KR101799152B1 - Method for predicting survival of patients with non-small cell lung cancer using PD-L1 polymorphism - Google Patents

Abstract

The present invention relates to the early diagnosis prognosis of NSCLC patients with PD-L1 polymorphism, and more specifically to 257th bases, 690th bases of SEQ ID NO: 2 of SEQ ID NO: 1 in the PD-L1 gene, SEQ ID NO: The present invention relates to a method for diagnosing and predicting a prognosis affecting the survival outcome of early stage non-small cell lung cancer using any one of the polymorphisms (SNPs) of the 154th base of SEQ ID NO: 3.
The prediction technique of lung cancer survival prognosis according to the present invention can increase the survival rate of lung cancer patients by easily evaluating the prognosis of patients with lung cancer and targeting the means and treatment for selecting and evaluating treatment methods.

Description

Methods for the diagnosis of non-small cell lung cancer using PD-L1 polymorphism (PD-L1 polymorphism)

The present invention relates to a method for diagnosing a prognosis of patients with non - small cell lung cancer using PD-L1 polymorphism, and more particularly, to a method for diagnosing the prognosis of patients with non - small cell lung cancer using PD-L1 gene rs4143815, rs822336 and rs822337 SNPs. Methods for diagnosing and predicting prognostic factors, and uses thereof.

Globally, lung cancer accounts for 1,600,000 new cases each year, of which 1.4 million die. This accounted for 13% of all cancer cases and accounted for 18% of cancer-related deaths. In 2010, lung cancer deaths increased to 1,500,000, accounting for 19% of all cancer-related deaths.

Histologically, about 80% are non-small-cell lung cancers, of which 32-40% are adenocarcinoma, including bronchoalveolar carcinoma (BAC), 25-30% Squamous cell carcinoma, and 8-16% is large cell neuroendocrine carcinoma. More than 65% of all non-small cell lung cancers are found to be in a state where complete resection is impossible from the time of diagnosis.

Diagnosis of NSCLC is performed by examination of pathologists of suspected tissues such as biopsy samples. After NSCLC diagnosis, the patient's illness is assigned to the patient's overall health status and severity of symptoms such as age, coughing and dyspnea, prognosis (recovery opportunity) using specific types of NSCLC and cancer staging. The progression stage considers the size of the tumor and whether the tumor is present only in the lung or diffuse elsewhere in the body. Specific treatment options for NSCLC patients are selected based on the above considerations, and the cancer progression stage is an important factor for treatment selection. Patients with early NSCLC can potentially be cured by surgical resection to remove the tumor, but current diagnostic aspects can not predict which patient will recur after surgery.

Also, because cancer often recurs locally or transitions from native cancer tissue to distant tissues and organs, which of the patients with early cancer need to undergo drug treatment after surgical removal of their primary tumor It is important to reveal. This is particularly important in patients with early NSCLC.

The ideal treatment for lung cancer is early detection and removal of the cancer by surgery. However, early diagnosis is difficult because early diagnosis of lung cancer has progressed to such an extent that more than half of the patients can not undergo surgery. In addition, after the onset of lung cancer, especially in non-small cell carcinoma, if surgery is not enough to perform surgery, first of all, only 30% of cases can be performed curative resection. The 5-year survival rate, which depends on the degree of cancer progression, was recovered in all patients who underwent curative resection, including squamous cell carcinoma (37%), adenocarcinoma (27%) and large cell carcinoma (27%). The majority of these patients relapse after surgery and become more aggressive and die. Early NSCLC prognosis can not be confirmed with sufficient accuracy to direct more aggressive therapies for patients with a high likelihood of recurrence as a current clinical diagnostic method.

Therefore, it may be necessary to identify patients with high risk of early NSCLC who have to undergo chemotherapy or have generally reevaluated treatment findings, and can determine the prognosis of NSCLC so that it is easy to decide whether to use additional treatment options The survival rate can be remarkably increased.

The present inventors selected 13 single nucleotide polymorphisms from the PD- 1 , PD - L1 , and CTLA- 4 genes involved in the development and progression of NSCLC cancer using 354 non-small cell lung cancer surgical tissues , And confirmed the genotype. The present invention was completed by analyzing the relationship between the genotype of the single nucleotide polymorphism and the overall survival of the patient.

Korean Patent Publication No. 10-2011-0009609 Korean Patent No. 10-0894322 Korean Patent No. 10-1307660 Korean Patent No. 10-1219794

It is an object of the present invention to provide a composition for markers for diagnosis and prediction of lung cancer prognosis, which contains a single base polymorphism (SNP) of the PD-L1 gene.

Another object of the present invention is to provide a kit for predicting the survival prognosis of lung cancer patients comprising the composition of the present invention.

Another object of the present invention is to provide a microarray for predicting the survival prognosis of lung cancer patients comprising the composition of the present invention.

Another object of the present invention is to provide a method for providing information for predicting the survival prognosis of lung cancer patients.

In order to achieve the above object, the present invention provides a PD - L1 (SNP) of a gene for a marker for the diagnosis and prediction of lung cancer.

In one embodiment of the present invention, the PD - L1 The single nucleotide polymorphism (SNP) of the gene includes the 257th base in the nucleotide sequence shown in SEQ ID NO: 1, the 690th base in the nucleotide sequence shown in SEQ ID NO: 2, and the 154th nucleotide in the nucleotide sequence shown in SEQ ID NO: Lt; / RTI > polymorphism.

In one embodiment of the present invention, the lung cancer may be squamous cell carcinoma, small cell carcinoma, adenocarcinoma, large cell carcinoma or non-small cell carcinoma.

In one embodiment of the present invention, the lung cancer may be non-small cell carcinoma.

In one embodiment of the present invention, the lung cancer may be a surgically-resected lung cancer tissue or a lung cancer cell.

 In addition, the present invention provides a kit for predicting survival prognosis of a lung cancer patient comprising a composition.

 The present invention also provides a microarray for predicting the survival prognosis of a lung cancer patient comprising the composition.

In addition, the present invention also provides a method for screening a nucleic acid extracted from a nucleic acid extracted from a patient suffering from lung cancer, wherein the 257th base in the nucleotide sequence of SEQ ID NO: 1, the 690th nucleotide in the nucleotide sequence of SEQ ID NO: 2 and the 154th nucleotide in the nucleotide sequence of SEQ ID NO: And identifying a polymorphism selected from the group consisting of the following: < RTI ID = 0.0 > 1, < / RTI >

In one embodiment of the present invention, the genotype of the 257th polymorphism of SEQ ID NO: 1 is GG (SEQ ID NO: 2), wherein the 690th base of SEQ ID NO: 2 is C and the 154th base of SEQ ID NO: , The survival prognosis is low.

In one embodiment of the present invention, the lung cancer may be non-small cell carcinoma.

The prediction technique of lung cancer survival prognosis according to the present invention can increase the survival rate of lung cancer patients by easily evaluating the prognosis of patients with lung cancer and targeting the means and treatment for selecting and evaluating treatment methods.

Figure 1 rs4143815 C of PD-L1 gene> G (A), rs822336 G > C (B), rs822337 T> A (C) the single nucleotide polymorphism (SNP), diploid type (D), the three SNPs (E) and the degree of PD-L1 mRNA expression in tumor tissues (F).
FIG. 2 shows the results of analysis of the effect of unicellular rs822336G> C and rs822337T> A polymorphism on promoter activation of PD-L1 gene using luciferase assay.

The terms used in the present invention are defined as follows.

Prognosis refers to the progression and cure of disease, such as lung cancer-induced death or the likelihood of progression, including onset, recurrence, metastatic spread, and drug resistance, for example neoplastic diseases such as lung cancer. For the purpose of the present invention, the prognosis refers to the risk of developing lung cancer, preferably non-small cell lung cancer, and the survival prognosis after onset, preferably a patient who has undergone surgical resection of lung cancer, more preferably, Of patients.

"Prediction" refers to the determination of the likelihood of a patient developing lung cancer, and preferably or non-favorably responding to therapies such as chemotherapy or radiotherapy to treat a patient, for example, a particular therapeutic agent, and / Elimination by surgery, and / or the likelihood and / or likelihood of survival after chemotherapy for a certain period of time without cancer recurrence. The predictive method of the present invention is a patient having a high risk of developing lung cancer for any particular patient, and can prevent or delay the onset of the disease through special and appropriate management, or select the most appropriate treatment method for a patient with lung cancer, Lt; / RTI > The predictive method of the present invention can be used to identify whether a patient is responding favorably to treatment regimens, such as, for example, a prescribed treatment or combination, surgical intervention, chemotherapy or other prescribed treatment regimen, It is possible to predict whether or not survival is possible.

"Genetic polymorphism" refers to a case where a genetic variation occurs in at least 1% of the population. The insertion, deletion, or substitution of a single nucleotide in DNA is called single nucleotide polymorphism (SNP).

The term "polymorphism " refers to a sequence in a sequence of genes that varies within a cluster. Polymorphisms consist of different "alleles ". The arrangement of this polymorphism can be confirmed by its position in the gene and the different amino acids or bases found therein. These amino acid variations are the result of two possible mutant bases, C and T, which are two different alleles. Since the genotype is composed of two different distinct alleles, any of the various possible variants can be observed in any individual (e. G., CC, CT or TT in this example). The individual polymorphisms are also known to those skilled in the art and are used in, for example, the Single Nucleotide Polymorphism Database (dbSNP) of the Nucleotide Sequence Variation of the nucleotide base mutations available on the NCBI website. ("Reference SNP", "refSNP", or "rs #").

"Single nucleotide polymorphism (SNP) refers to the diversity of DNA sequences that occur when a single nucleotide (A, T, C or G) in the genome is different between members of a species or between individual chromosomes For example, differences in single bases such as three DNA fragments of different individuals (eg, AAGT [A / A] AG, AAGT [A / G] AG, and AAGT [G / Within a population, SNPs are defined as minor allele frequencies (MAFs), which are the frequencies of allele frequencies (MAFs). (Deletion) or addition (insertion) of a polynucleotide sequence in the polynucleotide sequence of the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO: It is possible to cause a change in the translation frame.

The term "genotype" refers to the expression of a particular gene in a cell or tissue sample.

Specific allele. ≪ / RTI >

An "allele" or "allele" is one of two or more alternative forms of a gene that occupy the same chromosomal locus.

"Allele frequency" refers to the frequency (percentage or percentage) that an allele is present within an individual, within a lineage, or within a group of lines. The frequency of alleles in a system or population can be estimated by normalizing the allele frequency of a sample of individuals from the system or population.

"Diagnosis" means identifying the presence or characteristic of a pathological condition. Among them

The invention is also particularly useful for the diagnosis of solid pancreaticobiliary tumors of the pancreas. The present invention includes predicting the progression and metastasis of lung cancer, preferably non-small cell lung cancer recurrence. Therefore, it is very important to accurately predict the recurrence and progression of non-small-cell lung cancer, and factors that can predict the response of treatment while supplementing clinical indicators such as tissue differentiation and stage are needed. SNP can be used as a diagnostic tool for non-small cell lung cancer. That is, the polymorphism measurement of these genes can be used as an indicator (diagnostic marker) for predicting the differentiation, stage, and progression of non-small cell lung cancer.

"Diagnostic markers or diagnosis markers are substances that can distinguish cells with non-small cell lung cancer from normal cells. It is a polypeptide or nucleic acid that shows an increase pattern in non-small cell lung cancer cells compared to normal cells MRNA, etc.), lipids, glycolipids, glycoproteins, sugar (monosaccharides, disaccharides, polysaccharides, etc.) and the like.

The term " marker for predicting the survival prognosis of a patient with lung cancer "means a marker having a polymorphism capable of predicting the risk of lung cancer, the cure of the onset of lung cancer or the progress of lung cancer, preferably the nucleotide described above. In addition, the patient refers to a patient for discriminating the risk of lung cancer or a patient who has undergone surgical resection of lung cancer, particularly lung cancer. The patient who has undergone surgical resection of the lung cancer preferably refers to a patient who has undergone surgical resection of lung cancer such as non-small cell carcinoma, squamous cell carcinoma, adenocarcinoma or large cell carcinoma. More preferably, do.

"Danger" refers to a statistically high incidence of a disease or condition in a subject having a particular polymorphic allele, compared to the incidence of a disease or condition in a member of the individual that does not possess the particular polymorphic allele.

The term "functional equivalents" refers to, for example, one or more substitutions, deletions or additions from a reference sequence, a net effect that does not result in various functional dissimilarities between the reference and subject sequences, ≪ / RTI > and the nucleotide sequence of the mutated mutant sequence. Preferably, the nucleotide sequence has at least about 65% identity, more preferably at least about 75% identity, most preferably about 95% identity. For the purposes of the present invention, sequences with substantially equivalent biological activities and substantially equivalent synthetic features are treated as substantial equivalents.

"Cancer "," tumor ", or "malignant" refers to or represents the physiological condition of a mammal that is generally characterized by unregulated cell growth.

"Subject" or "patient" means any single entity that requires treatment, including human, cow, dog, guinea pig, rabbit, chicken, In addition, any subject who participates in a clinical study test that does not show any disease clinical findings, or who participates in epidemiological studies or used as a control group is included.

"Tissue or cell sample" refers to a collection of similar cells obtained from a subject or tissue of a patient. The source of the tissue or cell sample may be a solid tissue from fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; Blood or any blood components; It may be a cell at any point in the pregnancy or development of the subject. Tissue samples can also be primary or cultured cells or cell lines.

"Nucleic acid" is meant to include any DNA or RNA, such as chromosomes, mitochondria, viruses and / or bacterial nucleic acids present in a tissue sample. Includes one or both strands of a double-stranded nucleic acid molecule and includes any fragment or portion of the intact nucleic acid molecule.

"Gene" means any nucleic acid sequence or portion thereof that has a functional role at the time of protein coding or transcription, or in the control of other gene expression. The gene may consist of only a portion of the nucleic acid encoding or expressing any nucleic acid or protein that encodes the functional protein. The nucleic acid sequence may comprise an exon, an intron, an initiation or termination region, a promoter sequence, another regulatory sequence, or a gene abnormality within a particular sequence adjacent to the gene.

"Primer" refers to an oligonucleotide sequence that hybridizes to a complementary RNA or DNA-targeted polynucleotide and serves as a starting point for the stepwise synthesis of a polynucleotide from a mononucleotide by the action of, for example, the nucleotidyltransferase that occurs in the polymerase chain reaction .

"Protein" also includes fragments, analogs, and derivatives of proteins that retain essentially the same biological activity or function as the reference protein

"Label" or "label " means a compound or composition that facilitates the detection of a reagent, such as a reagent conjugated, conjugated, conjugated, or fused to a nucleic acid probe or antibody. The label may itself be detected (e. G., A radioactive isotope label or a fluorescent label), in the case of an enzyme label, to catalyze the chemical modification of the detectable substrate compound or composition.

"Treatment" means an approach to obtaining beneficial or desired clinical results.

For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in the extent of disease, stabilization (i.e., not worsening) of the disease state, (Either partially or totally), detectable or undetected, whether or not an improvement or temporary relief or reduction

Also, "treatment" may mean increasing the survival rate compared to the expected survival rate when not receiving treatment. Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Such treatments include treatments required for disorders that have already occurred as well as disorders to be prevented. &Quot; Palliating " a disease may reduce the extent of the disease state and / or undesirable clinical symptoms and / or delay or slow the time course of the progression, It means to lose.

"About" means that the reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length is 30, 25, 20, 25, 10, 9, 8, 7, , Level, value, number, frequency, percent, dimension, size, quantity, weight, or length that varies from one to three, two, or one percent.

Throughout this specification, the words " comprising "and" comprising ", unless the context requires otherwise, include the stated step or element, or group of steps or elements, but not to any other step or element, And that they are not excluded.

Hereinafter, the present invention will be described in detail.

The disease to be diagnosed in the present invention is a disease associated with lung cancer.

The lung cancer may preferably be non-small cell lung cancer (NSCLC), and the non-small cell lung cancer includes squamous cell cancer, adenocarcinoma, large cell carcinoma, or squamous cell carcinoma. More preferably squamous cell cancer.

Patient refers to a patient with lung cancer, ie squamous cell, small cell, adenocarcinoma, large cell carcinoma or non-cell carcinoma. Preferably, the subject includes patients who have undergone surgical resection of lung cancer, i.e. squamous cell, small cell, adenocarcinoma, large cell carcinoma or non-cell carcinoma.

Non-small cell lung cancer accounts for more than 75% of all lung cancer, with an average 5-year survival rate of 15%. The high mortality rate of non-small cell lung cancer is associated with a high proportion of patients with some unresectable tumors (Parkin DM, et al., Cancer J Clin 55: 74-108, 2005). It has been reported that many of the surgically resected patients die from recurrence of cancer even though they have a good prognosis in patients with non-small cell lung cancer of the resectable stage (Arriagada R, et al., N Engl J Med 350: 351-60, 2004). Therefore, when prognostic factors are used for patients with non - small cell lung cancer, it is possible to target the evaluation and prognosis of the prognosis and the selection and treatment of the treatment method, and thus it is expected that the personalized treatment of patients with non - small cell lung cancer will be possible. The aim of this study was to evaluate the prognosis of patients with non-small cell lung cancer.

The present invention relates to the use of the PD - L1 gene polymorphism as a diagnostic marker for non-small cell lung cancer (NSCLC) and as a predictive marker, and the specific SNP of the PD - L1 gene is associated with a bad prognosis in the early stages of non- For the first time. The prognosis includes progression, recurrence and metastasis of non-small cell lung cancer.

< PD - L1 prognostic marker>

Therefore, the present invention relates, in one aspect, to the use of the PD - L1 gene as a diagnostic marker for lung cancer, preferably non-small cell lung cancer prognosis. Specifically, PD - single nucleotide polymorphism (SNP) of the L1 gene rs4143815C> G (Gene Bank Acession # : NT_008413.19), rs822336G> C (Gene Bank Acession #: NT_008413.19) and rs822337T> A (Gene Bank # Acession : NT_008413.19) for the diagnosis and prediction of the prognosis of non-small cell lung cancer and its use. The PD-L1 protein may be a known one, for example, a known human-derived sequence may be obtained from a known DB, including, but not limited to, functional equivalents thereof. The selection and application of significant diagnostic markers determines the reliability of diagnostic results. Significant diagnostic markers are those markers that are highly reliable with high validity and consistency in repeated measurements. The non-small-cell lung cancer prognostic markers of the present invention show the same results in repeated experiments with genes whose expression changes either directly or indirectly with the onset of lung cancer, preferably non-small cell lung cancer, Are highly reliable markers that are very large when compared to a few, and are less likely to give false results. Therefore, the diagnosis result based on the result of measuring the expression level of the significant diagnostic marker of the present invention can be reasonably reliable.

The present inventors examined the polymorphisms of the PD - L1 gene in 354 non-small cell lung cancer patients who had undergone surgical resection for stage I, stage II, stage 3A, and evaluated the genotype, overall survival (OS) And disease-free survival (DFS).

The term "total survival (OS)" refers to the period from the day of surgery to the day of death due to any cause or the last follow-up date. DFS refers to the day from surgery to the day of recurrence or death for any cause. The results showed that polymorphism of rs4143815C> G (Gene Bank Accession #: NT_008413.19), rs822336G> C (Gene Bank Accession #: NT_008413.19) and rs822337T> A And there was a significant relationship with overall survival and disease free survival.

Therefore, rs4143815C> G, rs822336G> C, and rs822337T> A SNP in the PD - L1 gene of the present invention can be regarded as independent prognostic markers for patients with non-small cell lung cancer who underwent surgical resection, respectively. An analysis of this may help to determine the group of patients at high risk for poor disease non-small-cell lung cancer prognosis and may help in the therapeutic determination of non-small-cell lung cancer.

As one embodiment of the present invention, the present invention relates to a marker for predicting the survival prognosis (survival rate) of lung cancer, preferably a non - small cell lung cancer patient comprising a polymorphic site of the PD - L1 gene and a marker composition containing the same.

The present invention provides a polynucleotide comprising a polynucleotide of SEQ ID NO: 1 in which the 257th base is C or G and consists of 20 to 100 consecutive DNA sequences containing the base; Or a complementary polynucleotide thereof, to a marker for predicting the survival prognosis of a lung cancer patient and a composition for a marker comprising the same.

The 257th base in the polynucleotide of SEQ ID NO: 1 is present at the 3'-untranslated region of PD-L1 (Programmed cell death-1 ligand, hereinafter referred to as PD-L1) (C > G)), Genebank accession No. &lt; / RTI &gt; Sequence No. 5458001-5459000 in the NT_008413.19 sequence is shown as SEQ ID NO: 1.

Also, the present invention provides a polynucleotide comprising 20 to 100 consecutive DNA sequences comprising the base, wherein the 690th base is G or C in the polynucleotide of SEQ ID NO: 2; Or a complementary polynucleotide thereof, to a marker for predicting the survival prognosis of a lung cancer patient and a composition for a marker comprising the same.

In the polynucleotide of SEQ ID NO: 2, the 690th base exists at the 5'-untranslated region of the PD-L1 gene and corresponds to the -1884th base from the transcription start point, the 7424th base from the start codon, (Rs822336 (G > C)), Genebank accession No. The sequence numbered 5438001-5439000 in the NT_008413.19 sequence is shown as SEQ ID NO: 2.

The present invention also relates to a polynucleotide comprising a polynucleotide of SEQ ID NO: 3 in which the 154th base is T or A and consists of 20 to 100 consecutive DNA sequences containing the base; Or a complementary polynucleotide thereof, to a marker for predicting the survival prognosis of a lung cancer patient and a composition for a marker comprising the same.

In the polynucleotide of SEQ ID NO: 3, the 154th base is present at the 5'-untranslated region of the PD-L1 gene and corresponds to -1349th base from the transcription start point, -6960th base from the start codon. (Rs822337 (T > A)), Genebank accession No. The sequence numbered 5439001-544000 in the NT_008413.19 sequence is shown in SEQ ID NO: 3.

The polynucleotide or its complementary polynucleotide according to the present invention may be composed of at least 20, preferably 20 to 100, more preferably 20 to 50 contiguous bases.

The polynucleotide or its complementary polynucleotide is a polymorphic sequence. A polymorphic sequence refers to a sequence comprising a polymorphic site representing a single base polymorphism in the nucleotide sequence. A polymorphic site is a site in a polymorphic sequence where a single base polymorphism occurs.

Single nucleotide polymorphisms can be included in coding sequences of genes, non-coding regions of genes, or in intergenic regions between genes. SNPs in the coding sequence of a gene do not necessarily cause changes in the amino acid sequence of the target protein due to the degeneracy of the genetic code. SNPs that form the same polypeptide sequence are called synonymous (also called silent mutations) and SNPs that form other polypeptide sequences are said to be non-synonymous. Non-consensual SNPs can be missense or nonsense, and mismatch changes produce other amino acids while nonsense changes form non-mature termination codons. SNPs that are not in the protein-coding region can induce gene silencing, transcription factor binding, or non-coding RNA sequences.

<How to Perform>

The genotyping of the SNP of the present invention can be confirmed by sequencing analysis, sequencing analysis using an automatic sequencer, pyrosequencing, hybridization with a microarray, PCR-RELP (restriction fragment length polymorphism), PCR-SSCP single strand conformation polymorphism (PCR), SSO (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method using PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF / MS method, RCA method rolling circle amplification, HRM (high resolution melting), primer extension, Southern blot hybridization, dot hybridization, and the like.

Further, the results of the SNP polymorphism can be statistically processed using statistical analysis methods commonly used in the art, such as Student's t-test, Chi- continuous variables, categorical variables, odds ratios, and 95% confidence intervals, obtained through linear regression analysis, linear regression line analysis, and multiple logistic regression analysis, % Confidence interval, and so on.

The agent capable of detecting the SNP contained in the marker for lung cancer, preferably non-small cell lung cancer survival prognosis prediction (diagnosis) of the present invention and the marker composition containing the same, comprises the polynucleotide of SEQ ID NO: 1, a polynucleotide consisting of 20 to 100 contiguous bases including rs4143815C> G, rs822336G> C, or rs822337T> A SNP, a complementary polynucleotide thereof, a primer and a probe specifically hybridizing with the polynucleotide May be selected.

In the present invention, the primer or probe that specifically hybridizes with the polynucleotide or its complementary polynucleotide is allelespecific. Allele-specific refers to hybridizing specifically to each allele, that is, hybridizing so that the base of a polymorphic site present in the polymorphic sequence can be specifically discriminated. Here, hybridization is usually carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

In the present invention, a probe means a hybridization probe, and means an oligonucleotide capable of binding sequence-specifically to a complementary strand of a nucleic acid. The hybridization conditions show a significant difference in the intensity of hybridization between alleles and should be sufficiently stringent to hybridize to only one of the alleles. Preferably, the probe of the present invention aligns with the polymorphic site of the polymorphic sequence. This can lead to good hybridization differences between different allelic forms. The probe can be used in a kit such as a microarray for predicting the survival prognosis of lung cancer by detecting alleles, a prediction method and the like. Important probes can be labeled for detection and can be labeled, for example, as radioactive isotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. It is well known in the art to appropriately label such a probe, and can be carried out by a conventional method.

In the present invention, the primer can form a base pair with a template complementary to a base sequence having a short free 3 'hydroxyl group, and functions as a starting point for template strand copying Quot; short sequence &quot; The appropriate length of the primer may vary depending on the purpose of use, but is generally comprised of 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template. The primers can be hybridized to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing the polymorphic site. The primer of the present invention can be used in a kit such as a microarray for predicting the survival prognosis of lung cancer and a prediction method by detecting alleles.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with an analogue, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The present invention relates, in another embodiment, to a microarray for predicting the survival prognosis of lung cancer, preferably non-small cell lung cancer patients, comprising said composition. The microarray may be composed of a conventional microarray except that it comprises the polynucleotide, primer or probe of the present invention. The hybridization of nucleic acids on a microarray and the detection of hybridization results are well known in the art. The detection may be performed, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray, The hybridization result can be detected.

The microarray method can simultaneously study the expression of RNA in thousands or even tens of thousands of genes in tumors, enabling more comprehensive insights into the molecular basis of human disease. It can also be used to assess gene expression patterns, clinical outcomes, and response to chemotherapy regimens in tumor classifications.

In another aspect, the present invention relates to a kit for predicting the survival prognosis of a lung cancer patient comprising the composition.

The kit of the present invention can be used to predict the prognosis of lung cancer by identifying each polymorphic site (SNP) in the PD - L1 gene, which is a predictive marker for the survival prognosis of lung cancer, by identifying the rs4143815C> G, rs822336G> C or rs822337T> have. The kit for predicting the survival prognosis of lung cancer of the present invention includes polynucleotides, primers or probes for identifying rs4143815C> G, rs822336G> C and rs822337T> A SNPs in the PD - L1 gene as well as one or more other A component composition, solution or device may be included.

In one embodiment, the kit of the present invention may be a kit containing the necessary elements necessary for performing PCR. The PCR kit may contain test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq polymerases and reverse transcriptase enzymes, as well as specific polynucleotides, primers or probes specific for the SNPs. , DNase, RNAse inhibitors, DEPC-water and sterile water, and the like.

<Diagnosis and Information Delivery Method>

On the other hand, the present invention, on the other hand, comprises measuring rs4143815C> G, rs822336G> C or rs822337T> A SNP expression levels and / or mutations, preferably frame shift mutations, of the PD - L1 gene based on said finding , Lung cancer, preferably a method for diagnosing and predicting the prognosis of non-small cell lung cancer, or a method for providing information therefor.

The method also provides useful information for the development of a biodegradable polymer patch having an anti-cancer agent for preventing recurrence or metastasis after lung cancer surgery.

In one embodiment, the method of the present invention comprises measuring the level of rs4143815 C> G, rs822336 G> C or rs822337 T> A SNP expression in the PD - L1 gene from a biological sample isolated from a patient; And comparing the rs4143815 C> G, rs822336 G> C, or rs822337 T> A SNP expression level or the level of the protein encoded by the gene in the PD - L1 gene to the expression of the gene of interest in a normal control sample, , Preferably a method for providing information for diagnosis and prediction of non-small-cell lung cancer prognosis.

At this time, if the rs822336C-rs822337A haplotype is two in the PD - L1 gene or the rs4143815 C> G polymorphism is GG in the biological sample isolated from the patient, the risk ratio of overall survival and disease free survival It is determined that it is very high.

The diagnostic methods relate to examining the expression characteristics of particular markers, particularly in relation to non-small cell lung cancer, and the methods disclosed herein are useful for obtaining data and information useful in assessing appropriate or effective therapies for the treatment of patients with non- Efficient, and cost-effective means. &Lt; RTI ID = 0.0 &gt;

The nucleic acid of a lung cancer patient can be obtained from a sample such as tissue, cell, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine obtained from these lung cancer patients, and the nucleic acid sample is synthesized from DNA, mRNA or mRNA lt; / RTI &gt;

The nucleic acid of the lung cancer patient can be carried out by conventional methods such as phenol / chloroform extraction method and protease K treatment method, and the target nucleic acid can be obtained by amplifying and purifying the target nucleic acid by PCR.

The present invention can also provide information for determining the dose of the anticancer agent and the method of administration necessary for preventing recurrence or metastasis after lung cancer, preferably non-small cell lung cancer surgery.

That is, the present invention confirms rs4143815 C> G, rs822336 G> C, or rs822337 T> A polymorphism of the PD - L1 gene from a biological sample isolated from non-small cell lung cancer patients, The type, amount and concentration of the anticancer drug to be administered after the anticancer drug administration method may be applied differently according to the kind of the lung cancer.

Thus, the present invention includes all uses as PDs and PDs in lung cancer, preferably non-small cell lung cancer, using the rs4143815 C> G, rs822336 G> C or rs822337 T> A expression profiles of the PD - L1 gene do.

Therefore, the prediction technique of lung cancer survival prognosis according to the present invention can increase the survival rate of lung cancer patients by easily evaluating the prognosis of patients with lung cancer and targeting the means and treatment for selecting and evaluating treatment methods.

< Example >

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Unless otherwise indicated, nucleic acids are written in 5'3 'orientation from left to right. The numerical ranges recited in the specification include numerals defining the ranges and include each integer or any non-integral fraction within a defined range. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, the preferred materials and methods are described herein.

1. Selection of research subjects

We retrospectively reviewed 354 patients with non - small cell lung cancer who underwent surgical resection between September 1998 and August 2007 at Kyungpook National University Hospital. Tumors originating from the same patient and non - tumor lung tissue were received from the Human Resources Bank of Kyungpook National University Hospital, which is supported by the Ministry of Health, Welfare and Family Affairs. All patients received consent before surgery. All human derivatives used are provided by KNHH, with approval from the Clinical Trials Committee. All the patients included in the study were Koreans. Patients did not receive chemotherapy or radiotherapy before surgery. The pathologic stage of the tumor was determined according to the International System for Staging Lung Cancer.

2. Patient characteristics and clinical Predictor  Association analysis

The relationship between clinicopathologic characteristics and overall survival of the patients is shown in Table 1. By univariate analysis, age (log-rank P [ P _{L -R} ] = 0.006) and stage ( P _{L -R} <0.0001) were significantly associated with overall survival. There was no correlation between overall survival and sex, smoking, histologic type, and adjuvant therapy.

3. Selection of single nucleotide polymorphism and genotype analysis

The NCBI database ( http://www.ncbi.nlm.nih.gov/SNP ) and related literature were searched to confirm the potential functional polymorphisms in PD-1 , PD-L1 and CTLA-4 genes. The selection of single nucleotide polymorphisms prioritized whether it was located in the coding region of the promoter or untranslated region or gene, whether it was previously associated with cancer, or had evidence that it was functionally important. All 12 polymorphisms were selected, with Hapmap's Japanese genotypic data (JTP) with a minority allele frequency (MAF) greater than 5%, except for the linkage disequilibrium coefficient r ² greater than 0.8.

Ten polymorphisms were analyzed by genotyping using SEQUENOMS MassARRAY iPLEX assay (SEQUENOM Inc., San Diego, Calif.), And rs4143815 and rs36084323 were genotyped by restriction polymorphism analysis.

4. Analysis of the relationship between single nucleotide polymorphism and survival outcome

The log rank for single nucleotide polymorphism identification number, base change, frequency of minor alleles, significance ( P-value for HWE) and total survival (OS) of 12 single nucleotide polymorphisms The log-rank P values are shown in Table 2. Of the 12 monoclonal polymorphisms examined, rs4143815C> G, rs822336G> C, and rs822337T> A of PD-L1 were corrected (HR [aHR] = 2.09, 95% confidence interval = 1.40-3.12, P = 0.0003; aHR = 1.87, 95% CI = 1.09-3.21, P = 0.02; aHR = 1.75, 95% CI = 1.07-2.88, P = 0.03, respectively recessive model (recessive model)) age, sex, smoking status, the arm When adjusted for tissue type, stage, and adjuvant therapy, overall survival was significantly associated with poor outcome. Three predominant haplotypes account for 100% of the subject, rs822336G> C, rs822337T> A, and | D | = 1.0, r ² = 0.71, and linkage disequilibrium (LD). In agreement with each genotypic analysis, the rs822336C-rs822337A haplotype (haplotype 3, ht3), which contains a mutant allele in both loci, has been reported to have other haplotypes, rs822336G-rs822337T (haplotype 1, ht1) and rs822336G-rs822337A (AHR = 1.31, 95% CI = 0.99-1.71, P = 0.06, Table 3) in comparison with the haplotype 2, ht2, but was associated with poor overall survival. Therefore, the present inventors confirmed the survival result of patients having ht3. For this analysis, the 6 haplotypes derived from the three haplotypes were categorized into three groups according to the number of occurrences of 0, 1, and 2 ht3 (ie, the haplotype 1 [dt1], ht1-2 / ht1-2; dt2, ht1-2 / ht3; dt3, ht3 / ht3). As with genotype analysis, patients with two ht3 (dt3) were most likely to have a significant association between genotypic and survival in recessive gene models, and patients with two ht3 (dt3) (AHR = 1.84, 95% confidence interval = 1.07-3.16, P = 0.03, Table 3), as compared with patients with one or more dt1 + dt2 1D).

5. From survival results rs4143815C > G, rs822336G > C, and rs822337T > Combination Effect of A Combined effects ) Confirm

We investigated the combined effects of rs4143815C> G, rs822336G> C, and rs822337T> A, which are significantly associated with overall survival in each single-nucleotide polymorphism analysis in survival outcomes, by exploratory analysis ). Because dt3 had two ht3s and rs822336G> C and rs822337T> A and rs4143815 GG were associated with poor survival outcomes, dt3 and rs4143815 GG were considered to be a bad genotype. So we evaluated the binding effect as a group of patients made based on the number of bad genotypes of each patient. Overall survival decreased as the number of bad genotypes increased ( P trend = 0.0003), as compared to the reference population without any bad genotype. Based on multivariate analysis, patients with two poor genotypes were found to be significantly associated with poor overall survival (p <0.001), compared with patients without a single bad genotype (aHR = 2.84, 95% confidence interval = 1.445. 63, P = 0.003; Table 4 and FIG. 1E).

6. rs822336G> C and rs822337T> A PD-L1 Effect of Promoter Activation

The effect of monoclonal rs822336G> C and rs822337T> A polymorphisms on the promoter activation of the PD-L1 gene was investigated using the luciferase assay.

1982bp (-1884 to +98) fragments including rs822336G> C and rs822337T> G were synthesized by PCR using genomic DNA. Including the Kpn restriction enzyme recognition site was used as a forward primer (5- GG GGTACC GGGTA GAAACAGG TGGGAAAG- 3) and Xho restriction enzyme recognition site on the reverse primer contains (5- CCG CTCGAG CTACCTGCAGGCGGACAGAA -3). The PCR product was cloned by insertion into the Kpn / Xho site of the pGL3-basic plasmid. The sequence of all clones was confirmed by DNA sequencing.

H1299, a non-small cell lung cancer cell line, was purchased from the Korean Cell Line Bank in Seoul, Korea, and a DNA fingerprinting method using short tandem repeats in a Korean cell line bank, Respectively. The pRL-SV40 vector (Promega, Madison, WI, USA) and the pGL3-basic plasmid were transfected into H1299 cells using Effectene trasfection reagent (Qiagen, Hilden, Germany). These cells were removed 48 hours after transformation. Cell lysates were prepared according to Promega's instructions. The activity of luciferase was measured using a Lumat LB953 luminometer (EG &amp; G Berthhold, Bad Wildbad, Germany) and the results were normalized using the activity of pRL-SV40 Renilla luciferase. All experiments were repeated 3 times.

The higher promoter activation of rs822336G-rs822337T haplotype in H1299 cells compared to the rs822336C-rs822337A haplotype suggests that rs822336G-rs822337T is associated with higher PD-L1 expression.

7. Statistical analysis

Differences in gene distribution due to clinicopathologic factors in patients were compared using two tests. Overall survival (OS) was calculated from the day of surgery to the day of death for any cause or until the last follow-up date. Survival analysis was calculated using the Kaplan-Meier method. Differences in overall survival according to genotype were compared using a log-rank test. Hazard ratios (HRs) and 95% confidence intervals (CIs) were calculated using multivariate Cox proportional hazards models and were analyzed by age, gender, smoking status, Type and pathologic stage, and adjuvant therapy. All analyzes were performed using the Statistical Analysis System for Windows (version 9.2) [SAS Institute, USA] for the Windows program.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> KYUNGPOOK NATIONAL UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Method for predicting survival of patients with non-small cell          lung cancer using PD-L1 polymorphism <130> PN1503-080 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 1000 <212> DNA <213> 5458001-5459000 of Gene Bank Acession #: NT_008413.19 from Homo sapiens <400> 1 aaaatggaac ctggcgaaag cagaggagga gaatgaagaa agatggagtc aaacagggag 60 cctggaggga gaccttgata ctttcaaatg cctgaggggc tcatcgacgc ctgtgacagg 120 gagaaaggat acttctgaac aaggagcctc caagcaaatc atccattgct catcctagga 180 agacgggttg agaatcccta atttgagggt cagttcctgc agaagtgccc tttgcctcca 240 ctcaatgcct caatttcttt tctgcatgac tgagagtctc agtgttggaa cgggacagta 300 tttatgtatg agtttttcct atttattttg agtctgtgag gtcttcttgt catgtgagtg 360 tggttgtgaa tgatttcttt tgaagatata ttgtagtaga tgttacaatt ttgtcgccaa 420 actaaacttg ctgcttaatg atttgctcac atctagtaaa acatggagta tttgtaaggt 480 gcttggtctc ctctataact acaagtatac attggaagca taaagatcaa accgttggtt 540 gcataggatg tcacctttat ttaacccatt aatactctgg ttgacctaat cttattctca 600 gacctcaagt gtctgtgcag tatctgttcc atttaaatat cagctttaca attatgtggt 660 agcctacaca cataatctca tttcatcgct gtaaccaccc tgttgtgata accactatta 720 ttttacccat cgtacagctg aggaagcaaa cagattaagt aacttgccca aaccagtaaa 780 tagcagacct cagactgcca cccactgtcc ttttataata caatttacag ctatatttta 840 ctttaagcaa ttcttttatt caaaaaccat ttattaagtg cccttgcaat atcaatcgct 900 gtgccaggca ttgaatctac agatgtgagc aagacaaagt acctgtcctc aaggagctca 960 tagtataatg aggagattaa caagaaaatg tattattaca 1000 <210> 2 <211> 1000 <212> DNA <213> 5438001-5439000 of Gene Bank Acession #: NT_008413.19 from Homo sapiens <400> 2 gaggcagaag gaaggatggt actgataaat cagccaaatt agatggaaga aagcgaatta 60 cagctgtact tgcaaagaac tcttggctc ttttttccct taaatattaa atcactagtt 120 ttcaaaactt caaatgtgaa catgactcac ctgaggacaa tgttaaaatg ttgacctcca 180 agaccctgcc cccaagtttg gatcccaggc agaaccctgg aatctgtatt ttaaacatta 240 accccaagtc gagtgtaatg caagtaacca tcagagacac tctgagaaac agcacattgg 300 caatgatgaa tttatatgtc taaaaatgaa tagagtagat gttacatgaa taggaagtgg 360 tggtattcaa gatgaccata gtatctagct cttcagccct ggctccccac tgctcttctc 420 ccatctcagc acttctccat ctatttcgtc caaataaaaa aattcacaca gagtttcagg 480 acttaacccc ccactcatta accatctgtt ttgctttaca tatttttctg aggtaataaa 540 atttctcttt ttctaaacac agcctgtttt tcaatctccg ggtagttgat caattgtatg 600 ggaaaatgaa tggctgaagg gtagaaacag gtgggaaaga tgaacaaaaa cacgaatcct 660 cacattacta atacgcaaat cactgagcag caagctgagc aaataccctc aattcccatc 720 agcaacttta gagaaaggca aattccgttt gcctcattga tcatttaggt agaccctgaa 780 cactgctttc ataaaacaaa aacaaaatac ccatccccag tttaaaaaat tattcataga 840 tcatccaggc catctaggag gatatgattt aatcctggct acttggtaaa ttatttgccc 900 aagttaactc agctagttag tggtagatgg ctctgaagcc agttgttttt ttttgttttg 960 ttttttgcag acctcaagag tcatgatgaa ctagcagatc 1000 <210> 3 <211> 1000 <212> DNA <213> 5439001-5440000 of Gene Bank Acession #: NT_008413.19 from Homo sapiens <400> 3 ataaagttta tgccctgggt cttgaccatt tttagaaaaa taaaacatta aatgaaaata 60 tcagagggca ttgcagatag tagatctaag tattttttca tgaaacttgt tgtacatgtg 120 tgtgtcatac acagactata tatatgcagt acctgtaaac tgtattgcca cataatgtct 180 atattttcct agaggtcaca gtcaccaaag ttgggaagtc acccaacttc gggaactttg 240 ggaagtcacc caaacttaca gtcaccaaaa ttgctctatt ctactatgtg acctcaaaag 300 tgatttgaaa gaaggaacat ctgagctggg cccaaaccct attgcaattt tattggggcc 360 aaagagaact ccatgctcct gccaaatcaa ggcagtgtca gcctcaataa tttcccagat 420 aaaaataaaa atctgtgata caatcagaat gtgaaaattc ttattttgga agcaaatgtc 480 ataaccaatg caagggctat ctcaatattc attcattatg cagtattttg aactgcagtt 540 gaaatgaata agaaggaaag gcaaacaacg aagagtccaa tttctcaatt tagaaaaaga 600 gaaaaaaaag aaaagggagc acacaggcac ggtggctcaa gcctgtaata tcagcacttt 660 ggcggatcac ttgaggtcaa ggagttcgag aaaagagagc acctagaagt tcagcgcggg 720 ataatactta agtaaattat gacaccatcg tctgtcatct tgggcccatt cactaaccca 780 aagctttcaa aagggctttc ttaaccctca cctagaatag gcttccgcag ccttaatcct 840 tagggtggca gaatatcagg gaccctgagc attcttaaaa gatgtagctc gggatgggaa 900 gttcttttaa tgacaaagca aatgaagttt cattatgtcg aggaactttg aggaagtcac 960 agaatccacg atttaaaaat atatttccta ttatacaccc 1000

Claims (10)

A composition for markers for diagnosing and predicting the prognosis of non-small cell lung cancer, which contains a single nucleotide polymorphism (SNP) of the PD-L1 gene located at the 154th base in the nucleotide sequence shown in SEQ ID NO: 3. delete delete delete The method according to claim 1,
Wherein the non-small cell lung cancer is a surgically resected non-small cell lung cancer tissue or a non-small cell lung cancer cell. A kit for predicting the survival prognosis of a patient with non-small cell lung cancer comprising the composition according to claim 1 or 5. A microarray for predicting the survival prognosis of patients with non-small cell lung cancer comprising the composition according to claims 1 or 5. The nucleotide sequence selected from the group consisting of the 257th base in the nucleotide sequence shown in SEQ ID NO: 1, the 690th base in the nucleotide sequence shown in SEQ ID NO: 2, and the 154th nucleotide in the nucleotide sequence shown in SEQ ID NO: 3 Comprising the steps of: identifying a polymorphism in the lung cancer;
Wherein the 690th base of SEQ ID NO: 2 is C, the haplotype of the 154th base of SEQ ID NO: 3 is A, and the genotype of the 257th polymorphism of SEQ ID NO: 1 is GG. &Lt; / RTI &gt; delete 9. The method of claim 8, wherein the lung cancer is non-small cell lung cancer.

Images