KR101993894B1 - Double Stranded Oligo RNA Structure Comprising miRNA - Google Patents

Abstract

The present invention relates to a double stranded oligo RNA construct comprising a double stranded miRNA and a composition for preventing or treating cancer comprising the same. More particularly, the present invention relates to a double-stranded oligo RNA construct comprising miR-3670, miR-4477a, miR-8078, which is characterized by a method of effectively inhibiting cancer cell proliferation or inducing spontaneous killing of cancer cells, To an anticancer pharmaceutical composition comprising an acceptable carrier.

Description

Double-stranded oligo RNA structure containing micro RNA {Double Stranded Oligo RNA Structure Comprising miRNA}

The present invention relates to a double-stranded oligo RNA structure comprising a double-stranded miRNA and a composition for preventing or treating cancer comprising the same. More specifically, the present invention effectively inhibits the proliferation of cancer cells or induces spontaneous death of cancer cells. It relates to an anticancer pharmaceutical composition comprising an acceptable carrier.

The effective and traditional treatment method for diseases caused by the failure of normal gene control, typically referred to as cancer, has been surgically resecting and removing the tumor, but the primary cancer is metastasized to other organs. In some cases, surgery was not possible, so anticancer drug therapy was used. Anticancer drugs used for drug treatment were mainly synthesized by organic or inorganic methods of monomolecular substances. This is effective against proteins that disturb the signaling system mainly due to overexpression of phosphate activating factor proteins included in the signal transduction system. It was developed and used to inhibit the activity of proteins by binding. Traditional drug therapy in this way has many side effects, one of which is that the substance used as a drug is an artificially synthesized substance derived from external bodies and that the anticancer substance targets a protein that has already overexpressed its action point.

The development of drug treatments to replace the traditional drug treatment methods has progressed in several ways, one of which is the use of small interfering RNA (hereinafter referred to as siRNA) (Iorns, E., Lord, CJ, Turner, N. & Ashworth, A. Utilizing RNA interference to enhance cancer drug discovery.Nat Rev Drug Discov 6, 556-68. 2007.). siRNA is a single-stranded RNA composed of 16 to 27 nucleotides and acts as a constituent of ribonucleoprotein, known as RNA Induced Silencing Complex (RISC) in cells (Tomari, Y. & Zamore). , PD Perspective: machines for RNAi.Genes Dev 19, 517-29, 2005, Chu, CY & Rana, TM Potent RNAi by short RNA triggers.Rna 14, 1714-9, 2008, Mittal, V. Improving the efficiency of RNA interference in mammals.Nat Rev Genet 5, 355-65, 2004, Reynolds, A. et al. Rational siRNA design for RNA interference.Nat Biotechnol 22, 326-30. 2004). RISC functions as RNA enzyme scissors, cutting messenger RNA (messenger RNA, hereinafter referred to as mRNA) to inhibit protein production from mRNA. The siRNA contained in RISC combines with the mRNA having a sequence complementary to the siRNA sequence to form double-stranded RNA, and the RISC acts as an RNA enzyme scissors to cleave the target mRNA, so that the mRNA no longer repeatedly produces a protein ( template).

As such, siRNA-based anticancer drugs are evaluated as more advanced technologies than the monomolecular anticancer drugs in that they block mRNA before the protein production stage, and that they utilize RNA and cell-intrinsic RISC systems, but siRNA-based technology There is a side effect that cannot be solved by the method, which is a phenomenon called off-target effect (Jackson, AL et al. Widespread siRNA "off-target" transcript silencing mediated by seed region sequence complementarity. Rna 12, 1179 -87, 2006., Jackson, AL et al. Position-specific chemical modification of siRNAs reduces "off-target" transcript silencing.Rna 12, 1197-205, 2006., Jackson, AL et al. Expression profiling reveals off-target Gene regulation by RNAi.Nat Biotechnol 21, 635-7, 2003., Nielsen, CB et al. Determinants of targeting by endogenous and exogenous microRNAs and siRNAs.Rna 13, 1894-910, 2007., Peek, AS & Behlke, MA Design of active small interfering RNAs.Curr Opin Mol Ther 9, 110-8, 2007.). As described above, mRNA that binds complementarily to the siRNA sequence is degraded, but it is not complementary to the entire siRNA sequence, but only partially binds to the complementary mRNA to induce degradation, which induces degradation of the mRNA that is not the target. It is called a target effect.

Research to use microRNA (microRNA, hereinafter referred to as miRNA) as a therapeutic agent is in progress in order to overcome the technical difficulties of the siRNA-based anticancer therapeutic agent described above (Agostini, M. & Knight, RA miR-34: from bench to bedside.Oncotarget 5, 872-81, 2014., van Rooij, E., Purcell, AL & Levin, AA Developing MicroRNA Therapeutics.Circulation Research 110, 496-507, 2012., Burnett, JC & Rossi, JJ RNA-based therapeutics: current progress and future prospects.Chem Biol 19, 60-71, 2012., Dangwal, S. & Thum, T. microRNA therapeutics in cardiovascular disease models.Annu Rev Pharmacol Toxicol 54, 185-203, 2014). miRNA is an RNA composed of 16 to 27 nucleotides and is classified as a protein non-coding RNA (Carthew, RW & Sontheimer, EJ Origins and Mechanisms of miRNAs and siRNAs.Cell 136, 642-55, 2009., MacFarlane, L.-A. & Murphy, PR MicroRNA: Biogenesis, Function and Role in Cancer.Current Genomics 11, 537-561, 2010., Bartel, DP MicroRNAs : target recognition and regulatory functions.Cell 136, 215-33, 2009.). miRNAs are recorded in the genome of higher animal and plant cells and are known to play a key role in regulating cell metabolism and function, including cell generation, growth, differentiation, and death. To date, more than 2,000 miRNAs have been known in the human genome, and the functions of many of these miRNAs are not yet known.

The miRNA is transcribed from the genome into RNA by an RNA polymerase called Pol II, whose initial length varies indefinitely (Carthew, RW & Sontheimer, EJ Origins and Mechanisms of miRNAs and siRNAs. Cell 136, 642 -55, 2009., Brodersen, P. & Voinnet, O. Revisiting the principles of microRNA target recognition and mode of action.Nat Rev Mol Cell Biol 10, 141-148, 2009.). This is due to the diversity of positions included in the genome of miRNAs, which are located in the intron, which is a non-involved part of the protein production of mRNA, and are transcribed at the same time as mRNA production, and inter-genic regions in the genome. It is because it is produced in various ways, such as when it is located in and is independently transcribed (Malone, CD & Hannon, GJ Small RNAs as guardians of the genome. Cell 136, 656-68, 2009.). The miRNA matrix generated in this way is called primary miR (primary microRNA), and the primary miR is edited into precursor miR (precursor miRNA, pre-miR) by RNA cleavage enzyme (RNase) called Drosha in the nucleus. (Bartel, DP MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009). Pre-miR forms the RNA hair-pin structure and consists of approximately 70-80 nucleotides. Pre-miR inside the cell nucleus is transferred from the nucleus to the cytoplasm by exportin protein, and is secondary processed by another RNA cleavage enzyme (RNase) called Dicer in the cytoplasm to consist of 16-27 nucleotides. Double-stranded mature miR (mature microRNA, hereinafter referred to as miR without other modifiers means mature miR) is generated. Among the double-stranded miRs, one strand of RNA is selectively selected to bind to RISC, which is the ribonucleoprotein comple, to have activity, and bind to the target mRNA using the miR sequence.

In general, mRNA can be divided into three parts based on whether or not it is involved in protein production.The coding region containing protein translation information and the 5'and 3'parts of the coding region, respectively, which do not have protein translation information. It can be divided into'-UTR (Un-Translated Region) and 3'-UTR. Using a sequence complementary to the mRNA, siRNA that induces degradation of the target mRNA acts regardless of the 5'-, 3'-UTR and coding portions of the mRNA, whereas miR mainly binds to 3'-UTR ( (Carthew, RW & Sontheimer, EJ Origins and Mechanisms of miRNAs and siRNAs. Cell 136, 642-55, 2009., Bartel, DP MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009.).

In addition to the difference in the binding site to the mRNA, the distinctive feature of siRNA and other miRNAs is that siRNA mainly binds to mRNA, which contains a sequence complementary to the entire siRNA sequence, whereas miRNA is located 2-8 nucleotides from the 5'end of the miRNA. The size of the seed region sequence differs in that it is mainly used for target mRNA recognition, so even if the entire miRNA sequence does not have a perfect complementary sequence to the target gene and a certain non-complementary sequence is included, it does not affect miRNA activity. (Bartel, DP MicroRNAs: target recognition and regulatory functions. Cell 136, 215-33, 2009). As the sequence size of the seed portion is 6-8 nucleotides, there are various types of mRNAs having a sequence complementary to the 3'UTR, and for this reason, one species of miRNA can simultaneously control several species of mRNA. These miRNA properties impose the function of miRNA as an efficient regulator involved in the control of many aspects of cell physiology, including cell division, growth, differentiation, and death. In addition, the function of miRNA as a modulator acts as an advantage in implementing an effective anticancer effect.SiRNA aims to suppress the expression of a single gene, whereas miRNA can inhibit the expression of multiple cancer-causing genes at the same time. .

A large number of mRNAs contain a portion where more than one type of miRNA is likely to bind to the 3'UTR, and according to one bioinformatics calculation, it is known that approximately 30% of the total mRNA is regulated by miRNAs. have.

The fact that miRNA acts as a major regulator in this signaling system can be seen in that it plays an important role in major diseases including cancer (MacFarlane, L.-A. & Murphy, PR MicroRNA: Biogenesis, Function and Role). in Cancer.Current Genomics 11, 537-561. 2010., Malone, CD & Hannon, GJ Small RNAs as guardians of the genome.Cell 136, 656-68. 2009., Nicoloso, MS, Spizzo, R., Shimizu, M., Rossi, S. & Calin, GA MicroRNAs--the micro steering wheel of tumour metastases.Nat Rev Cancer 9, 293-302. 2009., Landi, D., Gemignani, F. & Landi, S. Role of variations within microRNA-binding sites in cancer.Mutagenesis 27, 205-10.2012.). In fact, through several studies, it has been revealed that the expression pattern of miRNAs in cancer cells is significantly different from that in normal cells. In addition, miRNA expression patterns vary greatly depending on the primary organ in which the cancer has occurred. Various cancers such as lung cancer, liver cancer, skin cancer, and blood cancer show unique miRNA expression patterns according to the primary organ, and through this, miRNA is a major factor in cancer biology. It is known to play a role. In particular, it is known that miRNAs expressed in carcinomas are generally low compared to their expression levels in normal cells.

An attempt to use miRNA as an anticancer therapeutic agent based on the deep association of miRNA in cancer has been recently started, as an example, a clinical trial to verify the ability of miRNA named miR-34a to inhibit cancer cell proliferation and induce apoptosis. (Wiggins, JF et al. Development of a lung cancer therapeutic based on the tumor suppressor microRNA-34. Cancer Res 70, 5923-30. 2010., Bader, AG et al. miR-34 Regulated Genes and Pathways as Targets for Therapeutic Intervention.Google Patents, 2009., Hermeking, H. The miR-34 family in cancer and apoptosis.Cell Death Differ 17, 193-9. 2010., Chang, TC et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis.Mol Cell 26, 745-52. 2007.).

In order to use miRNA as an anticancer treatment, an effective method is needed to deliver miRNAs injected from outside the body to pathological tissues without being degraded inside the body. For this, an RNA oligo structure including a miRNA sequence may be used. It is known that high efficiency can be induced in vivo by linking chemical substances to the terminal site of RNA oligos to have enhanced pharmacokinetics characteristics (Nature 11; 432(7014): 173-8, 2004). At this time, the stability of the RNA oligo varies depending on the nature of the chemical substance bound to the end of the sense (passenger) or antisense (guide) strand of the RNA oligo. For example, RNA oligos in the form of conjugated polymer compounds such as polyethylene glycol (PEG) are improved oligos by interacting with anionic phosphate groups with oligos in the presence of cationic substances to form a complex. It becomes a carrier with stability (J Control Release 129(2):107-16, 2008). In particular, micelles composed of polymer complexes are extremely small in size compared to other systems used as drug delivery vehicles, such as microspheres or nanoparticles, but have a very uniform distribution and are formed spontaneously. There is an advantage in that it is easy to ensure the quality control and reproducibility of the formulation.

In addition, in order to improve the intracellular delivery efficiency of the RNA oligo, a hydrophilic material (e.g., polyethylene glycol (PEG)), which is a biocompatible polymer, is simply covalently bonded or linker-mediated to the RNA oligo. Through the covalently conjugated oligo conjugate, a technology for securing the stability of the oligo and efficient cell membrane permeability has been developed (Republic of Korea Patent No. 10-0883471). However, the chemical modification of the oligo and the conjugation of polyethylene glycol (PEG) (PEGylation) still have the disadvantage of low stability in vivo and not smooth delivery to target organs. Oligonucleotide double helix in order to solve these problems the oligonucleotides are hydrophilic and hydrophobic material bonded to the RNA double helix that was an RNA structure development, the structure SAMiRNA ^TM (self assembled micelle inhibitory RNA), by hydrophobic interactions of the hydrophobic substance named Self-assembled nanoparticles are formed (refer to Korean Patent Registration No. 10-1224828), and the SAMiRNA ^TM technology has the advantage of obtaining homogenous nanoparticles while being very small in size compared to existing delivery technologies. Have.

Under this technical background, the inventors of the present application have tried to discover miRNAs that are superior to the ability of miR-34a in clinical trials to inhibit cancer cell proliferation and induce cancer cell death. As a result, miR-3670, miR-4477a, which are excellent in anticancer efficacy, miR-8078 was discovered, and it was confirmed that these miRNAs and double-stranded oligo RNA structures containing them effectively block the expression of a number of genes known as cancer-causing genes to achieve anticancer effects, and the present invention was completed.

It is an object of the present invention to discover a miRNA excellent in inhibiting cancer cell proliferation and inducing cancer cell death, and to provide a double-stranded oligo RNA structure comprising the same, and a composition for preventing or treating cancer comprising the same as an active ingredient.

In order to achieve the above object, the present invention provides a double-stranded oligo RNA structure comprising the structure of the following structural formula (1):

A-X-R-Y-B structural formula (1)

In the structural formula (1), A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is miR-3670, miR-4477a, miR-8078 It means one or more miRNAs selected from the group consisting of.

The present invention also provides a composition for preventing or treating cancer comprising the oligonucleotide structure.

The double-stranded oligo RNA structure and the composition for cancer treatment comprising the same according to the present invention include one or more miRNAs selected from the group consisting of miR-3670, miR-4477a, and miR-8078, thereby measuring suitability as an existing anticancer agent. In order to show improved anticancer effect compared to a pharmaceutical composition for cancer treatment using miR-34a and other miRNAs as active ingredients in clinical trials, it can be widely used as an anticancer therapeutic agent.

FIG. 1 shows miR-34a, miR-100, and miR-125b, representatively selected from the entire screening library, in order to measure the activity of miRNAs included in the screening library, and each mRNA 3′ known to be inhibited by these expressions. The UTR was inserted into the 3'UTR of a luciferase expression vector to confirm the ability to inhibit protein expression by miR-34a, miR-100 and miR-125b.
FIG. 2 shows a screening library consisting of 1700 miRNAs treated with an NCI-H460 lung cancer cell line to quantify cell growth using a Resazurin reagent, which is converted into a relative growth value.
Figure 3 shows the selection of 50 kinds of miRNAs showing excellent efficacy in the NCI-H460 cell line, and using the same, the relative cancer cell growth inhibition ability measured by WST-1 reagent.
Figure 4 shows the degree of cell death after injecting miR-34a, miR-3670, miR-8078, and miR-4477a into the cells by transfection method to measure the apoptosis effect in lung cancer cell lines. The results were stained with Annexin V and analyzed by flow cytometry.
FIG. 5 shows the ability of lung cancer cell lines to form clusters according to the influence of miRNAs by injecting each miRNA into a lung cancer cell line by transfection and culturing it on a soft agar for 2 weeks.
6 shows a Z-score for cell death ability when target candidate groups are selected using target scan, which is a miRNA target prediction software, and the content in cells is inhibited by using siRNA targeting them.
Figure 7 shows the degree to which the expression level of the genes identified in Figure 6 is inhibited by miRNA by qPCR analysis.
FIG. 8 shows the degree of inhibition of the expression of luciferase protein by miRNA by cloning the 3'UTR of the genes identified in FIG. 6 into the 3'UTR of luciferase.
9A and 9B are diagrams comparing the degree of induction of cell suicide mechanisms by treating a lung cancer cell line using an oligo RNA structure containing a miRNA sequence and then staining with Annexin V.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

In the present invention, an attempt was made to discover a miRNA that is superior to miR-34a, which is known to have an anticancer effect, and to confirm its anticancer effect.

In the present invention, about 1700 miRNA screening libraries were synthesized (Table 1), and treated with NCI-H460 (lung cancer cell line) to measure cancer cell growth inhibitory ability, and the following nucleotide sequence, which is superior to miR-34a, was obtained. Having discovered miR-3670, miR-4477a, and miR-8078 (Table 3), it was confirmed that their anticancer efficacy was excellent (FIGS. 4 to 8 ).

Accordingly, the present invention relates to a double-stranded oligo RNA structure comprising one or more miRNAs selected from the group consisting of miR-3670, miR-4477a, and miR-8078, and comprising the structure of the following structural formula (1).

A-X-R-Y-B structural formula (1)

In the structural formula (1), A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is miR-3670, miR-4477a, miR-8078 It means one or more miRNAs selected from the group consisting of.

In the present invention, the miR-3670 may be a double-stranded RNA consisting of the nucleotide sequence of SEQ ID NO: 35 and SEQ ID NO: 36 or SEQ ID NO: 67.

In the present invention, the miR-4477a may be a double-stranded RNA consisting of the nucleotide sequence of SEQ ID NO: 43 and SEQ ID NO: 44 or SEQ ID NO: 68.

In the present invention, the miR-8078 may be a double-stranded RNA double-stranded RNA consisting of the nucleotide sequence of SEQ ID NO: 65 and SEQ ID NO: 66 or SEQ ID NO: 69.

That is, the miR-3670 template strand may be characterized in that it is represented by SEQ ID NO: 35.

5'-AGAGCUCACAGCUGUCCUUCUCUA-3'(MIMAT0018093. SEQ ID NO: 35)

The miRNA that ultimately shows activity in vivo is single-stranded, but in order to bind to RISC, it must be supplied into cells in the form of double-stranded with a base sequence having a similar base size. At this time, the opposite sequence (antisense) binding to the sequence has a sequence complementary to the active sequence. The complementary sequence may have a perfect complementary sequence, or an endogenous sequence may be used. Each of the double-stranded sequences, or a base located at 3'of one strand, may not have a base bond with the other sequence, which is referred to as a 3'overhang and may include this.

That is, the perfect complementary sequence of miR-3670 may be characterized by being represented by SEQ ID NO: 36.

5'-GAGAAGGACAGCUGUGAGCUCUUU-3'(SEQ ID NO: 36)

In addition, the endogenous complementary sequence of miR-3670 may be characterized by being represented by SEQ ID NO: 67.

5'-GACUGGUAUAGCUGCUUUUGGAGCCUCA-3'(SEQ ID NO: 67)

As described in the background art, the seed region corresponding to bases 8-9 from the second base of the miRNA activity sequence is a major factor in the activity, and the long double-stranded containing it when producing double-stranded RNA. It can also be prepared and used.

Like miR-3670, the active sequences of miR-4477a and miR-8078 and the complementary sequence for forming a double strand with them may be characterized by being represented as described below. These double strands can also constitute a double strand including a 3'overhang as described above, and can also be used to constitute a long sequence of double strands including a seed region.

miR-4477a

5'-CUAUUAAGGACAUUUGUGAUUC -3' (MIMAT0019004 SEQ ID NO: 43)

perfect complementary sequence of miR-4477a

5'- AUCACAAAUGUCCUUAAUAGUU -3' (SEQ ID NO: 44)

Endogenous complementary sequence of miR-4477a

5'- AUCACAAAUGUCCUUAAUGGCA -3' (SEQ ID NO: 68)

miR-8078

5'- GGUCUAGGCCCGGUGAGAGACUC (MIMAT0031005, SEQ ID NO: 65)

perfect complementary sequence of miR-8078

5'- GUCUCUCACCGGGCCUAGACCUU (SEQ ID NO: 66)

Endogenous complementary sequence of miR-8078

5'- CUCCACCGGGCUGACCGGCCUG -3' (SEQ ID NO: 69)

In the present invention, the miRNA discovered through the library screen was confirmed to generate anticancer efficacy by controlling genes commonly known to play a major role in induction, generation, and growth of cancer. It is a characteristic of miRNA that one type of miRNA can simultaneously control the expression of multiple mRNAs. This property was also confirmed in the present invention, and is a useful property for the development of oligo-based anticancer drugs.

MiR-3670 of the present invention simultaneously inhibits the expression of CBX4, NRAS, CASR, TXLNA, SNIP1, HNF1A, FZD4, TRIB1, ADMA19, CKAP5, miR-8078 inhibits the expression of GREB1, HECTD3, RIPK4, miR- It was confirmed that 4477a simultaneously inhibited the expression of STIL, KIF11, AKAP11, and FAM120A (FIG. 6).

It is known that the target genes suppressed by the miRNA of the present invention have the following functions.

CBX4 (polycomb chromobox 4) is involved in tumor angiogenesis and promotion of tumor metastasis, and NRAS is known to play a major role in tumor growth and cell division (Orouji, E. et al. MAP Kinase pathway gene copy alterations in NRAS/BRAF wild-type advanced melanoma.Int J Cancer (2015); Zheng, C. et al. MicroRNA-195 functions as a tumor suppressor by inhibiting CBX4 in hepatocellular carcinoma.Oncol Rep 33, 1115-22 (2015); Jiao , HK et al. Prognostic significance of Cbx4 expression and its beneficial effect for transarterial chemoembolization in hepatocellular carcinoma.Cell Death Dis 6, e1689 (2015); Ohashi, K. et al. Characteristics of lung cancers harboring NRAS mutations.Clin Cancer Res 19 , 2584-91 (2013)).

CASR is found to be overexpressed in tumors and is necessary for tumor metastasis, and TXLNA is known to be involved in tumor growth and metastasis. Clinical results have been reported that the survival rate of patients with high expression rates is low (Mashidori, T., Shirataki). , H., Kamai, T., Nakamura, F. & Yoshida, K. Increased alpha-taxilin protein expression is associated with the metastatic and invasive potential of renal cell cancer.Biomed Res 32, 103-10 (2011); Tennakoon, S., Aggarwal, A. & Kallay, E. The calcium-sensing receptor and the hallmarks of cancer.Biochim Biophys Acta (2015); Ohtomo, N. et al. Expression of alpha-taxilin in hepatocellular carcinoma correlates with growth activity and malignant potential of the tumor.Int J Oncol 37, 1417-23 (2010)).

SNIP1, known as a transcriptional coactivator, promotes the expression of cyclin D1, which is essential for cell growth and division. It is known that the anticancer prognosis of patients with high SNIP1 expression levels is poor. In addition, it is known that it binds to c-Myc, which plays a role as a major regulator of cell proliferation, and plays a role in promoting tumor growth (Li, Q. et al. SNIP1: a new activator of HSE signaling pathway. Mol Cell Biochem 362 , 1-6 (2012); Fujii, M. et al. SNIP1 is a candidate modifier of the transcriptional activity of c-Myc on E box-dependent target genes.Mol Cell 24, 771-83 (2006); Roche, KC , Rocha, S., Bracken, CP & Perkins, ND Regulation of ATR-dependent pathways by the FHA domain containing protein SNIP1.Oncogene 26, 4523-30 (2007); Jeon, HS et al. High expression of SNIP1 correlates with poor prognosis in non-small cell lung cancer and SNIP1 interferes with the recruitment of HDAC1 to RB in vitro.Lung Cancer 82, 24-30 (2013); Liang, X. et al. Hypoxia-inducible factor-1 alpha, in association with TWIST2 and SNIP1, is a critical prognostic factor in patients with tongue squamous cell carcinoma.Oral Oncol 47, 92-7 (2011)).

HNF1A and FZD4 are components of the Wnt signaling system, which are deeply involved in tumor growth and survival, and the Wnt signaling system has been intensively studied in tumor biology and its importance is widely known. TRIB1 is known to play a role in inhibiting tumor cell growth, metastasis, and suicide of cells, and it is known as a factor that regulates the MAPK signaling system, one of the major signaling systems in tumor growth (Pecina-Slaus, N. et al. Wnt). signaling transcription factors TCF-1 and LEF-1 are upregulated in malignant astrocytic brain tumors.Histol Histopathol 29, 1557-64 (2014); Ueno, K. et al. Tumor suppressor microRNA-493 decreases cell motility and migration ability in human bladder cancer cells by downregulating RhoC and FZD4.Mol Cancer Ther 11, 244-53 (2012); Lin, ZY et al. MicroRNA-224 inhibits progression of human prostate cancer by downregulating TRIB1.Int J Cancer 135, 541-50 (2014) ; Soubeyrand, S., Naing, T., Martinuk, A. & McPherson, R. ERK1/2 regulates hepatocyte Trib1 in response to mitochondrial dysfunction.Biochim Biophys Acta 1833, 3405-14 (2013)).

ADAM19 is a protein distributed in cell membranes and is known to play a variety of biological roles including cell-cell contact and cell-extracellular matrix contact. In tumor biology, it is known to be deeply related to tumor growth and metastasis. . It was found through the present invention that the CKAP5 gene, which is known to play an important role in tumor survival through gene functional screens, is also controlled by the miRNA, and GREB1 is related to the signaling system of tissues or tumors responding to hormones. As a gene, it is known to promote cell growth by overexpressing it in various types of tumors (Zhang, Q. et al. Role of microRNA-30c targeting ADAM19 in colorectal cancer. PLoS One 10, e0120698 (2015); Shan, N. , Shen, L., Wang, J., He, D. & Duan, C. MiR-153 inhibits migration and invasion of human non-small-cell lung cancer by targetin; g ADAM19.Biochem Biophys Res Commun 456, 385- 91 (2015); Martens-de Kemp, SR et al. Functional genetic screens identify genes essential for tumor cell survival in head and neck and lung cancer.Clin Cancer Res 19, 1994-2003 (2013); Rae, JM et al. GREB1 is a novel androgen-regulated gene required for prostate cancer growth.Prostate 66, 886-94 (2006); Zhang, L. et al. Development of transcriptomic biomarker signature in human saliva to detect lung cancer.Cell Mol Life Sci 69, 3341-50 (2012); Laviolette, LA, Hodgkinson, KM, Minhas, N., Perez-Iratxeta, C . & Vanderhyden, B.C. 17beta-estradiol upregulates GREB1 and accelerates ovarian tumor progression in vivo. Int J Cancer 135, 1072-84 (2014)).

HECTD3, E3 ubiquitin ligase, inhibits tumor death by inducing the degradation of caspase-8 by attaching polyubiquitin to caspase-8, which triggers cell suicide. It is known to increase drug resistance to cisplatin anticancer drugs by stabilizing the MALT1 protein. RIPK4, a receptor-interactin protein kinase 4, has been reported to induce the accumulation of beta-catennin, a cell growth signaling factor, and activate the Wnt signaling system at the same time. It has been shown that the artificial removal of RIPK4 can inhibit tumor growth in tumor animal models (Li, Y. et al. The HECTD3 E3 ubiquitin ligase facilitates cancer cell survival by promoting K63-linked polyubiquitination of caspase-8. Cell Death Dis 4, e935 (2013); Li, Y. et al. The HECTD3 E3 ubiquitin ligase suppresses cisplatin-induced apoptosis via stabilizing MALT1.Neoplasia 15, 39-48 (2013); Huang, X. et al. Phosphorylation of Dishevelled by protein kinase RIPK4 regulates Wnt signaling.Science 339, 1441-5 (2013)).

The STIL gene, which is an essential element in the process of transition from the G2 phase to the M phase during the cell cycle cycle, is observed to have a high expression rate in various types of carcinoma, and is known to be necessary for tumor proliferation and survival. KIF11 is also reported to be one of the factors necessary for tumor cell growth and metastasis, and it is known that it can inhibit tumor growth by inhibiting the activity of KIF11 (Erez, A. et al. Sil overexpression in lung cancer characterizes tumors with increased mitotic). activity.Oncogene 23, 5371-7 (2004); Erez, A. et al. The SIL gene is essential for mitotic entry and survival of cancer cells.Cancer Res 67, 4022-7 (2007); Tang, Y., Orth , JD, Xie, T. & Mitchison, TJ Rapid induction of apoptosis during Kinesin-5 inhibitor-induced mitotic arrest in HL60 cells.Cancer Lett 310, 15-24 (2011); Venere, M. et al. The mitotic kinesin KIF11 is a driver of invasion, proliferation, and self-renewal in glioblastoma.Sci Transl Med 7, 304ra143 (2015)).

AKAP11, which increases the activity of PKA by binding to protein kinase A (PKA), also binds to GSK-3beta at the same time and promotes the phosphorylation of GSK-3beta by PKA. Phosphorylated GSK-3beta loses its activity, which is recognized as a signal that promotes growth in cells and is one of the major mechanisms that induce tumor growth. Tumor cells are exposed to various stress conditions, such as acidic conditions and oxygen deprivation conditions, and maintain a mechanism that inhibits the death of tumor cells even under these favorable conditions. As one of them, FAM120A, an RNA-binding protein, is known to inhibit cell death and increase resistance to drugs by activating kinases such as Src (Logue, JS et al. AKAP220 protein organizes signaling elements that impact cell migration). J Biol Chem 286, 39269-81 (2011); Whiting, JL et al. Protein Kinase A Opposes the Phosphorylation-dependent Recruitment of Glycogen Synthase Kinase 3beta to A-kinase Anchoring Protein 220.J Biol Chem 290, 19445-57 ( 2015); Tanji, C. et al. A-kinase anchoring protein AKAP220 binds to glycogen synthase kinase-3beta (GSK-3beta) and mediates protein kinase A-dependent inhibition of GSK-3beta.J Biol Chem 277, 36955-61 ( 2002); Tanaka, M. et al. A novel RNA-binding protein, Ossa/C9orf10, regulates activity of Src kinases to protect cells from oxidative stress-induced apoptosis.Mol Cell Biol 29, 402-13 (2009); Bartolome, RA et al. IL13 Receptor alpha2 Signaling Requires a Scaffold Protein, FAM120A, to Activate the FAK and PI3K Pathways in Colon Cancer Metastasis. Cancer Res 75, 2434-44 (2015)).

In the present invention, it was confirmed that when the intracellular content of the genes is decreased using siRNA, the growth of cells is decreased as in the case of using miR-3670, miR4477a, and miR-8078 (Fig. 6), miR-3670, miR When -4477a and miR-8078 were delivered into lung cancer cells, it was confirmed that the mRNA expression of the genes was decreased as a result of qPCR (FIG. 7). In addition, it was confirmed as a result of luciferase that the genes are direct targets of miR-3670, miR-4477a, and miR-8078 (FIG. 8). This fact means that miR-3670, miR-4477a, and miR-8078 induce tumor cell death by simultaneously inhibiting the expression of several genes important for tumor cell growth and survival in a direct manner.

Among the miRNAs, miR-3670 simultaneously inhibits the expression of CBX4, NRAS, CASR, TXLNA, SNIP1, HNF1A, FZD4, TRIB1, ADMA19, CKAP5, and miR-8078 inhibits the expression of GREB1, HECTD3, RIPK4, and miR- 4477a simultaneously inhibits the expression of STIL, KIF11, AKAP11, and FAM120A, so that the mRNA of the genes is 100% complementary to the miRNA site, i.e., a perfect match, as well as some sequences. It includes cases of mismatch, i.e. there is a mismatch. For these miRNAs, the matching of the seed region is the most important, and with respect to a part of the mRNA sequence of the corresponding gene, it is preferably 70% or more, more preferably 80% or more, even more preferably 90% or more, even more. Preferably it may be composed of a sequence having a homology of 95% or more, most preferably 100%.

Such miRNAs may be duplexes or may include single molecule polynucleotides, and may be antisense oligonucleotides or microRNAs (miRNAs), but are not limited thereto.

In the case of an oligo conjugate in which a hydrophilic substance and a hydrophobic substance are bound to an RNA oligo as in the present invention, the RNA oligo can be efficiently delivered in vivo through a conjugate in which a hydrophilic substance and a hydrophobic substance are conjugated at both ends of the RNA oligo. In addition, stability can be improved.

Self-assembled nanoparticles are formed by the hydrophobic interaction of hydrophobic substances.These nanoparticles not only have extremely excellent delivery efficiency and stability in the body, but also have a very uniform particle size through the improvement of the structure. Since (Quality control) is easy, there is an advantage in that the manufacturing process as a drug is simple.

In one embodiment, in the double-stranded oligo RNA structure comprising miRNAs according to the present invention, the hydrophilic material is represented by (A) _n , (A _m -J) _n or (JA _m ) _n , and A is a hydrophilic material monomer (monomer), n may be 1 to 200, m may be 1 to 15, J may be a linker connecting m hydrophilic material monomers or m hydrophilic material monomers and oligonucleotides to each other.

When the hydrophilic material is (A) _n , the double-stranded oligo RNA structure according to the present invention has the structure of the following structural formula (1').

구조식 (1')

Structural Formula (1')

In the structural formula (1'), A, B, X and Y are the same as the definition in the structural formula (1), S is the sense strand of the specific miRNA for the gene, and AS is the specific miRNA for the gene. Refers to the antisense strand.

In one embodiment, the double-stranded oligo RNA structure comprising miRNAs according to the present invention may be a double-stranded oligo RNA structure comprising the structure of the following structural formula (2).

A-X-5' R 3'Y-B Structural Formula (2)

In the above Structural Formula (2), A, B, X, Y, and R are the same as those in Structural Formula 1.

More preferably, the double-stranded oligo RNA structure has a structure of the following structural formula (2').

구조식 (2')

Structural Formula (2')

In one embodiment, the hydrophilic material may be a cationic or nonionic polymer material having a molecular weight of 200 to 10,000, and preferably a nonionic polymer material having a molecular weight of 1,000 to 2,000. It is preferable to use a nonionic hydrophilic polymer compound such as polyethylene glycol, polyvinylpyrrolidone or polyoxazoline as the hydrophilic material, but is not limited thereto.

In another embodiment, when the hydrophilic material is (A _m -J) _n or (JA _m ) _n , the double-stranded oligo RNA structure according to the present invention has a structure of the following structural formula (3) or structural formula (4).

(A _m -J) _n -XRYB structural formula (3)

(JA _m ) _n -XRYB structural formula (4)

In the above structural formulas (3) and (4), A is a hydrophilic material monomer, n is 1 to 200, m is 1 to 15, J is between m hydrophilic material monomers or m hydrophilic material monomers and oligonucleotides. It may be a linker that connects to each other, and X and Y may each independently be a simple covalent bond or a linker-mediated covalent bond, and R may be specific miRNAs of the present invention. More preferably, the double-stranded oligo RNA structure comprising the miRNA according to the present invention has a structure of the following structural formula (3').

(A _m -J) _n -XSYB structural formula (3')

AS

In the above structural formula (3'), A, B, J, m, n, X and Y are the same as the definition in the above structural formula (3), S is the sense strand of the specific miRNA for the gene, AS is the gene It refers to the antisense strand of a miRNA specific for.

More preferably, the double-stranded oligo RNA structure comprising the miRNA according to the present invention has a structure of the following structural formula (4').

(JA _m ) _n -XSYB structural formula (4')

AS

In the structural formula (4'), A, B, J, m, n, X and Y are the same as the definition in the structural formula (4), S is the sense strand of the specific miRNA for the gene, AS is the gene It refers to the antisense strand of a miRNA specific for.

The hydrophilic material monomer (A) in the structural formulas (3) and (4) can be used without limitation, as long as it satisfies the purpose of the present invention among the monomers of the nonionic hydrophilic polymer. A monomer selected from the described compounds (1) to (3), more preferably a monomer of compound (1) may be used, and in compound (1) G is preferably selected from CH ₂ , O, S and NH. I can.

In particular, among the hydrophilic monomers, various functional groups can be introduced into the monomer represented by compound (1), and it has excellent bio-compatibility, such as good in vivo affinity and low immune response, as well as structural formula. It has the advantage of increasing the in vivo stability of the oligonucleotides contained in the structures according to (3) and structural formula (4) and increasing the delivery efficiency, so it is very suitable for the manufacture of the structure according to the present invention.

Table 2. Preferred hydrophilic material monomer structures in the present invention

It is preferable that the total molecular weight of the hydrophilic substance in Structural Formula (3) and Structural Formula (4) is in the range of 1,000 to 2,000. Therefore, for example, if a substance in which G is O and m is 6 in hexaethylene glycol according to compound (1), that is, structural formula (3) and structural formula (4) is used, hexaethylene glycol Since the molecular weight of the spacer is 344, the number of repetitions (n) is preferably 3 to 5.

_{The present invention is a suitable repeating unit of a hydrophilic group represented by (A m} -J) or (JA _m ) in the above structural formulas (3) and (4), i.e., a hydrophilic material block, as required by n. It is characterized in that it can be used as a number. A hydrophilic material monomer included in each of the hydrophilic material blocks and J as a linker may be independently the same or different between each hydrophilic material block. That is, when three hydrophilic material blocks are used (n=3), the hydrophilic material monomer according to compound (1) is used in the first block, the hydrophilic material monomer according to compound (2) is in the second block, and the third block is Different hydrophilic material monomers may be used for all hydrophilic material blocks, such as a hydrophilic material monomer according to compound (3), or any selected from the hydrophilic material monomers according to compounds (1) to (3) for all hydrophilic material blocks. One hydrophilic material monomer may be used equally. Likewise, the linker that mediates the bonding of the hydrophilic material monomer may also use the same linker for each block of the hydrophilic material, or a different linker may be used for each block of the hydrophilic material. In addition, m, which is the number of hydrophilic material monomers, may be the same or different between each hydrophilic material block. That is, in the first hydrophilic material block, 3 hydrophilic material monomers are connected (m=3), in the second hydrophilic material block 5 hydrophilic material monomers (m=5), and in the third hydrophilic material block, hydrophilic material monomers are connected. Different numbers of hydrophilic material monomers may be used, such as four connected (m=4), or the same number of hydrophilic material monomers may be used in all the hydrophilic material blocks.

In the present invention the linker (J) is a PO ₃ ^- as long as the purpose of the present invention due to, SO _3, and preferably is selected from the group consisting of CO _2, but is not limited to, monomers of the hydrophilic material used It is obvious to a person skilled in the art that any linker can be used.

All or part of the hydrophilic material monomer may be modified to have a functional group necessary for binding to another material such as a target-specific ligand, if necessary.

In some cases, one to three phosphate groups may be bonded to the 5ㅄ end of the antisense strand of the double-stranded oligo RNA structure containing the gene-specific miRNA.

For example, a double-stranded oligo RNA structure comprising miRNA has a structure of the following structural formula (3") or structural formula (4").

(A _m -J) _n -X-5' S 3'-YB Structural Formula (3'')

3'AS 5'-PO ₄

(JA _m ) _n -X-5' S 3'-YB Structural Formula (4'')

3'AS 5'-PO ₄

The hydrophobic material (B) serves to form nanoparticles composed of an oligonucleotide structure according to Structural Formula (1) through hydrophobic interaction.

The hydrophobic material preferably has a molecular weight of 250 to 1,000, and a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, a C ₁₂ to C ₅₀ unsaturated or Saturated hydrocarbon (hydrocarbon), diacylphosphatidylcholine (diacylphosphatidylcholine), fatty acid (fatty acid), phospholipid (phospholipid), lipopolyamine (lipopolyamine), etc. may be used, but is not limited thereto, and any It is obvious to those of ordinary skill in the art that a hydrophobic material can also be used.

The steroid derivative may be selected from the group consisting of cholesterol, cholesterol, cholic acid, cholesteryl formate, cotestanyl formate, and cholistanylamine, and the glyceride derivative is mono-, di- And tri-glyceride, etc. In this case, the fatty acid of the glyceride _{is preferably a C 12} to C ₅₀ unsaturated or saturated fatty acid.

In particular, among the above hydrophobic substances, saturated or unsaturated hydrocarbons or cholesterol are preferable in that they have the advantage of being able to be easily bonded in the step of synthesizing the oligonucleotide structure according to the present invention.

The hydrophobic substance is bound to the distal end of the hydrophilic substance, and may be bound to any position of the sense strand or the antisense strand of the miRNA.

In the present invention, a hydrophilic material, a hydrophilic material block, or a hydrophobic material and an oligonucleotide are bonded by a simple covalent bond or a linker-mediated covalent bond (X or Y). The covalent bond may be either a non-degradable bond or a decomposable bond. At this time, the non-degradable bond includes an amide bond or a phosphorylation bond, and the degradable bond includes a disulfide bond, an acid-decomposable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-degradable bond, but is not limited thereto. .

A miRNA oligo construct according to the present invention was prepared, a lung cancer cell line was treated in vitro, and the cell line was stained with Annexin V and analyzed using a flow cytometer. As shown in FIGS. 9A and 9B, it is clearly shown that when nanoparticles are used for increasing the stability in vivo by using an RNA structure, the self-killing effect of a cell line can be induced in a concentration-dependent manner.

Based on this, the present invention relates to a composition for preventing or treating cancer comprising the oligonucleotide structure. The present invention also relates to a method for preventing or treating cancer comprising administering the oligonucleotide construct.

In the present invention, the cancer is lung cancer, liver cancer, stomach cancer, colon cancer, pancreatic cancer, gallbladder and biliary tract cancer, breast cancer, leukemia, esophageal cancer, non-Hodgkin's lymphoma, thyroid cancer, cervical cancer, primary cancer of skin cancer and metastasis from it It is not limited to one or more types of cancer selected from the group consisting of metastatic cancers caused by the disease and tumorigenic cell diseases produced by promoting abnormal excessive cell division.

The miRNA sequence that can be used as an active ingredient in the composition for cancer treatment provided by the present invention is a sequence derived from a human genome, but a miRNA sequence obtained from a genome derived from another animal may also be used without limiting the genome derived from the miRNA to the human genome.

The miRNA can be used in the form of a variety of miRNA derivatives (miRNA mimics) that generate the biologically equivalent efficacy of miRNA, and a modified miRNA including a miRNA sequence including the same seed region can be used. At this time, the length of SEQ ID NO: 1 or SEQ ID NO: 2 can be shortened, and short derivatives consisting of 15 nucleotides in length can be used.

The miRNA derivative for the miRNA may partially include a phosphorothiolate structure in which an RNA phosphate backbone structure is substituted with another element such as sulfur, and instead of RNA, DNA, PNA ( petide nucleic acids) and LNA (locked nucleic acid) molecules can be used in a form in which the 2'hydroxyl group per RNA is substituted with various functional structures. Sihwa, fluoride, and the like are included, but are not limited to these variations.

The miRNA is not limited to mature miRNA (mature miRNA) and double-stranded RNA of the miRNA derivative derived therefrom, and may be used in the form of a miRNA precursor. Partial or total substitution of DNA, PNA, LNA, etc., and modification of the 2'hydroxyl group of a molecule per RNA are possible.

The miRNA can be used in the form of a miRNA precursor or a primary miRNA (pri-miRNA), which can be synthesized by a chemical method or delivered to a cell in the form of a plasmid for expression.

In the present invention, the method of delivering miRNA to cells cultured in a culture dish may be a method of using a mixture with cationic lipids, a method of delivering by electrical stimulation, a method of using a virus, etc. I do not put it.

The composition for treating cancer comprising the miRNA as an active ingredient may be a pharmaceutical composition further comprising a pharmaceutically acceptable carrier, and may be formulated together with a carrier.

In the present invention, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterilization and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare injection formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

The composition for preventing or treating cancer comprising the miRNA and a pharmaceutically acceptable carrier may be applied in any formulation containing it as an active ingredient, and may be prepared in an oral or parenteral formulation. Pharmaceutical formulations are oral, rectal, nasal, topical (including cheek and sublingual), subcutaneous, vaginal or parenteral; intramuscular, subcutaneous and intravenous Including) and suitable for administration or in a form suitable for administration by inhalation or insufflation.

Formulations for oral administration comprising the composition of the present invention as an active ingredient include, for example, tablets, troches, lozenges, water-soluble or oily suspensions, powders or granules, emulsions, hard or soft capsules, syrup or elixirs. can do. For formulation into tablets and capsules, etc., binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, and masne stearate Lubricating oils such as calcium, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax may be included, and in the case of capsule formulation, a liquid carrier such as fatty oil may be further included in addition to the above-mentioned substances.

Formulations for parenteral administration containing the composition of the present invention as an active ingredient include injection forms such as subcutaneous injection, intravenous injection, or intramuscular injection, suppository injection, or spray such as an aerosol that enables inhalation through the respiratory tract. It can be formulated as. In order to formulate a formulation for injection, the composition of the present invention may be prepared as a solution or suspension by mixing in water together with a stabilizer or buffer, and it may be formulated for unit administration in ampoules or vials. In order to inject as a suppository, it may be formulated into a composition for rectal administration such as a suppository containing a conventional suppository base such as cocoa butter or other glycerides or an enema. When formulated for spraying such as an aerosol, a propellant or the like may be blended together with an additive so that the water-dispersed concentrate or wet powder is dispersed.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1: Preparation of miRNA screening library

As a human miRNA sequence of 21 versions provided by the miRNA database miRBase (www.mirbase.org), 1700 miRNA screening libraries based on stem-loop structure are used as a solid synthesis method used for general oligo synthesis. The miRNA of the strand sequence was synthesized. Each strand of the synthesized miRNA was purified by reverse phase separation using C18 resin. All synthesized miRNA strands were identified and confirmed whether or not the intended sequence was synthesized using a MALDI-TOF mass spectrometer. In order to prepare a double-stranded miRNA, the corresponding complementary strand was heated in the presence of a salt for 2 minutes at 95°C and then gradually cooled to bind the double stranded.

[Table 1] miRNA sequence

Example 2: Measurement of activity of miRNA library specimens

In order to measure the activity of the miRNA double strand synthesized in Example 1, miR-34a, miR-100, and miR-125b were selectively selected from 1700 miRNA screening libraries. The selected miRNA was selected because of the many studies on the target mRNA type that controls function and expression and the binding region that binds to each mRNA 3'UTR from many previously performed studies. By substituting the 3'UTR portion of Bcl2, mTOR, and Lin28b mRNA, which is widely known to control expression by each of miR-34a, miR-100, and miR-125b, with the 3'UTR of the firefly luciferase vector. A vector corresponding to each miRNA was constructed. Each vector and miR control, or miR-34a, miR-100, and miR-125b corresponding to each vector were co-coated to the HEK-293T cell line using Lipofectamine 2000 (Invitrogen), an intracellular delivery reagent of the oligo. -Transfection (three repeated samples were prepared), and incubated for 24 hours at 37°C, 5% (v/v) carbon dioxide. The activity of luciferase was measured using a Luminometer (Thermo scientific) to confirm the activity of the synthesized miRNA (FIG. 1).

Example 3: Screening for discovery of microRNAs inducing proliferation inhibition of lung cancer cell lines

Dispense 3,000-10,000 NCI-H460 cell lines into a 96-well plate and incubate for 24 hours at 37°C, 5% (v/v) carbon dioxide, and then use RNAiMAX reagent (Invitrogen) for each miRNA in the miRNA library. Thus, transfection was performed so that the final concentration was 100 nM. Since each miRNA was transfected three times, three experimental 96-well plates were prepared per plate of a miRNA library stored in a 96-well plate. After culturing this for 24 hours under the same conditions as the cell culture conditions, a fluorescence value generated by adding a Resazurin reagent (Promega) was measured using a fluorescence meter (Fluoremeter, Tecan). In order to comparatively evaluate the ability to inhibit cell proliferation by each miRNA, the average value and standard deviation of 96 values measured in a 96-well plate were calculated, and the measured value in the well containing each miRNA from the average value was several standard deviations. It was calculated by substituting (Z-score) into the formula below to see if it is separated by a multiple.

In this case, x _i is the measured value of each well, μ is the average value of all wells measured in the plate, and σ is the standard deviation. The standard deviation multiple z _i of each well is an average value obtained from a plate that is repeated three times, and through this, about 50 primary candidate miRNAs having a z value less than -2 were selected (Fig. 2, Table 3).

[Table 3] Primary screening miRNA sequence

Example 4: Secondary screening for discovery of miRNAs that inhibit the proliferation of lung cancer cell lines

Using the 50 miRNA candidate groups obtained in the first screening, the measurement accuracy was improved and the second screening was carried out. Experimental conditions were the same as the first screening conditions, and the difference was that WST-1 reagent (Roche) was used instead of resazurin as a reagent for measuring the proliferation ability of cells. WST-1 was used because it has the advantage of being able to measure the intensity of the signal more quantitatively than resazurin. The measurement value of the cell inhibitory ability by each miRNA was disclosed in FIG. 3 as a value relative to the control, and miR-34a was also included as a positive control.

Example 5: Analysis of cell suicide induction ability

The method used in screening is a method of measuring the degree of inhibition of relative cell proliferation by measuring the number of cells in a quantitative sense. Mechanisms that inhibit cell proliferation include a method of slowing down the cell division cycle and a method of inducing cell suicide. In order to analyze the mechanism of action of miRNAs found in the present invention to inhibit cell proliferation, the degree of cell suicide was analyzed using a flow cytometer (Fluorescence Activated Cell Sorter, FACS). To this end, the cells were dispensed into a 6-well plate, and the miRNA was injected into the cells with an RNAiMAX reagent, and the cells were cultured under the conditions described above for 48 hours. Thereafter, the cells were treated with FIT-C fluorescent dye-labeled annexin V and analyzed by flow cytometry (FIG. 4). As a result of the analysis, it can be confirmed that most of the cells treated with miR-3670, miR-4477a, and miR-8078 were killed. It can be seen that the tumor growth inhibitory effect of miRNA identified in the screening was achieved by inducing cell death (Table 4).

[Table 4] Final screening miRNA sequence

Example 6: Inhibition of tumor growth in soft agar by miRNA

The characteristics as tumor cells can be measured by culturing tumor cells using soft agar. In the case of normal cells, a support such as a culture dish is required to grow, whereas a tumor cell has the characteristic of growing even in an environment without a physically strong support such as a soft agar. These tumor-specific properties were used to determine the ability to cluster cells in soft agar. NCI-H460 lung cancer cell lines were treated with control miRNA, miR-34a, miR-8078, miR-3670, miR-4477a, and miR-4765, respectively, and cultured for 24 hours, then mixed with soft agar and 2 in 6 well-plates. Incubated weekly. The cells were stained with a crystal violet dye to measure the number of each cluster (FIG. 5). As a result, it was confirmed that the cells treated with miR-8078 and miR-3670 hardly formed a cluster, and in the case of the cell group treated with miR-4477a, it could be confirmed that the cluster-forming ability was approximately 30% compared to the control group.

Example 7: Measurement of miRNA target mRNA cell proliferation inhibitory effect

The target mRNA whose protein expression is controlled by miRNA has a sequence that is partially complementary to that of the miRNA. The sequence of the seed region is particularly important for miRNA to suppress the expression of mRNA, because it inhibits gene expression by binding to mRNA having a sequence complementary to the seed region sequence. However, since the seed region sequence is relatively short with 8-9 bases, the target mRNA of miRNA is predicted using software. However, even when software is used, only some of the predicted targets are known to be actual targets. In order to solve these difficulties, the target gene was selected by determining whether the cell growth was inhibited after reducing the intracellular content of the target gene predicted through the software using siRNA. In order to predict the target mRNA of miRNA, TargetScan was used as a target prediction software commonly used in this field. Was selected. Three siRNAs were synthesized for each of the selected genes, and experiments were conducted in the same manner as in Example 3 using them. Cells were dispensed into 96 well-plates, treated with each siRNA, cultured for 48 hours, and then the cell proliferation ability was measured using a resazurin reagent. In the same manner as in Example 3, the Z-score of each gene was calculated from the average of the measured values of a total of 1,800 genes (about 600 genes x 3 types of siRNA), and disclosed in FIG. 6.

Example 8: Analysis of target mRNA of miRNA

The mode of action of miRNAs reduces the production of proteins from mRNA, and at the same time causes the degradation of most of the target mRNAs. Therefore, by injecting miRNA into cells and analyzing the content of the target mRNA of the miRNA using qPCR, and measuring the decrease in the content, it can be used as a criterion for determining whether the miRNA is a target mRNA. In order to determine whether the target mRNA is substantially lowered when the miRNA is delivered intracellularly by targeting the target gene of the miRNA identified in Example 7, miR-3670, miR-4477a, and miR-8078 were injected into the lung cancer cell line, respectively. After culturing for 48 hours, RNA was extracted from each cell and the RNA content was quantitatively measured (FIG. 7). As a result, it was confirmed that the expected target mRNA content of miR-3670, miR-4477a, and miR-8078 was significantly reduced.

Example 9: Identification of target mRNA by luciferase assay

Since miRNA inhibits protein production in the target mRNA by binding to the 3'UTR (untranslated region) of the target mRNA, luciferase assay is commonly used as a method for directly measuring the relationship between miRNA and target mRNA. TargetScan software provides a 3'UTR sequence containing a miRNA binding sequence, which is a gene cloning technique in a 3'UTR of firefly luciferase as described in Example 2 above. And the vector prepared in this manner was transfected into Human Embryonic Kidney (HEK) cells at the same time as the corresponding miRNA to measure the luciferase expression level of the vector. At this time, in order to correct the transfection efficiency, renilla luciferase was also transfected at the same time to correct the measured value. miRNA, Firefly luciferase, and Renilla luciferase were simultaneously injected and incubated for 48 hours, and then measured with a luminometer (FIG. 8). As a result, it was confirmed that each target mRNA was directly controlled by the corresponding miRNA.

Example 10: Synthesis of RNA oligo construct

The double-stranded oligo RNA structure prepared in the present invention has a structure as shown in the following structural formula (5).

(Ethylene glycol ^{_{6 -PO 3 -) 4 -5 '}} S 3'-C 6 -SSC 18 formula (5)

3'AS 5'-PO ₄

In the above structural formula (5), S is the sense strand of miRNA, AS is the antisense strand of miRNA, PO ₄ is a phosphate group, ethylene glycol is a hydrophilic material monomer, and hexa ethylene glycol is a linker (J). phosphoric acid group (PO ₃ ^-), coupled via, and C ₂₄ are tetra docosane acid (tetradocosane), and 5 'and 3' which contains a disulfide bond with a hydrophobic material is a double-helix oligonucleotide means the end direction of the RNA.

The miRNA sense strand in the above structural formula (5) uses DMT-hexaethylline glycol-CPG as a support and β-cyanoethylphosphoamidite is used to link the phosphodiester bonds forming the RNA skeleton structure. After synthesizing an oligo RNA-hydrophilic material structure containing a sense strand bound with hexaethylene glycol at the 3'end portion, the desired RNA-polymer structure by binding tetradocoic acid containing a disulfide bond to the 5'end The sense strand was prepared. In the case of the antisense strand to be annealed with the strand, an antisense strand having a sequence complementary to the sense strand was prepared through the aforementioned reaction.

Example 11: Induction of apoptosis mechanism by RNA construct containing miRNA sequence

In order to secure the stability of the miRNA selected through the above examples in vivo, an RNA oligo structure was prepared by the method of Example 10. In order to evaluate whether the nanoparticles prepared in this way also induce apoptosis in the lung cancer cell line, the lung cancer cell line was dispensed into a 6-well plate and cultured, and the nanoparticles were added to the culture solution at different treatment concentrations in each well. . After 48 hours after the addition of the nanoparticles, the cells were stained with Annexin V labeled with FIT-C fluorescent dye, and then the degree of cell death was analyzed by flow cytometry. As shown in FIGS. 9A and 9B, it can be seen that the miRNA prepared with the RNA construct kills cells in a manner dependent on the treatment concentration.

As described above, specific parts of the present invention have been described in detail, and it will be apparent to those of ordinary skill in the art that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

<110> BIONEER CORPORATION <120> Double Stranded Oligo RNA Structure Comprising miRNA <130> P18-B110 <150> KR 10-2016-0107937 <151> 2016-08-24 <160> 69 <170> PatentIn version 3.5 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 aucacauugc cagugauuac cc 22 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 guaaucacug gcaaugugau uu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 3 agauguccag ccacaauucu cg 22 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 4 agaauugcgu uuggacaauc agu 23 <210> 5 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 5 acuggacuug gagucagaag agugg 25 <210> 6 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 6 acucuucuga cuccaagucc aguuu 25 <210> 7 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 7 aaaaaccaca auuacuuuug cacca 25 <210> 8 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 8 gugcaaaagu aauugugguu uuuuu 25 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 9 caaagacugc aauuacuuuu gcg 23 <210> 10 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 10 caaaaguaau ugcagucuuu guu 23 <210> 11 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 11 ugaguuggcc aucugaguga g 21 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 12 cacucagaug gccaacucau u 21 <210> 13 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 13 aaagacauag gauagaguca ccuc 24 <210> 14 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 14 ggugacucua uccuaugucu uuuu 24 <210> 15 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 15 aaguaguugg uuuguaugag augguu 26 <210> 16 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 ccaucucaua caaaccaacu acuuuu 26 <210> 17 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 17 accuucuugu auaagcacug ugcuaaa 27 <210> 18 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 uagcacagug cuuauacaag aagguuu 27 <210> 19 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 19 caucugggca acugacugaa c 21 <210> 20 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 20 uucauucggc uguccagaug ua 22 <210> 21 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 21 uaggaugggg gugagaggug 20 <210> 22 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 22 ccucucaccc ccauccuauu 20 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 23 uggcuuuuaa cuuugauggc 20 <210> 24 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 24 caucaaaguu aaaagccauu 20 <210> 25 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 25 ugugacuuua agggaaaugg cg 22 <210> 26 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 26 ccauuucccu uaaagucaca uu 22 <210> 27 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 27 agaggcuuug ugcggauacg ggg 23 <210> 28 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 28 ccguauccgc acaaagccuc uuu 23 <210> 29 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 29 caaagugaug aguaauacug gcug 24 <210> 30 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 30 gccaguauua cucaucacuu uguu 24 <210> 31 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 31 aggaggcauc uugagaaaug ga 22 <210> 32 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 32 cauuucucaa gaugccuccu uu 22 <210> 33 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 33 gaaaaugaug aguagugacu gaug 24 <210> 34 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 34 ucagucacua cucaucauuu ucuu 24 <210> 35 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 35 agagcucaca gcuguccuuc ucua 24 <210> 36 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 36 gagaaggaca gcugugagcu cuuu 24 <210> 37 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 37 uagcccccag gcuucacuug gcg 23 <210> 38 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 38 ccaagugaag ccugggggcu auu 23 <210> 39 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 39 agaguuaacu caaaauggac ua 22 <210> 40 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 40 guccauuuug aguuaacucu uu 22 <210> 41 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 41 gauugagacu aguagggcua ggc 23 <210> 42 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 42 cuagcccuac uagucucaau cuu 23 <210> 43 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 43 cuauuaagga cauuugugau uc 22 <210> 44 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 44 aucacaaaug uccuuaauag uu 22 <210> 45 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 45 auuaaggaca uuugugauug au 22 <210> 46 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 46 caaucacaaa uguccuuaau uu 22 <210> 47 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 47 ugagugauug auagcuaugu uc 22 <210> 48 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 48 acauagcuau caaucacuca uu 22 <210> 49 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 49 cagaacagga gcauagaaag gc 22 <210> 50 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 50 cuuucuaugc uccuguucug uu 22 <210> 51 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 51 guggaccagg auggcaaggg cu 22 <210> 52 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 52 cuugccaucc ugguccacug cau 23 <210> 53 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 53 ugcuguauug ucagguagug a 21 <210> 54 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 54 ucacuaccug acaauacagu 20 <210> 55 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 55 guuucaccau guuggucagg c 21 <210> 56 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 56 cugaccaaca uggugaaacu u 21 <210> 57 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 57 ucaaguaguu ucaugauaaa gg 22 <210> 58 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 58 uuuaucauga aacuacuuga uu 22 <210> 59 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 59 uguuucgggg cucauggccu gug 23 <210> 60 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 60 caggccauga gccccgaaac auu 23 <210> 61 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 61 acguuugaau gcuguacaag gc 22 <210> 62 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 62 cuuguacagc auucaaacgu uu 22 <210> 63 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 63 uggcgauuuu ggaacucaau ggca 24 <210> 64 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 64 ccauugaguu ccaaaaucgc cauu 24 <210> 65 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 65 ggucuaggcc cggugagaga cuc 23 <210> 66 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 66 gucucucacc gggccuagac cuu 23 <210> 67 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 67 gacugguaua gcugcuuuug gagccuca 28 <210> 68 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 68 aucacaaaug uccuuaaugg ca 22 <210> 69 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 69 cuccaccggg cugaccggcc ug 22

Claims (16)

A double-stranded oligo RNA construct for treating cancer inducing a suicide mechanism of a cancer cell comprising the structure of the following structural formula (1).
AXRYB structural formula (1)
X and Y are each independently a simple covalent bond or a linker-mediated covalent bond, and R is an amino acid residue selected from the group consisting of SEQ ID NO: 65 and SEQ ID NO: 66 or SEQ ID NO: And double stranded RNA consisting of the nucleotide sequence of SEQ ID NO: 69 is contained as an active ingredient.
The method according to claim 1,
Wherein the hydrophilic substance is represented by (A) _n , (A _m -J) _n or (J _m ) _n , A is a hydrophilic monomer, n is 1 to 200, m is 1 to 15, J is m Wherein the oligonucleotide is a linker connecting oligonucleotides between the hydrophilic monomer and the hydrophilic monomer.
3. The method of claim 2,
Wherein the hydrophilic material has a molecular weight of 200 to 10,000.
3. The method of claim 2,
Wherein the hydrophilic material is polyethylene glycol (PEG).
3. The method of claim 2,
Wherein the hydrophilic monomer has a structure of the following compound (1).

Compound (1)
In the compound (1), G is selected from the group consisting of CH ₂ , O, S and NH.
3. The method of claim 2,
Wherein the linker (J) is selected from the group consisting of PO ₃ ^- , SO ₃ and CO ₂ .
3. The method of claim 2,
Wherein the hydrophobic substance has a molecular weight of 250 to 1,000.
8. The method of claim 7,
The hydrophobic material may be selected from the group consisting of steroid derivatives, glyceride derivatives, glycerol ether, polypropylene glycol, C ₁₂ to C ₅₀ unsaturated or saturated hydrocarbons, diacyl phosphatidyl choline diacylphosphatidylcholine, fatty acid, phospholipid, and lipopolyamine. &lt; RTI ID = 0.0 &gt; 18. &lt; / RTI &gt;
9. The method of claim 8,
Wherein said steroid derivative is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cortestanyl moromate, and cholestanyl amine.
The method of claim 8, wherein
Wherein the glyceride derivative is selected from mono-, di-, and tri-glycerides.
The method according to claim 1,
Wherein the covalent bond represented by X, Y and Z is a non-degradable bond or a degradable bond.
12. The method of claim 11,
Wherein the non-degradable bond is an amide bond or a phosphorylated bond.
12. The method of claim 11,
Wherein the degradable linkage is a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme degradable bond.
delete The method of claim 1, wherein the miRNA is selected from the group consisting of lung cancer, liver cancer, stomach cancer, colon cancer, pancreatic cancer, gall bladder cancer, breast cancer, leukemia, esophageal cancer, non-Hodgkin's lymphoma, thyroid cancer, cervical cancer, Wherein the cancer is treated with at least one cancer selected from the group consisting of metastatic cancer caused by metastasis and tumor-associated cell disease caused by abnormal abnormal cell division.
A composition for preventing or treating cancer, which comprises the double-stranded oligo RNA construct according to any one of claims 1 to 13 and 15.

Images