KR101895677B1 - Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp - Google Patents
Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp Download PDFInfo
- Publication number
- KR101895677B1 KR101895677B1 KR1020160124069A KR20160124069A KR101895677B1 KR 101895677 B1 KR101895677 B1 KR 101895677B1 KR 1020160124069 A KR1020160124069 A KR 1020160124069A KR 20160124069 A KR20160124069 A KR 20160124069A KR 101895677 B1 KR101895677 B1 KR 101895677B1
- Authority
- KR
- South Korea
- Prior art keywords
- lung cancer
- prognosis
- dtx1
- present
- predicting
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 DTX1 (Deltex-1) 유전자 내 단일염기다형성(single nucleotide polymorphism; SNP)을 이용한 폐암 예후 마커 및 이를 이용한 폐암의 생존 예후를 예측하는 방법에 관한 것이다. 보다 구체적으로, 본 발명은 DTX1 유전자의 프로모터, 엑손 등에 존재하는 특정 SNP 에 근거한 폐암 생존 예후 예측용 조성물, 이를 이용한 폐암 생존 예후 예측용 키트, 마이크로 어레이 및 폐암 생존 예후를 예측하는 방법에 관한 것이다.The present invention relates to a lung cancer prognostic marker using single nucleotide polymorphism (SNP) in DTX1 (Deltex-1) gene and a method for predicting the survival prognosis of lung cancer using the same. More particularly, the present invention relates to a composition for predicting the survival prognosis of lung cancer based on a specific SNP present in the promoter of DTX1 gene, exon and the like, a kit for predicting survival prognosis of lung cancer using the same, a method for predicting microarray and survival prognosis of lung cancer.
Description
본 발명은 비소세포폐암(non-small cell lung cancer, NSCLC)의 예후 예측을 위한 DTX1 (Deltex-1) 유전자 단일염기 다형성에 관한 것으로, 보다 구체적으로는 rs1732786의 SNP를 이용하여 초기 단계 비소세포폐암의 생존 결과에 영향을 미치는 예후를 진단 및 예측할 수 있는 방법 및 이의 용도에 관한 것이다.The present invention relates to DTX1 (Deltex-1) gene single nucleotide polymorphism for predicting the prognosis of non-small cell lung cancer (NSCLC), and more specifically, to SNP of rs1732786, The present invention relates to a method for diagnosing and predicting a prognosis affecting the survival outcome of a subject, and a use thereof.
전 세계적으로 폐암은 매년 1,600,000명에 이르는 새로운 환자가 발생하고, 이 중 1,400,000명이 사망한다. 이는 전체 암 발생의 13%를 차지하고, 암 관련 사망의 18%를 차지하는 수치이다. 2010년에는 폐암으로 인한 사망이 1,500,000건으로 증가하여, 전체 암 관련 사망의 19%를 차지했다. Globally, lung cancer accounts for 1,600,000 new cases each year, of which 1.4 million die. This accounted for 13% of all cancer cases and accounted for 18% of cancer-related deaths. In 2010, lung cancer deaths increased to 1,500,000, accounting for 19% of all cancer-related deaths.
조직학적으로는 80% 정도가 비소세포폐암(non-small-cell lung cancer)이고, 이 중 32-40%는 기관지 폐포암(bronchoalveolar carcinoma, BAC)을 포함한 선암(adenocarcinoma), 25-30%는 평편상피세포암(squamous cell carcinoma), 그리고 8-16%는 대세포신경내분비암(large cell neuroendocrine carcinoma)이 차지한다. 전체 비소세포폐암의 65% 이상은 진단 당시부터 완전 절제가 불가능한 상태로 발견된다.Histologically, about 80% are non-small-cell lung cancer, 32-40% of whom are adenocarcinoma including bronchoalveolar carcinoma (BAC), 25-30% Squamous cell carcinoma, and 8-16% of large cell neuroendocrine carcinoma. More than 65% of all non-small cell lung cancers are found to be in a state where complete resection is impossible from the time of diagnosis.
NSCLC의 진단은 생검 샘플과 같은 의심된 조직의 병리학자의 조사에 의해 수행된다. NSCLC 진단 후, 환자의 질환은 환자의 전체 건강 상태 및 연령, 기침 및 호흡 곤란과 같은 증상의 중증도, 특정 유형의 NSCLC 및 암의 진행 단계(staging)를 사용한 예후 (회복 기회)로 할당된다. 진행 단계는 종양의 크기 및 종양이 단지 폐에만 존재하는지 또는 신체의 다른 곳으로 확산되었는지를 고려한다. NSCLC 환자에 대한 특정 치료 옵션은 상기 고려사항을 기준으로 선택하고, 암 진행 단계는 치료 선택을 위해 중요한 요소이다. 조기 NSCLC를 갖는 환자들은 잠재적으로 종양을 제거하기 위한 수술 절제에 의해 치유될 수 있지만, 현재 진단 양상으로는 어느 환자가 수술 후 재발할 것인지를 예측할 수 없다. Diagnosis of NSCLC is performed by examination of pathologists of suspected tissues such as biopsy samples. After NSCLC diagnosis, the patient's illness is assigned to the patient's overall health status and severity of symptoms such as age, coughing and dyspnea, prognosis (recovery opportunity) using specific types of NSCLC and cancer staging. The progression stage considers the size of the tumor and whether the tumor is present only in the lung or diffuse elsewhere in the body. Specific treatment options for NSCLC patients are selected based on the above considerations, and the cancer progression stage is an important factor for treatment selection. Patients with early NSCLC can potentially be cured by surgical resection to remove the tumor, but current diagnostic aspects can not predict which patient will recur after surgery.
또한, 암은 흔히 국소적으로 재발하거나 본래의 암 조직으로부터 원거리의 조직 및 기관으로 전이하기 때문에, 조기 암을 갖는 환자 중 어느 환자가 이들의 원발성 종양의 수술적 제거 후 약물 치료를 받을 필요가 있는지를 밝히는 것은 중요하다. 이것은 특히 조기 NSCLC를 갖는 환자들에서 중요한 문제이다. Also, because cancer often recurs locally or transitions from native cancer tissue to distant tissues and organs, which of the patients with early cancer need to undergo drug treatment after surgical removal of their primary tumor It is important to reveal. This is particularly important in patients with early NSCLC.
폐암의 이상적인 치료법은 조기 발견하여 수술로 완전히 암을 제거하는 것이지만, 폐암의 진단 시 환자의 반수 이상이 수술을 할 수 없을 정도로 진행된 상태이므로 조기치료는 현실적으로 어렵다. 또한, 폐암 발병 후의 경우, 특히 비소세포암은 외과적 수술을 할 수 있을 만큼 진행되지 않은 경우라면 우선 수술을 시행하는데, 근치절제술을 시행할 수 있는 경우는 30%에 불과하다. 수술 후 완치 여부를 판정하는 5년 생존율은 암의 진행 정도에 따라 다르나, 근치절제술을 시행한 전체 환자를 대상으로 보면 편평상피암 37%, 선암 27%, 대세포암 27% 정도가 완치되었다. 이들 환자의 대다수는 수술 절제 후에 보다 공격적인 질환으로 재발하여 사망한다. 현재 임상적 진단 방법으로는 재발할 가능성이 높은 환자에 대해 보다 공격적인 치료요법을 지시하기에 충분한 정확도로 조기 NSCLC 예후를 확인할 수 없다.The ideal treatment for lung cancer is early detection and removal of the cancer by surgery. However, early diagnosis is difficult because early diagnosis of lung cancer has progressed to such an extent that more than half of the patients can not undergo surgery. In addition, after the onset of lung cancer, especially in patients with non-small cell carcinoma, if surgery has not progressed enough, surgery will be performed first, but only 30% can perform radical resection. The 5-year survival rate, which depends on the degree of cancer progression, was recovered in all patients who underwent curative resection, including squamous cell carcinoma (37%), adenocarcinoma (27%) and large cell carcinoma (27%). The majority of these patients relapse after surgery and become more aggressive and die. Early NSCLC prognosis can not be confirmed with sufficient accuracy to direct more aggressive therapies for patients with a high likelihood of recurrence as a current clinical diagnostic method.
따라서, 화학치료요법을 받아야만 하거나 일반적으로 재평가된 치료 소견을 가져야만 하는 높은 위험성의 조기 NSCLC 환자를 확인할 필요가 있고, 추가 필요한 치료 방법의 사용 여부를 손쉽게 결정할 수 있도록 NSCLC의 예후를 판단할 수 있으면 생존율을 현저히 높일 수 있다.Therefore, it may be necessary to identify patients with high risk of early NSCLC who have to undergo chemotherapy or have generally reevaluated treatment findings, and can determine the prognosis of NSCLC so that it is easy to decide whether to use additional treatment options The survival rate can be remarkably increased.
이에 본 발명자들은 비소세포폐암(NSCLC)의 발생 및 진행과 관련 있는 28개 유전자에서 79개의 잠재적 기능성 다형성을 선정하여 근치적 절제술을 받은 354명의 비소세포폐암 환자에서 유전자 칩(Affimetrix Inc., 미국)을 이용하여 유전자형을 분석하여, 전체생존(OS)과 무병생존(DFS)에서 로그-순위(log-rank) 검정법을 통해 초기 비소세포폐암 환자의 예후와 관련된 유전적 다형성을 발굴함으로써 본 발명을 완성하였다.Thus, the present inventors have developed a gene chip (Affimetrix Inc., USA) in 354 non-small cell lung cancer patients who underwent curative resection of 79 potential functional polymorphisms in 28 genes involved in the development and progression of non-small cell lung cancer (NSCLC) Genotypes were analyzed using genetic polymorphisms to identify genetic polymorphisms associated with the prognosis of patients with early stage non-small cell lung cancer through log-rank test in overall survival (OS) and disease free survival (DFS) Respectively.
따라서 본 발명의 목적은 DTX1 (Deltex-1) 유전자의 단일염기다형성(SNP)을 함유하는, 폐암 예후 진단 및 예측을 위한 마커용 조성물을 제공하는 것이다. It is therefore an object of the present invention to provide a composition for markers for diagnosing and predicting lung cancer prognosis, which contains a single base polymorphism (SNP) of the DTX1 (Deltex-1) gene.
또한 본 발명의 다른 목적은 본 발명의 조성물을 포함하는 폐암 환자의 생존 예후 예측용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for predicting the survival prognosis of lung cancer patients comprising the composition of the present invention.
또한 본 발명의 다른 목적은 본 발명의 조성물을 포함하는 폐암 환자의 생존 예후 예측용 마이크로어레이를 제공하는 것이다.Another object of the present invention is to provide a microarray for predicting the survival prognosis of lung cancer patients comprising the composition of the present invention.
나아가 본 발명의 다른 목적은 폐암 환자의 생존 예후 예측을 위한 정보를 제공하는 방법을 제공하는 것이다.It is a further object of the present invention to provide a method for providing information for predicting the survival prognosis of lung cancer patients.
상기 목적을 달성하기 위하여, 본 발명은 DTX1 (Deltex-1) 유전자의 단일염기다형성(SNP)을 함유하는, 폐암 예후 진단 및 예측을 위한 마커용 조성물을 제공한다.In order to achieve the above object, the present invention provides a composition for markers for diagnosing and predicting lung cancer prognosis, which contains a single nucleotide polymorphism (SNP) of the DTX1 (Deltex-1) gene.
본 발명의 일실시예에 있어서, 상기 DTX1 유전자의 단일염기다형성은 서열번호 1로 표시되는 염기서열 중 1128번째 염기의 SNP, 즉 rs1732786A>G 다형성일 수 있다. In one embodiment of the present invention, the single nucleotide polymorphism of the DTX1 gene may be the SNP of the 1128th nucleotide of the nucleotide sequence of SEQ ID NO: 1, that is, rs1732786A> G polymorphism.
본 발명의 일실시예에 있어서, 상기 폐암은 편평상피암, 소세포암, 선암, 대세포암 또는 비소세포암일 수 있다. In one embodiment of the present invention, the lung cancer may be squamous cell carcinoma, small cell carcinoma, adenocarcinoma, large cell carcinoma or non-small cell carcinoma.
본 발명의 일실시예에 있어서, 상기 폐암은 비소세포암일 수 있다.In one embodiment of the present invention, the lung cancer may be non-small cell carcinoma.
본 발명의 일실시예에 있어서, 상기 폐암은 수술로 절제된 경우일 수 있다. In one embodiment of the present invention, the lung cancer may be surgically ablated.
또한, 본 발명은 상기 조성물을 포함하는 폐암 환자의 생존 예후 예측용 키트를 제공한다. In addition, the present invention provides a kit for predicting survival prognosis of a lung cancer patient comprising the composition.
또한, 본 발명은 상기 조성물을 포함하는 폐암 환자의 생존 예후 예측용 마이크로어레이를 제공한다. The present invention also provides a microarray for predicting the survival prognosis of a lung cancer patient comprising the composition.
나아가 본 발명은 폐암 환자에서 추출한 핵산으로부터, DTX1 유전자의 rs1732786A>G 다형성을 확인하는 단계를 포함하는, 폐암 환자의 생존 예후 예측을 위한 정보를 제공하는 방법을 제공한다. Furthermore, the present invention provides a method for providing information for predicting the survival prognosis of lung cancer patients, including identifying the rs1732786A> G polymorphism of the DTX1 gene from nucleic acids extracted from lung cancer patients.
본 발명의 일실시예에 있어서, 상기 DTX1 유전자의 rs1732786 다형성의 유전자형이 GG인 경우 생존 예후가 높은 군으로 판정할 수 있다. In one embodiment of the present invention, when the genotype of the rs1732786 polymorphism of the DTX1 gene is GG, it can be determined that the survival prognosis is high.
본 발명의 일실시예에 있어서, 상기 폐암은 비소세포암일 수 있다. In one embodiment of the present invention, the lung cancer may be non-small cell carcinoma.
본 발명에 따른 폐암 생존 예후의 예측 기술은 폐암이 발병한 환자에 대하여 손쉽게 환자의 예후를 평가하고, 치료법의 선발 및 평가를 위한 수단 및 치료를 표적화함으로써 폐암 발병 환자의 생존율을 높일 수 있다.The prediction technique of lung cancer survival prognosis according to the present invention can increase the survival rate of lung cancer patients by easily evaluating the prognosis of patients with lung cancer and targeting the means and treatment for selecting and evaluating treatment methods.
도 1은 이용 가능한 RNA 133개 케이스(유전자형 분포: AA, AG, GG)의 DTX1 mRNA 발현을 RT-PCR을 이용하여 조사한 결과이다(P = 0.022).
도 2는 정상 폐 조직과 암 조직에서 DTX1의 mRNA 발현을 RT-PCR을 이용하여 조사한 결과이다(P = 0.003).
도 3은 루시퍼라제 리포터 유전자를 이용한 DTX1 프로모터의 rs1732786A>G 다형성에 의한 전사활성의 영향을 조사한 결과이다. Figure 1 shows the results of RTX-PCR (P = 0.022) of DTX1 mRNA expression of 133 cases of RNA (genotype distribution: AA, AG, GG).
FIG. 2 shows RTX-PCR of DTX1 mRNA expression in normal lung tissues and cancer tissues (P = 0.003).
FIG. 3 shows the results of investigation of the transcription activity of rs1732786A> G polymorphism of the DTX1 promoter using the luciferase reporter gene.
본 발명에서 사용되는 용어에 대한 정의는 이하와 같다.The terms used in the present invention are defined as follows.
"예후"는 폐암과 같은 신생물 질환의 예를 들어 발병, 재발, 전이성 확산, 및 약물 내성을 비롯한 폐암-기인성 사망 또는 진행의 가능성 등의 병의 경과 및 완치 여부를 의미한다. 본 발명의 목적상 예후는 폐암, 바람직하게는 비소세포폐암의 발병 위험성 및 발병 후의 생존 예후를 의미하며, 바람직하게는 폐암을 수술로 절제한 환자, 보다 바람직하게는 비소세포암을 수술로 절제한 환자의 예후를 의미한다.&Quot; prognosis " refers to the progression and cure of a disease, such as an outbreak, recurrence, metastatic spread, and the likelihood of lung cancer-induced death or progression, including drug resistance, For the purpose of the present invention, the prognosis refers to the risk of developing lung cancer, preferably non-small cell lung cancer, and the survival prognosis after onset, preferably a patient who has undergone surgical resection of lung cancer, more preferably, Of patients.
"예측"이란 환자가 폐암 발병할 가능성이 있는지를 판별하고, 화학요법 또는 방사선 치료 등 치료법에 대해 선호적으로 또는 비선호적으로 반응하여 환자의 치료, 예를 들어 특정 치료제, 및/또는 원발성 종양의 수술로 제거, 및/또는 암 재발 없이 특정 시기 동안 화학요법으로 치료된 후 생존할 여부 및/또는 가능성과 관련된다. &Quot; Prediction " refers to the determination of the likelihood of a patient developing lung cancer, and preferably or non-favorably responding to therapies such as chemotherapy or radiotherapy to treat a patient, for example, a particular therapeutic agent, and / Elimination by surgery, and / or the likelihood and / or likelihood of survival after chemotherapy for a certain period of time without cancer recurrence.
본 발명의 예측 방법은 임의의 특정 환자에 대한 폐암 발병 위험성이 높은 환자로써 특별하고 적절한 관리를 통하여 발병 시기를 늦추거나 발병하지 않도록 하거나, 폐암 발병 환자에 대한 가장 적절한 치료 방식을 선택함으로써 치료 결정을 하기 위해 임상적으로 사용될 수 있다. 본 발명의 예측 방법은 환자가 예를 들어 소정 치료제 또는 조합물, 외과적 개입, 화학요법 등의 투여를 비롯한 소정 치료 처방과 같은 치료 처방에 선호적으로 반응하는지를 확인하거나, 치료 처방 후 환자의 장기 생존이 가능한지 여부를 예측할 수 있다.The predictive method of the present invention is a patient having a high risk of developing lung cancer for any particular patient, and can prevent or delay the onset of the disease through special and appropriate management, or select the most appropriate treatment method for a patient with lung cancer, Lt; / RTI > The predictive method of the present invention can be used to identify whether a patient is responding favorably to treatment regimens, such as, for example, a prescribed treatment or combination, surgical intervention, chemotherapy or other prescribed treatment regimen, It is possible to predict whether or not survival is possible.
"유전적 다형성(genetic polymorphism)"은 인구집단에서 적어도 1% 이상의 빈도로 유전자 변이가 나타나는 경우를 말한다. DNA에서 한 개의 뉴클레오티드의 삽입, 소실, 또는 치환이 일어나는 것을 단일염기다형성(single nucleotide polymorphism, SNP) 이라고 한다. &Quot; Genetic polymorphism " refers to a case where a genetic variation occurs in at least 1% of the population. The insertion, deletion, or substitution of a single nucleotide in DNA is called single nucleotide polymorphism (SNP).
"다형성"이라는 용어는 군집 내에서 변하는 유전자의 서열에서의 배치를 지칭한다. 다형성은 상이한 "대립유전자"로 구성된다. 이러한 다형성의 배치는 유전자에서의 그의 위치 및 그에서 발견되는 상이한 아미노산 또는 염기에 의해 확인될 수 있다. 이러한 아미노산 변이는 2개의 상이한 대립유전자인, 2개의 가능한 변이체 염기, C 및 T의 결과이다. 유전자형은 2개의 다른 별개의 대립유전자로 구성되기 때문에, 여러 가능한 변이체 중 임의의 변이체가 어느 한 개체에서 관찰될 수 있다 (예를 들어, 이 예에서, CC, CT 또는 TT). 개개의 다형성은 또한 당업자에게 공지되어 있고, 예를 들면, NCBI 웹사이트 상에서 이용가능한 뉴클레오티드 염기 변이의 단일 뉴클레오티드 다형성 데이터베이스(Single Nucleotide Polymorphism Database (dbSNP) of Nucleotide Sequence Variation)에서 사용되는 것인, 지정된 독특한 식별자 ("기준 SNP", "refSNP" 또는 "rs#")이다. The term " polymorphism " refers to a sequence in a sequence of genes that varies within a cluster. Polymorphisms consist of different " alleles ". The arrangement of this polymorphism can be confirmed by its position in the gene and the different amino acids or bases found therein. These amino acid variations are the result of two possible mutant bases, C and T, which are two different alleles. Since the genotype is composed of two different distinct alleles, any of the various possible variants can be observed in any individual (e. G., CC, CT or TT in this example). The individual polymorphisms are also known to those skilled in the art and are used in, for example, the Single Nucleotide Polymorphism Database (dbSNP) of the Nucleotide Sequence Variation of the nucleotide base mutations available on the NCBI website. ("Reference SNP", "refSNP", or "rs #").
"단일염기다형성(single nucleotide polymorphism, SNP)은 게놈에서 단일염기(A, T, C 또는 G)가 종의 멤버들 간 또는 한 개체(individual)의 쌍 염색체 간에 다른 경우에 발생하는 DNA 서열의 다양성을 의미한다. 예를 들어, 서로 다른 개체의 세 개의 DNA 단편들(예: AAGT[A/A]AG, AAGT[A/G]AG,AAGT[G/G]AG)처럼 단일염기에서 차이를 포함하는 경우, 두 개의 대립 유전자(A 또는 G)라고 부르며, 일반적으로 거의 모든 SNPs는 두 개의 대립 유전자를 가진다. 한 집단(population)내에서, SNP는 소수 대립인자 빈도(minor allele frequency, MAF; 특정 집단에서 발견되는 유전자위치(locus)에서 가장 낮은 대립인자 빈도)로 할당될 수 있다. 단일염기는 폴리뉴클레오타이드 서열에 변화(대체), 제거(결실) 또는 첨가(삽입)될 수 있다. SNP는 번역 프레임의 변화를 유발할 수 있다."Single nucleotide polymorphism (SNP) refers to the diversity of DNA sequences that occur when a single nucleotide (A, T, C or G) in the genome is different between members of a species or between individual chromosomes For example, differences in single bases such as three DNA fragments of different individuals (eg, AAGT [A / A] AG, AAGT [A / G] AG, and AAGT [G / When included, it is called two alleles (A or G), and almost all SNPs have two alleles. Within a population, SNPs have a minor allele frequency (MAF; (Deletion) or addition (insertion) of a polynucleotide sequence in the polynucleotide sequence of the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO: It is possible to cause a change in the translation frame.
"유전자형(genotype)"이라는 용어는 세포 또는 조직 샘플에서 특정 유전자의 특이적 대립유전자를 지칭한다. The term " genotype " refers to a specific allele of a particular gene in a cell or tissue sample.
"대립 인자" 또는 '대립 유전자'란 같은 염색체 위치(same chromosomal locus) 를 점유하는 한 유전자의 둘 또는 그 이상의 선택적인 형태(alternative forms) 중 하나를 뜻한다. An "allele" or "allele" is one of two or more alternative forms of a gene that occupy the same chromosomal locus.
"대립유전자 빈도"는 대립유전자가 개체 내, 계통 내, 또는 계통의 집단 내에 존재하는 빈도 (비율 또는 백분율)을 지칭한다. 계통 또는 집단 내에서의 대립유전자 빈도를, 계통 또는 집단으로부터의 개체들의 샘플의 대립유전자 빈도를 평균화함으로써 추정할 수 있다. &Quot; Allele frequency " refers to the frequency (percentage or percentage) that an allele is present within an individual, within a lineage, or within a group of lines. The allele frequency in the system or population can be estimated by averaging the allele frequency of a sample of individuals from the system or population.
"진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 그 중에서도 본 발명은 특히 췌장의 고형 가유두상 종양 진단에 유용하다. 본 발명에서는 폐암, 바람직하게는 비소세포폐암 재발(Recurrence) 진행(progression), 전이(metastasis)를 예측하는 것을 포함한다. 이에, 비소세포폐암의 재발 및 진행을 정확히 예측할 수 있는 지표가 매우 중요하며 조직의 분화도와 병기와 같은 임상적 지표를 보완하면서 치료의 반응을 예측할 수 있는 인자가 필요한데, 본 발명의DTX1(Deltex-1) SNP가 이러한 지표 기능을 하므로 비소세포폐암 진단 인자로 이용할 수 있다. 즉, 이러한 유전자들의 다형성 특성 측정은 비소세포폐암의 분화도 및 병기, 진행을 예측하는데 유용한 지표(진단 마커)로 사용될 수 있다. &Quot; Diagnosis " means identifying the presence or characteristic of a pathological condition. Among them, the present invention is particularly useful for diagnosis of solid pancreaticobiliary tumors of the pancreas. The present invention includes predicting the progression and metastasis of lung cancer, preferably non-small cell lung cancer recurrence. Therefore, it is very important to accurately predict the recurrence and progression of non-small-cell lung cancer, and factors that can predict the response of treatment while supplementing clinical indicators such as tissue differentiation and stage are needed. 1) SNPs can be used as a diagnostic tool for non-small cell lung cancer. That is, the polymorphism measurement of these genes can be used as an indicator (diagnostic marker) for predicting the differentiation, stage, and progression of non-small cell lung cancer.
"진단용 마커 또는 진단 마커(diagnosis marker)"란 비소세포폐암을 가진 세포를 정상 세포와 구분하여 진단할 수 있는 물질로, 정상 세포에 비하여 비소세포폐암을 가진 세포에서 증가양상을 보이는 폴리펩타이드 또는 핵산(예: mRNA 등), 지질 , 당지질, 당단백질, 당(단당류, 이당류, 다당류 등) 등과 같은 유기 생체 분자 등을 포함한다. "Diagnostic marker or diagnosis marker" is a substance that can distinguish cells having non-small cell lung cancer from normal cells. It is a polypeptide or nucleic acid showing an increase pattern in cells having non-small cell lung cancer compared to normal cells (Such as mRNA), lipids, glycolipids, glycoproteins, sugar (monosaccharides, disaccharides, polysaccharides, etc.) and the like.
"폐암 환자의 생존 예후 예측용 마커"란 폐암 발병 위험성, 발병한 폐암의 완치 여부, 혹은 경과를 예측할 수 있는 다형성을 가진 마커를 의미하며, 바람직하게는 상기에서 서술한 뉴클레오티드를 의미한다. 또한, 상기 환자는 폐암 발병 위험성을 판별하기 위한 환자 또는 폐암, 특히 폐암을 수술로 절제한 환자를 의미한다. 상기 폐암을 수술로 절제한 환자는 바람직하게는 비소세포암, 편평상피암, 선암, 대세포암 등의 폐암을 수술로 절제한 환자를 의미하며, 보다 바람직하게는 비소세포암을 수술로 절제한 환자를 의미한다.The term " marker for predicting the survival prognosis of a patient with lung cancer " means a marker having a polymorphism capable of predicting the risk of lung cancer, the cure of the onset of lung cancer or the progress of lung cancer, preferably the nucleotide described above. In addition, the patient refers to a patient for discriminating the risk of lung cancer or a patient who has undergone surgical resection of lung cancer, particularly lung cancer. The patient who has undergone surgical resection of the lung cancer preferably refers to a patient who has undergone surgical resection of lung cancer such as non-small cell carcinoma, squamous cell carcinoma, adenocarcinoma or large cell carcinoma. More preferably, do.
"위험"은 특정 다형성 대립유전자를 보유하지 않은 개체의 구성원에서의 질환 또는 상태의 발생 빈도에 비교하여, 특정 다형성 대립유전자를 보유한 개체에서의 질환 또는 상태의 발생 빈도가 통계적으로 높음을 나타낸다.&Quot; Danger " refers to a statistically high incidence of a disease or condition in a subject having a particular polymorphic allele, compared to the incidence of a disease or condition in a member of the individual that does not possess the particular polymorphic allele.
"기능적 등가물"이라는 용어는 예를 들어, 기준(reference) 서열로부터 하나 또는 그 이상의 치환, 결실 또는 부가, 기준 서열과 실험(subject) 서열 사이의 다양한 기능적 비유사성을 낳지 않는 실제 효과(net effect) 등 변화된 돌연변이 서열의 뉴클레오티드와 핵산서열 모두를 의미한다. 바람직하게는, 뉴클레오티드 서열은 최소한 약 65%의 동일성, 보다 바람직하게는 최소한 약 75%의 동일성, 가장 바람직하게는 약 95%의 동일성을 가진다. 본 발명의 목적을 위해서는, 실질적으로 등가적인 생물학적 활성과 실질적으로 등가적인 합성 특징을 가지는 서열들은 실질적 등가물로 취급된다. The term " functional equivalents " refers to, for example, one or more substitutions, deletions or additions from a reference sequence, a net effect that does not result in various functional dissimilarities between the reference and subject sequences, ≪ / RTI > and the nucleotide sequence of the mutated mutant sequence. Preferably, the nucleotide sequence has at least about 65% identity, more preferably at least about 75% identity, most preferably about 95% identity. For the purposes of the present invention, sequences with substantially equivalent biological activities and substantially equivalent synthetic features are treated as substantial equivalents.
"암", "종양" 또는 "악성"은 일반적으로 비조절된 세포 성장의 특징을 갖는 포유동물의 생리학적 상태를 나타내거나 설명한다. &Quot; Cancer ", " tumor ", or " malignant " refers to or represents the physiological condition of a mammal that is generally characterized by unregulated cell growth.
"대상" 또는 "환자"는 인간, 소, 개, 기니아 피그, 토끼, 닭, 곤충 등을 포함하여 치료가 요구되는 임의의 단일 개체를 의미한다. 또한, 임의의 질병 임상 소견을 보이지 않는 임상 연구 시험에 참여한 임의의 대상 또는 역학 연구에 참여한 대상 또는 대조군으로 사용된 대상이 대상에 포함된다. &Quot; Subject " or " patient " means any single entity that requires treatment, including human, cow, dog, guinea pig, rabbit, chicken, In addition, any subject who participates in a clinical study test that does not show any disease clinical findings, or who participates in epidemiological studies or used as a control group is included.
"조직 또는 세포 샘플"은 대상 또는 환자의 조직으로부터 얻은 유사한 세포의 집합체를 의미한다. 조직 또는 세포 샘플의 공급원은 신선한, 동결된 및/또는 보존된 장기 또는 조직 샘플 또는 생검 또는 흡인물로부터의 고형 조직; 혈액 또는 임의의 혈액 구성분; 대상의 임신 또는 발생의 임의의 시점의 세포일 수 있다. 조직 샘플은 또한 1차 또는 배양 세포 또는 세포주일 수 있다. &Quot; Tissue or cell sample " refers to a collection of similar cells obtained from a subject or tissue of a patient. The source of the tissue or cell sample may be a solid tissue from fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; Blood or any blood components; It may be a cell at any point in the pregnancy or development of the subject. Tissue samples can also be primary or cultured cells or cell lines.
"핵산"은 임의의 DNA 또는 RNA, 예를 들어, 조직 샘플에 존재하는 염색체, 미토콘드리아, 바이러스 및/또는 세균 핵산을 포함하는 의미이다. 이중가닥 핵산 분자의 하나 또는 두개 모두의 가닥을 포함하고, 무손상 핵산 분자의 임의의 단편 또는 일부를 포함한다. &Quot; Nucleic acid " is meant to include any DNA or RNA, such as chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in a tissue sample. Includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or portion of the intact nucleic acid molecule.
"유전자"는 단백질 코딩 또는 전사시에 또는 다른 유전자 발현의 조절시에 기능적 역할을 갖는 임의의 핵산 서열 또는 그의 일부를 의미한다. 유전자는 기능적 단백질을 코딩하는 모든 핵산 또는 단백질을 코딩 또는 발현하는 핵산의 일부만으로 이루어질 수 있다. 핵산 서열은 엑손, 인트론, 개시 또는 종료 영역, 프로모터 서열, 다른 조절 서열 또는 유전자에 인접한 특유한 서열 내에 유전자 이상을 포함할 수 있다.&Quot; Gene " means any nucleic acid sequence or portion thereof that has a functional role at the time of protein coding or transcription, or in the control of other gene expression. The gene may consist of only a portion of the nucleic acid encoding or expressing any nucleic acid or protein that encodes the functional protein. The nucleic acid sequence may comprise an exon, an intron, an initiation or termination region, a promoter sequence, another regulatory sequence, or a gene abnormality within a particular sequence adjacent to the gene.
"프라이머"는 상보성 RNA 또는 DNA 표적 폴리뉴클레오티드에 혼성화하고 예를 들어 폴리머라제 연쇄 반응에서 발생하는 뉴클레오티딜트랜스퍼라제의 작용에 의해 모노뉴클레오티드로부터 폴리뉴클레오티드의 단계적 합성을 위한 출발점으로 기능하는 올리고뉴클레오티드 서열을 의미한다.&Quot; Primer " refers to an oligonucleotide sequence that hybridizes to a complementary RNA or DNA-targeted polynucleotide and serves as a starting point for the stepwise synthesis of a polynucleotide from a mononucleotide by the action of, for example, the nucleotidyltransferase that occurs in the polymerase chain reaction .
"단백질"은 또한 기준 단백질과 본질적으로 동일한 생물 활성 또는 기능을 보유하는, 단백질의 단편, 유사체 및 유도체를 포함하는 것이다&Quot; Protein " also includes fragments, analogs, and derivatives of proteins that retain essentially the same biological activity or function as the reference protein
"표지" 또는 "라벨"는 직접 또는 간접적으로 시약, 예를 들어 핵산 프로브 또는 항체에 컨쥬게이팅 되거나 융합되고 컨쥬게이팅 되거나 융합된 시약의 검출을 용이하게 하는 화합물 또는 조성물을 의미한다. 표지는 그 자체가 검출될 수 있거나 (예를 들어, 방사성 동위원소 표지 또는 형광 표지), 효소 표지의 경우에, 검출가능한 기질 화합물 또는 조성물의 화학적 변형을 촉매 할 수 있다.&Quot; Label " or " label " means a compound or composition that facilitates the detection of a reagent, such as a reagent conjugated, conjugated, conjugated, or fused to a nucleic acid probe or antibody. The label may itself be detected (e. G., A radioactive isotope label or a fluorescent label), in the case of an enzyme label, to catalyze the chemical modification of the detectable substrate compound or composition.
"치료"는 이롭거나 바람직한 임상적 결과를 수득하기 위한 접근을 의미한다. 본 발명의 목적을 위해서, 이롭거나 바람직한 임상적 결과는 비제한적으로, 증상의 완화, 질병 범위의 감소, 질병 상태의 안정화 (즉, 악화되지 않음), 질병 진행의 지연 또는 속도의 감소, 질병 상태의 개선 또는 일시적 완화 및 경감 (부분적이거나 전체적으로), 검출가능하거나 또는 검출되지 않거나의 여부를 포함한다. 또한, "치료"는 치료를 받지 않았을 때 예상되는 생존율과 비교하여 생존율을 늘이는 것을 의미할 수도 있다. 치료는 치료학적 치료 및 예방적 또는 예방조치 방법 모두를 가리킨다. 상기 치료들은 예방되는 장애뿐만 아니라 이미 발생한 장애에 있어서 요구되는 치료를 포함한다. 질병을 "완화(Palliating)"하는 것은 치료를 하지 않은 경우와 비교하여, 질병상태의 범위 및/또는 바람직하지 않은 임상적 징후가 감소되거나 및/또는 진행의 시간적 추이(time course)가 늦춰지거나 길어지는 것을 의미한다.&Quot; Treatment " means an approach to obtaining beneficial or desired clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in the extent of disease, stabilization (i.e., not worsening) of the disease state, (Either partially or totally), detectable or undetected, whether or not an improvement or temporary relief or reduction Also, " treatment " may mean increasing the survival rate compared to the expected survival rate when not receiving treatment. Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Such treatments include treatments required for disorders that have already occurred as well as disorders to be prevented. &Quot; Palliating " a disease may reduce the extent of the disease state and / or undesirable clinical symptoms and / or delay or slow the time course of the progression, It means to lose.
"약"이라는 것은 참조 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이에 대해 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4, 3, 2 또는 1% 정도로 변하는 양, 수준, 값, 수, 빈도, 퍼센트, 치수, 크기, 양, 중량 또는 길이를 의미한다.&Quot; about " means that the reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length is 30, 25, 20, 25, 10, 9, 8, 7, , Level, value, number, frequency, percent, dimension, size, quantity, weight, or length that varies from one to three, two, or one percent.
본 명세서를 통해, 문맥에서 달리 필요하지 않으면, "포함하다" 및 "포함하는"이란 말은 제시된 단계 또는 원소, 또는 단계 또는 원소들의 군을 포함하나, 임의의 다른 단계 또는 원소, 또는 단계 또는 원소들의 군이 배제되지는 않음을 내포하는 것으로 이해하여야 한다.Throughout this specification, the words " comprising " and " comprising ", unless the context requires otherwise, include the stated step or element, or group of steps or elements, but not to any other step or element, And that they are not excluded.
이하, 본 발명에 대하여 구체적으로 설명한다. Hereinafter, the present invention will be described in detail.
본 발명에서 진단하고자 하는 질병은 폐암과 관련된 질병이다.The disease to be diagnosed in the present invention is a disease associated with lung cancer.
상기 폐암은 바람직하게는 비소세포폐암(NSCLC)일 수 있으며, 상기 비소세포폐암은 편평상피암, 선암, 대세포암, 또는 선편평상피암을 포함한다. 더욱 바람직하게는 편평상피암일 수 있다.The lung cancer may preferably be non-small cell lung cancer (NSCLC), and the non-small cell lung cancer includes squamous cell cancer, adenocarcinoma, large cell carcinoma, or squamous cell carcinoma. More preferably squamous cell cancer.
환자는 폐암, 즉 편평상피암, 소세포암, 선암, 대세포암 또는 비세포암이 발병한 환자를 의미한다. 바람직하게, 상기 환자는 폐암, 즉 편평상피암, 소세포암, 선암, 대세포암 또는 비세포암을 수술로 절제한 환자를 포함한다.Patient refers to a patient with lung cancer, ie squamous cell, small cell, adenocarcinoma, large cell carcinoma or non-cell carcinoma. Preferably, the subject includes patients who have undergone surgical resection of lung cancer, i.e. squamous cell, small cell, adenocarcinoma, large cell carcinoma or non-cell carcinoma.
비소세포폐암은 전체 폐암의 75% 이상을 차지하며 평균 5년 생존율이 15% 에 해당한다. 비소세포폐암의 높은 사망률은 일부 절제 불가능한 종양을 가진 환자의 높은 비율과 관련되어 있다 (Parkin DM, et al., Global cancer statistics, 2002; CA Cancer J Clin 55:74-108, 2005). 또한 절제 가능한 병기의 비소세포폐암 환자 중에서 좋은 예후를 가질지라도, 외과적으로 절제한 환자의 상당수가 암의 재발로 사망하고 있음이 보고되고 있다 (Arriagada R, et al., N Engl J Med 350:351-60, 2004). 따라서 비소세포폐암 환자들에 대한 예후 인자를 이용할 경우, 예후의 평가, 치료법의 선발 및 평가를 위한 수단 및 치료를 표적화 할 수 있어 비소세포폐암 환자의 맞춤 치료가 가능할 것으로 기대되고 있다. 이에 비소세포폐암 환자의 예후 예측에 관한 집중적인 연구가 국내외적으로 현재 실시되고 있으나, 아직까지 뚜렷한 연구 결과가 없는 실정이다.Non-small cell lung cancer accounts for more than 75% of all lung cancer, with an average 5-year survival rate of 15%. The high mortality rate of non-small cell lung cancer is associated with a high proportion of patients with some unresectable tumors (Parkin DM, et al., Cancer J Clin 55: 74-108, 2005). It has been reported that many of the surgically resected patients die from recurrence of cancer even though they have a good prognosis in patients with non-small cell lung cancer of the resectable stage (Arriagada R, et al., N Engl J Med 350: 351-60, 2004). Therefore, when prognostic factors are used for patients with non - small cell lung cancer, it is possible to target the evaluation and prognosis of the prognosis and the selection and treatment of the treatment method, and thus it is expected that the personalized treatment of patients with non - small cell lung cancer will be possible. The aim of this study was to evaluate the prognosis of patients with non-small cell lung cancer.
본 발명은 DTX1 (Deltex-1) 유전자의 다형성을 이용한, 비소세포폐암(NSCLC) 예후 진단 및 예측 마커로서의 용도에 관한 것으로, DTX1 유전자의 특정 SNP가 비소세포폐암의 초기 단계에서의 나쁜 예후와 관련되어 있음을 처음으로 규명하였다. 상기 예후는 비소세포폐암의 진행(progression), 재발(Recurrence) 및 전이(metastasis)를 포함한다. The present invention relates to the use of DTX1 (Deltex-1) gene polymorphism as a diagnostic marker for non-small cell lung cancer (NSCLC) and as a predictive marker, and relates to the fact that the specific SNP of the DTX1 gene is associated with a bad prognosis in the early stage of non- For the first time. The prognosis includes progression, recurrence and metastasis of non-small cell lung cancer.
[[ DTX1DTX1 예후 Prognosis 마커Marker ]]
그러므로, 본 발명은 일 관점에서 DTX1 유전자의 폐암, 바람직하게는 비소세포폐암 예후의 진단 마커로서의 용도에 관한 것이다.Therefore, the present invention relates, in one aspect, to the use of the DTXl gene as a diagnostic marker for lung cancer, preferably non-small cell lung cancer prognosis.
구체적으로, p300/CBP 관련 요인인 DTX1 유전자의 단일염기다형성(SNP) rs1732786 A>G 의 비소세포폐암 예후 진단 및 예측 용도 및 이의 이용에 관한 것이다.More specifically, the present invention relates to the diagnosis and prediction of non-small cell lung cancer prognosis and its use of the single nucleotide polymorphism (SNP) rs1732786 A> G of DTX1 gene, a factor related to p300 / CBP.
상기 DTX1 단백질은 공지된 것, 예를 들면 공지된 인간 유래의 서열을 공지된 DB로부터 수득할 수 있는데, 이로 한정하는 것은 아니며, 이의 기능적 동등체를 포함하는 것이다.The DTX1 protein may be a known one, for example, a known human-derived sequence may be obtained from a known DB, including, but not limited to, functional equivalents thereof.
유의성 있는 진단 마커의 선택과 적용은 진단 결과의 신뢰도를 결정짓는다. 유의성 있는 진단 마커란, 진단하여 얻은 결과가 정확하여 타당도(validity)가 높고 반복 측정 시에도 일관된 결과를 나타내도록 신뢰도(reliability)가 높은 마커를 의미한다. 본 발명의 비소세포폐암 예후 진단 마커는, 폐암, 바람직하게는 비소세포폐암의 발병과 함께 직접적 또는 간접적 요인으로 발현이 변화하는 유전자들로 반복된 실험에도 동일한 결과를 나타내며, 발현 수준의 차이가 대조군과 비교할 때 매우 커서 잘못된 결과를 내린 확률이 거의 없는 신뢰도가 높은 마커들이다. 그러므로 본 발명의 유의성 있는 진단 마커의 발현 정도를 측정하여 얻은 결과를 토대로 진단된 결과는 타당하게 신뢰할 수 있다.The selection and application of significant diagnostic markers determines the reliability of diagnostic results. Significant diagnostic markers are those markers that are highly reliable with high validity and consistency in repeated measurements. The non-small-cell lung cancer prognostic markers of the present invention show the same results in repeated experiments with genes whose expression changes either directly or indirectly with the onset of lung cancer, preferably non-small cell lung cancer, Are highly reliable markers that are very large when compared to a few, and are less likely to give false results. Therefore, the diagnosis result based on the result of measuring the expression level of the significant diagnostic marker of the present invention can be reasonably reliable.
본 발명자들은 비소세포폐암 근치적 절제술을 받은 354명의 환자를 대상으로, DTX1 유전자의 다형성을 조사하여, 유전형과 전체 생존 (overall survival, OS) 및 무병 생존 (disease-free survival, DFS)과의 관계를 분석하였다. The present inventors examined the polymorphism of the DTX1 gene in 354 patients who underwent curative resection of non-small cell lung cancer to determine the relationship between genotype and overall survival (OS) and disease-free survival (DFS) Respectively.
상기 전체 생존(OS)이란 수술한 날부터 어떤 원인으로 죽는 날까지 또는 마지막으로 추적 조사한 날까지를 말하며, 상기 무병생존(DFS)이란 수술한 날부터 어떤 원인으로 재발 또는 사망하는 날까지를 말한다. 분석 결과, 비소세포암 환자에서 rs1732786 A>G 다형성이 전체 생존 및 무병 생존과 유의적으로 관련성이 있음을 알 수 있었다. 또한, rs1732786 AA<AG<GG의 순으로 생존률 및 무병생존률이 좋아짐을 확인하였다.The term "total survival (OS)" refers to the period from the day of surgery to the day of death due to any cause or the last follow-up date. DFS refers to the day from surgery to the day of recurrence or death for any cause. Analysis showed that rs1732786 A> G polymorphism was significantly associated with overall survival and disease-free survival in patients with non-small cell carcinoma. In addition, it was confirmed that survival rate and disease free survival rate were improved in the order of rs1732786 AA <AG <GG.
따라서, 본 발명의 DTX1 rs1732786A>G SNP는 외과적 절제술을 받은 비소세포폐암 환자에 대하여 독립적인 예후 마커로 볼 수 있으므로. 이에 대한 분석은 나쁜 질병 비소세포폐암 예후에 대한 고위험을 가진 환자 그룹을 판별하는데 도움을 주어, 비소세포폐암의 치료적 결정에 도움을 줄 수 있다.Therefore, the DTX1 rs1732786A> G SNP of the present invention can be regarded as an independent prognostic marker for patients with non-small cell lung cancer undergoing surgical resection. An analysis of this may help to determine the group of patients at high risk for poor disease non-small-cell lung cancer prognosis and may help in the therapeutic determination of non-small-cell lung cancer.
본 발명의 일 구체예에로서, DTX1 유전자의 다형성 부위를 포함하는 폐암, 바람직하게는 비소세포폐암 환자의 생존 예후 예측(진단)용 마커 및 이를 포함하는 마커용 조성물에 관한 것이다.In one embodiment of the present invention, the present invention relates to a marker for survival prognosis (diagnosis) of a lung cancer, preferably a non-small cell lung cancer patient comprising a polymorphic site of DTX1 gene, and a composition for a marker comprising the same.
서열번호 1로 이루어지는 폴리뉴클레오티드에서 상기의 rs1732786 A>G SNP를 포함하는 20~100개의 연속 염기로 구성되는 폴리뉴클레오티드A polynucleotide consisting of 20 to 100 contiguous bases comprising the above rs1732786 A > G SNP in the polynucleotide consisting of SEQ ID NO: 1
본 발명은 서열번호 1로 이루어지는 폴리뉴클레오티드에서 rs1732786 A>G SNP를 포함하는 20~100개의 연속적인 DNA 서열로 구성되는 폴리뉴클레오티드; 또는 이의 상보적인 폴리뉴클레오티드로 이루어진, 폐암 환자의 생존 예후 예측용 마커 및 이를 포함하는 마커용 조성물에 관한 것이다.The present invention provides a polynucleotide consisting of 20 to 100 consecutive DNA sequences comprising rs1732786 A > SNP in the polynucleotide of SEQ ID NO: 1; Or a complementary polynucleotide thereof, to a marker for predicting the survival prognosis of a lung cancer patient and a composition for a marker comprising the same.
본 발명에 따른 상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드는 20개 이상, 바람직하게는 20 내지 100개, 보다 바람직하게는 20 내지 50개의 연속 염기로 구성될 수 있다.The polynucleotide or its complementary polynucleotide according to the present invention may be composed of at least 20, preferably 20 to 100, more preferably 20 to 50 contiguous bases.
상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드는 다형성 서열(polymorphic sequence)이다. 다형성 서열(polymorphic sequence)이란 뉴클레오티드 서열 중에 단일염기다형을 나타내는 다형성 부위(polymorphic site)를 포함하는 서열을 말한다. 다형성 부위(polymorphic site)란 다형성 서열 중 단일염기다형이 일어나는 부위를 말한다.The polynucleotide or its complementary polynucleotide is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a single base polymorphism in a nucleotide sequence. A polymorphic site is a site in a polymorphic sequence where a single base polymorphism occurs.
단일염기다형성은 유전자의 코딩 서열, 유전자의 비-코딩 부위 또는 유전자 사이의 내부 지역(intergenic regions)에 포함될 수 있다. 유전자의 코딩 서열 내의 SNP는 유전암호의 중복성(degeneracy)으로 인해 반드시 타겟 단백질의 아미노산 서열 상에 변화를 일으키지는 않는다. 동일한 폴리펩타이드 서열을 형성하는 SNP는 동의적(synonymous)이라 하고(침묵 돌연변이라고도 불리움), 다른 폴리펩타이드 서열을 형성하는 SNP의 경우 비-동의적(non-synonymous)이라고 한다. 비-동의적 SNP는 미스센스 또는 넌센스일 수 있으며, 미스센스 변화는 다른 아미노산을 발생시키는 반면에 넌센스 변화는 비성숙 종결코돈을 형성한다. 단백질-코딩 부위가 아닌 곳에 존재하는 SNP는 유전자 사일런싱, 전사인자 결합 또는 비-코딩 RNA 서열을 유발시킬 수 있다.Single nucleotide polymorphisms can be included in coding sequences of genes, non-coding regions of genes, or in intergenic regions between genes. SNPs in the coding sequence of a gene do not necessarily cause changes in the amino acid sequence of the target protein due to the degeneracy of the genetic code. SNPs that form the same polypeptide sequence are called synonymous (also called silent mutations) and SNPs that form other polypeptide sequences are said to be non-synonymous. Non-consensual SNPs can be missense or nonsense, and mismatch changes produce other amino acids while nonsense changes form non-mature termination codons. SNPs that are not in the protein-coding region can induce gene silencing, transcription factor binding, or non-coding RNA sequences.
본 발명은 DTX1 rs1732786A>G에 대한 유전적 접근까지 확장한다. The present invention extends to a genetic approach to DTX1 rs1732786A > G.
[수행 방법][How to Perform]
본 발명의 SNP 의 유전자형의 확인은 시퀀싱 분석, 자동염기서열분석기를 사용한 시퀀싱 분석, 파이로시퀀싱 (pyrosequencing), 마이크로어레이에 의한 혼성화, PCR-RELP법 (restriction fragment length polymorphism),PCR-SSCP법 (single strand conformation polymorphism), PCR-SSO법 (specific sequence oligonucleotide), PCR-SSO법과 도트 하이브리드화법을 조합한 ASO (allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA법 (rolling circle amplification), HRM (high resolution melting)법, 프라이머 신장법, 서던 블롯 하이브리드화법, 도트 하이브리드화법 등의 공지의 방법에 의하여 수행될 수 있다. The genotyping of the SNP of the present invention can be confirmed by sequencing analysis, sequencing analysis using an automatic sequencer, pyrosequencing, hybridization with a microarray, PCR-RELP (restriction fragment length polymorphism), PCR-SSCP single strand conformation polymorphism (PCR), SSO (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method using PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF / MS method, RCA method rolling circle amplification, HRM (high resolution melting), primer extension, Southern blot hybridization, dot hybridization, and the like.
나아가, 상기 SNP 다형성의 결과들은 당업계에서 일반적으로 사용되는 통계학적 분석 방법을 이용하여 통계처리 할 수 있으며, 예를 들면, 스튜던트 t-검정(Student's t-test), 카이-스퀘어 테스트 (Chi-square test), 선형 회귀선 분석(linear regression line analysis), 다변량 로지스틱 회귀분석 (multiple logistic regression analysis) 등을 통해 얻은 연속 변수 (continuous variables), 절대 변수 (categorical variables), 대응비 (odds ratio) 및 95% 신뢰구간 (confidence interval) 등의 변수를 이용하여 분석할 수 있다.Further, the results of the SNP polymorphism can be statistically processed using statistical analysis methods commonly used in the art, such as Student's t-test, Chi- continuous variables, categorical variables, odds ratios, and 95% confidence intervals, obtained through linear regression analysis, linear regression line analysis, and multiple logistic regression analysis, % Confidence interval, and so on.
본 발명의 폐암, 바람직하게는 비소세포폐암 생존 예후 예측(진단)용 마커 및 이를 포함하는 마커용 조성물에 포함되는, 상기 SNP를 검출할 수 있는 제제는, 서열번호 1로 이루어지는 폴리뉴클레오티드에서 상기의 rs1732786 A>G SNP를 포함하는 20~100개의 연속 염기로 구성되는 폴리뉴클레오티드, 이의 상보적 폴리뉴클레오티드, 상기 폴리뉴클레오티드와 특이적으로 혼성화하는 프라이머 및 프로브로 이루어진 군에서 선택되는 것을 포함할 수 있다.The agent capable of detecting the SNP contained in the marker for lung cancer, preferably non-small cell lung cancer survival prognosis prediction (diagnosis) of the present invention and the marker composition containing the same, comprises the polynucleotide of SEQ ID NO: 1, a polynucleotide consisting of 20 to 100 consecutive bases including rs1732786 A > G SNP, a complementary polynucleotide thereof, a primer and a probe specifically hybridizing with the polynucleotide, and the like.
본 발명에 있어서, 상기 폴리뉴클레오티드 또는 그의 상보적 폴리뉴클레오티드와 특이적으로 혼성화하는 프라이머 또는 프로브는 대립형질 특이적 (allele-specific) 이다.In the present invention, a primer or a probe that specifically hybridizes with the polynucleotide or its complementary polynucleotide is allele-specific.
대립형질 특이적 (allele-specific) 이란 각 대립형질에 특이적으로 혼성화하는 것, 즉, 다형성 서열 중에 존재하는 다형성 부위의 염기를 특이적으로 구별할 수 있도록 혼성화하는 것을 말한다. 여기에서, 혼성화란 보통 엄격한 조건, 예를 들어 1M 이하의 염 농도 및 25℃ 이상의 온도 하에서 보통 수행될 수 있다.Allele-specific refers to hybridizing specifically to each allele, i.e., hybridizing such that the base of the polymorphic site present in the polymorphic sequence can be specifically discriminated. Here, hybridization is usually carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.
본 발명에 있어서, 프로브는 혼성화 프로브를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 혼성화 조건은 대립형질 간의 혼성화 강도에 있어서 유의한 차이를 보여 대립형질 중 하나에만 혼성화되도록 충분히 엄격해야 한다. 이러한 본 발명의 프로브는 중앙 부위가 다형성 서열의 다형성 부위와 정렬하는 것이 바람직하다. 이에 따라 서로 다른 대립형질성 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 상기 프로브는 대립형질을 검출하여 폐암 생존 예후를 예측하기 위한 마이크로어레이 등의 키트나 예측 방법 등에 사용될 수 있다. 중요한 프로브는 검출할 수 있도록 표지될 수 있으며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광 화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다.In the present invention, a probe means a hybridization probe, and means an oligonucleotide capable of binding sequence-specifically to a complementary strand of a nucleic acid. The hybridization conditions show a significant difference in the intensity of hybridization between alleles and should be sufficiently stringent to hybridize to only one of the alleles. Preferably, the probe of the present invention aligns with the polymorphic site of the polymorphic sequence. This can lead to good hybridization differences between different allelic forms. The probe can be used in a kit such as a microarray for predicting the survival prognosis of lung cancer by detecting alleles, a prediction method and the like. Important probes can be labeled for detection and can be labeled, for example, as radioactive isotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. It is well known in the art to appropriately label such a probe, and can be carried out by a conventional method.
본 발명에 있어서, 프라이머는 짧은 자유 3말단 수산화기 (free 3' hydroxyl group)를 가지는 염기 서열로 상보적인 템플레이트 (template)와 염기쌍 (base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작지점으로 기능을 하는 짧은 서열을 의미한다. 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 일반적으로 15 내지 30개의 염기로 구성된다. 프라이머 서열은 주형과 완전하게 상보적일 필요는 없으나, 주형과 혼성화할 정도로 충분히 상보적이어야 한다. 상기 프라이머는 다형성 부위를 포함하는 DNA 서열에 혼성화하여 다형성 부위를 포함하는 DNA 단편을 증폭시킬 수 있다. 본 발명의 프라이머는 대립형질을 검출하여 폐암 생존 예후를 예측하기 위한 마이크로어레이 등의 키트나 예측 방법 등에 사용될 수 있다.In the present invention, the primer can form a base pair with a template complementary to a base sequence having a short free 3 'hydroxyl group, and functions as a starting point for template strand copying Quot; short sequence " The appropriate length of the primer may vary depending on the purpose of use, but is generally comprised of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primers can be hybridized to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing the polymorphic site. The primer of the present invention can be used in a kit such as a microarray for predicting the survival prognosis of lung cancer and a prediction method by detecting alleles.
본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 상기 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스포트리에스테르,포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with an analogue, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
본 발명은 다른 구체예로서 상기 조성물을 포함하는 폐암, 바람직하게는 비소세포폐암 환자의 생존 예후 예측용 마이크로어레이에 관한 것이다.The present invention relates, in another embodiment, to a microarray for predicting the survival prognosis of lung cancer, preferably non-small cell lung cancer patients, comprising said composition.
상기 마이크로어레이는 본 발명의 폴리뉴클레오티드, 프라이머 또는 프로브를 포함하는 것을 제외하고는 통상적인 마이크로어레이로 이루어질 수 있다.The microarray may be composed of a conventional microarray except that it comprises the polynucleotide, primer or probe of the present invention.
마이크로어레이 상에서의 핵산의 혼성화 및 혼성화 결과의 검출은 당업계에 잘 알려져 있다. 상기 검출은 예를 들면, 핵산 시료를 형광 물질, 예를 들면, Cy3 및 Cy5와 같은 물질을 포함하는 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 마이크로어레이 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.The hybridization of nucleic acids on a microarray and the detection of hybridization results are well known in the art. The detection may be performed, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray, The hybridization result can be detected.
상기 마이크로어레이(Microarray) 방법은 종양 내의 수천 또는 심지어 수만 개의 유전자의 RNA 발현을 동시에 연구할 수 있어, 인간 질병의 분자적 기초에 대한 포괄적 통찰력을 보다 효과적으로 얻을 수 있게 해준다. 또한, 이를 이용하여 종양 분류에서의 유전자 발현 패턴, 임상학적 결과 및 화학적 치료요법에 대한 반응의 평가가 가능하다.The microarray method can simultaneously study the expression of RNA in thousands or even tens of thousands of genes in tumors, enabling more comprehensive insights into the molecular basis of human disease. It can also be used to assess gene expression patterns, clinical outcomes, and response to chemotherapy regimens in tumor classifications.
유사한 관점에서 본 발명은 또 하나의 예로서, 본 발명은 상기 조성물을 포함하는 폐암 환자의 생존 예후 예측용 키트에 관한 것이다.In another aspect, the present invention relates to a kit for predicting the survival prognosis of a lung cancer patient comprising the composition.
본 발명의 키트는 폐암 생존 예후의 예측용 마커인, DTX1 (Deltex-1) rs1732786A>G 다형성 부위(SNP)를 확인함으로써 폐암 생존 예후를 예측하는 데 사용될 수 있다. 본 발명의 폐암 생존 예후의 예측용 키트에는 DTX1 (Deltex-1) rs1732786A>G의 SNP 를 확인하기 위한 폴리뉴클레오티드, 프라이머 또는 프로브 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다.The kit of the present invention can be used to predict the survival prognosis of lung cancer by identifying DTX1 (Deltex-1) rs1732786A> G polymorphism site (SNP), which is a predictive marker for lung cancer survival prognosis. The kit for predicting the survival prognosis of lung cancer according to the present invention may comprise one or more other component compositions, solutions or suspensions suitable for the assay as well as polynucleotides, primers or probes for identifying SNPs of DTX1 (Deltex-1) rs1732786A> Device may be included.
일 양태로서, 본 발명의 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. PCR 키트는, 상기 SNP 에 대한 특이적인 폴리뉴클레오티드, 프라이머 또는 프로브 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수 (DEPC-water) 및 멸균수 등을 포함할 수 있다.In one embodiment, the kit of the present invention may be a kit containing the necessary elements necessary for performing PCR. The PCR kit may contain test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq polymerases and reverse transcriptase enzymes, as well as specific polynucleotides, primers or probes specific for the SNPs. , DNase, RNAse inhibitors, DEPC-water and sterile water, and the like.
[진단 및 정보제공 방법][Diagnosis and Information Delivery Method]
한편, 본 발명은 다른 관점에서, 상기 발견에 기초하여 DTX1 유전자의 rs1732786A>G SNP 발현수준 및/또는 변이, 바람직하게는 프레임 시프트 변이를 측정하는 것을 포함하는, 폐암, 바람직하게는 비소세포폐암 예후 진단 및 예측 방법 또는 이를 위한 정보 제공방법을 제공한다.On the other hand, the present invention, in another aspect, provides a method for diagnosing lung cancer, preferably non-small cell lung cancer prognosis, comprising measuring the rs1732786A> G SNP expression level and / or mutation, preferably a frame shift mutation, Diagnosis and prediction method, or a method for providing information therefor.
상기 방법은 또한, 폐암 수술 후 재발 또는 전이 방지를 위한 항암제 등을 탑재한 생분해성 고분자 패치 등의 개발에도 유용한 정보를 제공한다. The method also provides useful information for the development of a biodegradable polymer patch having an anti-cancer agent for preventing recurrence or metastasis after lung cancer surgery.
일 구체예로서, 본 발명의 방법은, 환자로부터 분리된 생물학적 시료로부터 DTX1 유전자의 rs1732786A>G SNP 발현 수준을 측정하는 단계; 및 상기 rs1732786A>G SNP 발현 수준 또는 상기 유전자가 코딩하는 단백질의 수준을 정상 대조구 시료의 해당 유전자의 발현과 비교하는 단계를 포함하는 폐암, 바람직하게는 비소세포폐암 예후 진단 및 예측을 위한 정보의 제공 방법을 제공한다. In one embodiment, the method comprises measuring rs1732786A> G SNP expression level of DTX1 gene from a biological sample isolated from a patient; And comparing the rs1732786A> G SNP expression level or the level of the protein encoded by the gene with the expression of the gene of interest in a normal control sample, to provide information for diagnosing and predicting the prognosis of lung cancer, preferably non-small cell lung cancer ≪ / RTI >
이 때, 환자로부터 분리된 생물학적 시료의 DTX1 rs1732786 A>G 다형성의 경우 전체생존 및 무병생존의 위험비가 G 유전인자가 많아질수록 매우 낮은 것으로 판별하는 것을 특징으로 한다. 즉, SNP의 유전자형이 AA<AG<GG의 순으로 생존 예후가 좋은 것으로 진단 및 예측될 수 있다.In this case, DTX1 rs1732786 A> G polymorphism of the biological sample isolated from the patient is characterized in that the risk ratio of overall survival and disease free survival is significantly lower as the G gene factor increases. That is, the genotype of SNP can be diagnosed and predicted as having good survival prognosis in order of AA <AG <GG.
상기 진단방법은, 특히 비소세포폐암에 따른 특정 마커의 발현 특징을 조사하는 것에 관한 것이고, 본 명세서에 개시된 방법은 비소세포폐암 환자 치료를 위해 적절하거나 효과적인 요법을 평가할 때 유용한 데이터 및 정보를 얻기 위한 편리하고, 효율적이며, 비용 효과적인 수단을 제공할 수 있을 것이다. The diagnostic methods relate to examining the expression characteristics of particular markers, particularly in relation to non-small cell lung cancer, and the methods disclosed herein are useful for obtaining data and information useful in assessing appropriate or effective therapies for the treatment of patients with non- Efficient, and cost-effective means. ≪ RTI ID = 0.0 >
폐암 환자의 핵산은 이들 폐암 환자로부터 획득한 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨 등의 시료로부터 수득할 수 있으며, 그 핵산 시료는 DNA, mRNA, 또는 mRNA로부터 합성되는 cDNA를 포함한다.The nucleic acid of a lung cancer patient can be obtained from a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine obtained from these lung cancer patients, and the nucleic acid sample is synthesized from DNA, mRNA or mRNA lt; / RTI >
상기 폐암 환자의 핵산은 페놀/클로로포름 추출법 및 프로테아제 K 처리방법과 같은 통상의 방법과 분리방법에 의하여 수행될 수 있으며, 또한 표적 핵산을 PCR을 통하여 증폭하고 이를 정제하여 얻을 수 있다.The nucleic acid of the lung cancer patient can be carried out by conventional methods such as phenol / chloroform extraction method and protease K treatment method, and the target nucleic acid can be obtained by amplifying and purifying the target nucleic acid by PCR.
본 발명은, 또한, 폐암, 바람직하게는 비소세포폐암 수술 후 재발 또는 전이 방지를 위해 필요한 항암제 투여량 및 투여방법 결정을 위한 정보도 제공할 수 있다. The present invention can also provide information for determining the dose of the anticancer agent and the method of administration necessary for preventing recurrence or metastasis after lung cancer, preferably non-small cell lung cancer surgery.
즉, 본 발명은 비소세포폐암 환자로부터 분리된 생물학적 시료로부터 DTX1 유전자의 DTX1 rs1732786A>G 다형성을 확인하여 예후가 나쁜 경우와 그렇지 않은 경우에 따라 폐암 수술 후 투여할 항암제의 종류, 양 및 농도 등 항암제 투여 방법을, 해당 폐암의 종류에 따라 적합하도록 서로 상이하게 적용할 수 있다. In other words, the present invention confirms the DTX1 rs1732786A> G polymorphism of the DTX1 gene from biological samples isolated from non-small cell lung cancer patients, and reports on the type, amount and concentration of anticancer drugs to be administered after lung cancer surgery, Methods of administration may be applied differently to suit the type of lung cancer.
이처럼, 본 발명에서는 폐암, 바람직하게는 비소세포폐암 환자에게서 DTX1 rs1732786A>G 발현 프로파일을 이용하는, 폐암 예후 진단 및 예측 마커로서의 모든 용도를 포함한다.Thus, the present invention includes all uses as a lung cancer prognosis diagnostic and prediction marker, using the DTX1 rs1732786A> G expression profile in lung cancer, preferably non-small cell lung cancer patients.
그러므로 본 발명에 따른 폐암 생존 예후의 예측 기술은 폐암이 발병한 환자에 대하여 손쉽게 환자의 예후를 평가하고, 치료법의 선발 및 평가를 위한 수단 및 치료를 표적화함으로써 폐암 발병 환자의 생존율을 높일 수 있다.Therefore, the prediction technique of lung cancer survival prognosis according to the present invention can increase the survival rate of lung cancer patients by easily evaluating the prognosis of patients with lung cancer and targeting the means and treatment for selecting and evaluating treatment methods.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.
달리 지시되지 않는 한, 핵산은 좌측에서 우측으로 5'3' 배향으로 기록된다. 명세서 내에서 열거된 수치 범위는 범위를 정의하는 숫자를 포함하고, 정의된 범위 내의 각각의 정수 또는 임의의 비-정수 분획을 포함한다.Unless otherwise indicated, nucleic acids are written in 5'3 'orientation from left to right. The numerical ranges recited in the specification include numerals defining the ranges and include each integer or any non-integral fraction within a defined range.
달리 정의되지 않는 한, 본원에서 사용된 모든 기술적 및 과학적 용어는 본 발명이 속하는 분야의 당업자가 통상적으로 이해하는 것과 동일한 의미를 갖는다. 본원에 기술된 것들과 유사하거나 등가인 임의의 방법 및 재료가 본 발명을 테스트하기 위한 실행에서 사용될 수 있지만, 바람직한 재료 및 방법이 본원에서 기술된다. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, the preferred materials and methods are described herein.
< < 실시예Example 1> 1>
실험 재료 및 방법Materials and Methods
1.실험군1. Experimental group
디스커버리 세트는, 1997년 12월 내지 2010년 1월 사이에 경북 국립 대학 병원(Kyungpook National University Hospital, KNUH)에서 치유적 외과 절제술을 받은 병리학적 단계 I, II, 또는 IIIA (micro-invasive N2) NSCLC를 가지는 환자 354명을 포함하였다. The discovery set was used for pathological phase I, II, or IIIA (micro-invasive N2) NSCLC, which received a healing surgical resection at Kyungpook National University Hospital (KNUH) between December 1997 and January 2010 Of the patients.
종양으로부터 게놈 DNA 샘플 및 상응하는 비-악성 폐 조직 표본들을 KNUH에서 National Biobank에 의해 제공받았고(Approval No. KNUHBIO_10-1016), 보건복지부에 의해 지원받았다. 수술 전 모든 환자로부터 동의서를 받았다. National Biobank로부터 유래된 모든 물질들은 기관 윤리 심의 위원회 프로토콜 하 수득하였다.Genomic DNA samples from tumors and corresponding non-malignant lung tissue samples were provided by National Biobank in KNUH (Approval No. KNUHBIO_10-1016) and were supported by the Ministry of Health and Welfare. All patients received consent before surgery. All substances derived from National Biobank were obtained under the Institutional Review Board protocol.
독립적 검증 세트에 대하여, 전체 772 환자들을 모았다: 428 케이스는 서울 국립 대학 병원으로부터, 344 케이스는 전남대학교 병원으로부터 수집하였다. 각 참여 기관에서 수술 전 모든 환자들로부터 동의서를 받고 연구 프로토콜을 심의 위원회로부터 승인받았다. 본 실험에 포함되는 모든 환자들은 한국 교포들이었다. 디스커버리 및 검증 세트에 포함되는 어느 환자들도 수술 전 화학요법이나 방사선요법을 받지 않았다. 종양의 병리학적 단계는 단계 폐암에 대한 국제 시스템에 따라 결정하였다.For the independent verification set, a total of 772 patients were collected: 428 cases from Seoul National University Hospital and 344 cases from Chonnam National University Hospital. Each participant received consent from all patients prior to surgery and received a study protocol approved by the review committee. All patients included in this study were Korean native Koreans. None of the patients included in the discovery and validation set received preoperative chemotherapy or radiotherapy. The pathological stage of the tumor was determined according to the international system for stage lung cancer.
2. 다형성 선별 및 지노타이핑(genotyping)2. Polymorphism screening and genotyping
웹사이트 데이터베이스를 이용하여 SNPs를 선별하였다. 이를 간략히 설명하면 SABioscience(http://www.sabiosciences.com/rt-pcr-product/HTML/PAHS-059Z.html)의 데이터베이스를 이용하여 노치 경로에 관여하는 28개의 후보군 유전자를 선별하였다. SNPs were selected using the website database. Briefly, 28 candidate genes involved in the Notch pathway were selected using a database of SABioscience (http://www.sabiosciences.com/rt-pcr-product/HTML/PAHS-059Z.html).
잠재적으로 기능적 SNP를 선택하기 위해, 웹 기반의 데이터베이스(http://snpinfo.niehs.nih.gov/)를 이용하였으며, 총 252 개의 SNPs가 선정되었다. To select potentially functional SNPs, a web-based database (http://snpinfo.niehs.nih.gov/) was used and a total of 252 SNPs were selected.
분석 검정 후(즉, JPT <0.1, LD r2> 0.8), 28개의 유전자에서 79 개의 SNP가 선정되었다. 79 개의 SNP 중 콜레이트(call rate) <95 %, 하디 - 와인버그 평형 (HWE) P <0.05, 또는 소수 대립인자 빈도 <0.10에 해당하는 15개의 SNP는 추가 분석에서 제외 하였으며, 이렇게 제외되지 않은 나머지 노치 경로 유전자 64개의 SNP를 분석하였다.After analysis (ie, JPT <0.1, LD r 2 > 0.8), 79 SNPs were selected from 28 genes. Of the 79 SNPs, 15 SNPs corresponding to a call rate <95%, a Hardy-Weinberg equilibrium (HWE) P <0.05, or a minority allele frequency <0.10 were excluded from further analysis, 64 SNPs of pathway genes were analyzed.
검증을 위하여, SEQUENOM's MassARRAY iPLEX 분석 (SEQUENOM Inc., San Diego, CA) 및 제한 단편길이 다형성 분석(restriction fragment length polymorphism assay)을 이용하여, 디스커버리 세트에서 우성, 열성 및/또는 공동 우성 모델 하 P< 0.05 를 가지는 전체 생존(OS) 과 무병 생존(DFS) 모두와 관련되어 있는 9개의 SNPs를 선별하여 지노타이핑하였다.Using a SEQUENOM ' s MassARRAY iPLEX assay (SEQUENOM Inc., San Diego, Calif.) And restriction fragment length polymorphism assay, P <0.05 was determined for the dominant, recessive, and / Nine SNPs associated with both total survival (OS) and disease free survival (DFS) were selected and genotyped.
3. 조직 샘플3. Tissue samples
DTX1의 mRNA의 발현 수준을 결정하기 위해, 133명의 폐암 환자 조직을 수집하였다. To determine the level of expression of DTX1 mRNA, 133 lung cancer tissues were collected.
4. 통계학적 분석 4. Statistical analysis
환자들의 임상병리학적 요소에 따른 유전자형 분포의 차이를 x2 테스트를 이용하여 비교하였다. 하디바이베르크 평형(Hardy-Weinberg equilibrium)은 x2 적합도를 이용하여 계산하였다. OS를 수술일로부터 마지막 팔로우-업한 날 또는 죽은 날까지 측정하였다. 무병 생존율(Disease-free survival; DFS)은 수술한 날부터 어떤 원인으로 재발 또는 사망하기 전까지의 질병이 없는 날을 계산하였다. 생존 추정값(survival estimates) 카프란 마이어(Kaplan-Meier) 방법을 이용하여 계산하였다. Differences in genotypic distribution according to clinicopathologic factors of patients were compared using x 2 test. The Hardy-Weinberg equilibrium was calculated using x 2 fit. The OS was measured from the day of surgery to the last follow-up or dead day. Disease-free survival (DFS) was calculated from the day of surgery to the day when there was no disease before recurrence or death for any cause. Survival estimates were calculated using the Kaplan-Meier method.
상이한 지노타입 전체에 걸쳐서 OS 및 DFS의 차이는 로그-순위(log-rank) 테스트를 이용하여 비교하였다. HR(Hazard ratio) 및 95% CI(confidence interval)을 다변량 콕스 비례 위험 모델을 이용하여 평가하였고, 연령 (≤ vs. > 중간값 연령), 성별 (여성 vs. 남성), 흡연 상태(비흡연- vs. 흡연 유경험자), 병리학적 단계(I vs. II-IIIA), 및 아쥬반트 요법(yes vs. no)을 고려하여 조정하였다. 타입 II 오류를 최소화하기 위해, 검증을 위한 SNP를 디스커버리 세트에서 0.10의 컷-오프 α 오류 수준을 이용하여 선별하였다. 다른 서브그룹의 유전자형-관련된 HR 간 차이를 비교하기 위해 동종성 테스트(homogeneity test)를 수행하였다. 모든 분석은 Windows, version 9.2 (SAS Institute, Cary, NC, USA)용 통계학적 분석법을 이용하여 수행되었다. Differences between OS and DFS across different genotype types were compared using log-rank tests. HR (hazard ratio) and 95% confidence interval (CI) were assessed using a multivariate Cox proportional hazards model. Age (≤ vs.> median age), gender (female vs. male), smoking status (non- vs. smokers), pathological stages (I vs. II-IIIA), and adjuvant therapy (yes vs. no). To minimize Type II errors, SNPs for validation were selected using a cut-off alpha error level of 0.10 in the discovery set. A homogeneity test was performed to compare the differences between the genotypically related HRs of the other subgroups. All analyzes were performed using statistical methods for Windows, version 9.2 (SAS Institute, Cary, NC, USA).
< < 실시예Example 2> 2>
환자 특성 및 임상적 Patient characteristics and clinical 예측인자Predictive factor
환자들의 임상학적 특징 및 병리학적 특징 및 그들의 전체 생존(OS) 및 무병생존(DFS)과의 연관을 조사하였다. 임상병리학적 특성에 의한 전체 생존 및 무병생존에 대한 단변량 분석 결과를 표 1에 나타내었다. The clinical characteristics and pathologic characteristics of the patients and their association with overall survival (OS) and disease free survival (DFS) were examined. Table 1 shows the results of univariate analysis of overall survival and disease-free survival by clinical pathology.
하기 표 1에 나타낸 바와 같이, 단일변량 분석에 의해 병리학적 병기가 두 코호트에서 전체생존(OS) 및 무병생존(DFS)과 유의적으로 연관되어 있다는 것을 알 수 있었고, (각각 log-rank P [PL -R] for OS = 3.310-5 and 4.810-13; and PL -R for DFS = 1.8x10-6 and 1.8x10-15) 성별과 흡연상태는 validation cohort에서 전체생존(OS)과 유의적으로 연관되어 있다는 것을 알 수 있었다(PL -R for OS = 0.001 and 0.004). 또한, 나이(>65years)는 validation cohort에서 전체생존(OS)과 유의적으로 연관되어 있다는 것을 알 수 있었다(PL -R for OS=0.006 and 0.01).Univariate analysis showed that pathological staging was significantly associated with overall survival (OS) and disease free survival (DFS) in the two cohorts, as shown in Table 1 below (log-rank P [ P L -R] for OS = 3.310 -5 and 4.810 -13; and P L -R for DFS = 1.8x10 -6 and 1.8x10 -15) gender and smoking status and significant overall survival (OS) in the validation cohort (P L -R for OS = 0.001 and 0.004), respectively. In addition, age (> 65years) was found to be significantly associated with overall survival (OS) in the validation cohort (P L -R for OS = 0.006 and 0.01).
<< 실시예Example 3> 3>
SNPsSNPs 및 생존 결과 사이의 관련성 And survival outcome
검색 세트에 분석된 64개의 SNPs 유전자형 중 9개의 SNPs(DTX1 rs1732786, LFNG rs1982157, NOTCH4 rs2071280, MFNG rs2071840, RBPJL rs2076026, EP300 rs2267424, NOTCH4 rs3134930, MAML2 rs555329, MAML2 rs7104987)가 전체 생존(OS) 또는 무병 생존(DFS)과 관련이 있었다(표 2 참조).(OS) or disease free survival (OS) of nine of the 64 SNPs genotypes analyzed in the search set (DTX1 rs1732786, LFNG rs1982157, NOTCH4 rs2071280, MFNG rs2071840, RBPJL rs2076026, EP300 rs2267424, NOTCH4 rs3134930, MAML2 rs555329, MAML2 rs7104987) (DFS) (see Table 2).
그러나 검증세트에서 rs1732786A>G 만이 일관된 결과를 보였으며, 조합 분석에서는, rs1732786A>G에서 G유전인자가 많아질수록 더 나은 생존율과 무병생존률을 보여 주었다(adjusted HR ?aHR? for OS, 0.81; 95% CI, 0.68-0.95; P = 0.01; aHR for DFS, 0.82; 95% CI, 0.72-0.94; P = 0.003; under codominant model; 표 3 참조). However, in the assays set only rs1732786A> G showed consistent results, and in the combination analysis, the greater the G gene in rs1732786A> G, the better the survival and disease free survival rate (adjusted HR? AHR? For OS, 0.81; % CI, 0.68-0.95; P = 0.01; aHR for DFS, 0.82; 95% CI, 0.72-0.94; P = 0.003; under codominant model;
rs1732786A>G과 생존과의 관계는 나이, 성별, 흡연 상태, 조직학적 타입, 병기에 의해 환자를 분류한 후 평가하였다. rs1732786A>G과 생존과의 관계는 다양한 임상병리학적인 요인들 중 판정기준치(cut off value)가 0.05인 병기 외에는 유의한 차이가 없었다(P-values for homogeneity test > 0.05 for all comparisons, 표 4 참조).The relationship between G and survival was assessed after classification of patients by age, sex, smoking status, histologic type, and stage. The relationship between G and survival was not significantly different amongst the various clinicopathologic factors except for the cut-off value of 0.05 ( P-values for homogeneity test> 0.05 for all comparisons, see Table 4) .
<< 실시예Example 4> 4>
rs1732786Ars1732786A >G의 유전자형이 > Genotype of G DTX1DTX1 mRNAmRNA 발현에 미치는 영향 Effect on expression
본 발명자들은 rs1732786A>G이 종양내에 DTX1 유전자에 어떠한 영향을 미치는지 확인하기 위하여 비소세포폐암 조직과 짝을 이룬 정상적인 폐조직에서 rs1732786A>G 유전자형에 따른 DTX1 mRNA 발현 정도를 평가하였다. The inventors have rs1732786A> G was the rate the degree DTX1 mRNA expression according to rs1732786A> G polymorphism in the normal lung tissues achieved a non-small cell lung cancer with a partner to see how affected the DTX1 gene in tumors.
DTX1 유전자의 mRNA 발현 정도는 정량적 역전사 중합효소 연쇄반응(quantitative reverse transcription- polymerase chain reaction)에 의해 측정되었다. TRIzol(Invitrogen, Carlsbad, CA)을 사용하여 비소세포폐암 조직과 짝을 이루는 정상적인 폐 조직(n=133)으로부터 RNA를 추출하였다. 실시간 중합효소연쇄반응(Real-time PCR)은 Quantifast SYBR Green PCR Master Mix(Quiagen)을 사용하여 Lightcycler 480(Roche Applied Science, Mannheim, Germany)을 통해 이루어졌다. 정방향 프라이머(5'-AGTTCACCGCAAGAGGATTC-3')와 역방향 프라이머(5'- GTGCCGATAGTGAAGATGAGTC -3')가 실시간 중합효소연쇄반응을 위한 실험에 사용되었다. 각각의 샘플은 β-actin의 발현으로 표준화하고, 중복 실험 하였다. 상대적인 정량은 2-Ct 방법으로 계산하였다. The degree of mRNA expression of the DTX1 gene was measured by quantitative reverse transcription-polymerase chain reaction (RT-PCR). RNA was extracted from normal lung tissue (n = 133) paired with non-small cell lung cancer tissues using TRIzol (Invitrogen, Carlsbad, Calif.). Real-time PCR was performed using Lightcycler 480 (Roche Applied Science, Mannheim, Germany) using Quantifast SYBR Green PCR Master Mix (Quiagen). A forward primer (5'-AGTTCACCGCAAGAGGATTC-3 ') and a reverse primer (5'-GTGCCGATAGTGAAGATGAGTC -3') were used in the experiments for real-time PCR. Each sample was normalized by the expression of < RTI ID = 0.0 > ss-actin < / RTI > Relative quantification was calculated by the 2- Ct method.
그 결과 종양 조직에서 rs1732786A>G의 유전자형에 따른 DTX1 mRNA 발현에 차이가 있음을 확인하였다. 즉, DTX1의 mRNA 발현량은 AA<AG<GG 순으로 증가하였다(Ptrend = 0.022)(도 1). 또한 DTX1 mRNA 발현은 정상조직에 비해 종양조직에서 낮은 것을 확인하였다(P = 0.003)(도 2). As a result, tumor tissue in accordance with the genotype of DTX1 rs1732786A> G mRNA expression was found to be different. That is, the amount of DTX1 mRNA expression increased in the order AA <AG <GG (P trend = 0.022) (Fig. 1). Also DTX1 mRNA expression was found to be lower in tumor tissue than in normal tissue (P = 0.003) (Fig. 2).
따라서, 상기의 결과로부터 DTX1 유전자의 rs1732786A>G 다형성은 폐암 예후 진단 및 예측을 위한 마커용 조성물로 유용하게 사용될 수 있음을 알 수 있다. Thus, from the above results, it can be seen that the rs1732786A> G polymorphism of DTX1 gene can be usefully used as a marker composition for diagnosis and prediction of lung cancer prognosis.
추가적으로, 본 발명자들은 DTX1 rs1732786A>G 다형성 및 폐암 발생 위험도와의 관련성이 DTX1 프로모터의 전사 활성의 변화에 기인한 것인지를 확인하기 위하여, 루시퍼라제 분석(luciferase assay)을 통해 이들 두 다형성의 야생형 대립형질 또는 다형성 대립형질의 프로모터 활성을 비교하였다. In addition, the present inventors conducted a luciferase assay to determine whether the association of the DTX1 rs1732786A> G polymorphism and the risk of lung cancer development is due to a change in the transcriptional activity of the DTX1 promoter, by comparing these two polymorphic wild-type alleles Or polymorphic alleles were compared.
in vitro 프로모터 분석 결과, rs1732786G 대립형질은 rs1732786A 대립형질에 비하여 높은 전사 활성을 나타내었다. In vitro promoter analysis showed that rs1732786G allele had higher transcriptional activity than rs1732786A allele.
또한, 알리바바2 프로그램 (Alibaba2 program; Grabe, N., In. Silico. Biol., 2, S1-1, 2002)을 이용하여 가능한 전사 인자 결합부위(potential transcription factor binding site)를 분석한 결과, rs1732786A에서 rs1732786G로 변이되면 시미안 바이러스-40 단백질1 (simian virus-40 protein 1, Sp1) 결합부위가 형성된다. Analysis of potential transcription factor binding sites using the Alibaba2 program (Grabe, N., In. Silico. Biol., 2, S1-1, 2002) revealed that rs1732786A To rs1732786G, a binding site for simian virus-40 protein 1 (Sp1) is formed.
따라서, rs1732786G 대립형질에 의한 새로운 결합부위의 형성이 프로모터의 활성 증가를 야기하는 것으로 판단된다(도 3 참조).Thus, it was determined that the formation of a new binding site by the rs1732786G allele causes an increase in the activity of the promoter (see Fig. 3).
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.
<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> DIAGNOSTIC METHODS FOR PROGNOSIS OF NON-SMALL-CELL LUNG CANCER USING DTX1 SNP <130> PN1607-234 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 1500 <212> DNA <213> Homo sapiens <400> 1 gccgaggcct cctcccaccc gcgagatccc ggcggccgcc agccggctcc tgcgtccgtc 60 cgtcggccgg gcagtctgtc cacgcgcgga aagctcggcg cggcggccga ggggcctggg 120 agggaacggg cgcggaggcg ggaccgcggc tccctcccac tccgggggga gcccaggagg 180 cggcggtgct ggagcgcgag ccggagccgg agccggagac gaagagaggc ggtgagaacg 240 cgggtgctta gggaccccac ccccggctcc cgctgggggc ccgcgagcgg ctcggggacg 300 tctgggctgg ggaagcgggg ctgttacccc cagggcggga ggcagagacg atccagctcc 360 tggcttcgcc ccctccgcga cgcgaccccc gaggggccct gggccgcgcc tgcagcgccg 420 cgcatccccg tgcttcccgg cgcaccccag cgcacccggc atccccccgg cagggcgagg 480 gccccggggg aagggaaggc tccgggagcc aaggagggcg ccccccaggc ggagagtctc 540 ggaaaaccgc gcccccggcc cctgccttcc ctccaggcct gccccaaggg aaagcgggcg 600 gggcgacccc gtacgccccc cttgctgtcc cccttcggtt ccccattgtt ctcagccgaa 660 tgctctcctg ggaagggggg agggggtgct gcgctctcct cttaaagggc cctctcccct 720 cttgtctcct ggcaggtcgc gagcacgagt ggggtggggc gtgcccacgg gcccccgccc 780 ccctcgtccc cctcgtcccc cagcccagct ccggagccgc agtccaggcg cgccgcccga 840 gggtccacgc cgcacccctc ccccgtgcgt tctgcggcca cccaggcctt ccaggacacc 900 gtggagaggg aacaaggggg cagggacgcc cccttcggca ggagccgtcg gagaaggggg 960 cccagaccgg agggaggcga gaagccccac tgaagccggg cgcagggtct gggacgcagt 1020 tgggagtgca aagggctggc tgagagccgc aggagcagca ggctgtggcc caggcctcct 1080 gggtgacagg ccctgtctgg cggggaagag ggaccaagag acaacacgga agaggctgga 1140 cctcgaacag gggcggctgc ctcactccct acctgagcca gccgaggggg ccaaggactt 1200 tagagctgtt tcctccggca taagagagac acttgctttc cagggcagca ccctttatcg 1260 gagaaggctc tacagggaag gggtctttgc agcctggatg gccatcccac attcctttaa 1320 cggaggtctc taggcctcag agagaaccca gagttagaaa ggaggccaga cggtccttgc 1380 tgtccccctg gggagagagg aagttgccgc ctgctgccag gcccaggagg agctgggcct 1440 gcaatagtgg gggacctggc ccctgaggca gtggcggcca tgtcacggcc aggccacggt 1500 1500 <110> Kyungpook National University Industry-Academic Cooperation Foundation <120> DIAGNOSTIC METHODS FOR PROGNOSIS OF NON-SMALL-CELL LUNG CANCER USING DTX1 SNP <130> PN1607-234 <160> 1 <170> KoPatentin 3.0 <210> 1 <211> 1500 <212> DNA <213> Homo sapiens <400> 1 gccgaggcct cctcccaccc gcgagatccc ggcggccgcc agccggctcc tgcgtccgtc 60 cgtcggccgg gcagtctgtc cacgcgcgga aagctcggcg cggcggccga ggggcctggg 120 agggaacggg cgcggaggcg ggaccgcggc tccctcccac tccgggggga gcccaggagg 180 cggcggtgct ggagcgcgag ccggagccgg agccggagac gaagagaggc ggtgagaacg 240 cgggtgctta gggaccccac ccccggctcc cgctgggggc ccgcgagcgg ctcggggacg 300 tctgggctgg ggaagcgggg ctgttacccc cagggcggga ggcagagacg atccagctcc 360 tggcttcgcc ccctccgcga cgcgaccccc gaggggccct gggccgcgcc tgcagcgccg 420 cgcatccccg tgcttcccgg cgcaccccag cgcacccggc atccccccgg cagggcgagg 480 gccccggggg aagggaaggc tccgggagcc aaggagggcg ccccccaggc ggagagtctc 540 ggaaaaccgc gcccccggcc cctgccttcc ctccaggcct gccccaaggg aaagcgggcg 600 gt; tgctctcctg ggaagggggg agggggtgct gcgctctcct cttaaagggc cctctcccct 720 cttgtctcct ggcaggtcgc gagcacgagt ggggtggggc gtgcccacgg gcccccgccc 780 ccctcgtccc cctcgtcccc cagcccagct ccggagccgc agtccaggcg cgccgcccga 840 gggtccacgc cgcacccctc ccccgtgcgt tctgcggcca cccaggcctt ccaggacacc 900 gtggagaggg aacaaggggg cagggacgcc cccttcggca ggagccgtcg gagaaggggg 960 cccagaccgg agggaggcga gaagccccac tgaagccggg cgcagggtct gggacgcagt 1020 tgggagtgca aagggctggc tgagagccgc aggagcagca ggctgtggcc caggcctcct 1080 gggtgacagg ccctgtctgg cggggaagag ggaccaagag acaacacgga agaggctgga 1140 cctcgaacag gggcggctgc ctcactccct acctgagcca gccgaggggg ccaaggactt 1200 tagagctgtt tcctccggca taagagagac acttgctttc cagggcagca ccctttatcg 1260 gagaaggctc tacagggaag gggtctttgc agcctggatg gccatcccac attcctttaa 1320 cggaggtctc taggcctcag agagaaccca gagttagaaa ggaggccaga cggtccttgc 1380 tgtccccctg gggagagag aagttgccgc ctgctgccag gcccaggagg agctgggcct 1440 gcaatagtgg gggacctggc ccctgaggca gtggcggcca tgtcacggcc aggccacggt 1500 1500
Claims (10)
상기 폐암은 편평상피암, 소세포암, 선암, 대세포암 또는 비소세포암인 것을 특징으로 하는 폐암 예후 진단 및 예측을 위한 마커용 조성물.The method according to claim 1,
Wherein the lung cancer is squamous cell carcinoma, small cell carcinoma, adenocarcinoma, large cell carcinoma or non-small cell carcinoma.
상기 폐암은 비소세포암인 것을 특징으로 하는 폐암 예후 진단 및 예측을 위한 마커용 조성물.The method of claim 3,
Wherein the lung cancer is non-small cell carcinoma.
상기 폐암은 수술로 절제된 경우인 것을 특징으로 하는 폐암 예후 진단 및 예측을 위한 마커용 조성물.The method according to claim 1,
Wherein the lung cancer is surgically resected. ≪ RTI ID = 0.0 > 8. < / RTI >
상기 DTX1 유전자의 rs1732786 다형성의 유전자형이 GG인 경우 생존 예후가 좋은 군으로 판정하는 것을 특징으로 하는, 폐암 환자의 생존 예후 예측을 위한 정보를 제공하는 방법.9. The method of claim 8,
Wherein the genotype of the rs1732786 polymorphism of the DTX1 gene is GG, the survival prognosis is determined to be a good group, and a method for providing information for predicting the survival prognosis of lung cancer patients.
상기 폐암은 비소세포암인 것을 특징으로 하는 생존 예후 예측을 위한 정보를 제공하는 방법.9. The method of claim 8,
Wherein the lung cancer is non-small cell carcinoma.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020160124069A KR101895677B1 (en) | 2016-09-27 | 2016-09-27 | Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020160124069A KR101895677B1 (en) | 2016-09-27 | 2016-09-27 | Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20180034046A KR20180034046A (en) | 2018-04-04 |
KR101895677B1 true KR101895677B1 (en) | 2018-09-05 |
Family
ID=61975801
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020160124069A KR101895677B1 (en) | 2016-09-27 | 2016-09-27 | Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101895677B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117004744B (en) * | 2022-04-27 | 2024-05-24 | 数字碱基(南京)科技有限公司 | Lung cancer prognosis evaluation method and model based on plasma microorganism DNA characteristics |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100894322B1 (en) | 2006-05-17 | 2009-04-24 | 경북대학교 산학협력단 | Makers for the diagnosis of susceptibility to lung cancer and method for predicting and analyzing susceptibility to lung cancer using the same |
KR101141829B1 (en) | 2009-07-22 | 2012-05-07 | 이명훈 | Genetic marker for predicting survival in patients with early stage lung cancer and method for predicting survival using the same |
KR101219794B1 (en) | 2010-08-20 | 2013-01-10 | 국립암센터 | Composition for diagnosing non-small cell lung cancer comprising an agent for determining level of methylation of HOXA11 gene and a method for diagnosing non-small cell lung cancer using the same |
KR101307660B1 (en) | 2011-06-09 | 2013-09-12 | 주식회사 디앤피바이오텍 | Method for predicting prognosis in patients with non-small cell lung cancer using telomere shortening |
-
2016
- 2016-09-27 KR KR1020160124069A patent/KR101895677B1/en active IP Right Grant
Non-Patent Citations (1)
Title |
---|
Oncotarget, Vol. 7, No. 38, pp. 61716-61727 (2016.08.20.)* |
Also Published As
Publication number | Publication date |
---|---|
KR20180034046A (en) | 2018-04-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101141829B1 (en) | Genetic marker for predicting survival in patients with early stage lung cancer and method for predicting survival using the same | |
KR101774747B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using pcaf snp | |
KR102195591B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using glut3 snp | |
KR101895677B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using dtx1 snp | |
KR101979990B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using eno1 snp | |
KR102195593B1 (en) | Diagnostic methods for prognosis of small-cell lung cancer using ddc snp | |
KR101799152B1 (en) | Method for predicting survival of patients with non-small cell lung cancer using PD-L1 polymorphism | |
KR101676089B1 (en) | Polymorphism biomarker for predicting prognosis in lung cancer patients and the method for predicting prognosis using the same | |
KR101766006B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using pcm1 snp | |
KR101957028B1 (en) | DIAGNOSTIC METHODS FOR PROGNOSIS OF NON-SMALL-CELL LUNG CANCER USING BUB3, AURKB, PTTG1 AND RAD21 SNPs | |
KR102573028B1 (en) | Diagnostic methods for prognosis of small-cell lung cancer using MPHOSPH9 SNP | |
KR101957009B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using foxf2 and heyl snp | |
KR102573077B1 (en) | Diagnostic methods for prognosis of small-cell lung cancer using MFF SNP | |
KR101414413B1 (en) | Marker for predicting survival in patients with early stage lung cancer and method for predicting survival using the same | |
KR102134176B1 (en) | Diagnostic methods for prognosis of non-small-cell lung cancer using arid3a snp | |
KR101717177B1 (en) | Markers for predicting survival and the response to anti-cancer drug | |
KR101478075B1 (en) | Markers for predicting survival and the response to anti-cancer drug in a patient with lung cancer | |
KR101795920B1 (en) | SLC5A10 gene polymorphisms marker for predicting survival in patients with lung cancer and method for predicting survival using the same | |
KR101860997B1 (en) | EGFR gene polymorphisms marker for predicting survival in patients with lung cancer and method for predicting survival using the same | |
US7745121B2 (en) | Polymorphism in the macrophage migration inhibitory factor (MIF) gene as marker for prostate cancer | |
KR101434759B1 (en) | Markers for predicting survival and the response to anti-cancer drug in a patient with lung cancer | |
KR101480243B1 (en) | C3 gene polymorphisms marker for predicting survival in patients with lung cancer and method for predicting survival using the same | |
EP3464620B1 (en) | Determination of genetic predisposition to aggressive prostate cancer | |
KR101507656B1 (en) | GNB2L1 gene polymorphisms marker for predicting survival in patients with lung cancer and method for predicting survival using the same | |
KR20220122269A (en) | Diagnostic methods for prognosis of small-cell lung cancer using CD155 and CD226 SNP |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |