubel et al. And Grant et al. Methods Enzymol. 153: 516-544 (1987)).

In cases where a plant expression vector is used, expression of the coding polypeptide sequences can be driven by any known promoter. For example, the CaMV 35S and 19S viral promoters can be used alone or in combination with the omega leader sequence from TMV (Takamatsu N., EMBO J. 6: 307-311, 1987). Alternatively, plant promoters such as the small RUBISCO subunit or heat shock promoters may be used (Coruzzi G. et al., EMBO J. 3, 1671-1680, 1984; Broglie R et al., Science 224, 838-8). And Winter J. et al., Results Probl. Cell Diff., 17, 85-105 (1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogens mediated by transfection. Such methods are described in generally available literature (for example, Hobbs S. or Murry L.E., McGraw Hill Yearbook of Science and Technology, McGraw Hill, New York, N.Y. 1992, pp. 191-196).

An insect system can also be used to express the desired polypeptides. For example, in one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector for expression of foreign genes in Spodoptera frugiperda cells or in Tri chopisus a cells. The polypeptide coding sequences may be cloned into a nonessential region of the virus, such as is a polyhedrin gene and placed under the control of the polyhedrin promoter. Successful insertion of the polypeptide coding sequence deprives the polyhedrin gene of activity and produces a recombinant virus lacking the envelope protein. Recombinant viruses can then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which the desired polypeptide can be expressed (Engelhard E.K. et al., Proc. Natl. Acad. Sci. 91: 3224-32).

83 3227, 1994).

Generally, a variety of viral-based expression systems are available in mammalian host cells. For example, in cases where an adenovirus expression vector is used, the sequences encoding the polypeptide of interest may be linked to an adenoviral transcription-translation complex consisting of a late promoter and a tripartite leader sequence. Incorporation of an insignificant E1 or E3 region of the viral genome can be used to obtain a live virus that is capable of expressing the polypeptide in infectious host cells (Logan J. and Shenk T., Proc. Natl. Acad. Sci. 81, pp. 3655-3659). 1984). In addition, transcriptional enhancers such as Rous sarcoma virus (RSV), an enhancer, can be used to enhance expression in mammalian host cells.

Specific initiation signals may also be used to achieve more efficient translation of sequences encoding the polypeptide of interest. Such signals include, for example, the ATG initiation codon and related sequences. In cases where the polypeptide coding sequences, their initiation codon, and the antisense sequences are incorporated into an appropriate expression vector, transcriptional and translational signals may be necessary. However, in cases where only the coding sequence or portion thereof is included, exogenous translational control signals, including the ATG initiation codon, should be provided. In addition, the initiation codon should be in the correct reading frame to guarantee translation of the entire insert. Exogenous translational elements and initiation codons can be of different origins, both natural and synthetic. Expression efficiency can be improved by incorporating transcriptional enhancers that are appropriate for the particular cellular system used and described in the literature (Scharf D. et al., Results Probl. Cell Differ. 20, pp. 125-162, 1994).

In addition, a host cell strain may be selected according to their ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired manner. Such modifications of polypeptides include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing that cleaves the prepro form of a protein can also be used to facilitate proper incorporation and / or winding and / or function. Various host cells, such as CHO, COS, HeLa, MDCK, HEK293, and WI38, which have specific cellular equipment and characteristic mechanisms for such post-translational activities, may be selected to ensure proper modification and processing of foreign proteins.

Stable expression is generally preferred for long-term high-yield production of recombinant proteins. For example, cell lines that stably express the desired polynucleotide may be transformed using expression vectors that may contain replicative and / or endogenous expression elements of viral origin and selective marker genes on the same or on a separate vector. After introduction of the vector, the cells may be allowed to grow for one to two days in an enriched environment prior to engaging in the selective medium. The purpose of the selective marker is to confer resistance to selection and its presence allows the growth and yield of cells that subsequently express the inserted sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture methods appropriate to the cell type.

Various selection systems can be used to obtain transformed cell lines. Exemplary, but not limited to, herpes simplex birus thimidine kinase (Wigler M. et al., Cell 11, p. 223-232 1977) and adenine phosphoribosyltransferase genes (Lovy I. et al. Cell 22, p. 817-8) are mentioned. 823 (1990)), which can be used in tk.sup- or aprt.sup.-cells. Antimetabolite, antibiotic or herbicidal resistance can also be used as a basis for selection; for example, dhfr, which confers resistance to methotrexate (Wigler M. et al., 1992).

8S <_; , Why. Nat. Acad. Sci. 77, pp. 3567-3570 (1980); npt, which confers resistance to aminogycosides, neomycin and G-418 (Colbere-Garapin F, et al., J. Mol. Biol. 150, pp. 1-14);

1981); and selectable genes, such as trpB, which allow cells to utilize indole instead of tryptophan, or hisD, which allow cells to utilize histinol instead of histidine (Hartman SC and Mulligan RC (Proc. Natl. Acad. Sci. 86: 8047-8051 (1988)). The use of visible markers has gained popularity of markers such as anthocynanin, beta-glucuronidase and its substrate GUS and luciferase and its luciferin substrate, which are used not only to identify transformants but also to quantify the amount of transient or constant protein expression attributable to a specific vector system (Rhodes CA) et al., Methods Mol. Biol. 55: 121-131 (1995).

Although the presence or absence of a gene expression marker indicates that the gene of interest is also present, its presence and expression need to be confirmed. For example, when a polypeptide coding sequence is incorporated within a marker gene sequence, recombinant cells containing the sequences may be identified by the absence of a marker gene group. Alternatively, the marker gene may be placed in tandem with the peptide coding sequence under the control of a single promoter. Expression of the marker gene in response to induction or selection usually also indicates expression of the tandem gene.

Alternatively, host cells that contain and express the desired polynucleotide sequence can be identified by a variety of methods known to those skilled in the art. Such methods include, but are not limited to, DNA-DNA or RNA-DNA hybridization and protein bioassay or immunoassay methods, including, for example, membrane, solution, or chip based methods for detecting and / or quantifying a nucleic acid or protein.

Many protocols are known in the art for detecting and measuring the expression of polynucleotides encoding the product, using polyclonal or monoclonal antibody specific for the product. Examples are enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and fluorescence activated cell sorting (FACS). A bilateral monoclonal based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a given polypeptide may be advantageous for some applications, but a competitive binding assay may also be used. These and other tests have been described, for example, by Hafflton R. et al. (Serology Methods, and Laboratory Manual, APS Press, St. Paul. Minn. 1990) and Maddox D.E. et al. (J. Exp. Med. 158: 1211-1216, 1983).

Numerous methods of labeling and conjugation are known to those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for generating marker hybridization or PCR probes for detecting polypeptide-related sequences include oligotagging, single stranded break, end-labeling, or PCR amplification with a labeled nucleotide. Alternatively, the sequences, or any portions thereof, may be cloned into a vector to produce an mRNA probe. Such vectors are known in the art, are commercially available and can be used to synthesize RNA probes in vitro by adding appropriate RNA polymerase such as T7, T3 or SP6 and labeled nucleotides. These methods can be performed using commercially available kits. Suitable reporter molecules or labels that can be used include, for example, radionucleotides, enzymes, fluorescent, chemiluminescent or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles.

Host cells transformed with the desired polynucleotide sequence may be cultured under conditions suitable for expression and protein recovery from the cell culture. The protein produced by the recombinant cell may be secreted or may be intracellularly dependent on the sequence used and / or the vector used. As is known to those skilled in the art, expression vectors containing the polynucleotides of the invention can be constructed to contain signal sequences with direct secretion of the encoded polypeptides across a prokaryotic or eukaryotic cell membrane. Other recombinant constructs can be used to link sequences encoding the polypeptide of interest to a nucleotide sequence encoding a polypeptide domain that facilitates purification of soluble proteins. Examples of such facilitating purification domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on an immobilized immunoglobulin, and domains used in FLACS extension / affinity a purification system (Immunex Corp., Seatle, Wash.). Incorporation of cleavage linker sequences, such as factor XA-specific or enterokinase (Invilrogen, San Diego, CA.) sequences alongside the purification domain and the encoded polypeptide can be used to facilitate purification. One such expression vector provides for the expression of a fusion protein comprising the polypeptide of interest and a nucleic acid encoding six histidine residues preceding the thioredoxin or enterokinase cleavage site. Histidine residues facilitate purification on immobilized metal ion affinity chromatography (IMIAC), (Porath J. et al., Prot. Exp. Purif. 3, pp. 263-281, 1992), while enterokinase the cleavage site provides a means for purifying the desired polypeptide from the fusion protein. A discussion of vectors containing fusion proteins was written by Kroll D.J. et al. (DNA Cell Biol. 12: 441-453, 1993).

In addition to recombinant production methods, the polypeptides of the invention and fragments thereof can be produced by direct peptide synthesis using solid phase methods (Merrifield J., J. Am. Chem. Soc., 85, 2149-2154, 1963). Protein synthesis> i 88 ->

> '> »>>))! >

> - i) I) »>) i»)) i) ») can be performed manually or automatically. Automated synthesis can be achieved, for example, using an Applied Biosystems 431A Peptide Syntethiser (Perkin Elmer). Alternatively, the different fragments can be chemically synthesized separately and combined using chemical methods to form a full-length molecule.

Composition of antibodies, fragments thereof and other binding agents

The invention further relates to binding agents, such as antibodies and antigen-binding fragments thereof, that exhibit immunological binding to the tumor polypeptide of the invention, or to a portion, variant, or derivative thereof. An antibody, or antigen-binding fragment thereof, specifically binds, immunologically binds, and / or is immunologically reactive to a polypeptide of the invention if it reacts detectably (e.g. in an ELISA) with a polypeptide and does not react detectably with unrelated polypeptides under similar conditions.

Immunological binding herein refers generally to a non-covalent interaction of the type that is between the immunoglobulin molecule and the antigen for which the immunoglobulin is specific. The strength or affinity of immunological binding interactions can be expressed as the dissociation constants (K a) of the interaction, with smaller K a values indicating greater affinity. The immunological binding properties of selected polypeptides can be quantified by methods well known in the art. One such method is based on measuring the rate of formation and dissociation of the antigen binding site / antigen complex, which rate depends on the concentration of the complex partners, on the affinity of the interactions and on the geometric parameters that also affect the rate in both directions. Thus, it is possible to determine both the constant on rate constant (Kon) and the off rate constant (Koff) by calculating the concentrations and the actual rate of association and dissociation. The ratio of Koff / Kon constants allows to exclude ,,, ·, 89) l.

»))» »> I)

Ί)))> ') >>

all parameters not derived from affinity and is therefore equal to the dissociation constant K a (Davies et al., Annual Rev. Biochem. 59, 439-473, 1990).

An antigen binding site or antibody binding portion refers to an immunoglobulin molecule that is involved in antigen binding. The antigen binding site is made up of the amino acid residues of the N-terminal variable (V ") regions of the heavy (Η) and (L") light chains. The three regions highly divergently dispersed within the V regions of the heavy and light chains are called hypervariable regions, which are interposed between the more conserved hemming extensions known as framework regions or FR. The designation “FR” refers to afflino acid sequences naturally found between and adjacent to hypervariable regions in immunoglobulins. In an anti-drug molecule, three hypervariable light chain regions and three hypervariable heavy chain regions are positioned relative to one another in a three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of the bound antigen, and the three hypervariable regions of each of the heavy and light chains are called complementarity-determining regions (CDRs).

Further, the binding agents may be capable of differentiating between cancer patients and without cancer, such as prostate cancer, using representative assays of the invention. For example, antibodies or other binding agents that bind to a tumor protein preferably produce a cancer signal in at least 20% of the patients with the disease, more preferably up to 30% of the patients. Alternatively or additionally, the antibody generates a negative signal indicative of the absence of disease in at least 90% of patients without cancer. As described herein, biological agents can be investigated to determine whether the binding agent meets this condition. )> 1) 1; Vzorky vzorky) samples (such as blood, serum, sputum, urine and / or tumor biopsies) from cancer patients and without cancer (as determined by standard clinical tests) for the presence of polypeptides that bind to the binding agent. Preferably, a statistically significant number of samples with or without disease are examined. Each binding agent should meet the above criteria; however, it is known to those skilled in the art that binding agents can be used in combination to improve sensitivity.

Any agent that meets these requirements may be a binding agent. For example, the binding agent may be a ribosome with or without a peptide component, an RNA molecule, or a polypeptide. In a preferred embodiment, the binding agent is an antibody or antigen-binding fragment thereof. Antibodies can be prepared by any method known to those skilled in the art (for example, Harlow and Lane, Antibody ^: A Laboratory Manual, Spring Spring Laboratory, 1988). Generally, the antibodies can be produced by culturing cells, including generating monoclonal antibodies as described herein, or by transfecting genes into suitable bacterial or mammalian host cells to allow production of recombinant antibodies. In one method, an immunogen-containing polypeptide, for example, is injected into a wide variety of mammals (e.g., mice, rats, rabbits, sheep, and goats). In this operation, the polypeptides of the invention may serve as an unmodified immunogen. Alternatively, particularly for relatively short polypeptides, a higher immune response may be elicited when the polypeptide is coupled to a carrier protein such as bovine serum albumin or keyhole lipped hemocyanin. The immunogen is injected into the animal host, preferably according to a predetermined list, containing one or more booster immunizations and blood is drawn periodically from the animal. Polyclonal antibodies specific for the polypeptides can then be purified from such antisera, for example, by affinity chromatography using a polypeptide coupled to a suitable solid nose.

pí ^ ^. W W.....

Monoclonal antibodies specific for the desired antigenic polypeptide can be prepared, for example, by the method of Kohler and Milstein (Eur. J. Immunol. 6: 511-519, 1976) and optionally improved. These methods include preparing immortalized cell lines capable of generating antibodies having the desired specificity (e.g., reactivity with the desired polypeptide). Such cell lines may be generated, for example, from spleen cells obtained from immunized animals. The spleen cells are then immortalized, for example, by fusing myeloma cells to a fusion partner, which is preferably syngenic to the immunized animal. Numerous fusion methods can be used. For example, spleen cells and myeloma cells may be combined with a nonionic detergent for several minutes, after which they are coated at low density on a selective medium that promotes the growth of hybrid cells but not myeloma cells. A preferred selective method uses HAT (hypoxanthine, aminopterin, thymidide) selection. After a sufficiently long period of approximately one to two weeks, hybrid colonies are observed. Individual colonies were separated and their supernatants tested for binding activity to the polypeptide. Hybridomas having high reactivity and specificity are preferred.

Monoclonal antibodies can be isolated from supernatants of growing hybridoma colonies. In addition, various methods can be used to improve yield, such as injecting a hybridoma cell line into a peritoneal cavity of a vertebrate, such as a mouse. The monoclonal antibodies can then be harvested from liquid collected in the abdominal cavity (acites) or blood. Impurities are removed from the antibodies by conventional means such as chromatography, gel filtration, precipitation, and extraction. The polypeptides of the invention can be used in a purification process such as affinity chromatography.

Many therapeutically useful molecules are known in the art, for example, antigen-binding sites that are capable of, are disclosed. , 92, exhibit immunological binding properties against the drug molecule. The proteolytic enzyme papain preferably cleaves IgG molecules to provide several fragments, two of which (F (ab) fragments) contain a covalent heterodimer that includes an intact antigen-binding site. The enzyme pepsin is able to cleave IgG molecules to provide several fragments, including a "F (ab) 2" fragment that contains both antigen-binding sites. The Fv fragment can be produced by proteolytic preferential cleavage of IgM and, in rare cases, iraunoglobulin IgG and IgA molecules. Fv fragments are more often derived using recombinant methods known in the art. The Fv fragment includes a non-covalent Vh-VL heterodimer containing an antigen-binding site that retains much of the antigenic resolution and binding capacities native to the drug molecule (Inbar et al., Proc. Natl. Acad. Sci. USA 69, p. 2659-2662, 1972; Hochman et al., Biochem. 15: 2706-2710 (1976); and Ehrlich et al., Biochem. 19, pp. 4091-4096 (1980).

A single chain Fv (sFv) polypeptide is a covalently linked Vh ^: VL heterodimer that is expressed from a gene fusion including genes encoding the Vh and VL genes bound by a peptide-encoding linker (Huston et al., Proc. Natl. Acad. Sci. USA 85). (16), 5879-5883 (1988). To distinguish chemical structures, a number of methods are described for converting naturally aggregated but chemically separated light and heavy polypeptide chains from the anti-V region into a sFv molecule that winds into a three-dimensional structure substantially similar to the antigen-binding site structure (US Patent Nos. 5091513 and U.S. 5,132,405 to Huston et al .; and U.S. Patent No. 4,941,778 to Ladner et al.

Each of the described molecules comprises a group of heavy chains and light chains of CDRs interposed between a group of heavy chains and light chains of FRs that provides support for CDRS and defines the CDR spatial ratio to each other. As used herein, the CDR family refers to the three hypervariable regions of the heavy and light chain V-regions. Proceeding from the N-terminus of the heavy and light chains, these regions are designated CDR1 ', CDR2, and CDR3'. Thus, the antigen-binding site comprises six CDRs comprising a CDR group from the heavy and light chain V regions. A polypeptide comprising CDR alone (i.e., CDR1, CDR2, or CDR3) is referred to herein as a molecular recognition unit. Crystallographic analysis of a number of antigen-antibody complexes suggests that the amino acid residues of the CDRs make extensive contact with the bound antigen, with the most extensive antigenic contact being with the heavy chain CDR3. Therefore, molecular resolution units are primarily responsible for the specificity of the antigen-binding site system.

The FR set used herein refers to the four flanking amino acid sequences that frame the CDRs of the heavy and light chain V-region CDRs. Some FR residues may contact the bound antigen; however, FRs are primarily responsible for winding the V-region into an antigen-binding site system, especially FR residues directly adjacent to the CDRs. Within FR, some amino acid residues and some structuring characteristics are very highly conserved. In this regard, all V-region sequences contain an internal disulfide loop of approximately 90 amino acid residues. When the V-regions wind through the binding site, the CDRs are expressed as projection loop motifs that form the antigen-binding surface. It is generally believed that there are conserved FR structural regions that affect the winding pattern of CDR loops into a particular canonical structure, independent of the exact CDR amino acid sequence. Furthermore, some FR residues are known to be involved in non-covalent interdomain contacts that stabilize interaction against heavy and light chain chains.

A number of "humanized" anti-antibody molecules containing an antigen-binding site have been described, derived from the inhuman ifflu299, 1991: Lobuglio

USA 86, pp. 4220-4224, noglobulin, including chimeric antibodies having rodent V regions and their CDRs fused to human constant domains (Winter et al., Nature 349, pp. 293 et al., Proc. Natl. Acad. Sci. .

1989); Shaw et al., J. Immunol. 138: 4534-4538 (1987); and Brown et al., Cancer Res. 47, pp. 3577-3583 (1987), rodent CDRs grafted into a human carrier FR prior to fusion with an appropriate human anti-substance constant domain (Riechmann et al., Nature 332, pp. 323-327, 1988; Verhoyen et al., Science 239, pp. 1534-1536 (1988; and Jones et al., Nature 321, pp. 522-525 1986) and rodent CDRs carried by recombinantly coated rodent FRs (European Patent Application No. EP 519596 published December 23, 1992). These humanized molecules are intended to minimize unwanted immunological responses against rodent versus human anti-substance molecules that limit the duration and efficacy of therapeutic applications of such fractions in human recipients.

The terms "veneered FR" and "recombinantly veneered FR" as used herein refer to the replacement of FR residues from, for example, a rodent heavy and light chain In a region of human FR residues to obtain a xenogeneic molecule containing an antigen-binding site, which retains substantially all of the native FR polypeptide winding structure. The sheathing methods are based on the recognition that the ligand generating characteristics of the antigen-binding site system is determined primarily by the structure and relatini of the disposition of the heavy and light chain CDR groups within the antigen-binding surface system (Davies et al., Ann. Re v. Biochem. 439-473 (1990). The specificity of antigen binding can be maintained in a humanized antibody CDR structure only if their interactions and their interaction with the rest of the V region domains are carefully observed. Using opiate methods, external FR residues (i.e., available for solvent) that have already encountered the immune system are selectively replaced by human residues to provide a hybrid molecule that contains either a poorly immunogenic or substantially non-immunogenic sheathed surface.

The sheathing process uses the available sequence data for the variable domains of the human antibody described by Kabat et al. (Kabat et al., Sequences of Proteins of Immunogenics1 Interest, 4th edition.) and other available US and foreign databases (both nucleic acids and proteins) Solvent availability In the amino acid region can be derived from the known three-dimensional structure for human and murine anti-substance fragments There are two general methods for sheathing a murine antigen-binding site. the domains of the molecule of interest for the antibody are compared to the corresponding FR sequences of the human variable domains obtained from the above sources, and most homologous human regions are then compared residue by residue with the corresponding mouse amino acids. and replaces residues contained in the human moiety using recombinant methods well known in the art. Residue switching is performed only with portions that are at least partially exposed (solvent accessible) and are carefully replaced with amino acid residues that may have a significant effect on the tertiary structure of V region domains, such as proline, glycine and charged amino acids.

Thus, the resulting veneered mouse antigen-binding sites are constructed to retain mouse CDR residues substantially adjacent to CDRs, residues identified as buried or near-buried (solvent unreachable) residues believed to be involved in non-covalent residues. (for example, electrostatic or hydrophobic) contacts between light and heavy chain domains and residues from conserved FR structural regions believed to affect canonical tertiary structures and loops

CDR. These design criteria are then used to prepare recombinant nucleotide sequences that combine the CDRs of both the heavy and light chains of the murine antigen-binding site system in FRs that can be used to transfect mammalian cells to express recombinant human antibodies that exhibit antigenic specificity of mice against drug molecules.

The invention further relates to the monoclonal antibodies of the invention which can be coupled to one or more therapeutic agents. Suitable agents in this regard are radionucleotides, differentiators, drugs, toxins and derivatives thereof. Examples of radionucleotides are ⁹ ° Y, ¹²³ J, ¹²⁵ J, ¹³¹ J, ^1S6 Re, ^1S8 Re, ²¹¹ At and ²¹² Bi. Preferred drugs include methotrexate and pyrimidine and purine analogs. Preferred differentiation inducers are phorbol esters and lactic acid. Preferred toxins are ricin, abrin, diphtheria toxin, cholera toxin, gelonin, Pseudomomas exotoxin, Shigella toxin, and a "pokeweed" antiviral protein.

The therapeutic agent may be coupled (e.g., by covalent bonding) to a suitable monoclonal antibody either directly or indirectly (e.g., a linker moiety). A direct reaction between the reagent and the antibody is possible if each contains a substituent capable of reacting with one another. For example, a nucleophilic group such as an amino group or a sulfhydryl group may be capable of reacting with a carbonyl-containing group such as an anhydride or acid halide or with an alkyl group containing a well-released group (e.g. a halide).

Alternatively, it may be desirable to couple the therapeutic agent with the antibody via a linker. The linker moiety may function as a spacer separating the antibody from the agent to prevent interference with the binding capabilities. The linker group can also be used to increase the chemical reactivity.

The substituent on the reagent or antibody and thereby increase the efficiency of the coupling. The increase in chemical reactivity may also facilitate the use of reagents or functional groups on reagents, which would otherwise be impossible.

It will be appreciated by those skilled in the art that a variety of bifunctional or polyfunctional agents, both homofunctional and heterofunctional (as described in Pierce Chemical Co., Rockford, IL), may be used as a linker. The coupling can be carried out, for example, through amino groups, carboxyl groups, sulfhydryl groups or oxidized carbohydrate residues. The methodology is described in numerous literature (e.g., U.S. Patent No. 4,671,958 to Rockwell et al.

If the therapeutic agent is more capable of being deprived of an antibody portion of the immunoconjugates of the invention, it may be desirable to use a linker group that is cleavable during or after internalization into the cell. Many different cleavable groups are described. The mechanism of intracellular release of an agent from a linker group includes cleavage by reducing the disulfide bond (e.g., U.S. Patent No. 4,489,710 to Spitler) by irradiating the photolabile bond (e.g., U.S. Patent No. 4,625,014 to Senter et al.) By hydrolyzing the derivatized side chains. amino acids (U.S. Patent No. 4,663,045 to Kohn et al.) by serum complement mediated hydrolysis (e.g., U.S. Patent No. 4,676,158 to Rodwell et al.) and acid-catalyzed hydrolysis (e.g., U.S. Patent No. 4,569,789 to Blattler et al.).

It may be desirable to coupling more than one agent to an antibody. In one embodiment, several agent molecules are coupled to an antibody molecule. In another embodiment, more than one type of agent may be coupled to one antibody. Irrespective of the particular embodiment, immunoconjugates with more than one agent may be prepared in various ways. For example, more than one agent may be directly coupled to an antibody molecule, or linkers having multiple sites for coupling may be used. Alternatively, a carrier may be used.

The carrier can carry agents in a variety of ways, including covalent bonding directly or through linkers. Suitable carriers include proteins such as albumins (e.g., U.S. Patent No. 4,507,234 to Kato et al.), Peptides and polysaccharides such as aminodextran (U.S. Pat.

699784, Shih et al.). The carrier may carry the agent by non-covalent bonding or encapsulation, such as within a liposome vesicle (U.S. Pat. Nos. 4,442,888 and 4,887,3088). Carriers specific for radionucleotide agents include radiohalogenated small molecules and chelating compounds. For example, U.S. Patent No. 4,735,792 discloses representative radiohalogenated small molecules and their synthesis. The radionuclide chelate may consist of chelating compounds that contain nitrogen and sulfur atoms as donor atoms to bind to the metal or metal oxide, to the radionuclide. For example, in U.S. Patent 4,667,562, Davidson et al. representative chelating compounds and their synthesis,

T-cell composition

The invention also relates, inter alia, to T cells specific for a tumor polypeptide or a variant or derivative thereof. Such cells can generally be prepared in vitro or ex vivo using standard methods. For example, the T cell may be isolated from bone marrow, peripheral blood or bone marrow fractions or patient peripheral blood using a commercially available cell separation system such as the Isolex ™ System (a commercial product of Nexell Therapeutics, Inc) (Irvine CA; see also U.S. Patent No. 5,240,856;

215926; WO 89/06280; W0 91 /

-, 99

16116: and HO 92/07243). Alternatively, T cells can be derived from related or unrelated human, non-human mammalian cell lines or cultures.

T cells may be stimulated by a polypeptide, polynucleotides encoding the polypeptide, and / or antigen presenting cells (APCs) that express such a polypeptide. Such stimulation is conducted under conditions and for a time sufficient to generate T cells that are specific for the polypeptide of interest. Preferably, the tumor polypeptide or polynucleotide of the invention is contained within a release carrier, such as a microsphere, to facilitate generation of specific T cells.

T cells are considered to be specific for a polypeptide of the invention when T cells specifically proliferate and secrete cytokines or kill target cells coated with the polypeptide or expressing a gene encoding the polypeptide. T cell specificity can be assessed using a variety of standard methods. For example, in a chromium release assay or proliferation assay, T cell specificity indicates a stimulation index with greater than 2-fold increase in lysis and / or proliferation, as compared to a negative control. Such assays can be performed, for example, according to Chen et al. (Cancer Res. 54: 1065-1070, 1994). Alternatively, the detection of T cell proliferation can be performed in a number of known ways. For example, T cell proliferation can be determined by measuring an increased rate of DNA synthesis (for example, by pulse-labeled T cell cultures with tritiated thymidine and measuring the amount of trtiated thymidine incorporated into DNA). Contact with the tumor polypeptide (100 ng / ml to 100 pg / ml, preferably 200 ng / ml to 25 pg / ml) for three to seven days usually results in at least a two-fold increase in T-cell proliferation. Said contact for two to three hours should result in T cell activation as measured by a standard cytokine assay, where a two-fold increase in the degree of cytokine release (e.g. TNF or INF-gamma) is indicative of T cell activation (Coligan et al., Cur; 1QQ, rent Protocols in Immunology, vol 1, Wiley Interscience, Greene 1998). The cells activated in response to a tumor polypeptide, polynucleotide, or APC-expressing polypeptide may be CD4 ⁺ and / or CD8 ⁺ . T Cancer polypeptide-specific cells can be expanded by standard methods. In a preferred embodiment, the T cells are derived from a patient, a related or unrelated donor, and are administered to the patient after stimulation and expansion.

For therapeutic purposes, CD4 ⁺ and / or CD8 ⁺ T cells that proliferate in response to a tumor polypeptide, polynucleotide, or APC may expand in numbers either in vitro or in vivo. Proliferation of T cells in vitro can be performed in a number of ways. For example, T cells may be re-exposed to a tumor polypeptide or short peptide corresponding to an immunogenic portion of such polypeptides with or without the addition of T cell growth factor such as interleukin-2 and / or stimulator cells that synthesize the tumor polypeptide. Alternatively, a T cell or multiple T cells that proliferate in the presence of a tumor polypeptide may be expanded by a series of cloning. Methods of cloning cells are well known in the art and include limiting dilution.

Pharmaceutical preparations

Additionally, the invention also relates to formulations comprising one or more polynucleotide, polypeptide, T cell and / or antibody compositions of the invention in a pharmaceutically acceptable carrier for administration to a cell or animal, either alone or in combination with one or more conventional therapeutic agents.

The composition of the invention may be administered in combination with other agents, as well as, for example, other proteins or polypeptides or various pharmaceutically active agents. In fact, there is no limitation for other components that r 101; they may also be incorporated, provided that these additional components do not have a significant adverse effect on contact with the target cell or host tissue. Thus, the compositions may be released in conjunction with various other agents as desired in certain circumstances. Such compositions may be separated from host cells or other biological sources or may be chemically synthesized as described herein. Similarly, such compositions may further comprise substituted or derivatised RNA or DNA compositions.

The invention therefore also relates to pharmaceutical compositions comprising one or more polynucleotide, polypeptide, antibody and / or T cell compositions of the invention together with a physiologically acceptable carrier. According to a preferred embodiment, the pharmaceutical composition of the invention comprises an immunological polypeptide and / or polynucleotide composition of the invention for prophylactic or therapeutic vaccine use. A method for preparing a vaccine is generally described, for example, in M.F. Command 1 and M.J. Newman, eds. Vaccine Design (The Subunit and Adjuvant Approach), Plenum Press (NY, 1995). Generally, such compositions comprise one or more polynucleotide and / or polypeptide compositions of the invention in combination with one or more stimulants.

It will be appreciated that any such pharmaceutical composition described herein may contain pharmaceutically acceptable salts of the polynucleotides and polypeptides of the invention. Such salts may be prepared using, for example, pharmaceutically acceptable non-toxic bases, including organic bases (e.g., primary, secular or tertiary amine salts and basic amino acids) and inorganic bases (e.g., sodium, potassium, lithium, ammonium, calcium and magnesium salts).

In another embodiment, the immunogenic compositions, for example, the vaccine compositions of the invention, comprise DNA encoding a > 103, one or more of the polypeptides described above, such that the polypeptide is generated in situ. As noted above, the polynucleotide may be administered within any of the release systems known to those skilled in the art as described in the literature (Rolland, Crit. Rev. Therap. Drug Carrier Systems 15, 143-198, 1998).

A suitable polynucleotide expression system comprises the necessary regulatory DNA regulatory sequences for expression in a patient (e.g., a suitable promoter and termination signal). Alternatively, bacterial release systems may include administering a bacterium (for example, Bacia-Calmette-Guerrin) that expresses an immunogenic portion of the polypeptide to the cell surface or secretes such an epitope.

In certain embodiments, polynucleotides encoding the immunogenic polypeptides described herein are introduced into suitable mammalian host cells for expression using any of a variety of viral-based systems. According to an illustrative embodiment, retrovirus is a common and efficient platform for gene release systems. The selected nucleotide sequence encoding the polypeptide of the invention may be inserted into a vector and packaged into retroviral particles by methods known in the art. The recombinant virus can then be isolated and released into the subject. Numerous explanatory retroviral systems have been described (e.g., U.S. Patent No. 5,297,940; Miller and Rosman, Bio Techniques 7, 780-790, 1989; Miller AD, Human Gene Therapy 1, 5-14, 1990; Scarpa et al. Virology 180, 849-852 (1991): Bums et al., Proc Natl Acad Sci USA 90: 8033-8037 (1993) and Boris-Lawrie and Temin, Cur. Develop, 3, pp. 102-109 (1992).

Numerous elucidating adenovirus-based systems are also described. Unlike retroviruses that integrate into the host cell, adenoviruses remain extrachromosomal and minimize the hazards associated with insertional mutagenesis (Haj-Ahm.ad and Graham, J. Virol. 57, 267-274 (1986); Bett et al., J .

Virol. 67, pp. 5911 to 5921, 1993; Mittereder et al., Human, ¹⁰⁷ Gene Therapy 5, 717-729, 1994; Seth et al., 3. Virol. 68: 933-9401 (1994); Barr et al., Gene Therapy 1, pp. 51-58, 1994; Berkner KL, Biotechniques 8, 616-629 (1988) and Rich et al., Human Gene Therapy 4, 461-476 (1993).

Various adeno-associated viral (AAV) vector systems are also developed for the release of polynucleotides. AAV vectors are readily constructed using well known methods in the art (e.g., U.S. Patent Nos. 5,173,414; and 5,199,994: International Publication Nos. WO 92/01070; and WO 93/03769; Lebkowski et al., Holec. Cell Biol 8: 3988-3996, 1988; Vincent et al., Vaccines 90, Cold Spring Harbor Laboratory Press, 1990; Carter BJ, Current Opiniin in Biotechnology 3, pp. 533-539, 1992; Muzyczka N Current Topics in Microbiol and Immunol 158: 97-129 (1992): Kotin RM, Human Gene Therapy 5: 793-801, 1994; Shelling and Smith, Gene Therapy 1, 165-169, 1994 and Zhou et al., J. Exp Med 179: 1867-1875 (1994).

Additional viral vectors useful for the release of polynucleotides encoding the polypeptides of the invention by gene transfer include vectors derived from a smallpox virus family such as a smallpox virus and a smallpox virus. For example, vaccinia virus recombinants expressing novel molecules can be constructed in the following manner. The DNA encoding the polypeptide is first inserted into a suitable vector such that it is adjacent to the cowpox promoter and flanking the DNA of the cowpox sequence as a thymidine kinase (TK) coding sequence. This vector is used to transfect cells that are simultaneously infected with smallpox. Homologous recombination serves to insert the promoter of cowpox plus the gene encoding the polypeptide of interest into the viral genome. Vzniklý TK. The (-) recombinant can be selected by culturing the cells in the presence of 5-bromo-deoxyuridine, and viral plaques can be collected, including the plaque.

- 104 that are resistant to it.

The smallpox-based infectious / transfection system can usually be used for the deployable transient expression or coexpression of one or more of the polypeptides described herein in host cells of the organism. In this particular system, cells are first infected in vitro with a vaccinia virus recombinant that encodes a bacteriophage T7 RNA polymerase. This polymerase has excellent specificity in that it only transcribes matrices carrying T7 promoters. After infection, cells are transfected with the appropriate polynucleotide or polynucleotides in the presence of the T7 promoter. The polymerase, expressed in the cytoplasm from the vaccinia virus recombinant, transcribes the transfected DNA into RNA, which is then translated into the polypeptide by the host translation machinery. The method represents high yield, transient, cytoplasmic production of large amounts of RNA and its translation products (e.g., Elroy.Stein and Moss, Proc. Natl. Acad. Sci USA 87: 6743-6747, 1980; Fuerst et al.

USA 83: 8122-8126 (1986).

Why. Nati. Acad. Sci

Alternatively, avian pox virus, such as poultry pox virus or canary pox virus, can also be used to release coding sequences. Recombinant avian poxvirus expressing immunogens from mammalian pathogens is known to contribute protective immunity when administered to non-avian species. The use of avian poxvirus vector is particularly desirable for humans and other mammalian species, since members of the avian pox genus can only productively replicate in susceptible avian species and are not infectious in mammalian cells. Methods for producing avian poxviruses are known in the art and use genetic recombination as described above with respect to vaccinia viruses (for example, WO 91/12882; WO 89/03429; and WO 92/03545).

Any number of alphavirus vectors can also be used to release the polynucleotide compositions of the invention, for example, the vectors described in U.S. Patent No. 5,843,723; US 6,015686; US 6,008035; and US 6,015694. Certain Venezuelan Equine Encephalitis (VEE) based vectors may also be used, with illustrative examples in US Patent Nos. 5,505,747 and 5,635,376.

Molecular conjugate vectors such as the adenoviral chimeric vectors described by Michael et al. (J. Biol. Chem. 268: 6866-6869, 1993) and Wagner et al. (Proc. Acad. Natl. Sci. USA 89: 6099-6103, 1992) can also be used for the gene release of the invention.

Further explanatory information on these and other viral-based release systems is described in the literature (Fisher-Hoch et al., Proc. Acad. Natl. Sci. USA 86: 317-321, 1989): Flexner et al., Ann. . N.Y. Acad Sci. 569: 86-103 (1989): Flexner et al., Vaccine 8: 17-21, 1990; U.S. Patent No. 4,603,212; U.S. Pat. No. 4,793,330; and US 5,017,487: WO 89/01973; U.S. Patent No. 4,777,127; GB 2 200651; EP 0 345242: WO 91/02805; Berkner, Biotechniques 6: 616-622 (1988); Rosenfeld et al., Science 252: 413-434 (1991); Kolls et al., Proc. Nati. Acad. Sci USA 91: 215-219 (1994); Kass-Eisler et al., Proc. Nati. Acad. Sci USA 90: 11498-11502 (1993); Guzman et al., Circulation 88, pp. 2838-2 2848, 1993; and Guzman et al., Cir. Res. 73, pp. 1202-1207, 1993.

In certain embodiments, the polynucleotide may integrate into the genome of a target cell. This integration may be to a specific location and orientation via homologous recombination (gene replacement) or may be to a random, non-specific, location (gene magnification). In yet another embodiment, the polynucleotide can be stably maintained in the cell as a separate, episomal segment of DNA. Such polynucleotide segments or episomes encode sequences sufficiently to maintain and replicate independently or in sync with the host cell cycle. The way in which the expression construct is released into the cell and how the polynucleotide remains in the cell depends on the type of expression of the construct used.

According to another embodiment of the invention, the polynucleotide is administered / released as naked DNA (e.g., Ulmer et al., Science 259: 1745-1749, 1993; Cohen, Science 259: 1691-7).

1692, 1993). The absorption of naked DNA can be enhanced by packaging the DNA into biodegradable beads that are effectively transferred to the cell.

According to yet another embodiment of the invention, the composition of the invention can be released by particle bombardment. According to one illustrative example, acceleration of a particle by gas can be achieved using a device that is a commercial product of Powderject Pharmaceuticals PLC (Oxford,

UK) and Powderject Vaccines Inc. (Madison, WI). Examples of such a solution are also described in the patent literature (U.S. Pat. No. 5,846,696; U.S. Pat. No. 6,010,778; U.S. Pat. No. 5,865,796; U.S. Pat. No. 5,584,807; and European Patent Publication No. EP 0 500799). This approach offers needle-free administration, wherein the dry powder composition with microscopic particle size, for example, polynucleotide or polypeptide particles, is accelerated to high velocity in helium gas generated by a hand-held device driving the particles to the respective target tissue.

According to a related embodiment, devices and methods that may be useful for needles without gas-driven injection of the composition of the invention are possible using Biojet. (Portland, OR); some examples of such a solution are described in U.S. Pat. No. 5,066-4413; US 5 and 5 993412).

(U.S. Pat. No. 4,790,824; 312,335; U.S. Pat. No. 5,383,151; U.S. Pat. No. 5,399,163; U.S. Pat. No. 5,520,639)

In another embodiment, the pharmaceutical compositions of the invention comprise one or more immunostimulants in addition to an immunogenic polynucleotide, polypeptides, antibody, T cell and / or APC composition of the invention. By immunostimulant is meant essentially any substance that supports or enhances an immune response (antibody and / or cell-mediated) to an exogenous antigen. One type of immunostimulant is an adjuvant. Numerous adjuvants contain a substance intended to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, or immune response stimulators such as lipid A and proteins derived from Bordatella pertussis or Mycobacterium tuberculosis. Certain adjuvants are commercially available, for example, Freun's Incomplete Adjuvant and Complete Adjuvant adjuvant (Difco Laboratories, Detroit, MI); Merck Adjuvant 65 (Merck &amp; Company, Inc., Rahvay, NJ); AS-2 (SmithKline Beecbam, Philadelphia, PA); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; calcium, iron or zinc salts; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes: biodegradable microspheres; monophosphoryl lipid A and quil A. Cytokines such as GM-CSF, interleukin-2, -7, -12 and other similar factors can also be used as adjuvants.

According to certain embodiments of the invention, preferred adjuvant compositions are those that induce a Th1 type immune response. High levels of Th1-type cytokines (e.g., IFN-gamma, TNFoc, IL-2 and IL-12) tend to promote the induction of cell-mediated immune responses into the administered antigen. In contrast, high levels of Th-2-type cytokines (e.g., IL-4, IL-5, IL-6, and IL-10) tend to promote induction of ¹⁰⁰ . , Or humoral immune responses. Upon administration of the vaccine of the invention, the patient exhibits an immune response that includes a Th1 and Th2 response. According to a preferred embodiment, wherein the response is preferably of the Th1 type, the level of Th1-type cytokines increases to a greater extent than the level of Th2-type cytokines. The level of these cytokines can be readily assessed using known assays. A review of the cytokine families has been reported by Mosmann and Coffman (Ann. Rev. Immunol. 7: 145-173 (1989)).

Certain preferred adjuvants for eliciting a predominantly Th1-type response include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A, together with an aluminum salt thereof. MPL ^R adjuvants are a commercial product of Corixa Corporation (Settle WA; for example, U.S. Pat. No. 4,436,727; US 877611; US 4,8606034; US 4 912094). CpG containing oligonucleotides (in which the CpG dinucleide is unmethylated) also introduce a predominant Th1 response. Such oligonucleotides are well known and described (for example, WO 96/02555; WO 99/33488; U.S. Patent No. 6,008200; and 5,856,462). Immunostimulatory DNA sequences are also described (for example, Sato et al., Science 273, 352, 1996). Another preferred adjuvant comprises a saponin, for example Quil A, or derivatives thereof including QS21 and QS7 (Aquila Biopharmaceuticals Inc, Framingham, MA); Escin; Digitonin; or Gypsophila or Chemopodium quinoa saponins. Other preferred compositions comprise more than one saponin in the adjuvant combination of the invention, for example a combination of at least two members of the group comprising QS21, QS7, Quil A, fS-escin or digitonin.

Alternatively, the saponin compositions may be combined with a vaccine carrier composed of substances such as chitosan or other swallowing ionic polymers, polylactide and polylactide-coglycolide particles, poly-N-acetylglucosamine-based polymer matrices, particles composed of polysaccharide or chemically modified polysaccharides liposomes and lipid-based particles and particles composed of glycerol monoesters. Saponins can also be formulated in the presence of cholesterol to form a particulate structure such as liposomes or ISOMs. Saponins can also be formulated with polyethylene ether or polyethylene ester either in a non-particulate solution or suspension or in a particulate structure such as low lamellar liposomes and ISCOMs. Saponins may also be formulated with excipients such as Carbopol ^R to increase viscosity or may be formulated as a flowable powder with a powdered excipient such as lactose.

In one embodiment, the adjuvant system comprises a combination of a monophosphoryl lipid A and a saponin derivative, such as a combination of QS21 and 3D-MPLK ^R adjuvant (HO 94/00153) or a less reactogenic composition, wherein QS21 is affected by cholesterol as described in the World Patent HO 96/33739. Other preferred compositions include an oil-in-water emulsion and tocopherol. Other particularly preferred adjuvant compositions comprising QS21, 3D-MPL ^R adjuvant and tocopherol in an oil-in-water emulsion are described in WO 97/17210.

Another supported adjuvant system comprises a combination of a CpG-containing oligonucleotide and a saponin derivative, particularly a combination of CpG and QS21 (World Patent Publication No. HO 00/09159). Preferably, the composition additionally comprises an oil in water emulsion and tocopherol.

Additional adjuvants for use in the pharmaceutical compositions of the invention include, for example, Montanide ISA 720 (Seppic, France), SAF (Chiron, California, United States), ISCOMS (CSL) MP-59 (Chiron), SBAS series adjuvants (e.g. SBAS-2). or SBAS-4, commercially available from SmithKline Beecham, Rixensart, Belgium), Detox ^(R Enhanzyn; CoriAvl -r <- x - - - - '''' • 'of s * ^u «í ·» ·' · - »* * J t iii iii iii iii iii iii iii iii iii iii ''''''''''''''' ¹¹ θ, xa, Hamilton, MT), RC-529 (Corixa, Hamilton MT) and other aminoalkyl glucosamine-4-phosphates (AGP), for example, described in US patent applications (pending) Nos. 08 / 853,826 and 09/074720 and polyoxyethylene ether adjuvants (WO 99/52549 A1).

Other preferred adjuvants include adjuvant molecules of formula (I): H (CH ₂ CH ₂ O) _n -AR where η 1 to 50, A bond or -C (O) -, R is C 1 -C 50 alkyl or phenylalkyl having 1 to 50 carbon atoms in the alkyl moiety.

According to one embodiment of the invention, the vaccine formulation comprises a polyoxyethylene ether of formula I, wherein n is 1 to 50, preferably 4 to 24, most preferably 9; the R component is an alkyl group having 1 to 50 carbon atoms, preferably 4 to 20 carbon atoms, most preferably 12 carbon atoms, and A is a bond. The concentration of the polyoxyethylene ethers should be 0.1 to 20%, more preferably 0.1 to 10%, and more preferably 0.1 to 1%. Preferred polyoxyethylene ethers are selected from the group consisting of polyoxyethylene-9-lauryl ether, polyoxyethylene-9-steoryl ether, polyoxyethylene-8-steoryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35-lauryl ether and polyoxyethylene-23-lauryl ether. Polyoxyethylene ethers such as polyoxyethylene lauryl ether are described in the Merck index (12th edition: entry 7717). These adjuvant molecules are disclosed in WO 99/52549. The polyoxyethylene ether of the formula I can optionally be combined with another adjuvant. For example, it is a preferred combination of an adjuvant with CpG (GB 9820956.2).

According to another embodiment of the invention, the immunogenic composition described herein is delivered to host antigen-presenting cells (APCs), such as dendritic cells, macrophages, B-cells,

I ir 1 1 li - I I ''> '·

1 · () i · t i I '

II,, <Ί '', i I> I i - Ί '. . > <> · ·>

monocytes and other cells that can be constructed for sensitivity to APC. Such cells may, but need not, be genetically modified to increase anti-gene delivery capacity, improve activation and / or maintain T cell response, for anti-tumor activity alone, and / or be immunologically compatible with the recipient (e.g., a suitable HLA haplotype) ). Generally, antigen-presenting cells (APCs) may be isolated from any biological fluid and from any organ, including tumor and peritumor tissues, and may be autologous, allogeneic, syngenic or xenogeneic cells.

A certain preferred embodiment of the invention is the use of dendritic cells as APC. Dendritic cells are potent APCs (Banchereau and Steinman, Nature 392, pp. 245-251,

1998) and have been found to be effective as a physiological adjuvant to induce prophylactic or therapeutic anti-tumor immunity (Timmerman and Levy, Ann. Rev. Med. 50, pp. 507-529,

1999). In general, dendritic cells can be identified based on their typical shape (ste11ate in a network with prominent in vitro cytoplasmic processes (dendrites)), their ability to receive, process and provide antigens with high efficiency and their ability to activate naive T cell responses. However, dendritic cells can be constructed to express specific cell surface or ligand receptors that are not commonly found in dendritic cells in vivo or ex vivo, and such modified dendritic cells include the invention. As an alternative to dendritic cells, secreted vesicles of antigen-filled dendritic cells (called exosomes) may be used in the vaccine (Zitvogel et al. Nature Med, 4, 594-600, 1998).

The dendritic cells and progenitors may be obtained from peripheral blood, bone marrow, from cells infiltrating into the tank, from cells infiltrating into peritumor tissues, from lymph nodes, from spleen, from skin, from umbilical spinal cord blood, or from any

T *** 4 «c« »I *

112 ·> “appropriate tissues or fluids. For example, dendritic cells can be differentiated ex vivo by adding a combination of cytokines such as GM-CSF, IL-4, IL-13 and / or TNFα to monocyte cultures harvested from peripheral blood. Alternatively, CD34 positive cells harvested from peripheral blood, umbilical spinal cord blood or bone marrow can be differentiated into dentritic cells by adding to the culture medium a combination of GM-CSF, IL-3, TNFot, CD40 ligand, LPS ligand fit3 and / or other compounds. that induce differentiation, maturation and proliferation of dendritic cells.

Dendritic cells are usually divided into mature "and immature", which makes it easy to distinguish between well characterized phenotypes. However, this naming should not exclude all possible intermediate resolution. Immature dendritic cells are referred to as APCs with a high yield and processing capacity, which corresponds to the high expression of Fcgama and mannmosis receptors. The mature phenotype is typically characterized by lower expression of these markers but by high expression of cell surface molecules responsible for T cell activation such as MHC class I and class II, adhesion molecules (e.g. CD54 and CD11) and costimulatory molecules (e.g. CD40, CD80, CD86 and 4-1BB).

APCs can be transfected with a polynucleotide of the invention (portion or other variant thereof) such that the encoded polypeptide, or immunogenic portion thereof, is expressed on the cell surface. Such transfection may be ex vivo and the pharmaceutical composition comprising such transfected cells may then be used for therapeutic purposes as described herein. Alternatively, a delivery vehicle gene that is directed to a dendritic or other cell providing an anti-gene resulting from transfection that occurs in vivo can be administered to a patient. Transfection of in vivo and ex vivo dendritic cells, for example, can generally be accomplished by any method known in the art (WO 97/24447) or by a gene gun (Mahvi et al., Immunology and cell Biology 75, pp. 456-45). >)>>),)>>)) '>)))> i »>>>))») »λ *))>>>>))»))))

460, 1997). Antigenic loading of dendritic cells can be achieved by incubating dendritic cells or progenitor cells with a tumor polypeptide, with DNA (bare or inside a plasmid vector), or with RNA; not with antigen-expressing recombinant bacteria or viruses (e.g., vaccinia, fowlpox, adenovirus or lentiviral vectors). Prior to loading, the polypeptide may covalently bind to an immunological partner that represents T cell help (e.g., a carrier molecule). Alternatively, the dendritic cell may be pulsed with an unconjugated immunological partner, separately or in the presence of the polypeptide.

Although any suitable carrier known to those skilled in the art may be used in the pharmaceutical compositions of the invention, the choice of carrier generally depends on the mode of administration of the pharmaceutical composition. The compositions of the invention may be formulated for any suitable route of administration. Topical, oral nasal, mucosal, intravenous, intracranial, intraperitoneal, subcutaneous, and intramuscular administration are exemplified.

The carriers used in the pharmaceutical compositions are biocompatible and may also be biodegradable. For certain embodiments, the pharmaceutical compositions of the invention exhibit a relatively constant amount of active agent release. However, in other embodiments, it may be desirable to release the active agent more rapidly immediately after administration. The formulation of such compositions is well known to those skilled in the art and may be known in the art. Examples of carriers useful in this regard are microparticles of poly (lactide coglycolide), polyacrylate, latex, starch, cellulose and dextran. As delayed release illustrative carriers, supramolecular biovectors which contain a non-liquid hydrophobic core (for example, a cross-linked polysaccharide or oligosaccharide) and optionally an external layer containing an amphiphilic compound, for example, wt. 11>

(11) (11) (11) (11) (11) (11) (11) (11)))) phospholipid (U.S. Pat. No. 5,151,254; and WO 94/20078; And WO 96/06638). The amount of active ingredient contained in a sustained release pharmaceutical composition depends on the site of implantation, the rate and expected duration of release, and the nature and conditions of the condition being treated or prevented.

In another illustrative embodiment, biodegradable microspheres (e.g. polylactate polyglycolate) can be used as carriers for the compositions of the invention. Suitable biodegradable microspheres are described in the patent literature (e.g., U.S. Pat

897268; U.S. 5,075,109; US 5,928,647; US 5,811,128; 5,820,883; US

853763; U.S. 5,814,344; U.S. 5,407,609; and US 5,942,252). Modified hepatitis B core protein carrier systems (WO 99/40934) are also suitable for many uses. Another exemplary carrier / release system employs carriers comprising particulate protein complexes (U.S. Patent No. 5,928,647) that are capable of introducing responses to a class of Ί-restricted cytotoxic T lymphocyte in a host.

Often, the pharmaceutical compositions of the invention further comprise one or more buffers (e.g., neutral buffered saline or phosphate buffered saline), carbohydrates (e.g., glucose, mannose, sucrose or dextrans), mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, bactoerostatic agents chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), solutes that impart isotonicity, hypotonicity or mild hypertonicity to the blood or to the recipient, suspending agents, thickeners and / or preservatives. The compositions of the invention may also be formulated as lyophilisates.

li 5

The pharmaceutical compositions of the invention may be in the form of a single dose or multiple dose containers, such as sealed ampoules or vials. Such containers are generally sealed to maintain sterility and stability of the composition until use. The compositions of the invention may be stored as suspensions, solutions or emulsions in oily or aqueous carriers. Alternatively, the pharmaceutical compositions may be stored in a freeze-dried state and require the mere addition of a sterile liquid carrier immediately prior to use.

Suitable dosage forms for the treatment regimen of the invention include, for example, oral, parenteral, intravenous, intranasal, and intraluscular formulations as will be known in the art and will now be briefly described.

For certain uses, the pharmaceutical compositions of the invention are administered orally to animals. Such compositions may be formulated with an inert diluent or an assimilable edible carrier, or may be enclosed in hard or soft gelatin capsules, or compressed into tablets, or incorporated directly into food or feed.

The active compounds may be incorporated with excipients and used in the form of, for example, tablets, buccal tablets, lozenges, capsules, lotions, suspensions, syrups, waffles (e.g. Mathiowitz et al., Nature 386 (6623), pp. 410-414, March 27) Hwang et al., Crit. Rev. Ther. Drug Carrier Syst. 15 (3), pp. 243-284, 1998; U.S. Pat.

580579; US 5,792,451). For example, lozenge tablets, pills and «

the capsules may also contain a wide variety of additional ingredients such as a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; disintegrating agents such as corn starch, potato starch, alginic acid; lubricants such as magnesium stearate; sweetening agents such as sucrose, lactose or saccharin; and seasonings

-i WWW! »·! ¹ »

-; 1, agents such as peppermint, oil of oil or glaze. When the unit dosage form is a capsule, it may contain, in addition to the above ingredients, a liquid carrier. Various other substances may be included as a coating or may otherwise modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac and / or sugar. Any materials for preparing any dosage form should be pharmaceutically pure and substantially non-toxic in the amount used. The active ingredients may be incorporated into sustained release formulations and formulations.

As a rule, the pharmaceutical compositions contain at least 0.1% of active ingredient, of which the active ingredient content may, of course, vary and is usually about 1 or 2% to 60 to 70% or more, percentages by weight or by volume based on the pharmaceutical composition. whole. The amount of active ingredient in any therapeutically useful composition is adjusted to a suitable dosage to provide any desired unit dosage. Factors such as solubility, bioavailability, half-life, route of administration, and other pharmacological considerations are considered by those skilled in the art for the manufacture of pharmaceutical compositions suitable for the purpose1.

For oral administration, the compositions of the invention may be formulated with at least one excipient in the form of a mouthwash, dentifrice, buccal tablet, oral spray, or sublingual orally administered composition. Alternatively, the active ingredient may be incorporated into oral solutions containing, for example, sodium borate, glycein potassium bicarbonate, or the active ingredient may be dispersed in a toothpaste, or a therapeutically effective amount may be added to compositions containing water, binders, abrasives, flavoring agents, foaming agents and humectants. Alternatively, the compositions may be formulated as tablets or solutions which may be placed under the tongue or otherwise dissolved in the mouth.

It may also be desirable to administer the pharmaceutical composition of the invention parenterally, intravenously, intramuscularly or even intraperitoneally. Such an approach is known to those skilled in the art, and suitable forms are described in the literature (for example, U.S. Pat. Solutions of the active ingredient in free base or pharmaceutically acceptable salt form can be prepared in water suitably in the presence of a surfactant such as hydroxypropyl cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under normal conditions of storage and use, such pharmaceutical compositions also generally contain a preservative to prevent the growth of microorganisms.

Exemplary pharmaceutical compositions for injection are aqueous sterile solutions or dispersions and sterile powders for the preparation of on-site sterile solutions or dispersions (for example, U.S. Patent No. 5,464,668). In all cases, the pharmaceutical form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersant, for example water, ethanol, polyol (for example glycerol, propylene glycol and liquid polyethylene glycols), suitable mixtures thereof, and / or vegetable oils. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, by the maintenance of the desired particle size in the case of dispersions, or by the use of surfactants. Prevention of the action of microorganisms can be facilitated by the use of various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid and thimerosal. In many cases, it is preferable to include isotonic agents, for example sugars or sodium chloride. Prolonged absorption of the injectable preparation can be brought about by the use of delaying absorption agents, such as aluminum monostearate and gelatin.

For parenteral administration in aqueous solution, the solution may optionally be suitably buffered and the liquid diluent first rendered isotonic by adding sufficient brine or glucose. These particularly suitable aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. The sterile aqueous medium that can be used is known to those skilled in the art. For example, the dose may be dissolved in 1 ml of isotonic sodium chloride solution and either added to 10000 ml of hypodermoclysic liquid or injected at the proposed infusion site (For example, Remington's Pharmaceutical Science, 15th Edition, pp. 1035-1038 and 1570-1580). The dosage form is naturally adapted to the condition of the individual being treated. For administration to humans, the composition must meet the requirements of sterility, pyrogenicity and, in general, safety and purity according to FDA standards of the Office of Biologics.

The compositions may be formulated using the active ingredient in neural or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) of inorganic acids such as hydrochloric and phosphoric acids, or organic acids such as acetic, oxalic, tartaric and mandelic acids. Salts formed with a free hydroxyl group may be derived from inorganic bases such as sodium, potassium, ammonium, calcium or ferric hydroxides or from organic bases such as isopropylamine, trimethylamine, histidine and procaine. After formulation, the solutions are administered in a manner appropriate to the dosage form in a therapeutically effective amount.

The carriers may further comprise, for example, any solvent, dispersant, carrier, coatings, diluents, antibacterial and antifungal agents, isotonic agents, absorption enhancers, buffers, carrier solutions, suspensions, and colloids. The use of such media and agents for pharmaceutically active agents is well known in the art. The media and reagents must be compatible with the active ingredient. Additional therapeutically active agents may also be incorporated into the pharmaceutical compositions. As used herein, the term "pharmaceutically acceptable" refers to molecular units and compositions that do not cause an allergic or similar adverse reaction when administered to humans.

The pharmaceutical compositions may also take the form of nasal sprays, inhalation or aerosol formulations. Methods of delivering media introducing genes, nucleic acids, and peptides directly into the lungs via nasal aerosol sprays are described in the literature (for example, US Patent Nos. 5,756,353; and 5,804,212). Similarly, drug delivery using intranasal microparticle resins is well known in the pharmaceutical art (Takenaga et al., J. Controlled Release 52 (1-2), pp. 81-87, March 2, 1998) and lysophosphatidylglycerol compounds (U.S. Pat. US 5,725,871). Similarly, the administration of transmucosal drugs in the form of a polytetrafluoroethylene carrier matrix is described (U.S. Pat. No. 5,780,445).

The compositions and uses of liposomes and liposome formulations as possible drug carriers are generally known to those skilled in the art (for example, Lasic, Trends Biotechnol. 16 (7), pp. 307-321, July 1998; Takakura, Nippon Rinsho 56 (3), p. 691). up to 695,

Indian J. Exp. Biol. 53 (8), Margalit, Crit. Roar. Ther. Drug March 1998; Chandran et al. 801-809, August 1997;

Carrier Syst. 12 (2-3), pp. 233-261, 1995; No. 5,574,445; US 5,552,157; 5,738,868; US 5,579,597).

US Pat. No. 5,556,513; US r-120

Λ, 3 »ηΰί '» .- »i W

Liposomes have been successfully used with numerous cell types that are normally difficult to transfect by other means including T cell suspensions, primary hepatocyte cultures and PC 12 cells (Renneisen et al., J. Biol. Chem. 265 (27), pp. 16337-16342). , September 25, 1990; Muller et al., DNA Cell Biol. 9 (3), pp. 221-229 (April 1990). In addition, the liposomes are free of DNA length limiters, which are generally viral-based release systems. Liposomes are effectively used to introduce, for example, genes, various drugs, radiotherapeutic agents, enzymes, viruses, and allosteric effector transcription factors into a variety of cell line cultures and animals. In addition, the use of liposomes is not associated with an autoimmune response or unacceptable toxicity following systemic release.

Liposomes can be formed from phospholipids that disperse in an aqueous environment and spontaneously form multi-amellar concentric bilayer vesicles (also referred to as multilamellar vesicles, MLVs).

The invention also relates to pharmaceutically acceptable nanocapsules. Nanocapsules can generally deliver the compounds in a stable and reproducible manner (for example, Quintanar-Guerrero et al., Drug Dev. Ind. Pharm. 24 (12), pp. 1113-1128, December 1998). To prevent local action of intracellular polymeric overload, such ultrafine particles (approximately 0.1 μη size) can be constructed using in vivo degradable polymers. Such particles can be produced by methods described in the literature (for example, Couvreur et al., Crit. Rev. Ther. Drug Carrier Syst. 5 (1), pp. 1-20).

Eur. J. Pharm. Biopharm. 45 (2), p.

J. Controlled Release and US Patent

1988; zur Muhlen et al.,

149-155, March 1998; Zambaux et al., 50 (1-3), pp. 31-40, January 2, 1998; file number 5 145687),

Methods of cancer therapy

The invention also relates to the above-described therapeutic agents which can be used for the treatment of cancer, particularly for the immunotherapy of prostate cancer. The pharmaceutical compositions of the invention are administered to patients, generally warm-blooded patients, and especially humans. The patient may or may not be infected with cancer. The pharmaceutical compositions of the invention may be used to prevent the development of cancer or to treat a patient infected with a cancer. The pharmaceutical compositions and vaccines may be administered before or after surgical removal of primary tumors and / or after treatment with radiotherapy or conventional chemotherapeutic drugs. The pharmaceutical compositions may be administered in any conventional manner: for example, by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, intradermal, anal, suppository, topical and oral administration.

In certain instances, the immunotherapy may be an active immunotherapy wherein the treatment is based on in vivo stimulation of the endogenous host immune system to respond to a tumor by administering an immune response modifying agent (such as polypeptides and polynucleotides of the invention).

In another embodiment, the immunotherapy may be a passive immunotherapy in which the treatment involves the release of an agent with immune responsiveness to the tumor (e.g., effector cells or antibodies) so that the anti-tumor effect can be directly or indirectly mediated and treatment is not necessarily dependent on the intact host immune system. Examples of effector cells include the above-described T cells, T cells (e.g., CD8 + cytotoxic T cells and CD4 ⁺ T helper-infiltrating lymphocytes), killer cells (e.g., Natural Killer cells and lymphokine activated killer cells), B cells and antigen-providing cells. cells (e.g., < 122, expressing the dendritic cell treasure polypeptide and macrophages) of the invention. T cell receptors and anti-substance receptors specific for the polypeptides of the invention can be cloned, expressed and transferred to other vectors or effector cells for adoptive immunotherapy. The polypeptides of the invention can also be used to generate antibodies or anti-idiotypic antibodies (U.S. Patent No. 4,918,164) for passive immunotherapy.

Generally, effector cells can be obtained in sufficient amounts for adoptive immunotherapy by in vitro growth as described herein. Culture conditions for expanding a single antigen-specific effector cell to several trillions with in vivo antigen recognition retention are well known in the art. Such in vitro culture conditions generally use intermittent stimulation with antigen, often in the presence of cytokines (such as IL-2) and a non-dividing cell delivery. As noted above, the immunoreactive polypeptides of the invention can be used to rapidly expand antigen-specific T cell cultures to generate a sufficient number of cells for immunotherapy. In particular, antigen-providing cells, for example, dental, macrophages, monocytes, fibroblasts and / or B cells, may be pulsed with immunoreactive polypeptides or transfected with one or more polynucleotides using conventional methods known in the art. For example, antigen-providing cells can be transfected with a polynucleotide having a promoter suitable for increasing expression in a recombinant virus or other expression system. Cultured effector cells for use in therapy must be capable of growth and broad distribution and long-term survival in vivo. Studies have shown that cultured effector cells can be induced to grow in vivo and to survive for substantial periods of time in substantial amounts by repeated stimulation with antigen supplemented with IL-2 (for example, Cheever et al., Immunological Reviews 157, 177, 1997).

Alternatively, the vector expressing the polypeptide of the invention can be introduced into antigen-delivering cells taken from a patient and clonally propagated ex vivo for retransmission to the same patient. The transfected cells may be reintroduced into the patient using means known in the art, preferably in sterile form, by intravenous, intracavitary, intraperitoneal or intranadoral administration.

The routes and frequency of administration of the therapeutic compositions of the invention as well as the dosage administered vary from individual to individual and can be readily determined by methods known in the art. Generally, the pharmaceutical compositions and vaccines are administered by injection (e.g., intracutaneously, intramuscularly, intravenously or subcutaneously), intranasally (e.g., by inhalation), or orally. Preferably, 1 to 10 doses are administered over 52 weeks. Preferably, six doses are administered at one-month intervals followed by periodic booster vaccination. Alternative protocols may be appropriate for individual patients. A suitable dose is the amount of the compound which, when administered as described above, is capable of enhancing the anti-tumor immune response and is at least 10 to 50% above the basal (i.e., untreated) level. Such response can be monitored by measuring anti-tumor antibodies in a patient or vaccine-dependent generation of cytolytic effector cells capable of killing the patient's tumor cells in vitro. Such vaccines should also be capable of eliciting an immune response that results in an improved clinical outcome (e.g., more frequent remission, complete or partial or longer disease-free survival) in vaccinated patients as compared to unvaccinated patients. Generally, the pharmaceutical compositions and vaccines comprise one or more polypeptides, wherein the amount of polypeptide contained in the dose is about 25 ng to 5 mg per kg of patient. A suitable dose varies with the weight of the patient, but is typically about 0.1 ml to about 5 ml.

Generally, a suitable dose and treatment regimen will provide effective

The substance or active substance in sufficient quantity to achieve a therapeutic and / or therapeutic agent. prophylactic benefit. Treatment response can be monitored by determining an improved clinical condition (e.g., more frequent remission, complete or partial or longer disease-free survival) in treated patients compared to untreated patients. The enhancement of an already existing immune response to a tumor protein is generally related to an improved clinical condition. Such an immune response can generally be evaluated using standard proliferation, cytotoxicity or cytokine assays, which can be performed using samples obtained from the patient before and after treatment.

Cancer detection and diagnostic tools, methods and kits

Generally, cancer can be detected in a patient by the presence of one or more prostate tumor proteins and / or polynucleotides encoding such proteins in a biological sample (such as blood, serum, sputum, urine and / or tumor biopsy) obtained from the patient. Alternatively, such proteins may be used as markers to indicate the existence or absence of cancer, for example, prostate cancer. In addition, such proteins may be useful for detecting other tumors. The binding agents of the invention allow the detection of the amount of antigen that binds to the agent in a biological sample. Polynucleotide primers and probes can be used to detect the amount of mRNA encoding a tumor protein, which is also indicative of the existence or absence of cancer. Generally, the prostate tumor sequence is to be contained in an amount at least three times higher in the tumor tissue than in normal tissue.

A variety of assay formats are known to those skilled in the art for the use of binding agents to detect polypeptide markers in a sample (for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988). Generally, the existence or absence of cancer can be determined by (a) uve 125 'by contacting a biological sample of a patient with a binding agent, (b) detecting in a sample the content of the polypeptide that binds to the binding agent and (c) comparing the content of the polypeptide with a predetermined value.

According to a preferred embodiment, the assay comprises the use of a binding agent immobilized on a solid support to bind and remove the polypeptide from the sample. The bound polypeptide can then be determined by a detection reagent that contains a reporter group and specifically binds to a binding agent / polypeptide complex. Such detection reagents may, for example, include a binding agent that specifically binds to the polypeptide or antibody or other agent that specifically binds to a binding agent such as anti-immunoglobulin, protein G, protein A or lectin. Alternatively, a competitive assay may be used in which the polypeptide is labeled with a reporter group and allows binding to the immobilized binding agent upon incubation of the binding agent with the sample. The extent to which the sample components inhibit the binding of the labeled polypeptide to the binding agent is indicative of the reactivity of the sample with the immobilized binding agent. Suitable polypeptides for use in such assays include the full length prostate tumor proteins and the respective polypeptide portions to which the binding agent binds, as described above.

The solid carrier can be any material known to those skilled in the art to which the tumor protein can bind. For example, the solid support may be a test well in a microbitration plate or nitrocellulose or other suitable membrane. The carrier may be a bead or disc, for example of glass, fiber glass, latex or a plastic material such as polystyrene or polyvinyl chloride. The carrier can also be a magnetic particle or a fiber optic sensor known from the literature (for example, U.S. Pat. No. 5,359,681). The binding agent may be immobilized on a solid support in a variety of ways known to those skilled in the art and adequately described

126; In patent and scientific literature. The term immobilization here always denotes both non-covalent binding and adsorption and covalent attachment (which may be a direct bond between the agent and the functional groups on the carrier or it may be a crosslinking agent). Immobilization by adsorption to a well in a microtiter plate or membrane is preferred. In such cases, adsorption may be achieved by contacting the binding agent in a suitable buffer with a solid carrier for a suitable time. Contact time varies with temperature, but is usually about one hour to one day. Generally, contacting a well of a plastic microtiter plate (e.g., polystyrene or polyvinyl chloride) with an amount of binding agent of about 10 ng to about 10 ng and preferably about 100 ng to 1 µg is sufficient to immobilize an adequate amount of binding agent.

Covalent coupling of a binding agent to a solid support can generally be achieved by first reacting the support with a bifunctional reagent that reacts with both the support and a functional group such as a hydroxyl group or an amino group of the binding agent. For example, the binding agent may be covalently coupled to carriers having a suitable polymeric coating using benzoquinone or by condensing the aldehyde group of the carrier with an amine and active hydrogen of the binding agent (e.g., Pierce Immunotechnology Catalog and Handbook, 1991, pp. A12-A13).

In certain embodiments, the assay is a two-piece sandwich assay. This assay is performed by first contacting the antibody, which is immobilized on a solid support, typically in a well of a microtiter plate, with the sample so that the polypeptides in the sample can bind to the immobilized antibody. The unbound sample is then removed from the immobilized polypeptide-to-substance complexes and a detection reagent (preferably a second antibody capable of binding to different sides of the polypeptide) is added to contact the reporter group. The amount of detection reagent remaining on the solid support is then determined using appropriate methods for a specific reporter group.

Once the antibody is mobilized on the carrier, as noted above, the remaining protein binding sites on the carrier are typically blocked. Any blocking agent known to those skilled in the art, such as bovine serum albumin or Tveen 20 ™ (Sigma Chemical Co., St. Louis, M0), may be used. The immobilized antibody is incubated with the sample and the polypeptide allowed to bind with the antibody. The sample is diluted with a suitable diluent, such as phosphate buffered saline (PBS) prior to incubation. A suitable contact time (i.e., incubation period) is a period of time sufficient to detect the presence of the polypeptide in a sample obtained from an individual with prostate cancer. Preferably, the contact time is sufficient to achieve a degree of binding that is at least 95% of the binding achieved in equilibrium between the bound and unbound polypeptides. It is clear to those skilled in the art that it is easy to determine the time required to reach equilibrium by determining the degree of binding that occurs over time. At room temperature, an incubation time of about 30 minutes is generally sufficient.

Unbound sample can then be removed by washing the solid support with a suitable buffer, such as PBS containing 0.1% Tween 20 ™. The second antibody, which contains a reporter group, can be added to a solid support. The above-mentioned reporter groups are preferred.

The detection reagent is then incubated for a sufficient time to detect the bound polypeptide. The appropriate time can generally be determined by testing the degree of binding that occurs over time. The unbound detection reagent is then removed and the bound detection reagent is determined using a reporter group. The method used to detect a reporter group depends on the nature of the reporter group. In the case of radioactive groups, scintillation counting or autoradiographic methods are generally suitable.

Spectroscopic methods can be used to detect dyes,

128: z, z) 5 i luminescent groups and fluorescent groups. Biotin can be determined using avidin coupled to various reporter groups (usually radioactive or fluorescent groups or enzyme). Enzyme reporter groups can generally be detected by adding a substrate (generally for a specific period of time), followed by a spectroscopic or other analytical method of the reaction products.

To determine the existence or absence of a cancer, such as prostate cancer, the signal detected from a reporter group that remains bound to a solid support is generally compared to a signal that corresponds to a predetermined value. According to a preferred embodiment, the predetermined value for detecting cancer is the average mean signal obtained when the imminobilized antibody is incubated with samples of patients without cancer. Generally, a signal-generating sample that represents three standard deviations above a predetermined value is considered positive for cancer. According to another preferred embodiment, the predetermined value is determined using a Receiver Operator Curve as described by Sackett et al., (Clinical Epidemiology &amp; Basis Science for Clinical Medicine, Little Brown and Co., pp. 106-107, 1985). According to such an embodiment, the predetermined value may be determined by plotting pairs of truly positive doses (i.e., sensitivity) and false positive doses (100% specificity) that correspond to each possible value for the diagnostic test result. The plot value closest to the upper left corner (that is, the value that includes the largest area) is the most accurate value, and a sample generating a signal that is higher than the value determined in this way can be considered positive for cancer.

According to a similar embodiment, the assay is performed by a flow or strip test format, wherein the binding agent is immobilized on a membrane, for example a nitrocellulose membrane.

«Μβ ^ ίΑ» »»! - ** - # A, 129, -

In a flow-through assay, polypeptides in a sample bind to the mobilized binding agent as the sample crosses the membrane. The second, labeled binding agent then binds to the binding agent-polypeptide complex when the solution containing the second binding agent flows through the membrane. Detection of binding of the second binding agent can be performed as described above. In the strip test format, one end of the membrane to which the binding agent is bound is immersed in a solution containing the sample. The sample migrates across the membrane across the region containing the second binding agent and the area of the immobilized binding agent. The concentration of the second binding agent on the area of the immobilized antibody indicates the presence of cancer. Typically, the concentration of the second binding agent at that point forms a pattern, for example, a line that is easily visible. The absence of such a pattern indicates a negative result. Generally, the amount of binding agent immobilized on the membrane is selected to generate a visually recognizable pattern when the biological sample contains an amount of polypeptides sufficient to generate a positive signal in a two-fold sandwich assay, in the above format. Preferred binding agents for use in such assays are antibodies and antibody binding fragments thereof. Preferably, the amount of immobilized antibodies on the membrane is about 25 ng to 1 µg, and more preferably about 50 ng to about 500 ng. Such tests are generally performed with a very small amount of biological sample.

However, there are numerous other protocols that are suitable for use with the tumor proteins or binding agents of the invention. Thus, the above description is merely illustrative. For example, those skilled in the art will recognize that the above protocols can readily be varied to use tumor polypeptides to detect antibodies that bind to such polypeptides in a biological sample. Detection of such tumor protein-specific antibodies may be related to the existence of cancer.

1301 _;

Cancer can also or alternatively be detected by the presence of T cells that specifically react with the tumor protein in the biological sample. In certain methods, a biological sample comprising CD4 + and / or CD8 ⁺ cells isolated from a patient is incubated with a tumor polypeptide, a polynucleotide encoding such a polypeptide, and / or an APC that expresses at least one immunogenic portion of such polypeptides, and absence of specific T cell activation. Suitable biological samples include, but are not limited to, isolated T cells. For example, T cells can be isolated from a patient by a routine technique (for example, Ficol1 / Hypague by centrifugation of peripheral blood lymphocytes according to density gradients). T cells can be incubated in vitro for two to nine days (typically four days) at 37 ° C with the polypeptide (for example, 5 to 25 µg / ml). It may be desirable to incubate another portion of the sample's T cells in the absence of tumor polypeptides as a control. For CD4 ⁺ cells, activation is preferably determined by assessing T cell proliferation. For CD8 ⁺ T cells, activation is preferably determined by assessing cytolytic activity. The proliferation value at least double and / or the value of cytolytic activity is at least 20% greater than in patients without disease indicates the existence of cancer of the patients.

As mentioned above, cancer can also or alternatively be detected based on the level of mRNA encoding a tumor protein in a biological sample. For example, at least two oligonucleotide primers may be used in a polymerase chain reaction (PCR) based on an enhancement assay of a portion of tumor cDNA released from a biological sample, wherein at least one polynucleotide primer is specific for (that is, hybridizes to) a polynucleotide encoding a tumor protein. The amplified cDNA is then separated and detected using methods known in the art, such as gel electrophoresis. Similarly, oligonucleotide probes that specifically hybridize to a polynucleotide encoding a tumor protein can be used in hybridization assays to detect the presence of a tumor protein. The polynucleotide encoding the sample.

To allow tumor protein hybridization in a biological under assay conditions, the oligonucleotide primers and probes should comprise an oligonucleotide sequence having at least about 60%, preferably at least about 75%, and even more preferably at least about 90% identity to the portion of the polypeptide encoding the tumor protein of the invention. is at least 10 nucleotides and preferably at least 20 nucleotides in length. Preferably, the oligonucleotide primers and / or probes hybridize to polynucleotides encoding the polypeptide of the invention under moderately stringent conditions as defined above. The oligonucleotide primers and / or probes that may be usefully used in the diagnostics described herein have at least 10 to 40 nucleotides in length. According to a preferred embodiment, the oligonucleotide primers comprise at least 10 contiguous nucleotides, more preferably at least 15 contiguous nucleotides of a DNA molecule having the sequence of the invention. Methods for both PCR-based assays and hybridization assays are well known in the art (e.g., Mul lis et al., Cold Spring Harbor Symp. Quant. Biol., 51, p. 263, 1987; Ehrlich ed. PCR Technology, Stockton Press, NY 1989).

A preferred assay uses RT-PCR, wherein PCR is used in conjunction with reverse transcription. Typically, RNA is extracted from a biological sample, such as biopsy tissue, and is reverse transcribed to produce DNA molecules. PCR amplification using at least one specific primer generates a cDNA molecule that can be separated and visualized using, for example, gel electrophoresis. The amplification may be performed on biological samples taken from a test subject and a subject not infected with cancer. The booster reaction can be performed on several dilutions of the cDNA in a two order magnification range. A two-fold or greater increase in expression in several dilutions of a test patient sample compared to the same dilution of an individual without cancer is generally considered positive.

- ¹³² ,)>

In another embodiment, the compositions of the invention may be used as markers for the progression of cancer. According to such an embodiment, the assays described above for cancer diagnosis can be performed over time and changes in the level of the reactive polypeptide or polypeptides or polynucleotide or polynucleotides are evaluated. For example, the tests may be performed every 24 to 72 hours for six months to one year and optionally longer. In general, cancer progresses in patients in whom the observed level of polypeptide or polynucleotide increases over time. In contrast, cancer does not continue if the level of the polypeptide or polynucleotide is constant or decreases over time.

Certain in vivo assays may be performed directly on the tumor. One such assay involves contacting the tumor cells with a binding agent. Binding agent binding can be detected directly or indirectly via a reporter group. Such a binding agent may also be used in histological applications, or polynucleotide probes may be used in such applications.

As noted above, numerous markers may be used in the assay to improve the sensitivity of a given sample. It is also clear that binding agents specific for different proteins can be combined in individual assays. Numerous primers or probes may be used concurrently. Selection of tumor protein markers may be based on routine attempts to determine combinations that result in optimal sensitivity. In addition or alternatively, the above tumor protein assays may be combined with assays for other known tumor antigens.

The invention also relates to kits for use in any diagnostic method. Such kits typically comprise two or more components required to perform a diagnostic test. The components may be compounds, reagents, coatings and / or shine. .. - „—-« W, ^ ·?; - '·? * ^ - «.SíWrtt.-tóW' * '·' ^M ''>>» t; -; i '?? (i) marriage. For example, the envelope in the kit may comprise a monoclonal antibody or fragment thereof that specifically binds to a tumor protein. Such antibodies or fragments thereof may be bound to the support material described above. One or more additional containers may contain elements such as reagents or buffers used in the assay. Such kits may also or alternatively comprise a detection reagent as described above that contains a reporter group suitable for direct or indirect detection of antibody binding.

Alternatively, the kit may be designed to detect the level of mRNA encoding a tumor protein in a biological sample. Such kits generally comprise at least one oligonucleotide probe or primer described above that hybridizes to a polynucleotide encoding a tumor protein. Such an oligonucleotide can be used, for example, with PCR or with a hybridization assay. Such a kit may include additional components including a second oligonucleotide and / or a diagnostic reagent or envelope to facilitate detection of the polynucleotide encoding the tumor protein.

The invention is illustrated by the following examples.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Isolation and characterization of prostate-specific polypeptides

This example describes the isolation of some prostate-specific polypeptides from a prostate tumor cDNA library.

The human prostate tumor cDNA expression library is constructed from A ⁺ RNA prostate tumor poles using the Su ~ perscript Plasmid System for cDNA Synthesis and the Plasmid Kit.

1Š’4

1))

Cloning kit (BRL Life Technologies, Gaithersburg, MD 20897) according to the manufacturer's protocol. Prostate tumor tissues are homogenized using polytron (Kinematica, Switzerland) and total RNA is extracted using Trizol reagent (BRL Life Technologies) according to the manufacturer's guidelines. The A ⁺ RNA poles were purified using a Qiagen oligotex spin column mRNA purification kit (Qiagen Santa Clarita, CA 91355) according to the manufacturer's protocol. The first strand cDNA was synthesized using the Not I / 01igo-dT18 primer. Double stranded cDNA is synthesized, ligated with EcoRI / BAXI adapters (Invitrogen, San Diego, California) and digested with NotI. After fractionation on a Chromá Spin-100O column (Clontech, Palo AI's, CA), cDNA was ligated to the EcoRI / NotI site of pCDNA3.1 (Invitrogen) and transformed into ElectroMax E.coli DH10B cells (BRL Life Technologies) by electroporation.

In the same way, a normal human pancreatic cDNA expression library was prepared from a set of six tissue samples (Clontech). The cDNA libraries are characterized by determining the number of independent colonies, the percentage of clones that the carrier inserts, the average insert size, and sequence analysis. The prostate tumor library contains 1.64 x 10 ⁷ independent colonies with 70% of the clones having the insert and an average insert size of 1745 base pairs. The normal pancreatic cDNA library contains 3.3 x 10 ⁶ independent colonies, with 69% of the clones having inserts and an average insert size of 1120 base pairs. For both libraries, sequence analysis showed that most clones have full-length cDNA sequences and are synthesized from mRNA with minimal rRNA and mitochondrial DNA contamination.

CDNA library subtraction was performed using the above prostate tumor cDNA library and the normal pancreas cDNA library as described by Hara et al.

199, 1994) with several modifications, a prostate tumor-specific cDNA library as follows: a normal pancreatic cDNA library (70 µg) is digested with Eco (Blood 84, pp. 189 to &lt; > &gt;

Her) _(k * '»»..,''>

RI, NotI, and Sful, followed by a loading reaction with the Klenow fragment of DNA polymerase. After phenol / chloroform extraction and ethanol precipitation, the DNA is dissolved in 100 µl of water, denatured by heat, and mixed with 100 µΐ (100 µg) of biotin photosondy (Vector Laboratories, Burlingame, CA). As recommended by the manufacturer, the resulting mixture is placed on a 270 W sunlight for 20 minutes on ice. Additional biotin photosensor (50 µL) was added and the biotinylation reaction repeated. After 5 times repeated extraction with butanol, the DNA precipitates out of ethanol and dissolved in 23 μΐ of water to obtain the driver DNA.

To generate indicator tracer DNA, a 10 µg prostate tumor cDNA library was digested with Banhl and XhoI, extracted with chloroform and passed through a Croma spin-400 column (Clontech). After ethanol precipitation, the indicator DNA is dissolved in 5 μΐ of water. The indicator DNA is mixed with 15 μΐ of control DNA and 20 μΐ of 2x hybridization buffer (1.5M NaCl / 10mM EDTA / 50mM HEPES pH 7.5 / 0.2% sodium dodecyl sulphate), covered with mineral oil and completely o

is denatured by heat. The sample is immediately transferred to a 68 C warm water bath and incubated for 20 hours (long hybridization [LH]). The reaction mixture was subjected to streptavidin treatment followed by phenol / chloroform extraction. This procedure is repeated three times. The extracted DNA was precipitated, dissolved in 12 ml of water, mixed with 8 µl of control DNA and 20 µl of 2x hybridization buffer and subjected to hybridization at 68 ° C for two hours (brief hybridization [SH3]). After removal of the biotinylated double stranded DNA, the subtracted DNA is ligated into the BamHI / XhoI site of chloramphenicol resistant pBCSK ⁺ (Stratagene, La Jolla, CA 92037) and transformed into ElectroMax E.coli DH10B cells by electroporation to generate a specifically subtracted prostate tumor prostate cDNA library (called 1 ")).

For analysis of the subtracted cDNA library, plasmid DNA was prepared from 100 independent clones, randomly selected from the subtracted prostate tumor library, and grouped according to insert size. Appropriate cDNA clones are further characterized by DNA sequencing using a Perkin Elmer / Applied Biosystems Division Automated Sequencer Model 373A (Foster City, CA). There appear to be an abundance of six cDNA clones designated Fl-13, Fl-12, Fl-16, HI-1, HI-9 and HI-4 in the prostate tumor-specific cDNA library. The determined sequences of 3 and 5 cDNAs for Fl-12 are in SEQ ID NOs: 2 and 3 with the determined sequences of 3 cDNAs for Fl-13, Fl-16, H1-1, H1-9 and H1-4 in SEQ ID NO: 1 and 4 to 7.

The cDNA sequences for the isolated clones were compared to known sequences in the gene bank using the EMBL and GenBank databases (edition 96). Four prostate tumor cDNA clones F1-13, F1-16, HI-1, HI-4 were found to encode the following previously identified proteins: prostate specific antigen (PSA), human glandular kallikrein, a gene promoting human tumor expression, and C-oxidase mitochondrial cytochrome II subunit. H1-9 was found to be identical to the previously identified human autonomously replicating sequence. No significant homologies to the Fl-12 cDNA sequence were found.

Subsequent studies led to the isolation of the full-length cDNA sequence for Fl-12 (also called P5Q4S). This sequence is in SEQ ID NO 107, the corresponding predicted amino acid sequence being in SEQ ID NO: 108. P504S splice variants are provided in SEQ ID NOs: 600 to 605.

To clone less abundant prostate tumor-specific genes, subtraction of the above-described cDNA library is performed with the normal pancreas cDNA library and the three most abundant genes in the first subtracted tumor-specific cDNA library.

in.

prostate: human glandular kallikrein, prostate specific antigen (PSA) and mitochondrial cytochrome C-oxidase subunit II. In particular, 1 µg of human gladulous kallikrein, PSA and mitochondrial cytochrome are added to the control CDA.

The C-oxidase II cDNA subunit II of pCDNA3.1 and subtraction were performed as described above to obtain a second subtracted cDNA library, hereinafter called subtracted prostate tumor specific cDNA library with spike.

22 cDNA clones were isolated from the subtracted cDNA library specific for the tip prostate. Identified cDNA sequences 3 and 5 for clones JI-17, L1-12, N1-1862, J1-13, J1-19,

J1-25, J1-24, Kl-58, Kl-63, L1-4 and L1-14 are in SEQ ID NOS8-9, 10-11, 12-13, 14-15, 16-17, 18-19. , 20-21, 22-23,

26-27 and 28-29. Determined 3 cDNA sequences for clones designated as J1-12, J1-16, J1-21, Kl-48, Kl-55, L1-2, L1-6, N1-1858,

NI-1860, NI-1861, NI-1864 are in SEQ ID NOS: 30-40. The above-described alignment of these sequences with those in the gene bank shows no significant homologies with three to five abundant DNA species (J1-17, L1-12, and N1-1862; SEQ ID NOS: 8-9, 10-11 and

12-13). Of the remaining two most abundant species, one (J1-12, SEQ ID NO: 30) was found to be identical to the previously defined protein associated with human pulmonary surfactant and the other (K1-48, SEQ ID NO: 33) has some homology to R norvegicus mRNA for 2-arylpropiony1-CoA epimerase. Of the seventeen less abundant cDNA clones isolated from the subtracted tip prostate tumor cDNA library, four were found (J1-16, Kl-55, LI-6 and NI-1864; SEQ ID NOS: 31, 34, 36 and 40) are identical to previously identified sequences, two showing some homology to human sequences (J1-21 and NI-1860; SEQ ID NOs: 32 and 38), and two were found to have some homology to inhuman coverts and two (L1). -2 and NI-1861; SEQ ID NOS: 35 and 39) show some homology to known human sequences. No significant homologies to the polypeptides J1-13, J1-19, J1-24, J1-25, K1-58, K1-63, L1-4, L1-14 were found (SEQ ID NOS: 14-15, 16-17 20-21, 18-19, 22-23, 24-25, 26-27

28-29), ', 1,33 »11

Subsequent studies led to the isolation of full-length cDNA sequences for J1-17, J1-12 and N1-1862; (SEQ ID NOS: 109-111). The corresponding predicted amino acid sequences are in SEQ ID NOS: 112-114. L1-12 is also referred to as P501S. The cleaved variant of the P501S cDNA is provided in SEQ ID NO: 606.

In another experiment, four additional clones were identified by subtracting a prostate tumor cDNA library with a normal prostate cDNA prepared from a set of three poles of normal prostate A + RNA (called prostate subtraction 2 '). The determined cDNA sequences for these clones, hereinafter referred to as U1-3064, III-3065, VI-3692 and 1Ά-3905, are in SEQ ID NOS: 69-72. Comparison of the determined sequences with those in the gene bank does not reveal any significant homologies to U1-3065.

The second peak subtraction (called prostate subtraction spike 2 ") is performed by subtracting a prostate tumor specific cDNA library with a normal pancreas cDNA library and further escalated with PSA, JI-17, a surfactant-associated lung protein, mitochondrial DNA, cytochrome c oxidase subunit II, N1-1862, an autonome replication sequence, L1-12, and a gene facilitating expression of tumor. Four additional clones, hereinafter VI-3686, R1-2330, 1B-3976 and VI-3679, were isolated. The determined cDNA sequences for these clones are in SEQ ID NOS: 73-76. Comparison of these sequences with those in the gene bank does not reveal any significant homologies to VI-3686 and R1-2330.

Further analysis of the three prostate subtractions described above (prostate subtractions 2, a prostate tumor tip-specific cDNA library, and prostate subtraction tips 2) resulted in the identification of sixteen additional clones, designated 1G-4736, 1G-4738, 1G-4741, 1G-4744 1G-4734, 1H-4774, 1H-4781, 1H-4785, 1H-4787, 1H-4796, 11-4810, 11-4811, 1J-4876, 1K-4884 and 1K-4896. Determined cDNA sequences for these &quot; V &apos;

the clones are in SEQ ID NOS: 77-92. 2 alignments of these sequences to those in the gene bank show no significant homologies to 1G-4741, 1G-4734, 11-4807, 1J-4876 and 1K-4896 (SEQ ID NOS: 79 , 81, 87, 90, and 92). Further analysis of isolated clones leads to the determination of extended cDNA sequences for 1G-4736, 1G-4738, 1G-4741, 1G-4744, 1H-4774, 1H-4781, 1H-4785, 1H-4787, 1H-4796, 11-4807 , 1J-4876, 1K-4884 and 1K-4896, in SEQ ID NOS: 179-188 and 191-193, and to determine additional cDNA pro partial sequences 11-4810 and 11-4811, in SEQ ID NOS: 189-190.

The result of another study of the prostate subtraction of tip 2 results in the isolation of three additional clones. Their sequences are determined as above and compared to the latest gene bank. All three clones were found to have homologues with known genes, which are cysteine rich proteins KIAA0242 and KIAA0280 (SEQ ID NOs ^1, 317, 319, and 320). Further analysis of these clones by Syn ten and microlines (Syn ten i, Palo AI's, CA) shows that all three clones are overexpressed in most prostate tumors and prostate BPH, as well as most normal prostate tissues. , but low expressed in all other normal tissues.

An additional subtraction was performed by subtracting the normal cDNA library from the normal pancreatic cDNA (called prostate subtraction 3). This led to the identification of six additional clones named 1G-4761, 1G-4762, 1H-4766, 1H-4770, 1H-4771 and 1H-4772 (SEQ ID NOS: 93-98). Comparison of these sequences with those in the gene bank does not reveal any significant homologies to 1G-4761 and 1H-4771 (SEQ ID NOS: 93 and 97). Further analysis of the isolated clones results in the determination of the extended cDNA sequences 1G-4761, 1G-4762, 1H-4766 and 1H-4772 in SEQ ID NOS: 194-196 and 199 and the determination of additional partial cDNA sequences for 1H-4770 and 1H-4771, in SEQ ID NOS: 197 and 198.

140 Subtraction of the prostate tumor cDNA library, prepared with a polyft + RNA pool from three prostate cancer patients, from the normal pancreas subtraction cDNA library, identifies eight clones named ID-4297, ID-4309, ID.1-4278, 1D-4288, 1D-4283, 1D-4304, 1D-4296, and 1D-4280 (SEQ.

NOS ID ^: 99-107). These sequences are compared to those in the gene bank as described above. No significant homology is found to ID-4283 and ID-4304 (SEQ ID NOS · 103 or 104). Further analysis of these isolated clones leads to the determination of the extended cDNA sequences for 1D-4309, ID.1-4278, 1D-4288, 1D-4283,

1D-4304, ID-4296 and 1D-4280 (SEQ ID NOS: 200-206).

The cDNA clones isolated in the above-described subtractions, prostate subtraction 1 "and prostate subtraction 2" are amplified PCR colonies and their mRNA expression levels in prostate tumor, normal prostate and various other normal tissues are determined using microarray technology. (Synteni, Palo Alto, Calif.). The amplification of PCR products is displayed with traces in the images in a number of formats, each product having a unique position in the series. The mRNA is extracted from the tissue sample tested, reverse transcribed, and fluorescently labeled cDNA samples are generated. Microarrays are compared to labeled cDNA samples, scans are scanned and fluorescence intensity is measured. This intensity correlates with the intensity of hybridization. Two clones (P509S and P510S) are found to be overexpressed in prostate and normal prostate tumors and expressed less in all other normal tissues tested (liver, pancreas, skin, bone marrow, brain, breast, adrenal gland, bladder, testes, salivary gland, small intestine, kidneys, egg vessels, lungs, spinal cord, skeletal muscles, and large intestine). The determined cDNA sequences for P509S and P51OS are in SEQ ID NOS: 223 and 224. Comparison of these sequences with those in the gene bank shows some homology with previously tested ESTs.

.'- · w - ..: ·. / ..,

Subsequent studies led for P509S. This sequence is for isolating the full-length cDNA sequence of SEQ ID NO: 332, wherein the corresponding predicted amino acid sequence is in SEQ ID NO: 339. Two variants of the full-length cDNA sequence for P510S are in SEQ ID NOs: 535 and 536, respectively the sequences are in SEQ ID NOs: 537 and 538. Additional cleaved variants of P510S are in SEQ ID NOs: 598 and 599.

Example 2

Determination of tissue specificity of prostate-specific polypeptides

Using specific primers, expression levels of mRNA for representative prostate-specific polypeptides El-16, HI-1, Ji-17 (also called P502S), LI-12 (also called P501S), El-12 (also aspirated by P504S and Ni) are examined. -1862 (also called P503S) in various normal and tumor tissues using RT-PCR.

Total RNA was extracted from various normal and tumor tissues using the Trizol reagent as described above. Synthesis of the first strain was performed using 1-2 g of total RNA by SuperScript II reverse transcriptase (BRL Life o).

Technologies) for one hour at 42 ° C. The cDNA is then amplified by PCR with a genspecific primer. To ensure the semi-quantitative nature of RT-PCR, β-actin is used as internal control for each of the tissues examined. First, serial dilutions of the first strain cDNA are performed and RT-PCR assays are performed with p-actin specific primers. Then, a dilution is found which allows the p-actin matrix to be amplified in a linear range that was sensitive enough to reflect the differences in the number of starting copies. Using these conditions, β-actin levels are determined for each reverse transcription reaction from each tissue. DNA contamination is minimized by treatment with DHase and guaranteeing a negative PCR result using prepared without the addition of reverse cDNA of the first transcriptase strain.

normal tissues of the lungs, ovaries,

MRNA expression levels are examined in four different types of tumor tissues (prostate cancer from two patients, breast cancer from three patients, colon and lung cancer) and sixteen prostate, colon, kidney, liver, pancreas, skeletal muscle, skin, stomach, testicles, bone marrow and brain. Fl-16 is found to be expressed in high tissue tissue of prostate, colon and normal prostate and, to a lesser extent, normal liver, skin and testes, with expression not detectable in the other tissues examined. H1 - 1 is expressed to a high extent in the prostate tumor, in the normal colon of the lungs, breast, in the normal prostate and in the normal brain, to a lesser extent in the normal lungs, pancreas, skeletal muscles, skin, small intestine, bone marrow and it was not detected in other test tissues. JI-17 (P502S) and LI-12 (P501S) appear to be specifically overexpressed in the prostate, both genes being expressed to a large extent in prostate tumor and normal prostate, but to a small, almost undetectable extent in all other tissues tested. NI-1862 (P503S) was found to be overexpressed (by 60%) in prostate tumors and detectable in normal colon and kidney. Thus, RT PCR results show that Fl-16, H1-1, JI-17 (P502S), N1-1862 (P503S) and LI-12 (P501S) are either prostate-specific or are expressed at a significantly increased rate in the prostate.

Further RT-PCR studies show that Fl-12 (P504S) is overexpressed (by 60%) in prostate tumors, detectable in normal kidney, but not detectable in all other tissues examined. Similarly, R1-2330 shows that it is overexpressed (by 40%) in prostate tumors, detectable in normal kidney and liver, but not detectable in all other

- 1 · 3 tissues tested. U1-3064 is overexpressed (by 60%) in prostate tumors and is also expressed in breast and colon tumors, but is not detectable in normal tissues.

The characteristics of RT-PCR, R1-2330, U1-3064 and 1D-4279 show that three antigens are overexpressed in the prostate and / or prostate tumor.

Northern analysis of four prostate tumors, two normal prostate samples, two BPH prostate and normal colon, kidney, liver, lung, pancreas, skeletal muscle, brain, stomach, testes, small intestine, and bone marrow show that LI-12 (P501S) it is overexpressed in prostate tumors and normal prostate while being undetectable in other normal tissues tested. JI-17 (P502S) was detected in two prostate tumors and was not detected in other tissues tested. NI-1862 (P5O3S) is overexpressed in three prostate tumors and expressed in normal prostate, colon and kidney, but not in the other tissues tested. Fl-12 (P504S) is highly expressed in two prostate tumors and is undetectable in all other tissues tested.

The above microarray technology is used to determine the expression level of representative antigens described herein in prostate, breast, and normal tissues from the group consisting of: prostate, liver, pancreas, skin, bone marrow, brain, breast, adrenal glands, bladder, testes, salivary glands, small intestine, kidneys, ovaries, lungs, spinal cord, skeletal muscle and large intestine. LI-12 (P5O1S) is overexpressed in normal prostate and prostate tumor, with some expression being recorded in normal skeletal muscle. Both JI-12 and Fl-12 (P504S) are overexpressed in the prostate tumor, with expression being lower to undetectable in all other tissues tested. NI-1862 (P503S) is expressed extensively in prostate tumor and normal prostate, and to a small extent in normal small intestine and normal colon, with expression not detectable in all other tissues tested. R1-233Q is expressed extensively in prostate and normal prostate tumor and to a small extent in all other tissues tested, iD-4279 is expressed extensively in prostate tumor and normal prostate, to a lesser extent in normal spinal cord and is undetectable in all other tissues tested.

Further microarray analysis focused specifically on the extent of expression of P501S (SEQ ID NO: 110) _in breast tumor shows slight overexpression not only in breast tumor but also in metastatic breast tumor (2/31), with negligible to low expression in normal tissues. These data suggest that P501S can be overexpressed in various lung and prostate tumors.

The expression level of 32EST (expressed tag sequence) described by Vasmatzis et al. (Proc. Natl. Acad. Sci. USA 95: 300-304, 1998) in various tumor and normal tissues is examined by microarray technology as described above. Two of these clones (P1000C and P1001C) were found to be overexpressed in prostate tumor and normal prostate and expressed to a low or undetectable extent in all other tissues tested (normal aorta, thymus, existing or activated PBMC, epithelial cells, spinal cord , adrenal gland, germ cells, skin, salivary gland, gastrointestinal tract, bone marrow, liver, lungs, dendritic cells, stomach, lymph nodes, brain, heart, small intestine, skeletal muscle, large intestine and kidney). The detected cDNA sequences for P1OOOC and PIOOIC are in SEQ ID NOs: 384 and 472. The PIOOIC sequence is shown to exhibit some homology to previously isolated human mRNA for the JM27 protein. Subsequent sequence comparison of SEQ ID NQ: 384 with those in public databases leads to the identification of the full length PlOOOC cDNA sequence (SEQ ID NO: 786), which encodes amino acid sequence 492. The amino acid sequence analysis by PSORT II leads to the identification of the putative transmembrane domain of amino acids 84 to 100. The P1000C open reading frame cDNA, including the stop codon, is provided in SEQ ID NO: 787, wherein the open reading frame without the stop codon is in SEQ ID NO: 788. The full length amino acid sequence of P1000C is in SEQ ID NO: 789. SEQ ID NOs: 790 and 791 represent amino acids 1 to 100 and 100 to 492 of P1000C.

Expression of the polypeptide encoded by the full-length cDNA sequence of Fl-12 (also called P504S, SEQ ID NO: 108) is examined by immunohistochemical analysis. King-anti-P504S polyclonal anti-full length P504S protein is generated by standard techniques. Subsequent isolation and characterization of polyclonal antibodies is also performed in a manner known in the art. Immunohistochemical analysis shows that the P504S polypeptide is 100% expressed in prostate cancer test samples (n = 5).

Rabbit-anti-P504S polyclonal antibody does not appear to label benign prostate cells with the same cytoplasmic granular staining, but rather with a light nuclear staining. Analysis of normal tissues shows that the encoded polypeptide is expressed in several but not all normal human tissues. The positive cytoplasmic staining of the rabbit-anti-P504S polyclonal antibody is normal human kidney, liver, brain, colon, and lung-associated macrophages, while the heart and bone marrow are negative.

These data suggest that the P504S polypeptide is present in prostate cancer tissues and that there are qualitative and quantitative differences in staining between benign prostatic hyperplasia and prostate cancer tissues, indicating that this polypeptide can be positively selectively detected in prostate tumors and therefore may be useful in the diagnosis of prostate cancer.

Example 1

Isolation and characterization of prostate-specific polypeptides by PCR-based subtractions

A cDNA subtraction library, containing normal prostate cDNA subtracted with ten normal cDNA tissues (brain, heart, kidney, liver, lung, ovary, placenta, skeletal muscle, spleen and thymus) and then passed to the first PCR amplification circuit, is provided by Clontech. This library was subjected to a second PCR amplification circuit according to the manufacturer's protocol. The resulting cDNA fragments were subcloned into the pT7 Blue T-vector (Novagen, Madison, WI) and transformed into XL-1 Blue MRF E.coli (Stratagene). DNA was isolated from independent clones and sequenced using Perkin Elffler / Applied Biosystems Divi on AutoBiated Sequencer Model 373A.

59 positive clones are sequenced. Comparison of the DNA sequences of these clones with those of the gene bank clones as described above does not show significant homologies in 25 of these clones, hereinafter designated P5, P8, P9, P18, P20, P30, P34, P36, P38, P39, P42, P49 , P50, P53, P55, P60, P64, P65, P73, P75, P76, P79, and P84. The cDNA sequences found for these clones are in SEQ ID NOs: 41-45, 47-52, and 54-65. For sequences P29, P47, P68, P80, and P82 (SEQ ID NOs: 46, 53 and 66-68), finds that they have some degree of homology with previously identified DNA sequences. To date, none of these sequences have been reported to occur in the prostate, as is known.

Further studies using SEQ ID NO: 67 as a probe in a standard full-length cloning method resulted in the isolation of three cDNA sequences that appear to be cleaved variants of P80 (also known as P704P). These sequences are in SEQ ID NOs: 620 to 622.

- 147 mi. Determined cDNA sequences for 115 to 123, 127, 131, 137, 145, and 160. Twenty-three clones (SEQ ID 132 to 136, 138 to 144, 146, 152,

Further studies using the PCR-based methodologies described above result in the isolation of more than 180 additional clones, of which 23 do not show significant homologies to known sequences. These clones are in SEQ ID NOs: 147-151, 153, 156-158

NO: 124 to 126, 128 to 130,

154, 155 and 159) show some homology to previously identified ESTs. Ten additional clones (SEQ ID NOS: 161-170) are found to have some degree of homology with known genes. Larger cDNA clones containing the P20 sequence show cleavage variants of the gene designated P703P. The determined DNA sequences for the variants designated DE1, DE13 and DE14 are provided in SEQ ID NOS: 171, 175 and 177, with the corresponding predicted amino acid sequences in SEQ ID NOs: 172, 176 and 178. The determined cDNA sequence for the expanded split form of P703 is in SEQ ID NO · 225. The DNA sequences for the cleaved variants referred to as DE2 and DE6 are in SEQ ID NOS: 173-174.

MRNA expression rate for representative clones in tumor tissues (prostate (n = 5), breast (n = 2), colon and lung), in normal tissues (prostate (n = 5), colon, kidney, liver, lung ( n = 2), ovarian (n = 2) skeletal muscle, skin, small intestine stomach and brain) and activated and non-activated PBMCs were determined by RT-PCR as described above. Unless otherwise noted, expression is examined on one sample from each tissue type.

P9 is found to be highly expressed in normal prostate and prostate tumor compared to normal tissues tested, except for normal colon where it exhibits comparable expression. P20, which is part of the P703P gene, is highly expressed in normal prostate and prostate tumor compared to all twelve normal tissues tested. Slight increase in P20 expression in breast tumor (n = 2), colon tumor

-, 148 ->

and is evident in lung tumor compared to all other tissues except lung (1 in 2). P18 overexpression is seen in normal prostate, prostate and breast cancer compared to other normal tissues except lung and stomach. A moderate increase in P5 expression is seen in normal prostate compared to most other normal tissues. However, some overexpression is evident in normal lung and PBMC. P5 overexpression is also seen in prostate tumor (2 out of 5), breast tumor, and one lung sample. P30 shows similar expression rates in normal prostate and prostate tumor, compared to 6 of the 12 other normal tissues tested. Overexpression appears in breast tumors in a single lung and colon tumor pattern as well as in normal PBMC. P29 is overexpressed in prostate tumor (5 out of 5) and in normal prostate (5 out of 5) compared to most normal melts. However, substantial expression of P 29 is evident in normal colon and normal lung (2 of 2). P80 is overexpressed in prostate tumor (5 out of 5) and in normal prostate (5 out of 5) compared to all other test tissues, with overexpression also seen in the colon tumor.

Further studies resulted in the isolation of 12 additional clones, hereinafter referred to as 10-d8, 10-h10, 11-c8, 7-g6, 8-b5, 8-b6, 8-d4, 8-d9, 8-g3, 8-h11, 9-f2 and 9-f3. Determined DNA sequences for

10-d8, 10-h10, 11-c8, 8-d4, 8-d9, 8-h11, 9-fl2 and 9-f3 are in SEQ ID NOs: 207, 208, 209, 216, 217, 220, 221 and 222. The determined DNA sequences in the upstream and downstream directions for 7-g6, 8-b5, 8-b6, and 8-g3 are in SEQ ID NOs: 210 and 211, 212 and 213, 214 and 215, and 218 and 219 respectively. no significant homology of the 9-f3 sequence results from a comparison of the determined sequences with the gene bank. Clones 10-d8,

11-c8 and 8-h11 show some homology to previously isolated ESTs, while clones 10-h10, 8-b5, 8-b6, 8-d4, 8-d9, 8-g3 and 9-fl2 show some homology to previously identified genes . Another characteristic results in the identity of clones 7-G6, and 8-G3 with known PAP and PSA genes.

The expression rate of mRNA for these clones was determined using the microarray technology described above. Clones 7-G6, 8-G3, 8-B5, 8-B6

8-D4, 8-D9, 9-F3, 9-F12, 9-H3, 10-A2, 10-A4, 11-C9 and 11-F2 are overexpressed in prostate tumor and normal prostate, with expression in other tissue is undetectable. Overexpression of 8-F11 is observed in prostate tumor and normal prostate, bladder, skeletal muscle, and colon. Overexpression of 10-H10 is observed in prostate tumor and normal prostate, bladder, lung, colon, brain and digestive tract. Overexpression of 9-B1 is observed in prostate tumor, breast tumor and normal prostate, salivary gland, digestive tract and skin, with overexpression of 11-C8 seen in prostate tumor, normal prostate and digestive tract.

It is found that another cDNA fragment derived from the normal prostate PCR-based subtraction described above is prostate-specific by both microarray and RT-PCR technology. The determined cDNA sequence of this clone (designated 9-A11) is shown in SEQ ID NO: 226. Comparison of this sequence to that of the public databases shows 99% identity to the known HXX13 gene.

Further studies have resulted in the isolation of clones 8-C6 and 8-H7. The determined cDNA sequences for these clones are in SEQ ID NOS: 227 and 228. These sequences appear to have some homology to previously isolated ESTs.

To obtain longer cDNA sequences for the P20 clone (also called P7O3P), hybridization-based methodologies are provided that provide three additional cDNA fragments that progressively extend the 5 'end of the gene. These fragments are called P703PDE5, P703P6.26 and P703PX-23 (SEQ ID NOs: 326, 328 and 330, the predicted corresponding amino acid sequences in SEQ ID NOs: 327, 329 and

331) and contain additional sequence 5. Screening the cDNA library (# 141-26) yields P703PDES with a portion of P703P as a probe.

Ρ703-6.26 was obtained with a mixture of three prostate tumor cDNA and P703PX-23 from a cDNA library (# 438-48). Thus, the additional sequences include all putative mature protease serums with a portion of the putative signal sequence. The full-length cDNA sequence for P703P is in SEQ ID NO: 524, wherein the corresponding amino acid sequence is in SEQ ID NO: 525.

Using a computer algorithm, the following regions of P703P predict to represent potential HLA A2-binding CTL epitopes: amino acids 164-172 of SEQ ID NO: 525 (SEQ ID NO: 723), amino acids 160-168 of SEQ ID NO: 525 (SEQ ID NO) 724), amino acids 239-247 of SEQ ID NO: 525 (SEQ ID NO: 725), amino acids 118 to 126 of SEQ ID NO: 525 (SEQ ID NO: 726), amino acids 112 to 120 of SEQ ID NO: 525 (SEQ ID NO: 525). Amino acids 155 to 164 of SEQ ID NO: 525 (SEQ ID NO = 728), amino acids 117 to 126 of SEQ ID NO: 525 (SEQ ID NO: 729), amino acids 164 to 173 of SEQ ID NO: 525 ( SEQ ID NO: 730), amino acids 154 to 163 of SEQ ID NO: 525 (SEQ ID NO '731), amino acids 163 to 172 of SEQ ID NO: 525 (SEQ ID NO: 732), amino acids 58 to 66 of SEQ ID NO And amino acids 59 to 67 of SEQ ID NO: 525 (SEQ ID NO: 734).

P703P is found to exhibit some homology with previously identified proteases such as thrombin. The thrombin receptor is found to be preferably expressed in highly metastatic breast cancer cells and in breast cancer biopsy samples. Introduction of the thrombin receptor anti-mediator cDNA inhibits invasion of metastatic breast cancer cells in culture. Thrombin receptor antibodies inhibit thrombin receptor activation and thrombin-induced platelet activation. In addition, peptides that enclose the ligand domain appear to inhibit platelet aggregation by thrombin. P703P may be of importance in prostate cancer through a protease activated receptor on a cancer cell or on stromal cells. Potential protease activities of P703P similar to trypsin can either activate the protease activated receptor on the cancer cell membrane to induce tumor genesis or activate the protease activated receptor on adjacent cells (such as stromal cells) to secrete growth factors and / or proteases (such as metalloproteinase matrix) ) that may promote tumor angiogenesis, invasion, and metastasis. Thus, P7O3β can promote tumor progression and / or metastasis by activating a protease activated receptor. Polypeptides and antibodies that block the P703P-receptor interaction can therefore be successfully used in the treatment of prostate cancer.

To determine whether P703P expression increases with increased severity of Gleason Grade, a tumor status indicator, quantitative PCR analysis of prostate tumor samples is performed in the Gleason Grade 5 to> 8 range. The mean expression rate of P703P, increased with increasing grade of Gleason grade, indicates that expression of P703P may be related to increased disease severity.

Another study using the PCR subtraction library of a prostate tumor pool subtracted against a set of normal tissues (referred to as JP: PCR subtraction) results in the isolation of thirteen additional clones, seven of which show no significant homology to gene bank sequences. The determined cDNA sequences for these seven clones (P711P, P712P, new 23, P774P, P775P, P710P and P768P) are in SEQ ID NOs: 307-311, 313-315. The remaining six clones (SEQ ID NOs: 316 and 321-325) ) shows some homology with known clones. Microarray analysis revealed that all thirteen clones showed triple or multiple overexpression in prostate tissues including prostate tumor, BPH, and normal prostate compared to normal non-prostate tissues. Clones P711P, P712P, new 23 and P768P show overexpression in most prostate tumors and BPH tissues tested (n = 29) and in most normal prostate tissues (n = 4), but low expression rates in

- 15’3 of all normal tissues. Clones P774P, P775P and P71OP show relatively low expression and expression in several prostate tumors and BPH samples with negative to low expression in normal prostate.

Another study leads to the isolation of the extended cDNA sequence for P712P (SEQ ID NO: 552). The amino acid sequences encoded by the 16, predicted free reading frames, contained in SEQ ID NO: 552 are in SEQ ID NOs: 553 to 568.

The full length cDNA for P711P is obtained using the SEQ ID NO: 307 sub-sequence to screen the prostate cDNA library. Directionally cloned prostate library cDNA was prepared using standard methods. A million colonies of this library were plated on LB / Amp plates. Nylon membrane filters are used to shift these colonies and the cDNAs captured by these filters are denatured and crosslinked on the filters with UV light. The P711P cDNA fragment of SEQ ID NO: 307 is radiolabeled and used to hybridize to these filters. Positive clones were selected and cDNAs were prepared and sequenced using a Perkin Elmer / Applied Biosystems. The sequence of P711P is in SEQ ID NO: 382 with the corresponding predicted amino acid sequence in SEQ ID NO: 383.

Using PCR and hybridization-based methodologies, cDNA sequence information is derived from the above clones, 11-C9 and 9-F3, termed P707P and P714P (SEQ ID NOS: 333 and 334). Compared to the latest gene bank, P707P is found to be a cleaved variant of the known HoxB13 gene. However, no significant homologies to P714P were found. Further studies using the sequence of SEQ ID NO = 334 as a probe in standard full-length cloning methods resulted in an expanded cDNA sequence for P714P. This sequence is in SEQ ID NO: 619. This sequence has some homologies to the gene that encodes the human ribosomal protein L23A.

^ «Sfe ^ aw ^ s ^ wíAtíeBí ► ·.

Clones 8-B3, P89, P98, P130, and P201 (according to US Application Serial No. 09 / 020,956, filed Feb. 9, 1998) are contained within a contiguous sequence called P705P SEQ ID NO '· 335 with the predicted amino acid sequence ( SEQ ID NO = 336), which is a cleaved variant of the known NKX3.1 gene.

Another P775P study resulted in the isolation of four additional sequences (SEQ ID NOs ^- · 473-476) that are cleaved variants of the P775P gene. SEQ ID NO: 474 contains two open reading frames (ORFs). The predicted amino acid sequences encoded by these ORFs are in SEQ ID NOs ^: 477 and 478. The cDNA sequence of SEQ ID NO · 475 contains an ORF that encodes the amino acid sequence of SEQ ID NO: 479. The cDNA sequence of SEQ ID NO: 473 is found to contain four ORFs. The predicted amino acid sequences encoded by these ORFs are in SEQ ID NOS-480 to 483. Other cleaved variants of P775P are in SEQ ID NOS ^: 593 to 597.

Another study leads to the identification of the genomic region on chromosome 22q11.2, known as the Cat Eye Syndrome region, which contains all five prostate genes P704P, P712P, P774P, P775P and B305D. The relative location of each of these five genes within the genomic region is shown in Figure 10. This region may therefore be related to malignant tumors and there may be other potential tumor genes within this region. These studies also led to the identification of the potential open reading frame (ORF) for P775P (in SEQ ID NO = 533), which encodes the amino acid sequence of SEQ ID NO: 534.

A comparison of clone SEQ ID NO · 325 (designated P558S) with gene bank and GeneSeq DNA databases shows that P558S is identical to the prostate-specific transglutamine gene known to have two forms. The full-length sequences for both forms are in SEQ ID NOs: ¹ 630 and 631 with the corresponding amino acid sequences in SEQ ID NOs: 632 and 633. The cDNA sequence of SEQ ID NO: 631 has 15 base-pair pairs,

- 154

which results in five amino acid inserts in the corresponding amino acid sequence (SEQ ID NO = 633). This insert is not included in SEQ ID NO = 630.

Another study of P768P (SEQ ID NO = 315) leads to the identification of the putative full-length open frame (ORF). The stop codon ORF cDNA sequence is in SEQ ID NQ ^; The cDNA sequence of the ORF without a stop codon is in SEQ ID NO = 765, with the corresponding amino acid sequence in SEQ ID NO = 766. This sequence shows 86% identity to the rat calcium transfer protein, suggesting that P768P may represent a human transfer protein of calcium. The locations of transmembrane domains within P768P are predicted using the PSORT II computer algorithm. Six transmembrane domains are predicted at amino acid positions 118-134, 172-188, 211-227, 230-246, 282-298 _and 348-364. The amino acid sequence of SEQ ID NO: 757 _and g772 are amino acids 1-134, 135- 188, 189-227, 228-246, 247298 and 299-511 of P768P.

Example 4

Synthesis of polypeptides

Polypeptides can be synthesized using a Perkin Elmer / Applied Biosystems 430A peptide synthesizer using FMOC chemistry with HPTU activation (O-benzotriazole-N, N, N, N-tetramethyluronium hexafluorophosphate). The Gly-Cys-Gly sequence may be attached to the amino terminus of the peptide to effect a method of conjugation, binding to an immobilized surface, or by labeling the peptide. Cleavage of the peptide from the solid support can be accomplished by the following trifluoroacetic acid / ethanedithiol / thioanisole / water / phenol cleavage mixture (40 = 1: 2 = 2: 3). After two hours of cleavage, the peptides can be precipitated in cold methyl tert-butyl ether. The peptide pellets can then be dissolved in water containing 0.1% trifluoroacetic acid (TFA) and lyophilized prior to purification by C18 reverse phase HPLC. A gradient of 0 to 60% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) can be used to elute the peptide. After lyophilization of the pure fractions, the peptides can be characterized by electrospray or other type of mass spectrometry and amino acid analysis.

Example 5

Further isolation and characterization of prostate-specific polypeptides by PCR-based subtractions

The cDNA library generated from the primary prostate mRNA tumor as described above is extracted using normal prostate cDNA. The subtraction is performed according to the PCR-based protocol (Clontech), which is adapted to generate larger fragments. According to this protocol, a double-stranded cDNA double stranded cDNA is digested separately by five restriction enzymes that recognize six-nucleotide restriction sites (MluI, MscI, PvuII, SalI and stuI). This digestion resulted in an average cDNA size of 600 base pairs, rather than an average size of 300 base pairs, based on the Rsal digestion according to the Clontech protocol. This modification does not affect the efficiency of subtraction. Two test files with different adapters are then created and the control library is left without the adapter.

The test and control libraries are then hybridized using an excess of control cDNA. In the first hybridization operation, the control library is separately hybridized to each of the two test cDNA populations. The results are: (a) unhybridized test cDNAs;

b) test cDNAs hybridized to other test cDNAs, c) test cDNAs hybridized to control cDNAs, and d) unhybridized control cDNAs. The two separate hybridization start reactions are then combined and hybridized again in the presence of additional denatured control cDNA. After this second hybridization, together with sets a) to d), a fifth set e) is generated in which a test cDNA with one adapter is hybridized to a test cDNA with the other adapter. The result of the second hybridization operation is the enrichment of differentially expressed sequences which can be used as matrices for amplifying PCR with adapter specific primers.

The ends are filled and PCR amplified using adapter specific primers. Only set e), which contains the test cDNA that has not hybridized to the control cDNA, is amplified exponentially. A second PCR amplification operation is then performed to reduce background noise and further enrich the differentially expressed sequences.

This PCR-based subtraction method normalizes differentially expressed cDNA such that rare transcripts that are overexpressed in prostate tumor tissue can be obtained. Such transcripts would be difficult to obtain by traditional transcription techniques.

In addition to other genes known to be overexpressed in the prostate tumor, 77 additional clones are identified. The sequences of these partial cDNAs are in SEQ ID NOS: 29-305. Most of these clones do not have significant homology with database gaps. Exceptions are JPTPN23 (SEQ ID NO: 231) having similarity to porcine containing val osine), JPTPN30 (SEQ ID NO: 234, similarity to rat mRNA for proteasome subunit), JPTPN45 (SEQ ID NO: 243, similarity to rat norvegicus on cystole NADP dependent isocitrate dehydrogenase), JPTPN4 6 (SEQ ID NO: 244 similarity to human subclone H8 d4 DNA sequence), JPID6 (SEQ ID NO = 265, G-gallus dynein light chain-A similarity), JP8D6 (SEQ ID NO 288, similarity to human BAC clone RG016J04), JP8F5 (SEQ ID NO = 289, similarity to, human subclone H8 3 b5 DNA sequence) and JP8E9 (SEQ ID NO: 299, similarity to human Alu sequence).

ά «-> ~ *»

Io7 Another study using a PCR-based library, consisting of a prostate tumor pool subtracted against a normal prostate pool (designated PT-PN PCR subtraction), provides three additional clones. Comparison of the cDNA sequences of these clones with the latest gene bank release did not show significant homologies to the two clones designated P715P and P767P (SEQ ID NOs 312 and 314). The remaining clone shows some homology to the known KIAAOO56 gene (SEQ ID NO: 318). Using microarray analysis to measure the level of mRNA expression in various tissues, it was found that all three clones were overexpressed in prostate tumors and BPH tissues. Clone P715P is overexpressed in most prostate and BPH tumors by three or more, with overexpression seen in most normal prostate and germ tissue samples, but negatively with low expression in all other normal tissues. Clone P767P is overexpressed in some prostate tumors and in BPH tissues with moderate expression in half of normal prostate and background samples for low expression in all other normal tissues tested.

Further analysis by the above-described method of the PT-PN PCR and DNA subtraction libraries containing cDNA from a prostate tumor subtracted by a set of normal cDNA tissue resulted in the isolation of the 27 additional clones (SEQ ID NQs ^: 340-365 and 381). that are overexpressed in the prostate tumor. Clones SEQ ID NOs: 341, 342, 345, 347, 348, 349, 451, 355-359, 361, 362 and 364 are also found to be expressed in normal prostate. Expression of all 26 clones in a number of normal tissues is low or undetectable, except for P544S (SEQ ID NO: 356), which is expressed in the small intestine. Of the 26 clones, 11 (SEQ ID NOs: 340 to 349 and 362) show some homology to previously identified sequences. Significant homologies with the clones of SEQ ID NOs: 350, 351, 353 to 23 are not found

361 and 363 to 365.

Comparison of SEQ ID NO: 362 _to those in the gene bank and GenSeq DNA databases shows that this clone (designated P788P) is identical to GenSeq order number X27262, which encodes the protein found in GenSeq protein order number Y00931. The full length P788P DNA sequence is in SEQ ID NO: 634, with the corresponding predicted amino acid in SEQ ID NO: 645. Subsequently, the full length cDNA sequence for P788P, which contains a polymorphism not detected in SEQ ID NO: 634, is cloned several times by PCR amplification from cDNA prepared from several RNA matrices from three individuals. This determined cDNA sequence of this polymorphic variant of P788P is in SEQ ID NO = 636 with the corresponding amino acid sequence in SEQ ID NO: 637. SEQ ID NO: 637 differs from SEQ ID NO: 635 by six amino acid residues. P788P has 7 potential transmembrane domains at the C-terminal portion and is a plasma membrane protein with an extracellular N-terminal region.

Another study of clone SEQ ID NO = 352 (designated P790P) resulted in the isolation of the full-length cDNA sequence of SEQ ID NO '526. The corresponding predicted amino acid is in SEQ ID NO' 522. Data from two quantitative PCR experiments indicate that P790P is excessive expressed in 11/15 prostate tumor samples tested and is expressed to a small extent in the spinal cord, with no expression in all other normal samples tested. Data from other PCR and microarray experiments show overexpression in normal prostate and prostate tumor, with little or no expression in other test tissues. Subsequently, significant homology to the previously identified G-protein coupled by the prostate tissue receptor is determined.

Additional studies of clone SEQ ID NO: 354 (designated P776P) lead to the isolation of the extended cDNA sequence of cDNAs in SEQ ID NO '369. The cDNA sequences found of the three additional cleaved variants of P776P are in SEQ ID NOs: 570-572. - encoded by two predicted open reading frames (ORFs) contained within SEQ ID NO: 570, one predicted ORF contained in SEQ ID NO: 571 and 11 ORFs contained in SEQ ID NO: 569 are in SEQ ID NO. Further studies lead to the isolation of the full-length sequence for clone SEQ ID NO: 570 ( _in SEQ ID NO: 737). Efforts to clone the full-length clone of SEQ ID NO: 571 lead to the isolation of two sequences (in SEQ ID NO). 738 and 739), representing a single clone that is identical except for the polymorphic insertion / deletion at position 1293. Clone SEQ ID NO: 739 (referred to as clone F) has a carbon at position 1293. The predicted amino acid sequence encoded in five open reading frames. frames ch within SEQ ID NO: 737, are in SEQ ID NOs: 740 to 744, with predicted amino acid sequences encoded by clone SEQ ID NOs: 738 and 739, which are in SEQ ID NOs: 745 to 750.

Comparison of the cDNA sequences for clones P767P (SEQ ID NO: 314) and P777P (SEQ ID NO = 350) with those in the human EST database gene bank shows that both clones have EST sequences together, which means that P767P and P777P can represent the same gene. The consensus DNA sequence, derived from the DNA sequences aligned with P767P, P777P, and multiple EST clones, is in SEQ ID NO · ^- 587. The amino acid sequences encoded by the three putative ORFs in SEQ ID NO · 587, - are in SEQ ID NOs ^: 588 to 590 .

Clone SEQ ID NO '342 (designated P789P) has been shown to exhibit homology to the previously identified gene. The cDNA sequences for P789P and the corresponding amino acid sequences are in SEQ ID NOs: 735 and 736.

Example 6

Peptide priming of mice and extension of CTL lines

6.1 This example illustrates the preparation of a cell-specific CTL cell line expressing the P502S gene.

160

J 1)) »>)»> 1> »)>))>>>>)))) 1)>)) ϊ I V)>>)>>>>»>

) 1>)>>) »)) ->))))

Mice expressing the human HLA A2Kb transgene (provided by Dr. L. Sherman of The Scripps Research Institute, La Jolla, CA) are immunized with peptide P2SU12 (VLGWVAEL SEQ ID NO: 306), which is derived from the P502S gene (also referred to as JI- 17, SEQ ID NO. ^- 8), as described by Theobald et al. (Proc. Natl. Acad. Sci. USA 92: 11993-11997, 1995) with the following modifications. Mice were immunized with 100 mcg P2S # 12 and 120 pg of peptide binding IA ^b, derived from hepatitis B viral protein emulsified in incomplete Freund's adjuvant. After three weeks, these mice are sacrificed and a suspension is prepared using a single cell nylon mesh. The cells are then resuspended at 6x10 ⁶ cells / ml in complete medium (RPMI-1640, Gibco BRL, Gaithersburg, MD) containing 10% FCS, 2 mM glutamine (Gibco BRL), sodium pyruvate (Gibco BRL), non-essential amino acids (Gibco BRL) , 2xlO ^_5 M 2-mercaptoethanol, 50 U / ml penicillin and streptomycin and cultured in the presence of pulses irradiated (3000 rad) P2Sttl2 (5 mg / ml P2SW12 and 10 mg / ml 2-microglobulin) blasts LPS (transgenic cell groups A2 cultured in 7 µg / ml dextran sulfate and 25 µg / ml LPS for three days). After six days, cells (5x10 ⁵ / ml) were restimulated with 2.5x10 ⁶ peptide pulsed (20,000 rad) EL4A2Kb cells (Sherman et al., Science 258: 815-818 (1992)) and 3x10 ⁶ / ml transgenic cells. pancreatic feeder cells A2. Cells are cultured in the presence of 20 U / ml IL-2. Cells are restimulated on a weekly basis as described in preparation of line cloning.

P2S # 12 lines are cloned by limiting dilution analysis with peptide pulsed EL4A2Kb tumor cells (1x10 ⁵ cells / well) as stimulators and A2 transgenic pancreatic feeder cells (5x10 ⁵ cells / well) and grown in the presence of 30 U / ml IL-2 On day 14, cells are restimulated as before. On the twenty-first day, the cultured clones are isolated and maintained in culture. Several of these clones show significantly higher reactivity (lysis) against human fibroblasts (expressing HLA A2Kb)

-.46.1 transduced P502S than control fibroblasts. An example is shown in Fig. 1.

These data suggest that P2S # 12 represents a naturally processed epitope of the P502S protein as compared to the expressed human HLA A2Kb molecule.

6.2 This example illustrates the preparation of mouse CTL lines and cell-specific CTL clones expressing the P501S gene

This series of experiments is carried out similarly as described above. Mice are immunized with P1tt10 peptide (SEQ ID NO: 337, which is derived from the P501S gene (also called LI-12, SEQ ID NO: 11O). P1tt10 peptide is derived by analyzing the predicted polypeptide sequence for P501S for potential HLA-A2 binding sequences defined published by HLA-A2 binding motifs (Parker KC et al., J. Immunol. 152, 163 (1994)) The P1tt10 peptide is synthesized as described in Example 4 and empirically tested for HLA-A2 binding using a T-based competition assay. The predicted A2 binding peptides are tested for their ability to compete with the HLA-A2 specific peptide presentation for the HLA-A2 clone restricted by the CTL clone (D15OM58), which is specific for the HLA-A2 binding influenza matrix peptide fluM58 D150M58 CTL secretes TNF in In the competition assay, test peptides are added at 100-200 µg / ml to D150M58 CTL cultures to bind HLA-A2 to CTL. h, CTLs grown with test peptides or control peptides are tested for their antigen dose response to peptide fluM58 in a standard TNF bioassay. As seen in Fig. 3, the P1tt10 peptide exhibits the competition of HLA-A2 limited by the presence of fluM58, demonstrating that the P1tt10 peptide binds HLA-A2.

Mice expressing the human HLA A2Kb transgene are immunized as described by Theobald et al. (Proc. Natl. Acad. Sci. USA 92: 11993-11997, 1995) with the following:

162 modifications. Mice were immunized with 62.5 .mu.g and 120 .mu.g PlSttlO IA ^b binding peptide derived from hepatitis B virus proteins emulsified in Incomplete Freund's Adjuvant. After three weeks, these mice are sacrificed and a suspension is prepared using a single cell nylon screen. The cells are then resuspended at 6x10 ⁶ cells / ml in complete medium (as described above) and cultured in the presence of pulsed-irradiated (3000 rad) PI Sieves 10 (2 µg / ml PlStt10 and 10 rng / ml / 32-microglobulin) blasts. LPS (transgenic pancreatic A2 cells cultured in 7 µg / ml dextransulphate and 25 µg / ml LPS for three days). After six days, cells (5x10 ⁵ / ml) were restimulated with 2.5x10 ⁶ pulsed-irradiated peptide (20,000 rads) of EL4A2Kb cells as described above and 3x10 ⁶ / ml transgenic pancreatic feeder cells A2. Cells are cultured in the presence of 20 U / ml IL-2. Cells are restimulated on a weekly basis as described in the preparation of line cloning. After three rounds of in vitro stimulation, one line is generated that recognizes the PlStt10-pulsed Jurkat A2Kb targets and the Jurkat P501S transduced targets as shown in Figure 4.

The PlStt10-specific CTL line is cloned by analysis of limited dilutions with pulsed EL4 A2Kb peptide cells (1x10 ⁴ cells / well) as stimulators and transgenic pancreatic A2 cells as feeder (5x10 ⁵ cells / well) grown in the presence of 30 U / ml IL -2. On day 14, cells are restimulated as before. On the 21st day, the living clones were isolated and maintained in culture. As seen in Figure 5, five of these clones exhibit specific cytolytic reactivity against the transduced P501S Jurkat A2Kb targets. These data demonstrate that PlStt10 is a natural epitope of the P501S protein that is expressed in the context of the human HLA.A2.1 molecule.

Example 7

In vivo CTL accretion using pure DNA immunization with prostate antigen i, κ v 'i, -> 1163 τ ι>>> ’>

I »Ί) ·» i 1 '1> 1,,>) »> i>

. ) i) j>> 1))>>

>) '-1 t>})>) 1 1)))

The prostate-specific LI-12 antigen as described above is also called P501S. HLA A2Kb Tg mice (provided by Dr. L. Sherman, The Scripps Research Institute, La Jolla, CA) are immunized with 100 ng of P501S in VR1012 both intramuscularly and intradermally. Mice are immunized three times with a two week break between immunizations. Two weeks after the last immunization, the immunized pancreas cells are cultured with Jurkat A2Kb-P501S transduced stimulator cells. CTL lines are immunized weekly. After two weeks of in vitro stimulation, CTL activity is evaluated against transduced P501S targets. Two out of eight mice developed strong anti-P501S CTL responses. These results demonstrate that P501S contains at least one natural HLA-A2 restricted epitope of CTL.

Example 8

The ability of human T cells to recognize prostate-specific polypeptides

This example illustrates the ability of prostate tumor polypeptide-specific T cells to recognize a prostate tumor.

Human CD8 ⁺ T cells are added in vitro to P502S-derived P2S-12 (SEQ ID NO: 306) (also called J1-17) using dendritic cells according to the protocol of Van Tsai et al. (Critical Reviews in Immunology 18: 65-75, 1998). The resulting CD8 ⁺ T cell microcultures are tested for their ability to recognize P2S-12 peptide as autologous fibroblasts or fibroblasts that have been transduced to express the P5O2S gene in the gamma-interferon ELISPOT assay (Lalvani et al., J. Exp. Med. 186 1997, pp. 859-865). T cell titer numbers were tested in duplicate on 10 ⁴ fibroblasts in the presence of 3 µg / ml human Pz-microglobulin peptide and 1 µg / ml P2S-12 or control E75 peptide. In addition, T cells

164 were simultaneously tested for autologous fibroblasts transduced with the P502S gene or as a control, fibroblasts transduced with HER-2 / neu. Before the test, fibroblasts were treated with 10 ng / ml gamma-interferon for 48 hours to re-regulate MHC class I expression. Microculture (# 5) shows strong discernibility for both peptide-pulsed fibroblasts and transduced fibroblasts in the gamma-interferon ELISPOT assay ^ Figure 2A shows a strong increase in the number of gamma-interferon traces with increasing number of T cells on fibroblasts pulsed with P2S -12 (solid bars) but not with the control peptide E75 (open bars). This demonstrates the ability of these T cells to specifically recognize the P2S-12 peptide. As shown in Figure 2B, this microculture shows an increase in the number of gamma-interferon traces with an increasing number of T cells on fibrioblasts transduced to be expressed. the P502S gene but not the HER-2 / neu gene. These results provide additional evidence that the P2S-12 peptide is a natural epitope of the P502S protein. In addition, this demonstrates that there is a high affinity of T cells in the human T cell reporter that are able to recognize this epitope. These T cells should also be able to recognize human tumors that express the P502S gene.

Example 9

Induction of prostate antigen specific CTL response in human blood

This example illustrates the ability of a prostate-specific antigen to elicit a CTL response in normal human blood.

Autologous dendritic cells (DCs) differentiate from monocyte cultures derived from normal donor PBMCs by 5 days growth in RPMI containing 10% human serum, 50 ng / ml GMCSF and 30 ng / ml IL-4. After culture, DCs are infected overnight with smallpox virus expressing recombinant P501S

-165 at Μ. 0.1. 5 and aged for 8 hours with the addition of 2 µg / ml CD40 ligand. The virus is inactivated by UV-irradiation, CD8 ⁺ cells are isolated by positive selection using magnetic beads, and the priming of the culture is initiated on 24-well plates. After five stimulation cycles with the help of autologous fibroblasts, retroviral identification of P501S and CD80 transduced CD8 ⁺ lines that specifically produce interferon-gamma is identified when stimulated with autologous P501S-transduced fibroblasts. Activity specific for P501S cell line 3A-1 could be obtained by subsequent stimulation cycles of autologous B-LCL transduced with P501S. Line 3A-1 appears to specifically distinguish autologous B-LCL transduced to express P501S but not EGFP-transduced autologous B-LCL, as measured by a cytotoxicity assay ( ⁵¹ Cr release) and interferon-gamma production (interferon gamma Elispot; Lalvani et al. , J. Exp. Med. 186: 859-865 (1997). The results of these tests are shown in Figures 6A and 6B.

Example 10

Identification of the natural CTL epitope contained in the prostate specific P703P antigen,

A 9-mer p5 peptide (SEQ ID NO: 338) is derived from the P703P antigen (also called P20). The p5 peptide is immunogenic in human HLA-A2 donors and is a natural epitope. Human antigen-specific CD8 + T cells can be cultured after repeated in vitro stimulations with monocytes pulsed with the p5 peptide. These CTLs specifically recognize p5-pulsed P703P-transduced target cells in both ELISPOT assays (as described above) and chromium release assays. In addition, immunization of transgenic HLA-A2Kb p5 mice results in the generation of CTL lines that recognize transduced target cells of HLA-A2Kb or HLA-A2 expressing P703P.

-. 166, Initial studies showing that p5 is a natural epitope were performed using HLA-A2Kb transgenic mice. Transgenic HLA-A2Kb mice are immunized subcutaneously into a paw of 100 µg of p5 peptide along with 140 gg of hepatitis B virus core peptide (Th-peptide) in Freund's incomplete adjuvant. Three weeks after immunization, in vitro pancreatic cells from immunized mice are stimulated with peptide pulsed LPS blasts. CTL activity is assessed by a chromium release assay five days after the first in vitro stimulation. Retroviral transduced cells expressing the control antigen P703P and HLA-A2Kb are used as targets. CTL lines are identified that specifically recognize both p5-pulse targets and targets expressing P703P.

Initial in vitro cultivation experiments have shown that the p5 peptide is immunogenic in humans. Dendritic cells (DC) are differentiated from monocyte cultures derived from normal human donor PMBC by culturing for five days in RPMI medium containing 10% human serum, 50 ng / ml human GM-CSF and 30 ng / ml human IL-4. After cultivation, DCs are pulsed with 1 µg / ml peptide and cultured with CD8 + T cell enriched PBMCs. CTL lines are restimulated on weekly bases with p5-pulsed monocytes. Five to six weeks after initiation of CTL cultures, the CTL distinguishes p5-pulsed target cells. Additionally, CTLs are shown to differentiate human cells transduced to express P703P, demonstrating that p5 is a natural epitope.

A study identifying another peptide epitope (termed peptide 4), derived from either the prostate tumor-specific P703P gene that can be recognized by cell surface CD4 T cells in connection with HLA class II molecules, is performed as described below. The amino acid sequence for Peptide 4 is in SEQ ID NO ^: 638, together with the corresponding cDNA sequence in SEQ ID NO: 639.

Twenty 15-mer peptides overlapped with 10 amino acids and derived from the carboxy terminus are generated by standard methods

167 of the P703P fragment. Dendritic cells (DC) are derived from normal donor PBMCs by GM-CSF and IL-4 standard protocols. CD4 T cells are derived from the same donor cells as DC using MACS beads and negative selection. DCs are pulsed overnight with sets of 15-mer peptides, each peptide having a final concentration of 0.25 µg / ml. Pulsed DCs are washed and plated at 1x10 ⁴ cells / well into V-bottom 96-well plates and added. with purified CD4 T cells at 1x10 ⁵ cells / well. The cultures are supplemented with 60 ng / ml IL-6 and 10 ng / ml IL-12 and incubated at 0 ° C. The cultures are restimulated as described above on a weekly basis using the generated and pulsed DCs as described above as antigen delivery cells supplemented with 5 ng / ml and 10 ng / ml IL-2. After 4 in vitro stimulation cycles, 96 lines (one line per well) are tested for specific proliferation and cytokine production in response to stimulation sets with an irrelevant set of mafflmaglobin-derived peptides used as controls.

One line (designated 1-F9) is identified from pool # 1, and exhibits specific proliferation (as measured by 3H proliferation assay) and cytokine production (as measured by interferon-gamma ELISA) in response to pool # 1 of P703P peptides. This line is further tested for specific recognition of the peptide set, specific recognition of individual peptides in the set, and in HLA mismatch analyzes to identify the relevant restriction allele. It is found that 1-F9 specifically proliferates and produces interferon-gamma in response to the tt1 peptide set as well as peptide 4 (SEQ ID NO · 638). Peptide 4 corresponds to amino acids 126 to 140 of SEQ ID NO: 327. Titration experiments were performed to assess the sensitivity of the 1.F9 line to a specific peptide. The line is found to specifically correspond to peptide 4 at concentrations as low as 0.25 ng / ml, indicating that T cells are very sensitive and therefore likely to have a high affinity for the epitope.

A panel is formed to determine the HLA restriction of the P703P response

168 cells displaying an antigen (APC) that partially agrees with a T cell-forming donor. APCs are pulsed with the peptide and used in proliferation and cytokine assays together with line 1-F9. The donor consensus APCs of the HLA-DRB-0701 and HLA-DQB02 alleles are capable of delivering the peptide to T cells, suggesting that the specific P703P response is limited to one of these alleles.

Antibody blocking assays are used to determine whether the limiting allele is HLA-DRB0701 or HLA-DQB02. Anti-HLA-DR blocking antibody L243 or the irrelevant consensus isotype IgG2a is added to T cells and APC cultures are pulsed with the peptide RMPTVLQCVNVSVVS (SEQ ID NO: 638) at 250 ng / ml. Standard interferon-gamma assays and proliferation assays are performed. While the control antibody has no effect on the ability of T cells to recognize with peptide-triggered APC, in both assays the anti-HLA-DR antibody completely blocks the ability of T cells to specifically distinguish from peptide-pulsed APC.

To determine whether the peptide epitope RMPTVLQCVNVSVVS (SEQ ID NO: 638) is natural, the ability of line 1-F9 to discriminate APCs pulsed with recorabinant P703P protein is examined. A number of recombinant P703P, E.coli-derived P703P, Pichia-derived P703P and baculovirus-derived P703P are used for these experiments. The irrelevant protein controls used are E. coli derived L3E (lung specific antigen) and baculovirus-derived mammaglobin. In interferon-gamma ELISAs, line 1-F9 is able to efficiently recognize both E. coli forms P703P and recombinant Pichia-derived P703P, whereas baculovirus-derived P703P is less efficiently recognized. Subsequent Western blot analyzes show that the E.coli protein and Pichia P703P preparations are intact, while the baculovirus P703P preparations are approximately 75% degraded. Thus, the peptide RMPTVLQCVNVSVVS (SEQ ID NO: 638) of P703P is a natural peptide epitope derived from P703P and placed into T cells in the context of HLA-DRB-0701.

In another study, 24 15-mer peptides overlapped with 10 amino acids and derived from the N-terminal fragment of P703P (corresponding to amino acids 27 to 154 of SEQ ID NO: 525) were generated using standard methods, and their ability to recognize CD4 cells was determined essentially as described above. DCs are pulsed overnight with sets of peptides, with each peptide at a final concentration of 10 µg / ml. A large number of individual CD4 T cell lines (65/480) show significant cytokine proliferation and release (IFN-gamma) in response to P703P peptide sets, but not to the control peptide set. CD4 T cell lines that exhibit specific activity are restored to a suitable P703P peptide set and re-tested for individual peptides of each set as well as titration of the peptide set of peptide set in the IFN-gamma release assay and proliferation assay.

16 immunogenic peptides are distinguished by T cells from the entire dose of peptide antigens tested. The amino acid sequence of these peptides is in SEQ ID NOs: 656 to 671 with the corresponding cDNA sequences in SEQ ID NOs: 640 to 655. In some cases, the peptide reactivity of the T cell line may be mapped to a single peptide, but several may be mapped to more than one peptide in each set. For further analysis, CD4 T cell lines are selected that exhibit a representative resolution image from each peptide set with reasonable affinity for the peptide (1-1A, -6A; II-4C, -5E; III-6E, IV-4CB, -3F, 9B, -10F, V-5B, -4D, and -10F). These CD4 T cell lines are restimulated to a suitable single peptide and re-assayed for analog DCs pulsed with the truncated form of recombinant P7O3P protein in E. coli (aa 96 to 254 of SEQ ID NO: 525), full-length P703P in the baculovirus expression system and fusion between influenza virus NS-1 and P703P in E. coli. From the T cell lines tested, line I-1A recognizes a specifically garbled form of P703P (E.coli) but no other recombinant form of P703P. This line also recognizes the peptide used to induce T cells. Line 2-4C recognizes the garbled form of P703P (E.coli) and the full-length form of P703P in the ba-, 170 τ τ-- ¹ culovirus, as well as the peptide. Other T cell lines tested are either peptide specific (II-5E, II-6F, IV-4B, IV-3F, IV-9B, IV-10F, V-5B and V-4D) or are unresponsive to any test antigen (V-10F). These results demonstrate that the peptide sequence RPLLANDLMLIKLDE (SEQ ID NO · 671 corresponding to aa 11Ο to 124 SEQ ID NO: 525) recognized by the 1-1A T cell line and the peptide sequence SVSESDTIRSISIAS (SEQ ID NO: 668, corresponding to aa 125 to 139 SEQ. 135-149 of SEQ ID NO: 525) and ISIASQCPTAGNSCL (SEQ ID NO: 667 corresponding to α, a. 135-149 of SEQ ID NO: 525) recognized by the II-4C T cell line may be natural epitopes of the P703P protein.

Example 11

Expression of breast tumor-derived antigen into the prostate

Isolation of the B305D antigen from a breast tumor by differential display is described in U.S. patent application Ser. No. 08 / 700,014, filed Aug. 20, 1996. Several cleaved forms of the antigen are isolated. The determined cDNA sequences of these cleaved forms are in SEQ ID NOs: 366 to 375 with predicted amino acid sequences corresponding to SEQ ID NOs: 292, 298 and 301 to 303, which are in SEQ ID NOs: 299 to 306. In another study, the cleaved is isolated. a variant of the cDNA sequence of SEQ ID NO · 366 that contains an additional guanine residue at position 884 (SEQ ID NO: 530) resulting in a frame shift of the open reading frame. The determined DNA sequence of this ORF is in SEQ ID NO: 531. This frame shift generates a 293 amino acid protein sequence (in SEQ ID NO: 532) that contains a C-terminal domain common to the other isoforms of B305D but which differs in the N-terminal region .

The level of B305D expression in tumor and normal tissues is examined by real-time PCR analysis and Nothern analysis. The results indicate that B305D is strongly expressed in the breast tumor, the tumor

- ”\ 71»

»7 t> 7

7 prostate, normal prostate and testes, and expression is low or undetectable in all other tissues examined (colon, lung, smoking, normal bone marrow, kidney, liver, colon , lungs, ovaries, skin, small intestine and stomach). Using real-time PCR analysis on a prostate tumor panel, B305D in prostate tumors is shown to increase with increasing Gleason grade, demonstrating that B305D expression increases the progression of prostate cancer.

Example 12

Generation of human CTL in vitro using Whole Gene Priming and Stimulation with prostate-specific antigen P501S

Human CTL lines are derived using in vitro whole-gene priming of P501S cowpox infected with DC (e.g., Yee et al., The Journal of Immunology 157 (9), pp. 4079-4086, 1996). which specifically discriminate P501S transduced autologous fibroblasts (also known as LI-12) determined by analysis using interferon gamma ELISPOT as described above. Using a panel of HLA-mismatched B-LCL lines transduced with P501S, it appears that these CTL lines are likely to be restricted to HLAB class I alleles. Dendritic cells (DCs) differentiate from monocyte cultures derived from PBMCs of normal human donors by growing for 5 days in RPMI medium containing 10% human serum, 50 ng / ml human GM-CSF and 30 ng / ml human IL-4. Subsequent culture, DC is infected overnight with recombinant P501S cowpox virus five fold repeated infection (M.0.I) and matures overnight with ingredients of 3 µg / µl of CD40 ligand. The virus is inactivated by UV-irradiation. CD8 + T cells are isolated by a magnetic bead system and culture is initiated by standard culture methods. Cultures are restored every 7-10 days using autologous primary fibroblasts, retroviral transduced with P501S and CD80. After four stimulation cycles of the CD8 + T cell line, the specificities are found to produce interferon-gamma upon stimulation of P501S and CD80 by transduced autologous fibroblasts. A panel of HLA-mismatched B-LCL lines transduced with P501S is generated to define a restriction allele of the response. Measurement of interferon-gamma in the ELISPOT assay shows that the specific response to P501S is likely to be limited by the HLA B alleles. These results demonstrate that the CD8 + CTL response to P501S can be elicited.

To identify the recognized at least one epitope, the cDNA encoding P501S is fragmented by various restriction digests and subcloned into the retroviral expression vector pBIB-KS. Retroviral supernatants are generated by transfection of the Phoenix-Ampho ihelper packaging line. Supernatants were used to transduce Jurkat / A2Kb cells for CTL screening. CTL is screened in IFN-gamma ELISPOT assays against these A2Kb targets transduced with the P501S fragment library. The starting positive fragments P501S / H3 and P501S / F2 are sequenced and found to encode amino acids 106-553 and amino acids 136-547 of SEQ ID NO: 113. H3 truncation is performed by encoding amino acid residues 106-351 of SEQ ID NO ^: 113, which additional fragments coding for amino acids 1 to 472 (fragment A) and amino acids 1 to 351 (fragment B) are also constructed. Fragment A, but not fragment B, stimulates CTL, thereby localizing the epitope to amino acid residues 351-472. Overlaps of the 20-mer and 18-mer peptides representing this region are tested by pulsing Jurkat / A2Kb cells against the CTL IFN-gamma assay. Only peptides P501S-369 (20) and P501S-369 (18) stimulate CTL. The 9-mer and 10-mer peptides representing this region were synthesized and similarly tested. Peptide P501S-370 (SEQ ID NO = 539) is a minimal 9-mer giving a strong response. Peptide P501S-376 (SEQ ID NO: 540) also gives a weak response, suggesting that

173 ->

can represent a cross-reactive epitope,

Subsequent studies investigate the ability of P501S-transformed human primary B cells to initiate the 1 HC class I-restricted, P5Q1S-specific, autologous CD8 T cell. Primary B cells are derived from PBMC homozygous donor HLA-A2 by culturing in CD-40 and IL-4 ligand, transduced at high frequency by recombinant P501S to the pBIB vector and selected blastocidin-S. To grow in vitro, CD8 + T cells were cultured with autologous CD40 ligand + IL-4-derived, P501S-transduced B cells in a 96-well microculture format. These CTL microcultures are restimulated with P501S transduced B-cells and then examined for specificity. Following this initial screening, microcultures with significant signal above the sequence were cloned into autologists of EBV-transformed B-cells (BLCL), also transduced with P501S. Using IFN-gamma ELISPOT to detect several of these CD8 T cell clones were found to be specific for P5Q1S, as evidenced by reactivity to BLCL / P501S but not BLCL transduced with the control antigen. It is also demonstrated that the specificity of anti-P501S CD8 T cells is HLA-A2-restricted. Firstly, anti-substance blocking experiments with anti-HLA-A, B, C (W6.32), anti-HLA-B, C (B1.23.2) and control monoclonal antibodies show that only anti-HLA antibody -A, B, C blocks the resolution of P501S expressing an autologous BLCL. Secondly, anti-P501S CTL also distinguishes HLA-A2 evaluated, heterologous BLCL transduced P501S, but not the corresponding EGFP transduced control BLCL.

The natural CD8 class I-restriction peptide epitope of P5O1S is identified as follows: Dendritic cells (DCs) are isolated with a Percol gradient followed by differential adherence and cultured for five days in the presence of RPMI containing 1% human serum, 50 ng / ml GM-CSF and 30 ng / ml IL-4. After cultivation, DCs are infected for 24 hours with adenovirus expressing P501S at

&Gt; 175 has 411 to 486 amino acids P501S (SEQ ID NO: 113) is distinguishable by both specific P501S clones. To identify the specific 18-20-mer peptide recognized by the clones, each of the 18-20-mer peptides that constitute a positive set in the gamma-Elispot assay are individually tested for the ability to stimulate both P501S CTL, 4E5 and 4E7 specific clones. Both 4E5 and 4E7 specifically recognize one 20-mer peptide (SEQ ID NO: 710, cDNA sequence in SEQ ID NO '711), which include amino acids 453 to 472 of P5O1S. Since the minimal epitope recognized by CD8 + T cells is almost always either a 9-mer or a 10-mer peptide sequence, 10-mer peptides are synthesized that comprise the entire sequence of SEQ ID NO: 710, which differ by one amino acid. Each of these 10-peptide peptides is tested for their ability to stimulate two P501S-specific clones (preferably 1D5 and 1E12). One 10-mer peptide (SEQ ID NO: 712, cDNA sequence in SEQ ID NO: 713) is identified as specifically stimulating P501S-specific clones. This epitope includes amino acids 463 to 472 of P501S. This sequence defines at least a 10-mer epitope from P501S that can be natural and to which CTL responses in normal PBMC can be identified. Thus, this epitope is a candidate for use as a vaccine moiety and a therapeutic and / or diagnostic reagent for prostate cancer.

To identify a class I restriction element for the P501S derived sequence of SEQ ID NO · 712, a pairing and mismatch analysis is performed. In gamma-IFN E1 spot assays, the specific response of clones 4A7 and 4E5 to P501S-transduced autologous fibroblasts is blocked by preincubation with 25 µg / ml W6 / 32 (pan-Class I blocking antibody) and Bl.23.2 (HLA-B / C blocking antibody). antibody). These results demonstrate that the specific response of SEQ ID NO = 712 is limited to HLA-B or HLA-C alleles.

For HLA mismatch analysis, B-LCL autologists (HLA-A1, A2, B8, B51, Cwl, Cw7) and B-LCL (HLA)

-176 A2, A3, B18, B51, Cw5, Cw14), which include the HLAB51 alleles, pulse for one hour with 20 µg / ml of the peptide of SEQ ID NO: 712, washed and assayed for gamma-IFN Elispot assay for ability to stimulate 4A7 clones and 4E5. Blocking tests with antibodies with Bl.23.2 (HLA-B / C blocking antibody) were also performed. The specific response of SEQ ID NO: 712 is determined using both autologous (D326) and heterologous (D107) B-LCL and, in addition, responses are blocked by preincubation with 25 µg / ml B1.23.2 HLA-B / C blocking antibody. Taken together, these results indicate that the P501S specific response to the peptide of SEQ ID NO: 712 is limited to the HLA-B51 allele of class I. Molecular cloning and sequence analysis of the HLA-B51 allele from D3326 reveals that the HLA-B51 subtype F326 is HLA-B51011.

Based on the 10-mer P501S-derived epitope of SEQ ID NO: 712, two 9-mers with SEQ ID NOs: 714 and 715 were synthesized and tested in E1 ispot assays for the ability to stimulate two P501S-specific CTL clones derived from line 12A2. . The 10-mer peptide of SEQ ID NO: 712, as well as the 9-mer peptide of SEQ ID NO: 715, but not the 9-mer peptide of SEQ ID NO: 714 are capable of stimulating P5O 18 -specific CTL to produce IFN-gamma. These results demonstrate that the peptide of SEQ ID NO'-715 is a 9-mer P501S-derived epitope differentiated by P501S-specific CTL. The DNA sequence encoding the epitope of SEQ ID NO: 715 is in SEQ ID NO- 716.

To identify the class I limiting allele for the P501S-derived peptide specific response SEQ ID NOs: 712 and 715, the HLA B and C alleles from the donor used in the in vitro accretion experiment were cloned. Sequence analysis indicates that the relevant alleles are HLA-B8, HLA-B51, HLA-CwO1 and HLA-CwO7. Each of these alleles is subcloned into an expression vector and co-transfected with the P501S gene into VA-13 cells. The transfected VA-13 cells are then tested for their ability to specifically stimulate P501S-specific CTL in ELISPOT analysis. VA-13 cells transfected with P501S and HLA-B51 are shopable to stimulate P501S-specific CTL to sec477 gamma-IFN retention. VA-13 cells transfected with HLA-B51 alone or P501S + other HLA alleles are unable to stimulate P501S-specific CTLs. These results demonstrate that the restriction allele for the P501S-specific response is allela HLAB51. Sequence analysis shows that the relevant restriction allele subtype is HLA-B51011.

To determine whether P501S-specific CTL can recognize prostate tumor cells that express P501S, retrovirally transfer P501S-useful lines LnCAP and CRL2422 (both expressing moderate amounts of P501S mRNA and protein) and PC-3 (expressing small amounts of P501S mRNA and protein) ) plus the PSO1S-negative cell line DU-145 together with the HLA-B51011 allele that was cloned from the donor used to generate the P501S-specific CTL. HLA-B51011 or EGFP-transduced and selected tumor cells are treated with gamma-interferon and androgen (to over-regulate stimulatory functions of P501S) and used in the gamma-interferon Elispot assay with P501S-specific CTL clones 4E5 and 4E7. The untreated cells are used as controls.

Both 4E5 and 4E7 both efficiently and specifically discriminate LnCAP and CRL2422 cells that have been transduced with the HLA-B51011 allele but not the same EGFP-transduced cell line. Additionally, both CTL clones specifically distinguish PC-3 cells transduced with HLA-B51011, but not the P5O1S-negative DU-145 tumor cell line. Gamma-interferon or androgen treatment does not improve CTL's ability to distinguish tumor cells. These results demonstrate that the P501S-specific CTL, produced in vitro by full-gene growth, specifically and efficiently discriminates prostate cell tumor lines that express P501S.

The natural CD4 epitope P501S is identified as follows:

CD4-specific cells were prepared as described above

A series of 16 overlapping peptides are prepared that occupy approximately 50% of the amino terminal portion of the P501S gene (amino acids 1-325 of SEQ ID NO: 113). For growth, the peptides are combined into sets of five peptides, pulsed with 4 µg / ml in dendritic cells (DC) for 24 hours TNF-alpha. The DCs are then washed and mixed with negatively selected CD4 + T cells in U-bottom 96-well plates. The cultures are restored weekly with fresh CD-loaded peptide sets. After a total of four stimulation cycles, the cells are allowed to remain for an additional week and tested for specificity against APCs pulsed with sets of peptides using gamma-IFN ELISA and proliferation assays. Adhesion monocytes loaded with either a relevant set of peptides at 4 µg / ml or an irrelevant peptide at pg / ml as APC are used for these assays. T cell lines that exhibit either specific cytokine secretion or proliferation are then screened for recognition of individual peptides occupied in the pool. T cells can be identified from sets A and B, which recognized individual peptides from these sets.

From Set A specifically, lines AD9 and AE10 recognize peptide 1 (SEQ ID NO: 719) and line AF5 recognizes peptide 39 (SEQ ID NO: 718). From B, it is determined that the BC6 line recognizes peptide 58 (SEQ ID NO: 717). All of these lines were stimulated for a specific peptide and tested for specific peptide recognition by both titration assay and cell lysates generated by infection with HEK293 cells with an adenovirus expressing either P501S or an irrelevant antigen. For these assays, APC-adherent monocytes are pulsed individually with 10, 1 or 0.1 ag / ml of individual

P501S peptides and DCs are pulsed overnight at a 1: 5 dilution of adenovirus-infected cell lysates. AD9, AE10, and AF5 lines retain significant discriminability of the relevant P501S-derived peptides even at 0.1 mg / ml. In addition, the AD9 line exhibits a significant (8.1 stimulation index) specific activity for lysates from adenovirus P501S infected cells. These results show that the high affinity of CD4 T cell lines can be generated against P501S derived epitopes, and that at least a subset of these T cells specific for the sequence of SEQ ID NO: 719 derived from P501S is specific for an epitope that is natural in human cells. The DNA sequence encoding the amino acid sequence of SEQ ID N0 = 717 _and M 719 are in SEQ ID NOS: 720-722.

To further characterize the P501S-specific activity of AD9, the line is cloned by anti-CD3. Three clones, designated 1A1, 1A9 and 1F5, were identified as being specific for the P501S-1 peptide (SEQ ID NO: 719). To determine the HLA restriction allele for the P501S-specific response, each of these clones was tested by anti-class II substance blocking and HLA mismatch assays using a proliferation and gamma-interferon assay. In anti-drug blocking and gamma-interferon production assays using ELISA, the ability of all three clones to recognize peptide-pulsed APC is specifically blocked by co-incubation with either pan-class II blocking antibody or HLA-DR blocking antibody but not with HLA-DQ or irrelevant antibody. Proliferation assays performed simultaneously with the same cells confirm these results. These data demonstrate that the P5GlS-specific clone response is limited by the HLA-DR allele. Other studies show that the limiting allele for P501S-specific responses is HLA-DRB1501.

Example 13

Identification of prostate-specific antigens by microarray analysis

This example describes the isolation of some prostate-specific polypeptides from a prostate tumor cDNA library

The above described prostate tumor cDNA expression library is screened by microarray analysis to identify clones that exhibit at least 3-fold overexpression of tumor tissue

180 '«v. In prostate and / or normal prostate tissue, as compared to non-prostate normal tissues (not including testes). 372 clones and 319 were identified, of which successfully sequenced. Table I summarizes these clones, which are in SEQ ID NOS: 385-400. Of these sequences, SEQ ID NOS: 386, 389, 390 and 392 correspond to the new genes and SEQ ID NOS: 393 and 396 correspond to the previously identified sequences. The others (SEQ ID NOs: 385, 387, 388, 391, 394, 395, and 397 to 400) correspond to known sequences as shown in Table I.

Table I

Summary of prostate tumor antigens

Known genes Formerly identified - New genes genes gamma-chain P504S 23379 (SEQ ID NO: 389) T cells - Kal 1ikrein P1000C 23399 (SEQ ID NO: 393)

Vector P501S 23320 (SEQ ID NO NO- 386) CGI-S2 protein mRNA P503S 23381 (SEQ ID NO NO: 390) (23319, SEQ ID NO: 385). PSA P510S Aid.6 Dehyd. P784P

L-iditol-2-dehydro- P502S genase (2376, SEQ ID NO: 388)

181

Ets transcription factor PDEF (22672, SEQ ID NOS: 398) P706P hTGR (22678, SEQ ID NO: 399) 19142.2 bangur.seg 22621 (SEQ ID NO: 396) KIAA0295 (22684, SEQ ID NO: 400) 55661 Wang (23404 SEQ ID NO: 393) Acid phosphatase prostatic (22655 SEQ ID NO: 397) P712P transglutaminase (22611, SEQ ID NO: 395) P778P HDLBP (23507, SEQ ID NO ^: 394) CGI-69 Protein (23367, SEQ ID NO: 387) KIAA0122 (23382, SEQ ID NO: 391) TEEG

CGI-82 exhibits 4.06-fold overexpression in prostate tissues compared to other normal test tissues. It is overexpressed in 43% of prostate tumors, 25% of normal prostate and not detected in other normal test tissues. L-iditol-2 dehydrogenase shows a 4.4-fold overexpression in prostate tissues as compared to other normal tissues tested. It is overexpressed in 90% of prostate tumors, 100% of normal prostate and undetected

- 182 (i) in other normal tissues tested. Transcription of factor Ets PDEF shows 5.55-fold overexpression in prostate tissues as compared to other normal tissues tested. It is overexpressed in 47% of prostate tumors, 25% of normal prostate and not detected in other normal tissues tested. hTGRI shows 9.11-fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 63% of prostate tumors and is not detected in other normal tissues tested, including normal prostate. KIAA0295 shows 5.59-fold overexpression in prostate tissues as compared to other normal tissues tested. It is overexpressed in 47% of prostate tumors, low to undetected in other normal tissues tested, including normal prostate. Prostate acid phosphatase shows a 9.14-fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 67% of prostate tumors, 50% of normal prostate and is not detected in other normal tissues tested. Transglutaminase shows 14.84-fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 30% of prostate tumors, 50% of normal prostate and is not detected in other normal tissues tested. The high-density lipoprotein (HDLBP) binding protein shows 28.06-fold overexpression in prostate tissues as compared to other normal tissues tested. It is overexpressed in 97% of prostate tumors, 75% of normal prostate and is not detected in other normal tissues tested. The CGI-69 report is a 3.5-fold overexpression in prostate tissues as compared to other normal tissues tested. It is a low-enriched gene, detected in more than 90% of prostate tumors and in 75% of normal prostate. Expression of this gene in normal tissues is very low. KIAA0122 shows 4.24 fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 57% of tumors

183 and not found in other normal tissues tested, including normal prostate tissues. Bangur 19142.2 shows a 23.25-fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 97% of the prostate tumor, and 100% of the normal prostate. It is undetectable in other normal tissues tested. Wang 5566.1 shows 3.31-fold overexpression in prostate tissues compared to other normal tissues tested. It is overexpressed in 97% of prostate tumors, and 75% of normal prostate, and is also overexpressed in normal bone marrow, pancreas, and activated PBMC. The new clone 23379 (also referred to as P553S) shows 4.86-fold overexpression in prostate tissues compared to other normal tissues tested. It is detectable in 97% of prostate tumors and 75% of normal prostate and is undetectable in the other normal tissues tested. The new clone 23399 shows 4.09-fold over-expression in prostate tissues compared to other normal tissues tested. It is overexpressed in 27% of prostate tumors and is undetectable in all other normal tissues tested, including normal prostate. The new clone 23320 shows 3, 15-fold overexpression in prostate tissues as compared to other normal tissues tested. It is detectable in all prostate tumors and in 50% of normal prostate tissues. It is also expressed in the normal colon and trachea. Other normal tissues do not express this gene in large quantities.

Subsequent cloning studies of full-length P553S using standard methods indicate that this clone is an incompletely cleaved form of P501S. The determined cDNA sequences for the four cleaved variants of P553S are in SEQ ID NOs: 623 to 626. The amino acid sequence encoding in SEQ ID NO: 626 is in SEQ ID NO: 627. The cDNA sequence of SEQ ID NO: 623 contains two open reading frames (ORFs). The amino acid sequences encoded by the two ORFs are in SEQ ID NOs: 628 and 629.

184>} t

5)

I)? >

»))))) I))> Ϊ> · 1 5

Example 14

Identification of prostate-specific antigens by electronic subtraction

This example describes the use of electronic subtraction techniques to identify prostate-specific antigens.

Potential prostate-specific genes in the gene bank of the human EST database are identified by electronic subtraction (similar to that described by Vasmatizis et al., Proc. Natl. Acad. Sci. USA 95: 300-304, 1998). The sequences of EST clones (43,482) derived from various prostate libraries are obtained from the public human EST gene bank database. Each prostate EST sequence is used as a questionnaire sequence in the National Center for Biotechnology Information (BLASTN) survey of the human EST database. All consents considered identical (consensus sequence length> 100 base pairs, identical consensus density over this region> 70%) are grouped together. Groups containing more than 200 EST are excluded as they are likely to be repeating elements or genes expressed above, such as ribosome proteins. If two or more groups include common ESTs, they are pooled into supergroups, resulting in 4,345 prostate supergroups.

The records for the 479 human cDNA libraries represented in the gene bank edition were folded to create a database of these cDNA library records. These 479 cDNA libraries were divided into three groups: Plus (normal prostate and prostate tumor libraries, breast cell libraries in which expression is desired), Minus (libraries of 2 other adult tissues in which expression is not desired) and Others (libraries from germline tissues, infant tissues, tissues occurring only in women, non-prostate tumor tissues, and cell lines other than prostate cell lines in which expression is considered to be

185)>>

> »·>))>

·> 1 not relevant). Table II summarizes these groups.

Table II

Prostate cDNA and EST libraries

Library With libraries tt EST Plus 25 43, 482 Normal 11 18,875 Tumor 11 21,769 Cell lines 3 2, 838 M i nus 166 Others 287

Each supergroup is analyzed for EST within the supergroup. The tissue of each EST clone is recorded and used to classify the supergroup into 4 groups: Type 1 EST clones found only in Plus libraries; no expression was detected in Minus or other groups of libraries; EST type 2 clones derived only from Plus and Other library groups; no expression was found in the Minus group; EST type 3 clones derived from Plus, Minus or Other libraries, but the number of EST derived from Plus is greater than in the Minus or Other group and EST type clones derived from Plus, Minus and Other libraries, but the number derived in the Plus group is greater than number derived from the Minus group. This analysis identifies 4345 breast groups (Table III). EST 3172 clones from Reseach Genetics, Inc were ordered from these groups. and are obtained in frozen glycerol slo-186 -

vain 96-way pads. Table III Summary prostate skup i n Type # superskup i n tt sorted EST 1 688 677 2 2899 2484 3 85 11 4 673 0 Ce1kem 4345 3172

The EST clones inserts were amplified by PCR using amino-weighted PCR primers for Synteni microarray analysis. If more than one PCR product is obtained for a particular clone, that PCR product is not used for expression analysis. A total of 2528 clones from the electronic subtraction method were analyzed by micro rank analysis to identify electronic subtraction breast clones that had high levels of tumor versus normal tissue mRNA. Such screening is performed using Synteni micro-lines (Palo Al's, CA) according to the manufacturer's instructions (and essentially as described by Schen et al., Proc. Nat. Acad. Sci.).

10619, 1996; and Heller et al., Proc.

pp. 2150-2155 (1997). In these assays, clones are plated on a chip, which is then compared to fluorescent probes generated from normal prostate and tumor prostate cDNA and from various other normal tissues. Images are scanned and fluorescence intensity is measured.

USA 93, pp. 10614 to Nat. Acad. Sci.USA 94,

Clones with an expression ratio greater than 3 (which means that the mRNA content in the prostate tumor and in the normal prostate is at least

- 187

1

- · ’) ·)> ϊ ϊ *)

triple compared with mRNA content in others normal tissue) i dent i ficci as sequence specific for tumors prostate (Table IV). The sequences of these clones are in SEQ ID NO: 401 to 453 s with certain new sequences in SEQ ID NO: 407, 413, 416 a 419 422 426 427 and 450. Table IV Tumor-specific clones of the prostate SEQ ID NO: Designation Comment sequence 401 22545 The third day is three-pointed P100C 402 22547 previously identified P704P 403 22548 known 404 22550 known 405 22551 PSA 406 22552 prostate secretory protein 94 407 22553 new 408 22558 previously identified P509S 409 22562 glandule kallikrein 410 22565 previously identified P1000C 411 22567 PAP 412 22568 B1006C (breast tumor antigen) 413 22570 new 414 22571 PSA 415 22572 previously identified P706P 416 22573 new 417 22574 new 418 22575 new - 419 22580 new 420 22581 PAP 421 22582 prostate secretory protein 94 422 22583 new

188) 1)

423 22584 prostate secretory protein 94 424 22585 prostate secretory protein 94 425 22586 known 426 22587 new 427 22588 new 428 22589 PAP 429 22590 known 430 22591 PSA 431 22592 known 432 22593 previously identified P777P 433 22594 gamma-chain T cell receptor 434 22595 previously identified P705P 435 22596 previously identified P707P 436 22847 PAP 437 22848 known 438 22849 prostate secretory protein 57 439 22851 PAP 440 22852 PAP 441 22853 PAP 442 22854 previously identified P509S 443 22855 previously identified P705P 444 22856 previously identified P774P 445 22857 PSA 446 23601 previously identified P777P 447 23602 PSA 448 23605 PSA 449 23606 PSA 450 23612 new 451 23614 PSA 452 23618 previously identified P1OOOC 453 23622 previously identified P705P

Another study of clone SEQ ID NO: 407 (also called PI 0200) leads to the isolation of the extended cDNA sequence in SEQ ID NO: 591.

The 189 extended cDNA sequence is found to contain an open reading frame that encodes the predicted amino acid sequence of SEQ ID NO-592. The P1020C and cDNA amino acid sequences were found to show some similarity to the human endogenous retroviral pol gene HERV-K and protein.

Example 15

Further identification of prostate-specific antigens by m-radium analysis

This example describes the isolation of additional prostate-specific polypeptides from a prostate tumor cDNA library

The human prostate tumor cDNA expression library described above is screened using microarray analysis to identify clones showing at least 3-fold overexpression in prostate tumor and / or normal prostate tumor tissues as compared to normal non-prostate (non-testicular) tissues. 142 clones were identified and sequenced. Some of these clones are in SEQ ID NOS ^: 454 to 467. Of these sequences, SEQ ID NOS: 459 to 460 represent novel genes. Others (SEQ ID NOS: 454-458 and 461-467) correspond to known sequences. Comparison of the detected sequence of SEQ ID NO: 461 with the sequences of the gene bank databases using the BLAST program shows homology to the previously identified Serum 2 transmembrane protease (TMPRSS2). The full-length cDNA sequence for this clone is in SEQ ID NO: 751, with the corresponding amino acid sequence in SEQ ID NO: 752. The cDNA sequence encoding the first 209 amino acids of TMPRSS2 is in SEQ ID NO: 753, with the first 209 amino acids in SEQ. ID N0 ^; 754.

SEQ ID NO: 462 (referred to as P835P) was found to correspond to the previously identified clone FLJI3518 (order number AK023643: SEQ ID NO '· 774), which had no associated open reading frame (ORF). This clone is used to search the database

- 190

Geneseq DNA and to follow a clone previously identified as a G protein-coupled receptor protein (Geneseq DNA Order No. A09351; amino acid Geneseq Order No. Y92365) which is characterized by seven transmembrane domains. The sequences of the fragments between these domains are in SEQ ID NOS: 778 to 785 in SEQ ID NOS: 778, 780, 782 and 784 representing the extracellular domains and SEQ ID NOS: 779, 781, 783 and 785 representing the intracellular domains. SEQ ID NOs: 778 to 785 represent amino acids 1 to 28, 53 to 61, 83 to 103, 124 to 143, 165 to 201, 226 to 238, 263 to 272, and 297 to 381 to P835P. The full-length cDNA sequence for P835P is in SEQ ID NO: 773. The cDNA sequence of the open reading frame for P835P, including the end codon, is in SEQ ID NO: 775, with the open reading frame without the end codon in SEQ ID NO: 776 and the corresponding amino acid the sequence is in SEQ ID NO: 777.

Example 16

Further characterization of prostate specific P710P antigen

This example describes full-length cloning of P710P. The prostate cDNA library described above is screened with the P710P fragment described above. One million colonies were plated on LB / ampicillin plates. Nylon membrane filters were used to pick up these colonies and the cDNAs removed by these filters were denatured and crosslinked to the filters with UV light. The radiolabeled P710P fragment is used for hybridization with filters. Positive cDNA clones were selected and their cDNAs were obtained and sequenced using an Perkin Elmer / Applied Biosystems Division Sequencer automated sequencer. Four sequences are obtained and shown in SEQ ID NOS: 468-471. These sequences appear to represent different variants of the cleaved P710P genes. Subsequent alignments of the P710P CDNA sequences to those in the gene bank show homology to the DD3 gene (gene bank order number AF103907 & AF103908). The DD3 cDNA sequence is in SEQ ID NO: 618.

- 191 Example 17

Protein expression of prostate-specific antigens

This example describes the expression and purification of prostate-specific antigens in E. coli, baculovirus in mammalian and yeast cells.

a) Expression of P501S in E.coli

Full length expression from P501S was tested by first cloning P501S without a leader sequence (amino acids 36-553 in SEQ ID NO: 113) downstream of the first 30 amino acids of the M.tuberculosis antigen Ral2 (SEQ ID NO: 484) in pET17b. In particular, P501S DNA using AW025 (SEQ ID NO: 485) and AW003 (SEQ ID NO: 486) per PCR is used. AW025 is a directionally cloning primer containing a HindIII site. AW003 is an upstream cloning primer that contains an EcoRI site. DNA amplification was performed with 5 µl of lOXPfu buffer, 1 µl of 20 mM dNTP, 1 µΐ of both PCR primers at 10 µM, 40 µΐ of water, 1 µl of Pfu DNA polymerase (Stratagene, La Jolla.CA) and 1 µl of DNA at 100 ng / pl. Denaturation o

at 95 ° C for 30 seconds, followed by 10 ° C cycles of 95 ° C for 30 seconds, 60 ° C for 1 minute, and 72 ° C for 3 minutes, 20 cycles of 95 ° C for 30 sec. C for 1 minute and 72 C for 3 minutes and at least 1 cycle at 72 C for 10 minutes. The PCR product was cloned into Ral2m / pET17b using HindIII and EcoRI. The sequence of the resulting fusion construct (termed Ral2-P501S-F) was confirmed by DNA sequencing.

The fusion construct is transformed into BL21 (DE3) pLysE, pLysS and Codon Plus E. coli (Stratagene) and grown overnight in nutrient LB with kanamycin. The resulting culture is induced by iPTG, the protein is transferred to a PVDF membrane and blocked with 5% non-fat milk (in PBS-Tveen buffer), washed three times and incubated.

- 192 mice with anti-His tag antibody (Clontech) for 1 hour. The membrane is washed three times and treated with HRP-protein A (Zymed) for 30 minutes. Finally, the membrane is washed 3 times and developed with ECL (Amersham). No expression is detected by Western blotting. Similarly, no expression was detected by Western blotting when used to express the Ra12-P501S-F fusion in BL21 CodonPlus CE6 phage (Invitrogen).

N-terminal fragment of P501S (amino acids 36-325 of SEQ ID NO · ^- 113) was cloned in the direction of the first 30 amino acids of the M. tuberculosis antigen Ral2 in pET17b, as follows. P501S DNA was used to perform PCR using primers AW025 (SEQ ID NO: 485) and AW027 (SEQ ID NO = 487). AW027 is an upstream cloning primer that contains an EcoRI site and a terminal codon. DNA amplification is performed essentially as described above. The resulting PCR product was cloned into Ral2 in pET17b at the HindIII and EcoRI sites. The fusion construct (termed Ral2-P501S-N) is confirmed by DNA sequencing.

The Ral2-P501S-N fusion construct is used to express in BL21 (DE3) pLysE, pLysS and CodonPlus, essentially as indicated. Using Western blot analysis, protein bands are observed at an expected molecular weight of 36 kDa. Several bands of high molecular weight are also evident, probably due to aggregation of the recombinant protein. Expression was not detected by Western blotting when Ral2-P501S-F is used for expression in BL21CodonPlus CE6 fage.

A fusion construct comprising the C-terminal portion of P501S (amino acids 257-553 of SEQ ID NO: 113) that is downstream of the first 30 amino acids of M. tuberculosis antigen Ral2 (SEQ ID NO = 484) is prepared as follows. performing PCR using primers AW026 (SEQ ID NO: 488) and AW003 (SEQ ID NO: 486). AW026 is a directionally cloning primer containing a HindIII site. DNA amplification is carried out essentially as described above. The resulting PCR product was cloned into Ral2 in pET17b at the HindIII and EcoRI sites. The sequence of the fusion construct (termed Ral2-P501S-C) is confirmed.

The Ral2-P501S-C fusion construct is used to express in BL21 (DE3) pLysE, pLysS and CodonPlus, essentially as described above. Western blot analysis reveals a small amount of protein with several molecular weight aggregates. Expression is also determined by Western blotting when the Ral2-P501S-C fusion is used to express in BL21CodonPlus induced by the CE6 phage.

A fusion construct comprising a fragment of P501S (amino acids 36 to 298 of SEQ ID NO: 113) located in the li direction. tuberculosis antigen Ral2 (SEQ ID NO = 705) is prepared as follows: P501S DNA is used to perform PCR using primers AWO42 (SEQ ID NO: 706) and AW053 (SEQ ID NO: 707). AW042 is a downstream cloning primer that contains an EcoRI site. AW053 is an upstream and Xhol site upstream primer. DNA amplification is performed essentially as described above. The resulting PCR product was cloned into Ral2 in pET17b at the EcoRI and XhoI sites. The resulting fusion construct (termed Ral2-P5O1S-E2) is expressed in B834 (DE3) pLys S E. coli host cells in TB environment for two hours at room temperature. The expressed protein is purified by inclusion wash and passing through a Ni-NTA column. The purified protein remains dissolved in a buffer containing 20 mM Tris-HCl (pH 8), 100 mM NaCl, 10 mM β-Me, and 5% glycerol. The determined cDNA and amino acid sequences for the expressed fusion protein are in SEQ ID NOs: 708 and 709,

b) Expression of 0501S in baculovirus

Bac-to-Bac baculovirus expression system (BRL Life Technologies Inc) is used to express the P501S protein in insect cells. The full length P501S protein (SEQ ID NO · ^- 113) was amplified by PCR and cloned into the XbaI site of the donor plasmid pFastBacI. The combination bacmid and baculovirus are prepared according to the manufacturer's instructions. Recombinant baculovirus is amplified in Sf9 cells and high titer viral stocks are used to infect High Five cells (invitrogen) to obtain recombinant protein. The identity of the full-length protein was confirmed by N-terminal sequencing of the recombinant protein by Western blot analysis (Fig. 7). 0.6 million High Five cells in 6-well plates are infected with either unrelated BV / EDC-PD control virus (lane 2), recombinant baculovirus for P501S in varying amounts of MOI (lane 4-8) or not infected (lane 3). Cell lysates were run on SDS-PAGE under reducing conditions and analyzed by Western blotting with anti-P501S monoclonal antibody P501S-10E3-G4D3 (prepared as described below). Lane 1 is a molecular weight marker of biotinylated protein (BioLabs).

The localization of recombinant P501S in insect cells is examined as follows: Insect cells expressing P501S are fractionated into core, mitochondria, membrane and cytosol fractions. Equal amounts of protein from each fraction were analyzed by Western blot with monoclonal anti-P501S antibody. Due to the fractionation pattern, the core and mitochondrial fractions contain several components of membrane plasma. However, the membrane fraction is essentially free of mitochondria and nuclei. It is found that P501S is contained in all fractions that contain a membrane component, meaning that P5O1S can be linked to the membrane plasma of insect cells expressing the recombinant protein.

c) Expression of P5O1S in mammalian cells

Full length P501S (553 amino acids, SEQ ID NO: 113) is cloned into various mammalian expression vectors, including pCEP4 (invitrogen), PVR1012 (Vical, SanDiego, CA) and a modified form of the retroviral vector pBMN named pBIB. Transfection of p501S / pCEP4 and P501S / pVR1012 into HEK293 fibroblasts was performed with Fugene transfection reagent (Boehringer Mannheim). Dilute

195 with 2 µl of Fugene reagent in 100 µl of sera free medium and incubated for 5 to 10 minutes at room temperature. This mixture was added to 1 µg of P501S plasmid DRA, stirred briefly and incubated for 30 minutes at room temperature. The Fugene / DNA mixture is added to the cells and incubated for 24 to 48 hours. Recombinant expression of P501S in the converted HEK293 fibroblasts was determined by Western blotting using the monoclonal antibody P501S.

Transfection of p501S / pCEP4 into CHO-K cells (American Type Culture Collection, Rockville, MD) was performed using GenePorter transfection reagent (Gene Terapy Systems, San Diego, CA). Dilute 15 1 1 GenePorter in 500 μΐ of sera-free medium and incubate for 10 minutes at room temperature. The GenePorter / medium mixture is added to 2 µg of plasmid DRA, which was diluted in 500 µl of serum-free medium, stirred briefly and incubated for 30 minutes at room temperature. CHO-K cells are washed in PBS to remove serum proteins, GenePorter / DMA is added and incubated for five hours. An equal volume of 2-fold medium is added to the transfected cells and incubated for 24 to 48 hours.

Analysis of P501S transiently infected cells by FACS reveals surface expression of P501S. Expression was detected using a rabbit polyclonal antiserum against the P501S peptide as described. Flow cytometric analysis was performed using FaCScan (Becton Dickinson) and values were analyzed using Cell Quest.

CHO-K is also used as a pilgrimage only) Expression of P501S in S. cerevisiae

Using the yeast prepro signal sequence, P501S is expressed in membrane-targeted yeast. The natural signal sequence of the first lumenal domain of P501S is deleted to conserve the natural location of the expressed P501S protein.

Η Λ Λ - - - - • - - - - - Í Í Í Í Í

196 and the Prepro signal sequence of S. cerevisiae specifically binds to amino acids 55 to 553 of SEQ ID NO = 113 with a His tagged end cloned into the plasmid pRITI5068 by the CUP1 promoter and transfected into the S. cerevisiae Y1790 strain. The Y1790 strain is Leu + and His-. Protein expression is introduced by the addition of either 500 µl or 250 µΜ of copper sulfate at a temperature of 30 ° C in a minimum of histidine-supplemented medium. Cells are harvested 24 hours after introduction. The extracts were prepared by growing the cells to a concentration of 0D600 5.0 in 50 mM citrate phosphate buffer (pH 4.0) plus 130 mM sodium chloride supplemented with protease inhibitors. Cells are torn using glass beads and centrifuged at 15,000 g for 20 minutes. The recombinant protein is found to be 100% associated pellet.

Expression of the recombinant protein (63 kD) was detected by Westren blot analysis using the anti-P501S monoclonal antibody 10E-D4-G3 described below. The amino acid sequence of the expressed protein is in SEQ ID NO = 792.

The fermentation process for the production of cf prepro P501S-His labeled recombinant protein in S. cerevisiae (strain Y1790-CUP1 induction promoter) is evaluated as follows: In a solid medium of FSC004AA, 100 µl of a base stock containing 2.5x10 ^s cells / ml transformed with S is ground. .cerevisiae Y1790. FSC004AA has the following composition: glucose 10 g / L; sodium uolybdate dihydrate 0.0002 g / l; folic acid 0.000064 g / L; potassium dihydrogen phosphate 1 g / l; manganese sulfate monohydrate 0.0004 g / l; inositol 0.064 g / l: magnesium sulfate heptahydrate 0.5 g / l; boric acid 0.0005 g / L; pyridoxine 0.008 g / L; calcium chloride dihydrate 0.1 g / l; potassium iodide 0.0001 g / l; thiamine 0.008 g / L; sodium chloride 0.1 g / l cobalt chloride hexahydrate 0.00009 g / l; niacin 0.000032 g / L; ferric chloride hexahydrate 0.0002 g / l; riboflavin 0.000016 g / L; calcium pantothenate 0.008 g / l; copper sulfate pentahydrate 0.00004 g / l: biotin 0.000064 g / l; para-aminobenzoic acid

- 197 0.000016 g / l: zinc sulfate heptahydrate 0.0004 g / l; ammonium sulfate 5 g / l; 18 g / L agar; histidine 0.1 g / l,

Incubate two plates at 26 ° C for 26 hours. These solid precultures are harvested in 5 ml of liquid medium PSC007AA and 0.5 ml (or 9.3 x ^{10 7} cells) of this suspension is used to inoculate two liquid precultures.

PSC007AA has the following composition: glucose 10 g / l; sodium molybdate dihydrate 0.0002 g / l; folic acid 0.000064 g / L; potassium dihydrogen phosphate 1 g / l; manganese sulfate monohydrate 0.0004 g / l; inositol 0.064 g / L; magnesium sulfate heptahydrate 0.5 g / L; boric acid 0.0005 g / L; pyridoxine 0.008g / L; calcium chloride dihydrate 0.1 g / l; potassium iodide 0.0001 g / l; thiamine 0.008 g / L; sodium chloride 0.1 g / l; cofoalt chloride hexahydrate 0.00009 g / l '; niacin 0.000032 g / L; ferric chloride hexahydrate 0.0002 g / l; riboflavin 0.000016 g / L; calcium pantothenate 0.008 g / l; copper sulfate pentahydrate 0.00004 g / l: biotin 0.000064 g / l; para-aminobenzoic acid 0.000016 g / l: zinc sulfate heptahydrate 0.0004 g / l; ammonium sulfate 5 g / l; histidine 0.1 g / l.

These precultures were kept for 20 hours in two-liter flasks containing 400 ml of FSC007AA medium to obtain an OD of 1.8. These precultures have the following additional characteristics: pH 2.8: glucose 2.3 g / l; ethanol 3.4 g / l.

The best timing for liquid precultures for strain Y1790 is determined by preliminary experiments. Liquid precultures containing 400 ml medium and inoculated with different volumes of Master Seed (0.25, 0.5, 1 or 2 ml) are monitored to determine the best seed size and timing. Between 16 and 23 hours of culture, glucose, ethanol, pH, OD and cell number (as determined by flow cytometry) are followed. Glucose and biomass consumption is obtained after 20 hours of incubation with 0.5 inoculum. These conditions were chosen to transfer the preculture to the fermentation.

A total of 800 ml preculture was used to inoculate a 20 L fermenter containing 5 L of FSC002AA medium. Before inoculation, 3 ml of irradiated antifoams were added. The FSC002AA environment has the following composition: ammonium sulfate 6.4 g / L; sodium molybdate dihydrate 2.05 mg / L; folic acid 0.54 mg / L; potassium dihydrogen phosphate 8.25 g / L; manganese sulphate monohydrate 4.1 mg / l; inasitol 540 mg / L; magnesium sulfate heptahydrate 4.69 g / L; boric acid 5.17 mg / L; pyridoxine 68 mg / L; calcium chloride dihydrate 0.92 g / l; potassium iodide 1.03 mg / L; thiamine 68 mg / L; sodium chloride 0.06 g / l; cobalt chloride hexahydrate 0.92 mg / L; niacin 0.27 mg / L; hydrochloric acid 1 ml / L; ferric chloride hexahydrate 9.92 mg / L; riboflavin 0.13 mg / L copper sulfate pentahydrate 0.41 mg / L; glucose 0.14 g / L; calcium pantothenate 68 mg / L; zinc sulfate heptahydrate 4.1 mg / L; biotin 0.54 mg / L; para-aminobenzoic acid 0.13 mg / L; histidine 0.3 g / l.

The carbon source (glucose) is delivered by the continuous introduction of FFBO04AA. The FFB004AA environment has the following composition: glucose 350 g / L; sodium molybdate dihydrate 5.15 mg / L; folic acid 1.36 mg / L; sludge dihydrogen phosphate 20.6 g / l; manganese sulphate monohydrate 10.3 mg / l; inositol 1350 mg / L; magnesium sulfate heptahydrate 11.7 g / L; boric acid 170 mg / L; calcium chloride dihydrate 2.35 g / l; potassium iodide 2.6 mg / L; thiamine 170 mg / l and sodium chloride 0.15 g / l; cobalt chloride hexahydrate 2.3 mg / L; niacin 0.67 mg / L; hydrochloric acid 2.5 ml / L; ferric chloride hexahydrate 24.8 mg / L; riboflavin 0.33 mg / L; copper sulfate pentahydrate 1.03 mg / L; biotin 1.36 mg / L and calcium pantothenate 170 mg / L; zinc sulfate heptahydrate 10.3 mg / L; para-aminobenzoic acid 0.33 mg / l: histidine 5.35 g / l.

Occurrence glucose concentration is kept very low (®50

- 199 µg / l) to minimize ethanol production during fermentation. This is achieved by limiting the development of microorganisms by means of a limited supply of glucose. The content of standard biophase (OD 80-90) is achieved in the fermentation after a 44-hour growth phase.

The CUP1 promoter is then introduced by adding 500 μ 500 of copper sulfate to produce the P501S antigen. Addition of copper sulfate is followed by an accumulation of ethanol (up to 6 g / l) and the glucose intake is reduced to ethanol consumption. Copper available for microorganisms is monitored by spectrometric determination of copper ion concentration in the nutrient supernatant (DETC method). The fermentation is terminated with copper sulfate during the induction phase to maintain a concentration in the range of 150 to 250 μΜ in the supernatant. The biomass reaches OD 100 at the end of induction. Cells are harvested after 8 hours of induction.

The cell homogenate was prepared and assayed by SDS-PAGE Western Blot according to standard protocols. The major protein band with an expected molecular weight of 62 kD is detected by Western blotting using anti-P501S monoclonal antibodies. Western blot analysis also shows that the major 62KD band is formed progressively from the 30th minute of induction and reaches a maximum after three hours. Antigen production no longer appears between 3 and 12 hours of induction.

The number of French Press passages necessary to extract all anti-gene from the cells is evaluated. One, three and five passes and total cell lysates, cell lysate supernatants and pellets were tested by Western blot. Three passes of the French Press are enough for complete antigen extraction. The antigen is in the insoluble fraction.

e) Expression of P703P in the baculum ir

Digestion of plasmid pCDNA703 with XbaI and HindIII restriction endonucleases yielded a full-length cDNA P703P-DE5 (SEQ ID NO: 326) along with several flanking restriction sites. The resulting restriction fragment (approximately 800 base pairs) binds to the transfer plasmid pFastBacI, which is digested with the same restriction enzymes. The sequence of the insert was confirmed by DNA sequencing. The recombinant transfer plasmid pFB703 was used to carry recombinant bacmid DNA and baculovirus using the Bac-To-Bac baculovirus expression system (BRL Life Technologies). High Five cells are infected with recombinant BVF703 virus as described above to obtain recombinant P7O3P protein.

f) Expression of P788P in E. coli

The truncated, N-terminal portion of P788P (residues 1-644 of SEQ ID NO: 777, termed P788P-N) fused to the C-terminal 6xHis Tag was expressed in E.coli as follows: P788P cDNA was amplified with primers AW080 and AW081 (SEQ. ID NO: 672 and 673). AW080 is a primer cloning in the direction of the NdeI site. AW081 is an upstream cloning primer with an XhoI site. PCR-amplified P788P, as well as the pCRX1 vector, were digested with NdeI and XhoI. The vector and insert bind and transform into a NovaBlue cell. Colonies are randomly screened for the insert and then sequenced. Clone P788P tt6 is identical to the designed construct. The P788P-N tt6 / pCRX1 expression construct is transformed into competent E. coli BL21 CodonPlus-RIL cells. After induction, most cells grow well and reach 0D 600 greater than 2.0 after 3 hours. Coomassie-stained SDS PAGEs show an overexpressed band at approximately 75 kD. Western blot analysis using 6xHisTag confirms that the band is P78SP-N. The determined cDNA sequence for P788P-N is in SEQ ID NO: 674, with the corresponding amino acid sequence in SEQ ID NO: 675.

, 201

f) Expression of P510S in E. coli

The P51OS protein has nine potential transmembrane domains and is predisposed to have a plasmid membrane. The C-terminal protein of this protein and the predicted third extracellular domain of P510S are expressed in E.coli as follows:

The expression construct termed Ral2-P510S-C is selected to have a 6HisTag at the N-terminus, followed by a M. tuberculosis anti Ral2 gene (SEQ ID NO: 676) and a C-terminal portion of P51OS (amino residues 1176-1261 of SEQ ID NO: 538) ). Full length P510S was used to amplify the P510S-C PCR fragment using primers AW056 and AW057 (SEQ ID NOS: 677 and 678). AWO56 is a downstream cloning primer with an EcoRI site. AW057 is an upstream primer with an XhoI end and sites. The amplified P501S and Ral2 / pCRX1 fragment were digested with EcoRI and XhoI and then purified. The insert and vector bind to each other and transform into NovaBlue. Colonies are randomly screened for insert and sequence. For protein expression, the expression construct is transformed into competent cells of E. coli BL21 (DE3) CodonPlus-RIL. Mini induction screening is performed to optimize expression conditions. After induction, cells grow well, reaching an OD of 600 nm greater than 2.0 after three hours. Comassie SDS-PAGE staining shows a highly overexpressed band at approximately 30 kD. Although higher than expected molecular weight, Western blot analysis is positive and this band is a His-tag-containing protein. The optimized culture conditions are as follows: Diluted overnight / day culture (LB + kanamycin + chloramphenicol) in 2xYT (with kanamycin and chloramphenicol) at a rate of 25 ml culture per liter 2xYT. Grow at 37 ° C until OD 600 = 0.6. Remove the fraction as a TO sample. Add in

The cells were collected and stored at -80 ° C for 3 hours.

O

C. The determined cDNA and amino acid sequences for the Ral2-P510S-C construct are in SEQ ID NOs: 679 and 682.

- 202! . >

ID NO: 685 creates the upstream primer of SEQ ID

The P51OS-C expression construct is designed to have 5 added start codon and glycine (GGA) codon, and then a terminal fragment of P510S-C followed by a 6x histidine tag and a stop codon from vector pET28b. The cloning strategy is similar to that of Ral2-P51OS-C, except that the PCR primers used are the same as in SEQ ID NOs: 685 and 686 and the NcoI / XhoI slice in pET28b is used. Primer SEQ

Ncol and the starting codon is added.

NO: 686 creates an XhoI site on the terminal fragment of P510S-C. Clones were confirmed by sequencing. To express the protein, the expression construct is transformed into competent E. coli BL21 (DE3) CodonPlus-RIL cells. An OD600 greater than 2.0 thirty hours after induction is obtained. Comassie SDS-PAGE staining shows a highly overexpressed band at approximately 11 kD. Western blot analysis confirms that this band is P510S-C, as well as N-terminal protein sequencing. The optimized culture conditions are as follows: Diluted overnight / day culture (LB + kanamycin + chloramphenicol) in 2xYT (with kanamycin and chloramphenicol) at a rate of 25 ml of culture per liter of 2xYT and allowed to grow β

at 37 ° C until OD 600 = 0.5. Remove the fraction. Add 1 mM IPTG and allow to grow for 3 hours

C. Cells are packed and stored at -80 ° C

C until clean. The determined cDNA and amino acid sequences for the P51OS-C construct are in SEQ ID NOs: 680 and 683.

as a TO sample at 30

The predicted third extraction of the P51OS primary domain (P51OS-E3; residues 328-676 of SEQ ID NO = 538) is expressed in E.coli as follows: The P510S fragment is amplified by PCR using the primers set forth in SEQ ID NOs: 687 and 688. Primer SEQ ID NO. NO: 687 is a direction primer with an NdeI site for use in ligation into pPDM. Primer SEQ ID NO: 688 is an antisense primer with an added XhoI site for use in ligation to pPDM. The resulting fragment was cloned into pPDM at the NdeI and XhoI sites. Clones were confirmed by sequencing. For protein expression, the clone is transformed into competent E. coli BL21 (DE3) CodonPlus-RIL cells. After induction

203 (d) · t ·) is obtained with a D 600 greater than 2.0 after 3 hours. Comassie SDS-PAGE staining shows a highly overexpressed band at approximately 39 kD and the N-terminal sequence confirms that the N-terminus is P510S-E3. The optimized culture conditions are as follows: • The diluted overnight / day culture (LB + kanamycin + chloramphenicol) in 2xYT (with kanamycin and chloramphenicol) at a rate of 25 ml of culture per liter of 2xYT and grown at 37 o

C until OD 600 = 0.6. Remove the fraction as a TO sample. Add 1 corner of IPTG and grow at 30 ° C for three hours. A T3 sample is taken, cells are packed and stored at e

-80 ° C until clean. The determined cDNA and amino acid sequences for the P510S-E3 construct are in SEQ ID NOs: 681 and 684.

g) Expression of p775S in E. coli

The P775P antigen contains several open reading frames (ORFs). The third ORF encoding protein SEQ ID NO: 483 has the best emotional early. The expression fusion construct containing the M. tuberkulosis antigen Ral2 (SEQ ID NO = 676) and P775P.0RF3 with the 6xHisTag N-terminus was prepared as follows: P775P-0RF3 was amplified using directional PCR primers SEQ ID NO: 689 and upstream PCR primer SEQ ID NO. NO '690. The PCR amplified P775P and Ral2 / pCRXI fragment were digested with the restriction enzymes EcoRI and XhoI. The insert and vector bind to each other and transform into NovaBlue cells. Colonies are randomly screened for the insert and sequenced. The clone having the desired sequence is transformed into competent E. coli BL21 (DE3) CodonPlus-RIL cells. Two hours after induction, peak density of 0D600 reaches about 1.8. Comassie SDS-PAGE staining shows an overexpressed band at approximately 31 kD. Western blot analysis using the 6x HisTag antibody confirms that this band is Ral2-P775P-0RF3. The determined cDNA and amino acid sequences for the fusion construct are in SEQ ID NOs: 691 and 692.

, 204 ,, - ,,,. · ,, - ,,

Η) Expression of HisTag fusion protein P703P in E. coli cDNA for the coding region of P703P was prepared by PCR using primers SEQ ID NOS: 693 and 694. The PCR product was digested with the restriction enzyme EcoRI, gel purified and cloned into the modified vector pET28 with HisTag in a framework that has been digested with the restriction enzymes Eco72I and EcoRI. The correct construct is confirmed by DNA sequence analysis and then transformed into E.coli BL2KDE3) pLys S expression host cells. The determined cDNA and amino acid sequences for the expressed recombinant P703P are in SEQ ID NOs: 695 and 696.

I) Expression of HisTag fusion protein P705P in E. coli cDNA for the coding region of P705P was prepared by PCR using primers SEQ ID NOS: 697 and 698. The PCR product was digested with the restriction enzyme EcoRI, gel purified and cloned into the modified vector pET28 with HisTag in a framework that was digested with the restriction enzymes Eco72I and EcoRI. The correct construct is confirmed by DNA sequence analysis and transformed into E. coli expression host cells (BL2KDE3) pLys S and BNL21 (DE3) CodonPlus. The determined cDNA and amino acid sequences for the expressed recombinant P705P are in SEQ ID NOs: 699 and 700.

J) Expression of HisTag fusion protein P711P in E. coli cDNA for the coding region of P711P was prepared by PCR using primers SEQ ID NOS: 701 and 702. The PCR product was digested with the restriction enzyme EcoRI, gel purified and cloned into the modified vector pET28 with HisTag in a framework that has been digested with the restriction enzymes Eco72I and EcoRI. The correct construct is confirmed by DNA sequence analysis and transformed into E. coli expression host cells (BL2KDE3) pLys S and BL21 (DE3) CodonPlus. The determined cDNA and amino acid sequences for the expressed recombinant P711P are in SEQ ID NOs: 703 and 704. @ LH 4) »3»

3>>

)))))> 3 3> 33 3>

205> J>). i i> i>

'>)>)))) 3 J

Example 18

Preparation and characterization of antibodies against prostate-specific polypeptides

a) Preparation and characterization of polyclonal antibodies against P703P, P5O4S and P509S

Polyclonal antibodies against P703P, P504S and P509S are prepared as follows:

Each prostate tumor antigen expressed in the recombinant E.coli system was grown overnight in LB nutrient solution.

with appropriate antibiotics at 37 ° C in a shaking incubator. The following morning, 10 ml of overnight culture is added to 500 ml of 2xYT plus the appropriate antibiotics in a 2-liter Erlenmeyer flask. When the optical density of the culture (at 560 nm) reaches 0.4 to 0.6, cells with IPTG (1 mM) are induced. Four hours after IPTG induction, cells are harvested by centrifugation. The cells are washed with phosphate buffered saline and centrifuged again. The supernatant is discarded and the cells are either frozen for further use or processed immediately. 20 ml lysis buffer is added to the cell pellets and vortexed. To open E. coli cells, the mixture was then passed through a French Press at 11.04 MPa. The cells are then centrifuged again and the supernatant and pellets are checked by SDS-PAGE for recombinant protein separation. For the proteins on the pellets, the pellets are resuspended in 10 mM Tris, pH 8.0, 1% CHAPS, and the inclusion pellets are washed and centrifuged again. This process is repeated twice. The washed pellets are dissolved in either 8M or 6M guanidine hydrochloric acid containing 10 mM Tris (pH 8.0) plus 10 mM imidazole. The dissolved protein is added to 5 ml of nickel chelate resin (Qiagen) and incubated for 45 minutes to 1 hour at room temperature with stirring. After incubation, the resin and protein are passed through a disposable column and the flow rate is collected. The column is washed with respect to the column of 10 to 20 volumes of solubilizer and the starting buffer. The antigen was eluted from the columns using 8M urea, 10 mM Tris PpH 8.0 and 300 mM imidazole and collected in 3 ml fractions. To determine which fraction was used for further purification, gel DS-PAGE was run.

As a final purification operation, a strong anion exchange resin such as HiPrepQ (Biorad) is equilibrated with a suitable buffer and the fractions obtained above are loaded into a column. Each antigen was eluted from the column with increasing salt gradient. Fractions were collected after passing through the column and another SDS-PAGE gel was run to determine which fraction from the column was collected. The collected fractions were dialyzed against 10 mM Tris pH 8.0. Proteins are then passed through a 0.22 micron filter after filtration and the antigen is frozen until use.

500 micrograms of each prostate antigen are combined with 10 micrograms of muramyldipeptide (MDP). Every 4 weeks, rabbits were boosted with 100 µg of mixed with an equal volume of incomplete Freund's Adjuvant (IFA). Seven days after each increase, animals are bled. Sera are generated by incubating blood at

at 4 ° C for 12 to 4 hours followed by centrifugation.

96-well plates are coated with the antigen by incubating 50 microliters (usually 1 µg) of recombinant protein for 20 hours.

250 .mu.l of BSA blocking buffer was added to the wells and incubated for two hours at room temperature. Wash plates 6x with PBS / 0.01% Tween. The rabbit serum is diluted in PBS. 50 µl of diluted serum is added to each well and incubated for 30 minutes at room temperature. Plates are washed as described before adding 50 µl goat anti-rabbit horseradish peroxidase (HRP) at a dilution of 1 = 10,000 and incubated for 30 minutes at room temperature. The plates are washed again as described above and 100 µl of TBM microvell peroxidase substrate is added to each well. After incubation in the dark for 15 minutes at room temperature, the colorimetric reaction is terminated by driving 100 μΐ of 1N sulfuric acid with immediate reading at 450 nm. All polyclonal antibodies show immunoreactivity to the respective antigen.

b) Preparation and characterization of P501S antibodies

Mouse monoclonal antibodies directed against the carboxy-terminus for prostate-specific P510S antigen were prepared as follows:

A truncated P510S fragment (amino acids 355-526 of SEQ ID NO = 113) was generated and cloned into the pET28b vector (Novagen) and expressed in E. coli as a thioredoxin fusion protein with a histidine tag. The trx-P510S fusion protein is purified by nickel chromatography, digested with thrombin to remove the trx fragment, and further purified by acid precipitation, followed by reverse phase HPLC.

Mice are immunized with a truncated P501S protein. Serum mixtures of mice containing potential anti-P510S polyclonal sera are tested for specific reactivity by P510S ELISAs with purified P510S and trx-P501S proteins. Serum mixtures appearing to specifically react with P510S are then screened by Western blot analysis for the P510S reactivity. Mice containing the antibody component specific for P510S are sacrificed and spleen cells are used by known methods to generate hybridomas producing anti-P510S antibody. Hybridoma supernatants are assayed first for specific reactivity of P51OS by ELISA and then by FACS analysis for reactivity with P51OS-converted cells. Based on these results, the monoclonal hybridomas designated 10E3 are selected for further subcloning. A series of subclones tested for specific reactivity of P510S were generated using an ELISA assay and typed for IgG isotype. The results of this analysis are shown in Table V. Of the 16 subclones tested, the results were for the next

S> f * 'xx ^ -;> í>>,>, - "208,7)), 1) i S; T T>

The antibody 10E3-G4-D3 will select the study.

Table V Isotype analysis of murine antx-P510S monoclonal antibodies

K1on hybrid at home Isotype Determined [1g] in supernatant (^ g / mi: 4D11 lgGl 14.6 1G1 lgGl 0, 6 4F6 lgGl 72.0 4H5 lgGl 13, 8 4H5-E12 lgGl 10, 7 4H5-EH2 lgGl 9.2 4H5-H2-A10 lgGl 10, 0 4H5-H2-A3 lgGl 12, 8 4H5-H2-A10-G6 lgGl 13, 6 4H5-H2-B1i lgGl 12, 3 10E3 1 gG2a 3.4 10E3-D4 lgG2a 3, 8 10E3 - D4 - G3 1 gG2a 9.5 10E3 - D4 - G6 lgG2a 10.4 10E3-E7 lgG2a 6.5 8H12 lgG2a 0, 6

The specificity of 10E3-G4-D3 for P51OS is examined by FACS analysis. Cells were fixed (2% formaldehyde, 10 min), permeated (0.1% saponin, 10 min) and stained with 10E3-G4-D3 at 0.5-1 µg / ml followed by incubation with secondary, FITC- conjugated goat anti-mouse Ig antibody (Pharmingen, San Diego, CA). Cells are analyzed for FITC fluorescence using a fluorescent activated cell sorter Excalibur. For FACS analysis of the converted cells, B-LCL is retrovirally transformed with P510S. For analysis of infected cells, B-LCL is infected with a vaccine vector that expresses P510S. B-LCL converted with different antigen (P70SP) and uninfected B-LCL vectors were used to demonstrate the specificities in these assays. As shown, 10E3-G4-D3 binds to P51OSA-converted B-LCL as well as P51OS-infected B-LCL, but neither to uninfected cells nor to P510S-converted cells.

To determine whether the epitope, identified by 10E3-G4-D3, is on the surface or in intracellular portions of cells, B-LCL is converted by P510AS or HLA-B as a control antigen and either fixed or permeabilized as described above or directly stain 10E3-G4-D3 and analyze as above. Specific cognition of P510S 10E3-G4-D3 was found to require permeation, suggesting that the epitope recognized by this antibody is intracellular.

The reactivity of 10E3-G4-D3 with the three prostate tumor cell lines Lncap, PC-3 and DU-145, which are known to express high, medium and low levels of P510S, is examined by permeabilizing the cells and processing them as above. Higher reactivity of 10E3-G4-D3 is evident with the Lncap line than with PC-3, which shows higher reactivity than DU-145. These results agree with real time PCR and show that the antibody specifically recognizes P510S in these tumor cell lines, and that the epitope identified in the tumor cell lines is also intracellular.

The specificity of 10E3-G4-D3 for p51OS is also demonstrated by Western blot analysis. Lysates are generated from Lncap, PC-3 and DU-145 tumor cell lines from P510S transiently transfected HEK293 cells and from non-transfected HEK293 cells. Western blot analysis of these lysates with 10E3-G4-D3 revealed 46 kDa of immunoactive binding between transfected HEK cells Lncap, PC-3 and DU-145, but not in DU-145 cells or non-transfected HEK293 cells. Expression of P501S mRNA is cosistent with these outbreaks, as the semi-quantitative PCR analysis showed that P501S mRNA is expressed in Lnap, in a better but clear

- í f W f JS JS-«- W W W W W)))))))))

J · 1 I> -I>

í 1)>) ‘i>

printable level in PC-3 cells and not at all in DU-245 cells. Bacterially expressed and purified 0501S (designated P501SStr2) is recognized (24 kDA) of 10E3-G4-D3 as well as full length P501S, which was transiently expressed in HEK293 cells using the VR1012 or pCEP4 expression vector. Although the predicted molecular weight of P501S is 70.5 kD, both transfected and native P501S slightly reduce mobility due to the hygroscopic nature.

Immunohistochemical analysis is performed on a prostate tumor and a panel of sections of normal tissues (prostate, adrenal, brain, colon, gallbladder, intestinal obstruction, kidney, ovary, pancreas, parotid gland, skeletal muscle, spleen and testes). Tissue samples are mounted for 24 hours in a formalin bath and embedded in paraffin to cut into 10 micron slices. Tissue sections are permeabilized and incubated for one hour with 10E3-G4-D3. HRP-labeled anti-mouse after DAB incobation was used to detect immunoreactivities

P501S. P501S is found to be highly expressed in both normal prostate and prostate tumor tissue, but is not detected in any other tissue tested.

with a chroraogen antibody

To identify the epitope identified 10E3-G4-D3, epitope mapping is followed. 13 overlapping meres (5 amino acid overlap to SEQ ID NO · 489-501) are synthesized which overlap the P501S fragment used to generate 10E3-G4-D3. Flat-bottom 96-well microtiter plates are coated with both peptides and P501S fragment used to immunize mice at 1 Mg / ml for two hours at 37 ° C. The wells were aspirated and blocked with phosphate buffered saline containing 1% (w / v) BSA for two hours at room temperature, then washed with PBS. containing 0.1% Tween 20 (PBST). The purified 10E3-G4-D3 antibody is added at a double dilution (1000 ng to 16 ng) in PBST and incubated for 30 minutes at room temperature. Six washes of PBST followed by incubation with HRP-conjugated donkey against mouse IgG (H + L) Affinipure F (ab) fragment (Jackson Immunoresearch, West Grove.PA) at 1: 20,000 for 30 minutes. Plates are washed and incubated for 15 minutes in tetramethylbenzidine. The reaction is terminated by the addition of 1N sulfuric acid and the plates are read at 400 ng using an ELISA plate reader. As shown in Figure 8, the reactivity is evident with the peptide of SEQ ID NO: 496 (corresponding to amino acids 439 to 459 of P501S) and the P501S fragment, but not with the remaining peptides, indicating that the epitope identified by 10E3-G4-D3 is located at amino acids 439 to 459 of SEQ ID NO: 113.

To further evaluate the tissue specificity of P501S, multinucleated immunohistochemical analysis is performed on approximately 4700 different human tissues, including most normal organs as well as neoplasia derived from these tissues. Sixty-five of these human tissue samples are from the prostate. Tissue sections of 0.6 mm thickness are fixed in formalin and embedded in paraffin. The samples were re-treated with HIER using 10 mM citrate buffer (pH 6.0) and boiled for 10 minutes. The samples were stained with 10E3-G4-D3 and the immunoreactor P501S was visualized using HRP. All 65 prostate tissue samples (5 normal, 55 untreated prostate tumors, 5 hormone refractory prostate tumors) are positive, showing distinct perinuclear staining. All other tissues examined are negative for expression of P501S.

c) Preparation and characterization of P503S antibodies

The P503S fragment (amino acids 113-241 of SEQ ID NO: 114) is expressed and purified essentially from bacteria, as described above for P501S, and used to immunize rabbits and mice. Mouse monoclonal antibodies are isolated by standard hybridoma technology as described above. Rabbit monoclonal antibodies were isolated using the method of selected lymphocyte antibodies (Selected Lymphocyte Antibobody Method, SLAM) (Imm &lt; RTI ID = 0.0 &gt; W = &lt; / RTI &gt; Table VI lists the monoclonal antibodies developed against P501S.

Table VI

Opposite Species 2OD4 rabbit JA1 rabbit 1A4 mouse 1C3 mouse 1C9 mouse 1D12 mouse 2A11 mouse 2H9 mouse 4H7 mouse 8A8 mouse 8D1O mouse 9C12 mouse 6D12 mouse

DNA sequences encoding the complementarity determining region (CDR) for rabbit monoclonal antibodies 20D4 and JA1 are determined and are in SEQ ID NOs: 502 and 503.

To better define the epitope of the binding region of each antibody, a series of overlapping peptides comprising amino acids 109 to 213 of SEQ ID NO: 114 are generated. These peptides are used to map anti P501S monoclonal antibodies by ELISA: The recombinant P503S fragment used as an immunogen was used as positive controls. 96-well plates are coated with either 20 ng / well peptide or recombinant antitigen and left overnight at 0 ° C.

The plates are aspirated and blocked with phosphate buffered saline containing 1% (w / v) BSA, two throws - 213) for 3 hours at room temperature, then washed with PBS containing 0.1% Tween 20 (PBST). . Purified rabbit monoclonal antibodies, diluted with PBST, are added to the wells and incubated for 30 minutes at room temperature. This is followed by a 6x PBST wash and incubation for 30 minutes with a 1: 2000 protein-A HRP conjugate. Plates are washed 6 times in PBST and incubated with tetramethylbenzidine substrate (TMB) for an additional 15 minutes. The reaction is terminated by the addition of 1N sulfuric acid and the plates are read at 450 nm with an ELISA plate reader. ELISA is performed with murine monoclonal antibodies with tissue culture supernatants.

All antibodies bind to the recombinant P503S fragment except the negative control SP2 supernatant. 20D4, JA1 and 1D12 bind strictly to peptide # 2101 (SEQ ID NO = 504), corresponding to amino acids 151 to 169 of SEQ ID NO-114. 1C3 binds to peptide # 2102 (SEQ ID NO ^; 505), corresponding to amino acid 1 others 165 to 184 of SEQ ID NO: 114. 9C12 binds to peptide # 2099 (SEQ ID NO = 522), which corresponds to amino acids 120 to 139 of SEQ ID NO: 114. Other antibodies bind regions that have not been investigated in these studies. .

After mapping epitopes, antibodies are assayed by FACS analysis on a cell line that stably expresses P503S to confirm that the antibodies bind to cell surface epitopes. Stably transfected cells with a control plasmid were used as negative controls. Cells are stained alive without fixative. 0.5 µg of anti P503S monoclonal antibody is added and the cells are incubated on ice for 30 minutes before washing twice and incubating for 20 minutes with FITC-labeled secondary goat anti-rabbit or mouse antibody. After washing twice, the cells are analyzed by a cell fluorescent activated Excalibur sorter. Monoclonal antibodies 1C3, 1D12, 9C12, 20D4 and JA1 but not 8D3 were found to bind to the cell surface epitope P503S.

To determine which tissue expresses P503S, immuno-214 is performed, a histochemical analysis, essentially as described above, on a panel of normal tissues (prostate, adrenal, brain, colon, cervix, twelfth, gallbladder, ileum, kidney, Ovarian, pancreas, parotid, skeletal muscle, spleen and testes) HRP-labeled anti-mouse and anti-rabbit antibodies were used to visualize immunoreactivities of those P503S followed by incubation with TMB. P503S is found to be highly expressed in prostate tissue, less expression is observed in the cervix, colon, ileum and kidney and no expression is observed in adrenal, breast, duodenal, gallbladder, ovary, pancreas, parotid, parotid, skeletal, muscles, spleens and testes.

Western blot analysis was used to characterize the monoclonal and anti-substance specificity of P503S. SDS-PAGE is performed on recombinant (rec) P503S expressed in bacteria and purified from bacteria and on lysates from HEK293 cells transfected with full length P503S. The protein is transferred to nitrocellulose and analyzed by Western blotting with each of the anti-P503S monoclonal antibodies (20D4, JAi, 1D12, 6D12, and 9C12) at an antibody concentration of 1 µg / ml. The protein is detected by horseradish peroxidase (HRP) conjugated to a goat anti-ray monoclonal antibody or protein A-sepharose. Monoclonal antibody 20D4 detects the appropriate molecular weight of 14 kDa recombinant P5O3S (amino acids 113-241) and 23.5 kDa in HEK293 cell lysates transfected with full-length P503S. Other anti-P503S monoclonal antibodies show similar Western blot specificity.

d) Preparation and characterization of P703P antibodies

Rabbits are immunized with either garbled (P703Ptr1; SEQ ID NO · 172) or full-length mature form (P703Pf1, SEQ ID NO ·^- 523) or a recombinant P703P protein expressed in purified form from bacteria as described above. The affinity of the purified pollen-215 clonal antibody is generated using a P703Pf1 or P703Ptr1 immunogen coupled to a solid support. Rabbit monoclonal antibodies are isolated using SLAM technology (Immgenics Pharmaceuticals). Table VII is a list of polyclonal and monoclonal antibodies generated against P703P.

Table VII

Antibody Immunogen Type / type Aff.Clean.P703P (garbled) # 2594 P703Ptrl polyclonal rabbit Aff.Clean.P703P (length) # 9245 P703Pf1 rabbit rabbit 2D4 P703Ptrl monoclonal rabbit 8H2 P703Ptrl monoclonal rabbit 7H8 P703Ptrl monoclonal rabbit

The DNA sequences encoding the complementarity determining regions (CDRs) for the rabbit monoclonal antibody 8H2, 7H8 and 2D4 were determined and are in SEQ ID NOs: 506 to 508.

Epitope mapping studies as described above are performed. The monoclonal antibodies 2D4 and 7H8 were found to specifically bind peptides SEQ ID NO: 509 (corresponding to amino acids 145-159 of SEQ ID NO: 172) and SEQ ID NO: 510 (corresponding to amino acids 11-25 of SEQ ID NO: 172). Polyclonal antibody 2594 binds peptides of SEQ ID NOs: 511 to 514, with polyclonal antibody 9427 binding peptides of SEQ ID NOs: 515 to 517.

The specificity of anti-P703P antibodies was determined by the Wester blot method:

SDS-PAGE (1) was performed on bacterially expressed recombinant antigen; (2) lysates of HEK293 cells and cells «ΜΜμΜΜΗΜΜΜΜ ^^ -» · ^.........: • - 216 Ltk untransfected or transfected with expressing plasmid The full-length P703P; and (3) a supernatant isolated from these cells. The protein was transferred to nitrocellulose and subjected to Western blotting using anti-P703P polyclonal antibody # 2594 at an antibody concentration of 1 µg / ml. The protein is detected by horseradish peroxidase (HRP) conjugated to an anti-rabbit antibody. A 35 kDa immunoreactive band with recombinant P703P was observed. Recombinant P703P occurs at a slightly higher molecular weight as it is a labeled epitope. In lysates and supernatants from transfected full-length P703P cells, a 30 kD band corresponding to P703P is seen. Lysates from HEK293 cells stably transfected with a control plasmid are also tested for specificity and are negative for P703P expression. Other anti-P7O3β antibodies show similar results.

Immunohistochemical studies as described above were performed using an anti-P703P antibody. P703P is found to be highly expressed in normal prostate and prostate tumor tissue but is not detectable in all other tissues examined (breast, lung and normal kidney).

e) Preparation and characterization of P504S antibodies

It is expressed and purified from full length P504S (SEQ ID NO: 108) as described above for P501S, and used to raise rabbit monoclonal antibodies using the selected lymphocyte antibody (SLAM) method (Immgenics Pharmaceutical, Vancouver, BC, Canada) ). Western blot analysis revealed that the monoclonal anti-P504S 13H4 antibody binds to both expressed P504S and native P504S in tumor cells.

Immunohistochemical studies as described above are performed using 13H4 to assess expression of P504S in various prostate tissues. Monoclonal P5O4S antibody 13H4 stains a total of 104 cases, including 65 cases of radical prostatectomy with prostate cancer (PC), 26 cases of prostate biopsy and 13 cases of benign prostatic hyperplasia (BPH), P504S shows strong cytoplasmic glanular staining at 64/65 (98.5 PC50 in prostatectomy and 26/26 (100 PC in prostate biopsies. P504S stains strongly and diffuse in carcinomas (4+ in 91.2% PC cases; 3+ in 5.5%; 2+ in 2.2%) and 1+ in 1.1%) and high grade prostate intraepithelial neoplasia (4+ in all cases) P504S expression does not change with Gleson score Only 17/91 (18.7%) in NP / BPH cases around PC and 2/13 (15.4%) cases of BPH are focal (1+, not 2+ to 4+ in all cases) and weekly positive for P504S in the large glands P5O4S expression is not in small altrophic glands, prostatropic hyperplasia, hyperplasia basal cells and in transit cell metaplasia in each biopsy Thus, P504S appears to be overexpressed in all Gleason prostate cancer scores (98.5-100% sensitivity) and shows only focal positives in the large normal glands in 19/104 cases (82.3% specificity). These findings suggest that P504S can be successfully used to diagnose prostate cancer.

Example 19

Characterization of cell surface expression and location of prostate-specific P501S antigen chromosomes

This example describes studies demonstrating that the prostate-specific P501S antigen is expressed on the cell surface, along with studies to determine the likely chromosomal location of P501S.

It is predicted that P501S (SEQ ID NO: 113) has 11 transmembrane domains. Based on the discovery that the epitope identified by the anti-P501S monoclonal antibody 10E-G4-D3 (described in Example 17) is intracellular, it is believed that subsequent transmission of the 1818β gate determinants would allow prediction of the extracellular domains of P501S. Figure 9 is a schematic representation of the P5O1S protein showing the predicted location of the transmembrane domains and intracellular epitope described in Example 17. The underlined sequences represent the predicted transmembrane domains, the bold sequences represent the predicted extracellular domains, and italicized sequences represent the predicted intracellular domains. The underlined and bold sequences is the sequence used to generate polyclonal rabbit serum. The location of the transmembrane domains was predicted using the HHMTOP described by Tusnady and Simon (Principles Governing Amino Acid Composition of Integral Membrane Protein: Application to Topology Prediction, J. Mol. Biol. 283: 489-506, 1998).

Referring to Figure 9, it is predicted that the P501S domain flanked by the transmembrane domains of the corresponding amino acids 274-295 and 323-342 is extracellular. The peptide of SEQ ID NO · 518 corresponds to amino acids 306 to 320 of P501S and lies within the predicted extracellular domain. The peptide of SEQ ID NO: 519, which is identical to the peptide of SEQ ID NO = 518, with the exception of histidine substitution with asparginine, is synthesized as described above. Cys-Gly is added to the C-terminus of the peptide to facilitate conjugation to a carrier protein. Cleavage of the peptide from the solid support is accomplished by the following cleavage mixture ^: trifluoroacetic acid: ethanediol · thioanisole: water 'phenol (40 = 1 · 2: 2 3). After two hours of cleavage, the peptide is precipitated into cold ether. The peptide pellet was dissolved in 10% v / v acetic acid and lyophilized prior to purification by C18 reverse phase HPLC. A gradient of 5 to 60% acetonitrile (containing 0.05% trifluoroacetic acid) in water (containing 0.05% trifluoroacetic acid) was used to elute the peptide. The purity of the peptide was verified by HPLC and mass spectrometry to be &gt; 95%. The purified peptide is used to generate a rabbit polyclonal antiserum as described above.

Surface expression of P501S is examined by FACS analysis. Cells are stained with anti-P501S polyclonal peptide serum at 10 µg / ml, washed, incubated with secondary FITC-conjugated goat anti-rabbit IgG (ICN), washed and FITC fluorescence detected by Excalibur cell sorter fluorescence. For FACS analysis of transduced cells, B-LCL is retroviral transduced with P501S. To demonstrate the specificity of these assays, B-LCL transduced or nonrandranded with irrelevant antigen (P703P) is stained in parallel. Lncap, PC-3 and DU-145 are used to analyze FACS lines of prostate tumor cells. Prostate tumor cell lines are dissociated from tissue culture plates using a cell dissociation medium and stained as above. All samples were processed prior to FACS analysis with propidium iodide (PJ) and data were obtained from PJ-secreted cells (i.e., intact and nonperformed). Rabbit polyclonal serum raised against the peptide of SEQ ID NO: 519 is found to specifically recognize the surface of cells transduced to express P501S, demonstrating that the epitope recognized by polyclonal serine is extracellular.

To biochemically determine whether P501S is expressed on the cell surface, membranes are isolated from Lncap cells and subjected to Western blot analysis. Specifically, Lncap cells are lysed using a hofflogenizer in 5 ml homogenization buffer (250 mM sucrose, 10 mM HEPES, 1 mM EDTA, pH 8.0, 1 complete protease inhibitor tablet (Boehringer Mannheim)). The lysate samples were a

centrifuge at 1000 g for 5 minutes at 4 ° C. The supernatant is then centrifuged at 8000 g for 10 minutes at 4 ° C. The supernatant from 8000 g centrifugation is recovered and centrifuged at 100,000 g for 30 minutes at 4 ° C to obtain a surface membrane. . Samples were separated by SDS PAGE and subjected to Western blot analysis with the mouse monoclonal antibody 10E3-G4-D3 (described in Example 17) under the conditions described above. Recombinant purified P501S and HEK293 cells transfected with overexpressed 2204, 5, 6, 7, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9 , will be incorporated as positive controls to detect P501S. LCL cell lysate is included as a negative control. P501S could be detected in total cell lysate Lncap, in a fraction of 8000 g (inner membrane) and also in a fraction of 100,000 g (plasma membrane). The results indicate that P501S is expressed at and localized to the outer membrane.

To demonstrate that rabbit polyclonal serum, produced by the peptide of SEQ ID NO = 519, specifically recognizes this peptide, as well as the corresponding native peptide of SEQ ID NO = 518, ELISA assays are performed. For these assays, flat bottom 96-well microplate wells were coated with either peptide SEQ ID NO: 519, the longer peptide SEQ ID NO: 520, which occupies the entire predicted extracellular domain, peptide SEQ ID NO: 521, which represents the epitope recognized by antibody 10E3. -G4-D3 specific for P501S, or a P501S fragment (corresponding to amino acids 355-526 of SEQ ID NO: 113) that does not include an immunizing peptide sequence, at 1 µg / ml for two hours at 37 ° C. with phosphate buffered saline containing 1% (w / v) BSA for two hours at room temperature and then washed with PBS containing 0.1% Tween 20 (PBST). Add purified anti-P501S polyclonal rabbit serum at two dilutions (1000 ng to 125 ng) in PBST and incubate for 30 minutes at room temperature. This is followed by a 6-fold washing of PBST and incubation with HRP-conjugated goat anti-rabbit IgG (H + L) Affinipure F (ab) fragment at 1 = 20,000 for 30 minutes. The infants were washed and incubated for 15 minutes in tetramethylbenzidine. The reaction is terminated by the addition of 1N sulfuric acid and the cells are read by an ELISA plate reader. As seen in Figure 11, polyclonal rabbit serum anti-P501S specifically recognizes the peptide of SEQ ID NO: 519 used for immunization as well as the longer peptide of SEQ ID NO: 520, but does not recognize irelevan peptides and fragments derived from P501S.

In further studies, rabbits are immunized with peptides derived

221 from the P5O1S sequence and determined to be extracellular or intracellular as shown in Figure 9. Polyclonal rabbit sera are isolated and serum polyclonal antibodies purified as described above. FACS analysis was used to determine specific reactivity with P501S, using either B-LCL transduced with P501S or an irrelevant antigen P703P, B-LCL infected with pox virus expressing »P501S. For surface expression, dead or non-intact cells are excluded from the assay as described above. For intracellular staining, cells are fixed and permeabilized as described above. The rabbit polyclonal serum generated against the peptide of SEQ ID NO: 548, which corresponds to amino acids 181-198 of P501S, recognizes the surface epitope of P501S. Rabbit polyclonal serum generated against the peptide of SEQ ID NO = 551, which corresponds to amino acids 543 to 553 of P501S, recognizes an epitope that was potentially extracellular or intracellular because in various experiments intact or permeable cells were identified by polyclonal sera. Based on deduction, the sequences of SEQ ID NOs: 541 to 547, 549, and 550 that correspond to amino acids 109 to 122, 539 to 553, 509 to 520, 37 to 54, 342 to 359, 295 to 323, 217 to 274, 143 to 160 and 75 to 88 of P501S, considered to be potential surface epitopes of P501S identified by antibodies.

In further studies, murine monoclonal antibodies against amino acids 296 to 322 to P521S are predicted to be in the extracellular domain. A / J mice are immunized with P501S adenovirus followed by further enhanced recombinant E.coli protein, designated P501N, which contains amino acids 296-322 of P501S and peptide 296-322 (SEQ ID NO: 755) coupled to KLH. The mouse is then used for fusion of spleen B cells to form anti-peptide hybridomas. The resulting three clones, designated 4F4 (IgG1, kappa), 4G5 (IgG2a, kappa) and 9B9 (IgG1, kappa) were grown to produce antibody. The 4G5 mAb was purified by passing the supernatant through a Protein A-Sepharose column followed by elution of the antibody using 0.2 M glycine, pH 2.3. Cleaned

The pH of 222 antibody is neutralized by addition of 1M Tris HCl, and the buffer is changed to PBS.

For ELISA analysis, 96-well microplates are coated with peptide P501S 296-322 (called long P501), irrelevant peptide P775, P501S-N, P501TR2, P501S-long-KLH, peptide P501S 306 to 319 (named short) P501-KLH or irrelevant 2073-KLH peptide, all at a concentration of 2 µg / ml and incubated with a

The plates were washed with 5X PBS + 0.1% Tween and blocked with PBS, 0.5% BSA, 0.4% Tween 20 for two hours at room temperature. After addition of supernatants or purified mAbs, the plates are incubated at room temperature for 60 minutes. Plates are then washed and donkey anti-mouse IgHRP bound second antibody is added and incubated for 30 minutes at room temperature followed by a final wash as above. TMB peroxidase substrate is added and incubated in the dark for 15 minutes at room temperature. The reaction is terminated by the addition of 1N sulfuric acid and the OD is read at 450 nM. In all three hybrid clones, mAbs that recognize peptide 296 to 322 and recombinant protein P501N are secreted.

For FACS analysis, HEK293 cells are transiently transfected with P501S / VR1012 expression constructs using Fugene 6 reagent. After two days of culture, cells are harvested and washed, then incubated! with purified 4G5 mAb for 30 minutes on ice. After several washes with PBS, 0.5% BSA, 0.01% azide, goat anti-mouse Ig-FITC was added to the cells and incubated for 30 minutes on ice. Cells are washed and resuspended in wash buffer containing 1% propidium iodide and subjected to FACS assays. These analyzes confirm that amino acids 296-322 of P501S are in the extracellular domain and are expressed on the cell surface.

Chromosomal placement of P501S is determined using a Gene-Bridge 4 Radiation Hybrid panel (Research Genetics). The PCR primers SEQ ID NOS: 528 and 529 were used in PCR with DNA sets from the hybrid

- 223 panel according to the manufacturer's instructions. After 38 amplification cycles, the reaction products are separated on a 1.2% agar gel and the results are analyzed by the Sereverea Whitehead Institute / MIT Center for Genoae Research (http: //www.genome. Wi.mít.edu / cgi-bin / contig / rhmapper) (pl) to determine the likely location of chromosoa. By this approach, P5O1S is mapped to the long arm of chroaosome 1 at WI-9641 between q32 and q42. This region of chroaosome 1 has been linked to susceptibility to prostate cancer in hereditary prostate cancer (Smith et al. Science 274, 1371-1374, 1996; Berton et al (AJ Hum. Genet. 62: 1416-1424, 1998) These results suggest that P501S has a role in prostate cancer.

Example 20

Regulation of prostate-specific anti-P5O1S gene expression

Steroid (androgen) hormone modulation is a known treatment for the modality of prostate cancer. The expression of a number of androgen-specific antigens specific for prostate tissue has previously been demonstrated. The prostate-specific antigen response of the P501S antigen to androgen processing is examined in a tissue culture system as follows ^:

Cells from the prostate tumor LNCaP cell line are plated at 1.5 x ^{10 6} cells / T75 flask (for RNA isolation) or 3x10 ⁵ cells / 6-well plate (for FACS analysis) and grown overnight in RPMI 1640 containing 10% Coal Stripped Germ Calf Serum (BRL Life Technologies, Gaithersburg, MD). The cell culture remains for an additional 72 hours in RPMI 1640 containing 10% charcoal germ-calf serum with 1 nM synthetic androgen Methyl trienolone (R1881: New England Nuclear) added at different time intervals. Cells are harvested for RNA isolation and FACS analysis is performed for 0, 1, 2, 4, 8, 16, 24, 28, and 72 hours.

Ur »r! LS-. «. '»V, Μ. · i- »->» Λ> _in

224 after androgen addition. FACS analysis was performed using the anti-P501S antibody 10E3-G4-D3 and permeabilized cells.

For Northern analysis, leave 5-10 micrograms of total RNA on a formaldehyde-denatured gel, transfer to a Hybond-N nylon membrane (Amersham Pharmacia Biotech, Piscataway, NJ), cross-link, and stain with methylene blue. The filter is then prehybridized with Church Buffer (250 mM sodium phosphate, 70 mM phosphoric acid, 1 mM EDTA, 1% SDS, 1% BSA at pH 7.2) for one hour at 65 C. P501S DNA is labeled with a 32P High Labeling Kit Prime random primed DNA (Boehringer Mannheim). The uniform label was removed using MicroSpin S300-HR columns (Amersham Pharmacia Biotech). The RNA filter was hybridized overnight with fresh Church buffer containing labeled cDNA, washed with 1X SCP (0.1 M sodium chloride, 0.03 M disodium phosphate disodium 0.001 M dinatriufflEDTA), with 1% sarcosyl (n-lauroylsarcosine) and exposed to X-ray. film.

In both assays, FCS and Northern analysis, P501S message and protein levels were found to increase in response to androgen processing.

Example 20a

Preparation of fusion proteins of prostate-specific antigens

The example describes the preparation of a prostate-specific anti-P703P fusion protein and a truncated form of the known prostate antigen PSA. The garbled form of PSA has 21 amino acids distributed around the active serine site. The expression construct for the fusion protein also has a restriction site at the 3 terminus, just before the stop codon, to aid in the addition of cDNA for the additional anti genes.

A full-length 225 cDNA for PSA was obtained by RT-PCR from an RNA set of human prostate tumor tissues using primers SEQ ID NOS: 607 and 608, and cloned into the pCR-Blunt II-TOPO vector. The resulting cDNA was used as a template to obtain two different PSA fragments using PCR with two sets of primers (SEQ ID NOS: 609 and 610: and SEQ ID NOS: 611 and 612). PCR products having the expected size are used as matrices to obtain a truncated form of PSA using PCR with primers SEQ ID NOS: 611 and 613 that generate PSA (delta 208-218 in amino acids). The cDNA for the mature form of P703P with 6X histidine tag at the 5-end is prepared by PCR with P703P and primers SEQ ID NOS: 614 and 615. The cDNA for fusing P703P to the truncated PSA form (designated FOPP) is then obtained by PCR using a modified P703P cDNA the PSA cDNA forms as matrices and primers of SEQ ID NOS: 614 and 615. The FOPP cDNA was cloned into the NdeI and XhoI site of the pCRX1 expression vector and confirmed by DNA sequencing. The determined cDNA sequence for the FOPP fusion construct is in SEQ ID NO: 616 and the amino acid sequence is in SEQ ID NO: 617.

The FOPP fusion is expressed as recombinant protein alone in E.coli as follows: The expression plasmid pCRX1FOPP is transformed into the E.coli strain BL21-CodonPlus RIL. The transformant appears to express the FOPP protein with induction with 1mM IPTG. The culture of the corresponding expression clone is inoculated in 25 ml of LB containing 50 µg / ml kanamycin and 34 µg / ml chloramphenicol, grown for about 1 hour at 37 ° C to 0D600 of about 1 and stored overnight at 0 ° C.

The culture is diluted in 1 liter TB LB containing 50 µg / ml kanamycin and 34 µg / ml chloramphenicol and grown at 37 ° C 0D600 0.4. IPTG is added to the final end of 1 mM and the culture is incubated for 3 hours at 30 ° C. The cells are pelleted by centrifugation at 5,000 rpm for 8 minutes. To purify the protein, the cell pellet was suspended in 25 ml of 10 mM Tris HCl, pH 8.0, 2 mM PMSF, in complete protease inhibitor, and in 15 µg of lysozyme. Cells are skied for 30 minutes

A 226 full-length PSA cDNA was obtained by RT-PCR from an RNA set of human prostate tumor tissue using primer SEQ ID NO · 607 á 608, and cloned into the pCR-Blunt II-TOPO vector. The resulting cDNA was used as a template to obtain two different fragments of PSA using PCR with two sets of primers (SEQ ID NOs: 609 and 610; and SEQ ID NOs. 611 and 612). PCR products of the expected size are used as matrices to obtain a truncated form of PSA using PCR with primers SEQ ID NO = 611 and 613 that generate PSA (delta 208-218 in amino acids). The cDNA for the mature form of P7O3P with 6X histidine tag at the 5 'end is prepared by PCR with P703P and primers SEQ ID NOs 614 and 615. The cDNA for fusing P703P to the truncated form of PSA (designated FOPP) is then obtained by PCR using a modified P703P cDNA the PSA cDNA forms as matrices and primers of SEQ ID NOS: 614 and 615. The FOPP cDNA was cloned into the NdeI and XhoI site of the pCRX1 expression vector and confirmed by DNA sequencing. The determined cDNA sequence for the FOPP fusion construct is in SEQ ID NO: 616 and the amino acid sequence is in SEQ ID NO: 617.

The FOPP fusion is expressed as recombinant protein alone in E.coli as follows: The expression plasmid pCRX1FOPP is transformed into the E.coli strain BL21-CodonPlus RIL. The transformant appears to express the FOPP protein with induction with 1mM IPTG. The culture of the corresponding expression clone is inoculated in 25 ml of LB containing 50 µg / ml kanamycin and 34 µg / ml chloramphenol, grown for approximately 1 hour at 0 ° C.

temperature at 37 ° C to OD 600 approximately 1 and stored overnight at 0 ° C

The culture is diluted in 1 liter TB LB containing 50 µg / ml kanamycin and 34 µg / ml chloramphenol and grown at 37 ° C 0D600 0.4. IPTG is added to the final end of 1 mM and the culture is incubated for 3 hours at 30 ° C. The cells are pelleted by centrifugation for 8 minutes at 5,000 rpm. To purify the protein, the cell pellet was suspended in 25 ml of 10 mM Tris HCl, pH 8.0, 2 mM PMSF, in complete protease inhibitor, and in 15 µg of lysozyme. Cells are skied for 30 minutes

(I) at 4 ° C, resonate several times and centrifuge the lysate at 10,000 g for 30 minutes. The precipitate containing the inclusions is washed twice with 10 ml Tris HCl, pH 8.0 and 1%. CHAPS. The inclusions are dissolved in 40 ml of 10 mM Tris HCl, pH 8.0, 100 mM sodium phosphate and 8 M urea. The solution is bound to 8 ml of NiNTA (Qiagen) for one hour at room temperature. The mixture was poured into a 25 mL cylinder and washed with 50 mL of 10 mM Tris HCl, pH 6.3, 100 mM sodium phosphate, 0.5% DOCV and 9M urea. The bound protein was diluted with 350 mM imidazole, 10 mM Tris HCl, pH 8.0, 100 mM sodium phosphate and 9M urea. The FOPP-containing fractions were combined and dialyzed extensively against a 10 mM Tris HCl fraction, pH 4, 6, and stored at 20 ° C.

at -70 C.

Example 21

Characterization of the prostate-specific real time PCR antigen P501S in the peripheral blood of prostate cancer patients

Circulating epithelial cells are isolated from fresh blood of normal individuals and patients with prostate cancer metastases, mRNA is isolated, and cDNA is prepared using real time PCR processes. Real time PCR is performed by the Taqman ™ method using both gene-specific primers and probes to determine the level of gene expression.

Epithelial cells are enriched from blood samples using an immunomagnetic pearl separation method (Dynal A.S. Oslo, Norway). Isolated cells are lysed and magnetic beads are removed. The lysate is then processed for A + mRNA isolation using 01igo (dT) 25 coated magnetic beads. After washing the beads with buffer, the pearl / A + RNA sample samples are suspended in 10 mM Tris HCl, pH 8.0, and reverse transcribed. The resulting cDNA was subjected to real time PCR using gene-specific primers. The beta-actin content was also determined and used for normalization.

²²⁸ Samples with copies of P5Q1S larger than the mean of normal samples + 3 standard deviations are required to be positive. Real time PCR of blood samples is performed using the Taqman ™ method, but extends to 50 cycles using forward and reverse primers and probes specific for P501S. Of the 8 samples tested, 6 are positive for P501S and β-actin signal. The remaining 2 samples do not have detectable O-actin or P501S. No P501S signal is observed in 4 normal blood samples tested.

Example 22

Prostate-specific expression of P703P and P501S antigens in SCID Mouse-Passaged Prostate Tumors

Considering the efficacy of antigens in the treatment of prostate tumors, the continued presence of antigens in tumors during adrogen ablation therapy is significant. The presence of prostate-specific antigens P703P and P501S in prostate tumor samples grown in SCID mice in the presence of testosterone is evaluated as follows:

Two prostate tumors that metastasized to the bone were removed from patients, SCID mice implanted, and allowed to grow in the presence of testosterone. Tumors are evaluated for P7O3P, P501S and PSA mRNA expression by SYBR green real time quantitative PCR. In both cases, specific mRNA is present in lattice passage tumors. Since bone metastases grew in the presence of testosterone, this means that the presence of these genes would not be lost during ablational androgen therapy.

Example 23

- 229,)>

The monoclonal antibody anti-P503S inhibits tumor growth in vivo

The ability of anti-P503S 20D4 monoclonal antibody to inhibit tumor formation in mice is examined as follows:

Ten SCID mice are injected co-cutaneously with HEK293 cells that suppress P503S. Five mice receive intravenously on day 0 150 µg 20D4 (tumor cell injection time) on day 5 and day

9. Tumor size is measured for 50 days. Five mice that did not receive 20D4 show detectable tumors after approximately two weeks, which increase during the study. In contrast, tumors were not formed in any of the five mice that received 20D4. These results demonstrate that anti-P503S Mab 2OD4 exhibits potent anti-tumor activity in vivo.

Example 24

Characterization of a T cell receptor clone from a P5O1S specific T cell clone

T cells have a short lifetime. However, cloning of T cell receptor (TCR) chains and subsequent transfer substantially facilitates the endless spread of T cell specificity. Cloning of tumor-antigen TCR chains allows the transfer of specificity to T cells isolated from patients involved in the TCR MHC-restriction allele. Such T cells can then be elongated and used at adoptive delivery sites to introduce tumor antigen specificities into patients having tumors that express the antigen. Alpha and beta-chains of the T cell receptor from the prostate-specific antigen P501S CD8 T cell clone are isolated and sequenced as follows:

Total mRNA was isolated from 2x10 ⁶ cells from the CTL clone 4E5 (described in Example 12) using a Trisol reagent and cDNA was synthesized. To determine the Va and Vb sequences in this

A 23Q-clone panel is synthesized with a panel of Va and Vb subtype-specific primers and used in RT-PCR reactions with cDNA generated from each of these clones. RT-PCR reactions show that each of these clones expresses a common Vb sequence that corresponds to the Vb7 subfamily. In addition, using a cDNA generated from that clone, the expressed Va sequence is determined to be Va6. For the cloning of α and β-chains from clone 4E5, primers are included that include an inhibitor and a terminator-encoding TCR nucleotide. These primers are: TCR Valfa-6 5 (having sense) = GGATCC-GCCGCCACC-ATGTCACTTTCTAGCCTGCT (SEQ ID NO ^: 756) BamHI site Cossack TCR alpha TCR alpha sequence 3 '(antisense "antisense) GTCGACTCAGCTGGACCACAGCCGCAG (SEQ ID NO: 75) They radiate the TCR alpha site of the constant VCR-7 TCR sequence. 5 '(meaningful): GGATCC --- GCCGCCACCATGGGCTGCAGGCTGCTCT (SEQ ID NO: 756) BamHI site Cossack TCR alpha sequence TCR and 3' (antisense) GTCGAC - TCAGCTGGACCACAGCCGCAG (SEQ ID NO 757) SalI site TCR alpha constant sequence TCRb -7. 5 '(Meaningful) GGATCC --- GCCGCCACC - ATGGGCTGCAGGCTGCTCT (Seq

ID NO: 785 BamHI site Cossack TCR alpha sequence TCR beta 3 '(antisense) GTCGAC --- TCAGAAATCCTTTCTCTTGAC (Seq IC NO: 759) SalI site of TCR beta constant sequence. Standard 35 cycles of RT-PCR reactions were established using cDNA synthesized from the CTL clone and the above primers, using PWO thermostable reading polymerase (Roche, Nutley, NJ).

The resulting specific bands (approximately 850 base pairs for alpha and approximately 950 for beta) bind to a blunt PCR vector (in vitro gene) and transform into E. coli. E. coli transformed with plasmids containing full-length alpha and beta chains are identified to produce a wide variety of compositions corresponding to the plasmid expression.

Plasmids containing full-length TCR alpha and beta chains are subjected to sequencing. Sequence reactions showed cloning of full-length TCR alpha and beta chains with determined cDNA sequences for the Vb and Va chains set forth in SEQ ID NOs: 760 and 761. The corresponding amido acid sequences are set forth in SEQ ID NOs: 762 and 763. The Va sequence is found to be by nucleotide sequence alignment

- 231, _r is 99% identical (347/348) to Va6.2 and Vb is 99% identical to Vb7 (336/338).

It will be apparent from the foregoing that, although specific embodiments are described herein for illustration, modifications are possible without departing from the spirit and scope of the invention. Accordingly, the invention is not limited to the foregoing claims.

Industrial applicability

Polypeptides comprising at least a portion of a prostate-specific protein and polynucleotides encoding such polypeptides for the manufacture of pharmaceutical compositions for the diagnosis and treatment of cancer, especially prostate cancer.

JlíDr. Petr Kaienský attorney

A PARTNERS ^{KY 120} 00 Prague 2, Hůlková 2 Czech Republic

Claims (18)

PATENTOVÉ OKY An isolated polynucleotide comprising a sequence selected from the group consisting of (a) the sequences of SEQ ID NOs: 1 to 111, 115 to 171, 173 to 173 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526 530 531, 533, 535, 536, 552, 569-572, 587, 591, 593 to 606,618 aš 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681 711 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, (b) sequence corpplements in SEQ ID NOs: 111-111, 115-171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 through 572, 587, 591, 593 through 606, 618 through 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to (C) a sequence consisting of at least 20 contiguous residues of the sequence of SEQ ID NOs: 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330 , 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630 , 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, ( (d) 1 to 326, 524, 593 of the sequences that hybridize to the sequence of SEQ ID NO: 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, up to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674 , 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788 under moderately stringent conditions, (e) a sequence having at least 75% identity to SEQ ID NO: 1 to lil, 115 to 171, 173 to 175, 177, 179 to 305, 307 aě 315, 326, 328, 330, 332 aš 335, 340 aš 375, 381, 382 a 384 aš 476, 524, 526, 530, 531, 533, 535, 536 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, (f) a sequence having at least 90% identity to SEQ ID NO = 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330 , 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 to 572, 587, 591, 593 to 606, 618 to 626, 630 , 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788, <g> generated sequence variants in SEQ ID NO: 1 aš 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and i 384 to 476, 524, 526, 530, 531, 533, 535, 536, 552, 569 a 572,587,591 , 593 aš 606, 618 up to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 739, 751, 753, 764, 765, 773 to 776 and 786 to 788. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of (and) the sequence in SEQ ID NO: 112 to 114, 172, 176, 178, 327, 329, 331, 336, 339, 376 through 380, 383, 477 through 483, 496, 504, 505, 519, 520, 522,525 , 527, 532 537 to 551 , 553 aš 568, 573 to 586, 588 to 588; 590, 592, 627 a 629, 632, 633, 635, - 23,4 637, 638, 656 to 671, 675, 683, 684, 710, 712, 714, 715, 717 to 719, 723 to 734, 736, 740 to 750, 752, 754, 755, 766 to 772, 777 to 785 and 789 to 791, (b) a sequence having at least 70% identity to the sequence of SEQ ID NO: 112 to 114, 172, 176, 178, 327, 329, 331, 336, 339, 376 to 380, 383, 477 to 483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537 to 551, 553 to 568, 573 to 586, 588 to 590, 592, 627 to 629, 632, 633, 635, 637, 638, 656 to 671, 675, 683, 684, 710, 712, 714, 715, 717 to 719, 723 to 734, 736, 740 to 750, 752, 754, 755, 766 to 772, 777 to 785 and 789 to 791, (c) a sequence having at least 90% identity to SEQ ID NO: 112 to 114, 172, 176, 178, 327, 329, 331, 336, 339, 376 to 380, 383, 477 to 483, 496, 504, 505, 519, 520, 522, 525, 527, 532, 534, 537 to 551, 553 to 568, 573 to 586, 588 to 590, 592, 627 to 629, 632, 633, 635, 637, 638, 656 to 671, 675, 683, 684, 710, 712, 714, 715, 717 to 719, 723 to 734, 736, 740 to 750, 752, 754, 755, 766 to 772, 777 to 785 and 789 to 791, (d) polynucleotide encoded sequences (e) a sequence having at least 70% identity to the sequence encoded by the polynucleotide of claim 1; (f) a sequence having at least 90% identity to the sequence encoded by the polynucleotide of claim 1. An expression vector comprising the polynucleotide of claim 1 operably linked to an expression control sequence. A host cell transformed or transfected with the expression vector of claim 3. 5. An isolated antibody or antigen-binding fragment thereof that specifically binds to the polypeptide of claim 2. A method of detecting the existence of a cancer in a patient, the method comprising (a) obtaining a biological sample from the patient, (b) contacting the biological sample with a binding agent that binds to the polypeptide of claim 2, (c) determining the amount of polypeptide bound to the binding agent in the sample, (d) comparing the amount of polypeptide to a predetermined value, and determining the existence of cancer in the patient. A fusion protein comprising at least one polypeptide of claim 2. The fusion protein of claim 7 comprising a sequence selected from the group consisting of (a) the sequences included in SEQ ID NO: 682, 692, 695, 699, 703 and 709 and (b) the sequences included in SEQ ID NO: 679, 691, 696, 700, 704 and 708. 9. A oligonucleotide that hybridizes to the sequence shown in SEQ ID NO: 1 to 111, 115 to 171, 173 to 175, 177, 179 to 305, 307 to 315, 326, 328, 330, 332 to 335, 340 to 375, 381, 382 and 384 to 476, 524, 526 , 530, 531, 533, 535, 536, 552, 569-572, 587, 591, 593 to 606, 618 to 626, 630, 631, 634, 636, 639 to 655, 674, 680, 681, 711, 713, 716, 720 to 722, 735, 737 to 788 for slightly 739, 751, 753, 764, 765, 773 to 776 and 786 stringent conditions. A method of stimulating and / or expanding tumor cell-specific T cells, comprising contacting the T cells with at least one component selected from the group consisting of (a) the polypeptides of claim 2, (b) the polynucleotides of claim 1, and (c) antigen-providing cells that express the polypeptide of claim 2, under conditions sufficient and for a sufficient period of time to stimulate and / or expand T cells. and An isolated T cell population comprising T cells prepared by the method of claim 10. A composition comprising a first component selected from the group consisting of a physiologically acceptable carrier and immunostimulants and a second component selected from the group consisting of (a) the polypeptides of claim 2, (b) the polynucleotides of claim 1, (c) the antibodies of claim 5, (d) the fusion proteins of claim 7, (e) the T cell population of claim 11, and? «- #> -» »» (F) antigen-providing cells that express the polypeptide of claim 2. 13. A method of stimulating an immune response in a patient, comprising administering to the patient the composition of claim 12. 14. A method of treating cancer in a patient, comprising administering to the patient a composition according to claim 12. A method for detecting cancer in a patient, comprising (a) obtaining a biological sample from the patient, (b) contacting the biological sample with the oligonucleotide of claim 9, (c) detecting in the sample the amount of polynucleotide that hybridizes and (d) comparing the amount of polynucleotide that hybridizes to the oligonucleotide to a predetermined value, and results in determining the existence of cancer in the patient. 16. A diagnostic kit comprising at least one oligonucleotide of claim 9. 17. A diagnostic kit comprising at least one antibody of claim 5 and a detection reagent having a reporter group. 18. A method of inhibiting the development of cancer in a patient, comprising: (a) incubating the CD4 ⁺ and / or CD8 ⁺ T cells isolated from the patient with at least one component selected from the group consisting of: ) the polypeptides of claim 2, (ii) the polynucleotides of claim 1, and (iii) an antigen-providing cell that expresses the polypeptide of claim 2, such that the T cells proliferate, and (b) administering to the patient an effective amount of proliferated T cells,