JP2011093892A - Tumor proliferation inhibitor containing cancer-inhibitive micro-rna - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To find out a micro-RNA effective as a tumor proliferation inhibitor, and to provide a new tumor proliferation inhibitor and a medicinal composition for use in cancer treatment. <P>SOLUTION: The tumor proliferation inhibitor includes as an effective ingredient at least one kind of a micro-RNA having a base sequence expressed in SEQ ID NO: 1 through 19 in the sequence table; the pancreatic cancer proliferation inhibitor contains as an effective ingredient at least one kind of a micro-RNA having a base sequence expressed SEQ ID NO: 1 through 5 in the sequence table; the colic cancer proliferation inhibitor contains as an effective ingredient at least one kind of a micro-RNA having a base sequence expressed SEQ ID NO: 5 through 19 in the sequence table; and the medicinal composition for use in cancer treatment contains these tumor proliferation inhibitors. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a tumor growth inhibitor containing a cancer-suppressing microRNA as an active ingredient. More specifically, the present invention relates to a tumor growth inhibitor containing pancreatic cancer inhibitory microRNA or colon cancer inhibitory microRNA as an active ingredient. Furthermore, this invention relates to the pharmaceutical composition for cancer treatment containing this tumor growth inhibitor.

  MicroRNAs are small non-coding RNAs of about 22 bases, suggesting that there are about 1000 types in humans. In recent years, microRNAs have attracted attention as molecules that suppress the expression of various genes in vivo. A region of each microRNA gene exists on the genome and is transcribed by RNA polymerase II to form a microRNA initial transcript of about several hundred bases. MicroRNA early transcripts are processed by two RNase III enzymes called Drosha in the nucleus and Dicer in the cytoplasm to form mature microRNAs. Mature microRNA is known to interact with regulatory protein complexes (RNA-induced silencing complex, RISC) and interact with multiple target gene mRNAs with complementary sequences to suppress gene expression. (Non-patent document 1).

  Some microRNAs have been implicated in human diseases including cancer. In particular, regarding the relationship between cancer and microRNA, the expression pattern of many microRNAs differs between normal and cancerous tissues in various organs, which strongly suggests the involvement of abnormal microRNA expression in the carcinogenesis process ( Non-Patent Document 2-4). Recently, the presence of tumor-inhibiting or carcinogenic-promoting microRNAs has been suggested (Non-patent Documents 5-7). As tumor-suppressing microRNAs, miR-15 and miR-16 have been reported to induce apoptosis in human megakaryocyte cells by suppressing the expression of apoptosis inhibitor BCL2 (Non-patent Document 8). Let-7 is known to suppress the expression of oncogene Ras in human lung cancer and uterine cancer cell lines (Non-patent Document 9). In addition, miR-143 and miR-145 have decreased expression in human colon cancer tissues, but their biological significance is still unclear (Non-patent Document 10). On the other hand, as a carcinogenic microRNA, miR-17-92 cluster has been reported to induce B cell lymphoma in mice in cooperation with transcription factor c-Myc (Non-patent Document 11). Moreover, miR-21 expression reduction is known to induce apoptosis in human glioblastoma cell lines (Non-patent Document 12). From the above, it is strongly suggested that decreased expression of tumor-inhibiting microRNA or increased expression of tumor-promoting microRNA may be involved in the human carcinogenesis process.

  A prognosis determination method for cancer using miRNA, a gene therapy vector for cancer, and a pharmaceutical composition for cancer treatment have also been proposed (Patent Document 1). A pharmaceutical composition for cancer treatment containing, as an active ingredient, any one selected from the group consisting of miRNA, pre-miRNA and pri-miRNA transcribed from DNA containing a specific base sequence is described (claims) Item 15).

  Furthermore, the present inventors tried to identify a microRNA whose expression is induced by the activation of the tumor suppressor gene p53 for the purpose of searching for a tumor suppressor microRNA, and microRNA34a (miR-34a) A patent application was filed for the result of finding out that it had a growth inhibitory effect on a plurality of colon cancer cells (Patent Document 2).

JP 2005-192484 A JP 2008-239596 A

Bartel DP, MicroRNAs: Genetics, Biological Properties, Mechanisms and Functions (MicroRNAs: Genomics, Biogenesis, Mechanism, and Function), Cell, 2004, 116, p.281-297 Lu J, Getz G, Miska EA et al., MicroRNA expression profiles classify human cancers, Nature, 2005, 435, p.834-838 Volinia S, Calin GA, Liu CG, Ambs S, et al., A microRNA expression signature of human solid tumors defines cancer gene targets, Proc Natl Acad Sci USA, 2006, 103, p.2257-2261 Calin GA, Croce CM, MicroRNA signatures in human cancers, Nature Rev Cancer, 2006, 6, 857-866 Esquela-Kerscher A, Slack FJ, Oncoirs-microRNAs with a role in cancer, Nature Rev Cancer, 2006, 6, pp. 259-269 Kent OA, Mendell JT, A small piece in the cancer puzzle: Oncogene, 2006, 25, p.6188- 6196 Zhang B, Pan X, Cobb GP, Anderson TA, MicroRNAs as oncogenes and tumor suppressors, Dev Biol, 2007, 302, p.1-12 Cimmino A, Calin GA, Fabbri M, Iorio MV, et al., MiR-15 and miR-16 induce apoptosis by targeting BCL2 (miR-15 and miR-16 induce apoptosis by targeting BCL2), Proc Natl Acad Sci USA, 2005, 102, p.13944-13949 Johnson SM, Grosshans H, Shingara J, Byrom M et al., RAS is regulated by the let-7 microRNA family, Cell, 2005, 120, p.635 -647 Michael MZ, O'Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Reduced accumulation of specific microRNAs in colorectal neoplasia (MRNA), Mol Cancer Res, 2003, Volume 1, p.882-891 He L, Thomson JM, Hemann MT, Hernando-Monge E, et al., A microRNA polycistron as a potential human oncogene, Nature, 2005, 435, p.828-833 Chan JA, Krichevsky AM, Kosik KS, microRNA-21 is an anti-apoptotic factor in human glioblastoma cell lines (MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells), Cancer Res, 2005, 65, p. 6029-6033

  As described in Non-Patent Documents 1 to 12 above, it is strongly suggested that a decrease in tumor suppressive microRNA expression or an increase in carcinogenic microRNA expression may be involved in the human carcinogenesis process. Does not describe a tumor growth inhibitor using a tumor-suppressing microRNA.

  In addition, in the invention described in Patent Document 1, DNA that can produce microRNA by transcription is used instead of a method that uses microRNA directly. In addition, Patent Document 1 does not include data on cancer treatment using microRNA using DNA capable of producing microRNA by transcription, and describes a tumor growth inhibitor actually using tumor suppressive microRNA. It has not been.

  Patent Document 2 describes a tumor growth inhibitor containing miR-34a as an active ingredient. However, despite the fact that hundreds of microRNAs are known, only miR-34a has been identified as an effective microRNA.

  Accordingly, an object of the present invention is to find a microRNA effective as a tumor growth inhibitor other than miR-34a, and to provide a new tumor growth inhibitor and a pharmaceutical composition for cancer treatment.

  The present inventors have newly developed a function screening method for microRNA in order to find a microRNA effective as a tumor growth inhibitor other than miR-34a. By this method, 15 types of colon cancer suppressive microRNAs were newly discovered, and 5 types of pancreatic cancer suppressive microRNAs were newly discovered. Based on this discovery, a tumor growth inhibitor containing microRNA as an active ingredient and a pharmaceutical composition for cancer treatment were completed.

The present invention is as follows.
[1]
A tumor growth inhibitor comprising as an active ingredient at least one microRNA having a base sequence represented by SEQ ID NOs: 1 to 19 in the sequence listing.
[2]
The tumor growth inhibitor according to [1], comprising as an active ingredient at least one microRNA having a base sequence represented by SEQ ID NOs: 1 to 5 in the sequence listing, wherein the tumor is pancreatic cancer.
[3]
The tumor growth inhibitor according to [1], comprising as an active ingredient at least one microRNA having a base sequence represented by SEQ ID NOs: 5 to 19 in the sequence listing, wherein the tumor is colon cancer.
[Four]
The tumor growth inhibitor according to [1], which contains microRNAmiR-22 having the base sequence represented by SEQ ID NO: 6 in the sequence listing as an active ingredient, and the tumor is colon cancer.
[Five]
The tumor growth inhibitor according to any one of [1] to [4], wherein the microRNA is a double-stranded precursor composed of RNA or DNA having a complementary base sequence.
[6]
The tumor growth inhibitor according to [5], wherein RNA having a complementary base sequence is modified RNA.
[7]
The tumor growth inhibitor according to any one of [1] to [6], further containing atelocollagen as a carrier.
[8]
The tumor growth inhibitor according to [7], wherein the mass mixing ratio of microRNA and atelocollagen is in the range of 1:99 to 99: 1.
[9]
[1] A pharmaceutical composition for cancer treatment comprising the tumor growth inhibitor according to any one of [8].

  ADVANTAGE OF THE INVENTION According to this invention, the tumor cell growth inhibitor and the pharmaceutical composition for cancer treatment which show the growth inhibitory effect with respect to a pancreatic cancer and / or a colon cancer cell can be provided.

The result of having confirmed the cell growth inhibitory effect by introduce | transducing individually 5 types of microRNA identified in Example 1 to a pancreatic cancer cell line, and measuring a cell number continuously is shown. The 16 types of microRNAs identified in Example 2 are individually introduced into the colon cancer cell line HCT116, and a microscopic observation image after culturing for 5 days is shown. The 16 types of microRNAs identified in Example 2 were individually introduced into colon cancer p53 mutant SW480 cells, and microscopic observation images after 5 days of culture are shown. The result (miR-22, miR-101, miR-30c, miR-345) of the quantitative RT-PCR method obtained in Example 2 is shown. The result (miR-193b) of the quantitative RT-PCR method obtained in Example 2 is shown. The result of the Imunoblot analysis obtained in Example 2 is shown. The result of the cell cycle analysis obtained in Example 2 is shown. The expression suppression result via p2 13 'untranslated region (3'UTR) by miR-22 obtained in Example 3 is shown. The suppression result of p53 dependent p21 expression induction by miR-22 obtained in Example 3 is shown. The result which shows the anticancer agent sensitivity increase effect of the cancer cell by miR-22 obtained in Example 3 is shown. The result of p53-dependent expression increase of miR-22 obtained in Example 3 is shown. The activation mode result with respect to the stress of miR-22 obtained in Example 3 is shown.

[Functional screening method for microRNA]
As described above, the present inventors have newly developed a functional screening method for microRNA in order to find a microRNA effective as a tumor growth inhibitor other than miR-34a. The microRNA functional screening method not only efficiently identifies tumor-suppressing microRNAs but also can efficiently identify cancer-promoting microRNAs. This system compares hundreds of microRNAs, such as humans and mice, in terms of (i) whether they are of interest (eg cell proliferation, metastasis, etc.) or (ii) whether they are promoting or suppressing It can also be identified in a short time. As for the former, the experimenter himself decides the trait he wants to know and constructs a suitable experimental system. Regarding the latter, changes in increase (cancer promotion) and decrease (cancer suppression) of the number of cells into which microRNA has been introduced are detected using a microarray. Specific methods are listed below.

[1] Use of a microRNA precursor-expressing virus library: A mixture (library) of viruses each expressing a microRNA precursor (about 500 to 600 base pairs) is used. Rather than investigating the functions of microRNAs individually, using a library of hundreds of microRNA-expressing viral vectors enables functional screening of large quantities of microRNAs in a relatively short time. Become. In addition, by using an expression system based on a virus library, it is possible to evaluate various traits as compared with the case of using a synthetic microRNA. In this study, we used the Lenti-mir ^TM Virus Library from System Biosciences of the United States for the construction of the system. However, if it is a virus library that expresses 500-600 bp of microRNA precursors, it can be used in principle. Is possible.

  [2] Design of microarray for detecting microRNA precursors: Design of probes that specifically hybridize to microRNA precursors of about 500 to 600 bp. The relative amount of the number of cells into which a certain microRNA has been introduced is detected as the fluorescence intensity of the labeled microRNA precursor. For this purpose, oligonucleotide probes that bind complementarily to each of several hundred microRNA precursors (each about 500 to 600 bp as a transcription product from a viral vector) were designed. The detection of the microRNA precursor is labeled as a complementary double strand because it is amplified by PCR from the state integrated in the genome as described later. For this reason, oligonucleotide probes were designed for both the sense and antisense of each precursor. In this study, a 60 bp oligonucleotide probe was designed using eArray software from Agilent Technologies, USA. The probe was mounted on the company's microarray with multiple replicates.

  Functional screening is possible by combining the above [1] and [2]. In particular, microRNAs that negatively control the trait of interest, such as cell proliferation and metastasis, can only be identified by functional screening using this combination.

Actual screening (1) Cells are infected with a virus library, and microRNA is introduced. For each trait of interest, genomic DNA is extracted from each cell sample to be compared.
(2) Amplify only the vicinity of the microRNA precursor by PCR.
(3) The amplified microRNA precursor is fluorescently labeled.
(4) After hybridization on the microarray, the fluorescence intensity is measured with a laser scanner and digitizing software.
(5) The change of the character of interest is identified as the fluorescence intensity ratio.

[Identification of microRNA molecules that suppress the growth of pancreatic cancer cell lines]
As described in detail in the Examples, a microRNA library was introduced into a pancreatic cancer cell line MIA PaCa-2, cultured for a certain period, and then a dropout clone was identified. As a result, five types of microRNA molecules (SEQ ID NOs: 1 to 5) that suppress the growth of pancreatic cancer cell lines were identified. A list of microRNAs is shown below (Table 1).

[Identification of microRNA molecules that suppress the growth of colon cancer cell lines]
As described in detail in the Examples, colon cancer cell lines HCT 116 and SW480 were infected with a microRNA-expressing lentiviral library and cultured for a certain period of time. Genomic DNA was collected from each of the cells immediately after infection and cultured for a certain period of time, and a viral fragment (including a microRNA precursor sequence) integrated into the chromosome was amplified by PCR. After labeling reaction using these as templates, the copy number of virus-derived microRNA genes was quantified using a custom-designed microarray. The aim was to isolate microRNAs that suppress cell growth, and so-called dropout clones were identified that exist in cells immediately after infection and whose copy number decreases after culturing for a certain period of time. As a result, it was found that 16 types of microRNAs strongly suppressed the growth of colon cancer cell lines. The list of microRNAs is shown below (Table 2). However, miR-34a is described in Patent Document 2 as a microRNA that suppresses the growth of colon cancer cell lines. In addition, miR-532 (SEQ ID NO: 5) is a microRNA identified above as a microRNA molecule that suppresses the growth of pancreatic cancer cell lines. Fourteen microRNAs from miR-22, miR-30c to miR-601, miR-605 excluding miR-34a and miR-532 were designated as SEQ ID NOS: 6-19.

  In microRNA (miRNA), a primary transcript having a length of several hundred to several thousand nucleotides is first synthesized from a miRNA gene. It is cleaved by a protein-enzyme complex called a microprocessor in the nucleus, and becomes a hairpin type precursor miRNA of about 60 to 70 nucleotides. After moving from the nucleus to the cytoplasm by exportin 5, it is further digested by ribonuclease III called Dicer to become a mature miRNA of 19 to 24 nucleotides. Mature miRNA forms a complex (RNA-induced silencing complex, RISC) and functions together with Argonaute protein, which is a regulator of RNA interference (RNAi).

  The microRNAs having the base sequences shown in SEQ ID NOs: 1 to 19 in the sequence listing in the present invention have the following sequences, and are all mature single-stranded miRNAs.

miR-22: AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 6)
miR-30c: UGUAAACAUCCUACACUCUCAGC (SEQ ID NO: 7)
miR-34a: UGGCAGUGUCUUAGCUGGUUGUU (SEQ ID NO: 2)
miR-101: UACAGUACUGUGAUAACUGAA (SEQ ID NO: 8)
miR-124: UAAGGCACGCGGUGAAUGCC (SEQ ID NO: 9)
miR-145: GUCCAGUUUUCCCAGGAAUCCCU (SEQ ID NO: 10)
miR-146b: UGAGAACUGAAUUCCAUAGGCU (SEQ ID NO: 11)
miR-193b: AACUGGCCCUCAAAGUCCCGCU (SEQ ID NO: 12)
miR-206: UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 13)
miR-218: UUGUGCUUGAUCUAACCAUGU (SEQ ID NO: 14)
miR-345: GCUGACUCCUAGUCCAGGGCUC (SEQ ID NO: 15)
miR-424: CAGCAGCAAUUCAUGUUUUGAA (SEQ ID NO: 16)
miR-532: CAUGCCUUGAGUGUAGGACCGU (SEQ ID NO: 5)
miR-551b: GCGACCCAUACUUGGUUUCAG (SEQ ID NO: 17)
miR-601: UGGUCUAGGAUUGUUGGAGGAG (SEQ ID NO: 18)
miR-605: UAAAUCCCAUGGUGCCUUCUCCU (SEQ ID NO: 19)
miR-29b: UAGCACCAUUUGAAAUCAGUGUU (SEQ ID NO: 1)
miR-222: AGCUACAUCUGGCUACUGGGU (SEQ ID NO: 3)
miR-224: CAAGUCACUAGUGGUUCCGUU (SEQ ID NO: 4)

  The mechanism of action of miRNA begins with the formation of a complex between messenger RNA (target mRNA) that has a partially complementary sequence to the miRNA sequence and RISC containing miRNA, and protein synthesis by the ribosome on the target mRNA (translation process) Inhibition of RNA, and further, degradation of mRNA by an intracellular structure called P-body. In the present invention, miRNA suppresses the translation of mRNA involved in the promotion of tumor cell growth, activates an intracellular tumor suppressor network, suppresses tumor cell growth, and induces cell death. (See Example 2).

  miRNA can also be a double-stranded precursor consisting of RNA having a complementary base sequence. The double-stranded precursor breaks the double strand from the thermodynamically unstable end in the cell to become a mature single-stranded miRNA, and exerts an effect of suppressing the growth of tumor cells.

  In addition to RNA having a complementary base sequence, RNA having a complementary base sequence can also be RNA in which a part of the nucleic acid of RNA having a complementary base sequence is modified. By such modification, the stability of the double-stranded precursor can be improved. As an example of modification, for example, 2-O (2-methoxy) ethyl-modification can be mentioned.

  The tumor growth inhibitor of the present invention can contain a carrier for transferring miRNA into cells. As such a carrier, a carrier for various RNAs including siRNA can be mentioned, for example, atelocollagen can be mentioned as a carrier. In addition to atelocollagen, known delivery carriers such as liposomes can be used as the carrier.

  Atelocollagen is enzyme-solubilized collagen, which is a polypeptide obtained by degrading the telopeptide portion by treating the collagen with pepsin. There are no particular limitations on the type, origin, type, etc. of collagen. In addition to atelocollagen, modified products thereof can also be used. As a modified product, a side chain amino group, a chemical modification of a carboxyl group, or a chemical / physical cross-linked product can be used. In addition, any collagen derived from mammals such as cattle, pigs, horses, humans, birds, and fish can be used as a source, but it has thermal stability that does not change at the temperature at which the cells are cultured. It is desirable. Specifically, collagen derived from mammals and birds is desirable, or collagen obtained by genetic recombination thereof is desirable. There are no particular restrictions on the type of collagen, but types I, II, III, etc. can be used because of their availability.

  The mass mixing ratio of miRNA and atelocollagen can be determined as appropriate in consideration of the long axis of the complex being around 100 nm, and can be, for example, in the range of 1:99 to 99: 1. The mixing can be performed preferably in the range of 10:90 to 90:10, more preferably 30:70 to 70:30.

  The tumor growth inhibitor of the present invention is effective as a tumor growth inhibitor of pancreatic cancer if it contains at least one microRNA having a base sequence represented by SEQ ID NOs: 1 to 5 in the sequence listing as an active ingredient. is there. The tumor growth inhibitor of the present invention can also contain two or more microRNAs having the base sequences represented by SEQ ID NOs: 1 to 5 as active ingredients.

  In addition, the tumor growth inhibitor of the present invention is effective as a tumor growth inhibitor of colorectal cancer, containing as an active ingredient at least one of the microRNAs having the base sequences shown in SEQ ID NOs: 5 to 19 It is. The tumor growth inhibitor of the present invention can also contain two or more kinds of microRNAs having the base sequences represented by SEQ ID NOs: 5 to 19 as active ingredients.

Highly efficient apoptosis induction mechanism by miR-22
Apoptosis can be induced by introducing miR-22 (SEQ ID NO: 6) alone into a colon cancer cell line (see Example 2), but this effect is particularly efficient in cells where the tumor suppressor gene p53 is wild-type. Well induced. In order to clarify this mechanism, miR-22 target genes were searched (for details, see Example 3).

  As a result, it was revealed that miR-22 suppresses p21. p21 has been considered to be a tumor suppressor gene that is induced by p53 and has a function of stopping the cell cycle. On the other hand, p21 induction is known to suppress apoptosis. In recent years, it has been clarified that p21 functions not only as a tumor suppressor gene but also as an oncogene, and screening of small molecule compounds that induce p53 activation and do not induce p21 expression. Although application to anticancer agents has been energetically performed all over the world, no effective one has been isolated yet.

  miR-22 represses translation of p21 via a miR-22 recognition sequence present in the 3 ′ untranslated region of p21 mRNA (FIG. 7). It was also revealed that the expression of p21 induced by p53 was strongly suppressed after adding an anticancer drug to the cells (FIG. 8). In addition, miR-22 is introduced into cancer cells to increase sensitivity to anticancer agents, and cancer cells can be efficiently induced to apoptosis with low concentrations of anticancer agents. It was found (FIG. 9). It was also found that miR-22 is directly regulated by the tumor suppressor p53 (FIG. 10). Interestingly, miR-22 expression control by p53 was observed only at concentrations of anticancer agents and cytotoxic stress that induce apoptosis in cancer cells (FIG. 11). Based on these results, miR-22 may play a role as a “molecular switch” that increases expression when cells select death by apoptosis and efficiently induces cell death through suppression of p21 expression. Was strongly suggested. It was also confirmed that 70% of colorectal cancer patients frequently lack a single allele at the miR-22 locus on the chromosome. This result strongly suggests that miR-22 may be a tumor suppressor gene for colorectal cancer.

  miR-22 functions as a tumor suppressor in carcinogenesis of the large intestine, and since it has a locus loss and decreased expression in patients, it is an ideal nucleic acid as an antitumor agent by introducing miR-22 into tumor tissue. Is a molecule.

  Furthermore, it has been shown that miR-22 strongly induces cell cycle arrest in p53 mutant cancer cell lines (see Example 2). This indicates the possibility of contributing to enhanced sensitivity to anticancer agents, and is useful as a candidate for developing antitumor agents with a wide range of applications.

  The present invention also includes a pharmaceutical composition for cancer treatment containing the tumor growth inhibitor of the present invention.

  In the pharmaceutical composition for cancer treatment according to the present invention, the content of miRNA is, for example, 100 to 500 mg, more preferably 300 to 500 mg. Furthermore, the dosage of the pharmaceutical composition for cancer treatment containing miRNA according to the present invention as an active ingredient can be appropriately adjusted according to the stage, age, weight, etc. of the cancer patient, for example, 100 to 500 mg, more preferably It is desirable to be 300-500 mg. It is desirable to administer such a dose 1 to 10 times, more preferably 5 to 10 times.

  Hereinafter, the present invention will be described in more detail with reference to examples.

Reference example
Create custom microarrays to detect microRNA precursors
1) The sequence of the human microRNA precursor expression lentiviral library to be used was obtained from a public database (miRBase, Ensembl, PubMed).
2) 60 bp oligonucleotide probe candidates were designed for these sequences using probe sequence design software (eArray, Agilent). The candidate and the entire sequence of the human microRNA precursor were subjected to homology search with Blast, and the probe with low specificity was redesigned with the same software.
3) Create a custom microarray with this probe sequence (Agilent). The same probe was arranged at a plurality of locations.

Example 1
Screening for pancreatic cancer suppressive microRNA
1) A lentiviral library (Lenti-miR Virus Library, SBI) expressing 445 human microRNA precursors was infected with the human pancreatic cancer cell line MIA PaCa-2 and cultured in a medium dish. The lentiviral genome infected with the cell line was integrated into the cell line genome and expressed the introduced microRNA precursor.

2) When cells grew on the culture dish, 1/8 of them were taken and cultured on a new culture dish (passaging). The passage was repeated about 9 times. During the passage, the remaining 7/8 cells that were not used were stored in liquid nitrogen.

3) DNA was extracted from a cell sample immediately after infection (P0) and a cell sample after 9 passages (P9). This DNA was a mixture of the cell line genome and the lentiviral genome introduced by lentiviral infection.

4) Polymerase chain reaction (PCR) was performed using this DNA as a template, and the portion containing the microRNA precursor DNA introduced by lentivirus infection was selectively amplified. In order to minimize the change in microRNA precursor ratio in the template due to PCR, PCR was performed independently in 4 tubes using the same template DNA, and this was mixed after PCR.
-PCR primer sequences;
forward primer: 5'-GCC TGG AGA CGC CAT CCA CGC TG-3 '(SEQ ID NO: 20); reverse primer: 5'-GAT GTG CGC TCT GCC CAC TGA C-3' (SEQ ID NO: 21)
・ PCR program: {94 ℃, 3 minutes} → {(94 ℃, 35 seconds → 65 ℃, 35 seconds → 72 ℃, 1 minute) × 25 times} → {72 ℃, 7 minutes} → 4 ℃

5) For 5) to 9) below, use a commercially available protocol / reagent kit for oligonucleotide CGH array. The PCR product was used as a template and enzymatically labeled with a fluorescent dye using a commercially available labeling kit (Genomic DNA Enzymatic Labeling Kit, Agilent). That is, using the PCR products of P0 and P9 as templates, fluorescently labeled DNA was synthesized using Exo-Klenow enzyme with Cy3 dCTP and Cy5-dCTP, respectively.

6) Labeled DNA was collected with a commercially available filter (YM-30 filter, Millipore).

7) The PCR products of P0 and P9 labeled with Cy3 and Cy5 were mixed, placed on the custom array prepared in 1, and hybridized at 65 ° C. for 24 hours.

8) The array was washed with Wash Buffer 1 and Wash Buffer 2 (Agilent). The array was scanned with a laser scanner, and the trend intensity ratio (log2 (Cy5 / Cy3)) was calculated using digitization software (FeatureExtraction Software, Agilent).

9) The average fluorescence intensity ratio of the same microRNA precursor was calculated using spreadsheet software. The average fluorescence intensity ratio was arranged from the largest to the smallest.

10) When introduced into human pancreatic cancer cell line MIA PaCa-2, the fluorescence intensity ratio is 10 ^-1 or less, that is, microRNA-222, -224, -29b,- 34a and -532 (SEQ ID NOs: 1 to 5) were identified.

  In addition, these microRNAs were individually introduced into pancreatic cancer cell lines, and the cell growth inhibitory effect was confirmed by measuring the number of cells over time (FIG. 1). As shown in FIG. 1, all of the candidate microRNAs were found to strongly suppress the growth of pancreatic cancer cell lines.

Example 2
Identification of colon cancer suppressive microRNA
1) Human colon cancer cell lines HCT 116 and SW480 cells were infected with a lentiviral miRNA expression library and cultured for a certain period of time. The subculture was repeated, and the cells were stored frozen for each passage and used for DNA preparation. Genomic DNA was prepared from cells immediately after infection and after 9 subcultures, and the lentivirus-derived miRNA gene region integrated into the cell population was amplified by PCR. The subsequent experimental operation is the same as the method of Example 1 above. Clones with a fluorescence intensity ratio of 10 ⁻¹ or less were extracted as candidates.

  The 16 types of microRNAs shown in the following table were extracted as candidates for significantly suppressing the growth of colon cancer cell lines.

2) Narrowing down candidate microRNAs In order to examine the cell growth inhibitory effect of candidate miRNAs extracted by the above method, 22-base mature synthetic miRNAs (Applied Biosystems, Pre-miRNA) were introduced into HCT116 and SW480 cells. And cultured for 3 to 5 days. After culturing for a certain period, the cell growth inhibitory effect was evaluated under a microscope (FIG. 2). The cell growth inhibitory effect was evaluated based on the morphology and the number of cells into which the candidate miRNA was introduced relative to the cells into which the negative control miRNA was introduced. In particular, the effect on cell proliferation was quantitatively evaluated by the MTS method for those with a remarkable growth inhibitory effect.

  The microRNAs shown in Table 4 were individually introduced into the colorectal cancer cell line HCT116, and from the results of FIG. 2 which were microscopic images after 5 days of culture, miR-22, 34a, 101, 124, 193b, 206, 424 , 532, 601, and 605 have strong cell death-inducing activity.

  The microRNAs shown in Table 4 were individually introduced into p53 mutant SW480 colorectal cancer cells, and from the results shown in FIG. 3, which is a microscopic image after culturing for 5 days. As well as p53 mutant SW480 cells.

  Comparing FIG. 2 and FIG. 3, miR-345 has a strong effect in the p53 mutant cell line. The same tendency was observed for miR-124. On the other hand, it can be seen that miR-22, 101, 601 has a strong effect of inducing cell death against both cell lines.

3) Expression of candidate miRNAs in human colorectal cancer specimens
To examine the expression of miR-22, miR-101, miR-30c, miR-345, and miR-193b in colorectal cancer specimens, we evaluated the expression of 24 human colon cancer tissues by quantitative RT-PCR. did. Total RNA was prepared from 24 cases of colorectal cancer surgical specimens and non-cancerous parts derived from the same individual, and the expression level of the miRNA in cancer tissues was quantified by quantitative PCR. Quantitative RT-PCR was performed using an Applied Biosystems TaqMan miRNA expression quantification system. The results are shown in FIGS. 4a and 4b (expression is expressed by relative quantification in cancerous / non-cancerous).

  In application to therapeutic agents, molecules that are expressed in normal tissues and show a significant decrease in expression in cancer tissues are preferred. Expression of three types (miR-22, miR-101, miR-30c) of candidate miRNAs was observed in more than half of colon cancer specimens. In addition, miR-345 and miR-193b were also found to decrease in expression in colorectal cancer specimens.

4) Function of therapeutic drug candidate miRNAs: miR-22, miR-101, miR-30c introduced miRNAs that showed decreased expression in more than 50% colorectal cancer specimens from expression analysis using clinical cancer specimens We analyzed the changes in intracellular gene expression. After introducing miR-22, miR-101, miR-30c mature miRNA into colon cancer cell line HCT 116 alone (Apllied Biosystems, pre-miR) and culturing for 3 days, gene expression analysis is performed by Agilent. An expression analysis array was used. Similarly, each miRNA was introduced into HCT 116 cells, proteins were prepared from the cells cultured for 3 days, and used as samples for Imunoblot analysis. Furthermore, the cell cycle was analyzed using cells into which candidate miRNAs were introduced in the same manner.

  Microarray analysis revealed that the introduction of miR-22, miR-101, and miR-30c activated the intracellular signal transduction system associated with the tumor suppressor p53. FIG. 5 shows immunoblotting detection of the expression of p53 and p53-related factors (p21, NOXA, LATS2) by the miRNA. From the results shown in FIG. 6, it was also found that cancer cells into which miR-22 and miR-101 were introduced were suppressed in cell proliferation due to apoptosis induction. On the other hand, miR-30c was found to induce cell cycle arrest. From these results, it was found that these three miRNAs suppressed cell proliferation by activating the tumor suppressor group.

The above results are summarized below.
In Table 4, miR-34a, which is a tumor suppressor miRNA described in Patent Document 2, was included. Except miR-34a, miR-22 to miR-424, miR-551b to miR-605 are shown in SEQ ID NOs: 6 to 19, respectively. miR-532 (SEQ ID NO: 5) also suppresses the growth of human pancreatic cancer cell lines as described above. miR-22, miR-30c, miR-101, miR-345, and miR-193b showed a strong cell growth inhibitory effect. This effect was also observed in a cell line in which p53, a typical tumor suppressor, was mutated. Therefore, miR-22, miR-30c, miR-101, miR-345, and miR-193b are considered to be applicable to a wide range of colorectal cancers as components of antitumor drugs.

  In addition, it was found that many of these miRNAs have decreased expression in human colon cancer specimens. In particular, regarding miR-22, miR-30c, and miR-101, it was found that the expression decreased in approximately half of the samples in common. From these results, it is considered that these three types of miRNAs are particularly useful as therapeutic drug components.

  Of the microRNA molecules isolated above, miR-34a and miR-532 were the only molecules common to colorectal cancer and pancreatic cancer, and nothing else was common. Since the same library and detection method are used in the experiment, it is strongly suggested that the function of the microRNA is specific to the tissue (cell). That is, other than miR-532 are microRNAs exhibiting an antiproliferative effect specific to colon cancer or pancreatic cancer. This fact indicates that other than miR-532, it is possible to provide a therapeutic agent that has little effect on other cells (ie, has few side effects).

Example 3
experimental method
Identification of miR-22 target gene: A cell line that constitutively expresses AGO2, one of miRNA regulators, was established in the colon cancer cell line HCT116. The introduced AGO2 can be analyzed using an HA antibody by adding an HA tag. MiR-22 and negative control miRNA were introduced into HCT116-AGO2 cells and cultured for 24 hours. A cell extract was prepared and AGO2 was immunoprecipitated using anti-HA antibody. RNA was prepared from the immunoprecipitate according to a conventional method, purified by a column, and then subjected to microarray analysis. A cyclin-dependent kinase inhibitor p21 was identified.

Measurement of p21 expression suppression by miR-22
A luciferase reporter gene in which the 3 ′ untranslated region of P21 was inserted was constructed. This reporter plasmid and miR-22 were introduced into cancer cells by a conventional method, cultured for 24 hours, and then luciferase activity was measured. Based on the measured value of the endogenous control, miR-22 showed an expression suppression effect via the p21 untranslated region. The results are shown in FIG.

  FIG. 7 shows the results of measuring luciferase activity by introducing a luciferase reporter plasmid in which the 3′UTR region of p21 mRNA was inserted into HCT 116 cells and a negative control miRNA (NC) or miR-22 (22). The graph shows relative activity values. FIG. 7 shows that when the luciferase reporter plasmid ligated with p21 3′UTR in which a mutation is introduced into the region to which miR-22 binds is used, miR-22 suppressive activity is attenuated.

Inhibition of p21 expression induction by miR-22
miR-22 and negative control miRNA were introduced into colon cancer cells and HCT116 by lipofection, cultured for 2 days, treated with adriamycin, an anticancer agent, and cell extracts were prepared over time. . The expression of p21 was confirmed by the Imunoblot method. The results are shown in FIG.

  MiR-22 and negative control miRNA (miR-NC) were introduced into colorectal cancer cell line HCT 116 cells, cultured for 48 hours, and adriamycin (ADR), an anticancer agent, was then added. Cell extracts were prepared over time at the times shown in the figure, and expression induction of p21 was analyzed by the Imuno blot method. It can be seen that in cells into which miR-NC has been introduced, p53 is activated after ADR addition, and p21 expression is induced accordingly. On the other hand, it can be seen that p21 expression is strongly suppressed in cells into which miR-22 has been introduced. GAPDH is used as an endogenous control indicating whether or not an equal amount of protein is obtained and transferred during electrophoresis.

miR-22 increases the sensitivity of cancer cells to anticancer drugs
MiR-22 and control miRNA were introduced into HCT 116 cells by the above method and cultured overnight. Cells were treated with low concentrations of adriamycin and cultured overnight, after which dead cells were detected by flow cytometry (FACS). Cell death was judged by changing the DNA detection pattern by PI staining. In addition, the intracellular protein PARP-1 that was cleaved with apoptosis was also detected. The results are shown in FIG.

  HCT 116 cells were treated with a low concentration of adriamycin (ADR), cultured for 24 hours, and then cell death was detected with a flow cytometer. As shown in the upper right panel, it can be seen that cell death was not caused by ADR treatment at a low concentration, and cell cycle arrest was induced. On the other hand, weak apoptosis was induced in cells into which only miR-22 was introduced (lower left panel). Cells treated with both miR-22 and low concentrations of ADR induced clear cell death, confirming that the cell cycle pattern was greatly disturbed (lower right panel)

Analysis of increased p53-dependent expression of miR-22
HCT 116 cells were treated with adriamycin, cultured for 24 hours, and intracellular total RNA was prepared. MiR-22 expression was quantified by TaqMan real-time PCR using 16 ng of total RNA. The results are shown in FIG.

  HCT 116 colon cancer cells were treated with anticancer drug adriamycin and cultured overnight, and then total RNA was prepared. miR-22 was quantified by TaqMan real-time PCR. It can be seen that miR-22 significantly increases in p53 wild-type cells after adriamycin treatment. On the other hand, since expression induction was not observed in cells lacking p53, it was found that miR-22 was induced to be p53-dependent.

Analysis of miR-22 expression regulation mechanism
HCT 116 cells were treated with low and high concentrations of adriamycin, RNA was collected over time, and miR-22 and p21 mRNA were quantified by real-time PCR. At the same time, a cell extract was prepared, and p53 and p21 were detected by immunoblotting to confirm the cleavage of PARP-1 which is a marker for apoptosis. The results are shown in FIG.

  Treatment of HCT 116 cells with low concentrations of ADR induces cell cycle arrest. At this time, rapid increases in p21 mRNA and protein levels are observed. On the other hand, in cells treated with a high concentration of ADR, cell death begins to be observed about 10 hours after treatment. At this time, it can be seen that miR-22 is induced to be expressed by the same kinetics as p21 mRNA. Interestingly, it was found that in cells cultured at a high concentration of ADR for 36 hours, the protein level hardly changed even though the expression level of p21 mRNA was increased. At this time, miR-22 expression is elevated. From these results, it is considered that miR-22 may be induced to express when cells select apoptosis.

Summary
The new knowledge at the molecular level about the antitumor cell proliferation activity of miR-22 was described. p21 targeted by miR-22 has been classically considered as a tumor suppressor gene that suppresses cell cycle enhancement. In recent years, it has been reported that p21 suppresses apoptosis and is deeply related to cell survival and the importance of p21 in cancer stem cells. As an anticancer agent, it has been reported that a small molecule compound that induces p53 activation and does not involve p21 activation is effective. That is, cell death is efficiently induced by simultaneously causing p53 activation and p21 suppression. miR-22 is a small non-coding RNA expressed endogenously, and an endogenous factor can suppress the expression of p21 with the activation of p53. This indicates that it is a molecule that not only sensitizes the effects of anticancer agents, but can also greatly contribute to the reduction of side effects.

  The present invention is useful in the field of cancer treatment by inhibiting cell growth with microRNA.

Claims (9)

A tumor growth inhibitor comprising, as an active ingredient, at least one microRNA having a base sequence represented by SEQ ID NOs: 1 to 19 in the Sequence Listing. 2. The tumor growth inhibitor according to claim 1, comprising as an active ingredient at least one microRNA having a base sequence represented by SEQ ID NOs: 1 to 5 in the sequence listing, wherein the tumor is pancreatic cancer. 2. The tumor growth inhibitor according to claim 1, comprising as an active ingredient at least one microRNA having a base sequence represented by SEQ ID NOs: 5 to 19 in the sequence listing, wherein the tumor is colon cancer. 2. The tumor growth inhibitor according to claim 1, comprising microRNAmiR-22 having the base sequence represented by SEQ ID NO: 6 in the sequence listing as an active ingredient, and the tumor is colon cancer. 5. The tumor growth inhibitor according to any one of claims 1 to 4, wherein the microRNA is a double-stranded precursor composed of RNA or DNA having a complementary base sequence. 6. The tumor growth inhibitor according to claim 5, wherein the RNA having a complementary base sequence is a modified RNA. The tumor growth inhibitor according to any one of claims 1 to 6, further comprising atelocollagen as a carrier. 8. The tumor growth inhibitor according to claim 7, wherein the mass mixing ratio of microRNA and atelocollagen is in the range of 1:99 to 99: 1. The pharmaceutical composition for cancer treatment containing the tumor growth inhibitor of any one of Claims 1-8.