JP6765665B2 - Deterrified plants, methods of producing sterile plants, and vectors - Google Patents

Description

The present invention relates to sterile plants, methods for producing sterile plants, and vectors.

In order to control the cultivation of newly created varieties and the spread of their genetic information, it is desired to make plants sterile. As an example of the method for sterilizing a plant, for example, a method for sterilizing a plant by controlling the formation of a male stalk that produces pollen and a female stalk that pollinates pollen has been attempted.

Torenia is a useful plant that is widely cultivated all over the world for viewing.
Regarding the regulation of the formation of flower organs of Torenia, Non-Patent Document 1 reports that the TfFARINELLI (TfFAR) gene and the TfPLENA1 (TfPLE1) gene, which are class C genes of Torenia, have been isolated.
In Non-Patent Document 2, a transposon was inserted into the expression region of the TfFAR gene to obtain a plant in which the expression of the TfFAR gene was reduced, and in this plant, some of the multiple male rods were converted into petals. It is disclosed that

Narumi, T. et al. “Chimeric AGAMOUS repressor induces serrated petal phenotype in Torenia fournieri similar to that induced by cytokinin application” Plant Biotechnology, 2008, Vol. 25, p.45-53 Takaaki Nishijima, Tomoya Niki, "A novel mutant" Yaesaki "that appeared in the progeny of self-fertilization of the easily denatured strain" Freckles "of Torenia, 2013, Horticultural Studies, 12 (Another 1), p.183

Non-Patent Document 1 describes that a plant in which the function of the TfFAR gene was suppressed was created, but this plant had only a notch in the edge of the petal, and similarly, the function of the TfPLE gene was A suppressed plant was created, but it is stated that this plant only had cuts in the edges of the petals. Therefore, a completely sterile plant has not been obtained.
Further, in Non-Patent Document 2, a plant in which a transposon is inserted into the expression region of the TfFAR gene and the expression of the TfFAR gene is reduced is obtained, but there is a description that this plant can be crossed. No completely sterile plant has been obtained.

The present invention has been made in view of the above circumstances, and an object of the present invention is to provide a sterile plant, a method for producing a sterile plant, and a vector by controlling the morphogenesis of a flower organ.

The present invention is as follows.

[1] The function of any of the following FAR genes (A) to (C) is deleted or suppressed.
It is a plant of the Azetogarashi family in which the function of any of the following PLE genes (D) to (F) is deleted or suppressed , and the fertility of all the flower organs possessed by the individual plant is lost. Fertile plant.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which 1 to 30 amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) 1 to 30 amino acids have been deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to
[2] A form in which the pistil is flower-covered and the stamen is flower-covered (however, the flower cover is formed concentrically toward the inside of the formation region centering on the original carpel formation region. The completely sterile plant according to the above [1], wherein the fertility of all the flower organs possessed by the individual plant is lost due to the double-flowered morphology in which the wall of the region is repeated in two or more layers.
[ 3 ] The function of the FAR gene is deleted or suppressed by having a modification site in the FAR gene and / or its promoter.
The completely sterile plant according to the above [1] or [2] , wherein the function of the PLE gene is deleted or suppressed by having a modification site in the PLE gene and / or its promoter.
[ 4 ] The function of the FAR gene has a base sequence complementary to the sense sequence which is the mRNA sequence of the FAR gene, and is deleted by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene. Or it is suppressed
The function of the PLE gene is deleted or suppressed by introducing a nucleic acid having a base sequence complementary to the sense sequence which is the mRNA sequence of the PLE gene and deleting or suppressing the expression of the PLE gene. The completely sterile plant according to the above [1] or [2] .
[ 5 ] The nucleic acid that suppresses the expression of the FAR gene is any of the following nucleic acids (g) to (i).
The completely sterile plant according to the above [ 4 ], wherein the nucleic acid that suppresses the expression of the PLE gene is any of the following nucleic acids (j) to (l).
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene.
(I) A sense strand or a part thereof consisting of a base sequence having 90 % or more identity with the base sequence shown in SEQ ID NO: 7, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. , A nucleic acid capable of suppressing the expression of the FAR gene,
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene.
(L) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence shown in SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. Nucleic acid containing, and capable of suppressing the expression of the PLE gene [6] In a plant of the family Azetogarashi
The function of any of the following FAR genes (A) to (C) is deleted or suppressed,
The following is function deficiency or inhibition of any of the PLE gene (D) ~ (F), wherein Ru to lose the fertility of all floral organs having individual plants are fully FuMinoruka method production of plants.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which 1 to 30 amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) 1 to 30 amino acids have been deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to
[7] A form in which the pistil is flower-covered and the stamen is flower-covered (however, the flower cover is formed concentrically from the original carpel formation region toward the medial side of the formation region. The method for producing a completely sterile plant according to the above [6], wherein the fertility of all flower organs possessed by the individual plant is lost by (excluding the double-flowered form in which the wall of the region is repeated in two or more layers).
[ 8 ] The function of the FAR gene is deleted or suppressed by modifying the FAR gene and / or its promoter.
The method for producing a completely sterile plant according to the above [6] or [7] , wherein the function of the PLE gene is deleted or suppressed by modifying the PLE gene and / or its promoter.
[9] the function of the FAR gene, has a sense sequence complementary to the nucleotide sequence is the sequence of mRNA of the FAR gene, by introducing a nucleic acid to be deficient or suppressed expression of the FAR gene into the plant , Missing or suppressing,
The function of the PLE gene, has a sense sequence complementary to the nucleotide sequence is the sequence of mRNA of the PLE gene, by introducing a nucleic acid to be deficient or suppressed expression of the PLE genes into the plant, deficient or The method for producing a completely sterile plant according to the above [6] or [7], which is suppressed.
[ 10 ] The nucleic acid that suppresses the expression of the FAR gene is any of the following nucleic acids (g) to (i).
The method for producing a completely sterile plant according to the above [ 9 ], wherein the nucleic acid that suppresses the expression of the PLE gene is any of the following nucleic acids (j) to (l).
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene.
(I) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the FAR gene,
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene.
(L) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the PLE gene.
[11] The function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene into the plant.
The function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene into the plant.
The nucleic acid that deletes or suppresses the function of the FAR gene is the nucleic acid of the following (s) for modifying the FAR gene and / or its promoter.
The completely sterile plant according to the above [8] , wherein the nucleic acid lacking or suppressing the function of the PLE gene is the nucleic acid of the following (t) for modifying the PLE gene and / or its promoter . Creation method.
(S) A guide RNA containing a base sequence selected from the sequence of the FAR gene and / or its promoter.
(T) A guide RNA containing a base sequence selected from the sequence of the PLE gene and / or its promoter.

According to the present invention, a plant having excellent sterility can be obtained.

It is a figure which shows typically the region used for the silencing vector among TfFAR cDNA and TfPLE cDNA in an Example. It is a figure which shows typically the expression cassette produced in an Example. It is a map diagram of the vector used in the Example. It is a map diagram of the vector used in the Example. It is a photograph which shows the expression analysis result of the TfFAR / TfPLE gene in an Example. It is a photograph comparing the flower morphology of the TfFAR / TfPLE-IR recombinant torenia and the control plant prepared in the example. It is a photograph comparing the flower morphology of the TfFAR / TfPLE-IR recombinant torenia and the control plant prepared in the example. It is a figure which shows typically the expression cassette produced in an Example. It is a figure which shows typically the expression cassette produced in an Example. It is a map diagram of the vector used in the Example. It is a photograph comparing the flower morphology of TfFAR target 1 & 2 / TfPLE target 1 & 2 genome editing torenia and the control plant prepared in the example. It is a photograph which shows the expression analysis result of the TfFAR / TfPLE gene in an Example.

≪Deterred plants≫
The sterile plant of the present invention
The function of any of the following FAR genes (A) to (C) is deleted or suppressed, and
The function of any of the following PLE genes (D) to (F) is deleted or suppressed.

(A) Gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which one to several amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional regulation function (C) Encoding a protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional regulatory function gene

(D) Gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) Amino acid in which one to several amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of a sequence and encoding a protein having a transcriptional control function (F) Encoding a protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcriptional control function gene

<FAR gene, PLE gene>
The ABC model is known as a model for explaining the flower development of angiosperms. In the ABC model, the development of flower organs is controlled by the expression patterns of class A gene, class B gene, and class C gene. In the region of expression of the class A gene alone, 萼 is formed, and in the region of expression of the class A gene and the class B gene, petals are formed. A pistil is formed in the expression region of the class B gene and the class C gene, and a carpel is formed in the expression region of the class C gene alone. AGAMOUS (AG) of Arabidopsis thaliana is known as a class C gene.
However, the above model was clarified in studies targeting some plant species such as Arabidopsis thaliana and snapdragon, and whether the above model can be applied to all other plant species as well, and which genes It is unknown whether it functions as a gene for each class.

In Torenia, it has been reported that the TfFAR gene and the TfPLE gene, which are considered to be one of the class C genes, have been isolated, and plants in which the functions of these genes have been suppressed have been produced. However, the observed flower morphological abnormalities were extremely minor.

The inventors cloned the FAR and PLE genes from Torenia fournieri, as shown in Examples below. Furthermore, the inventors have found that in plants into which a nucleic acid that suppresses the expression of the FAR gene of Torenia and a nucleic acid that suppresses the expression of the PLE gene of Torenia have been introduced, male and female torenia are petalized and completely sterile. We have found that a modified plant can be obtained.

The FAR gene according to the present invention is any of the above-mentioned genes (A) to (C).

In general, it is known that a protein having some physiological function can be deleted, substituted and / or added with one to several amino acids without impairing its original function.
In the protein (B), the number of amino acids in which 1 to several amino acids may be deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1 is preferably 1 to 30. 1 to 20 are more preferable, 1 to 10 are even more preferable, and 1 to 5 are particularly preferable.

In the protein (C), the identity with the amino acid sequence represented by SEQ ID NO: 1 is 80% or more and less than 100%, preferably 90% or more and less than 100%, and 95% or more and less than 100%. It is more preferable that it is 98% or more and less than 100%.
The identity between amino acid sequences can be determined by using various known homology search programs. For the identity between the amino acid sequences in the present invention, the value obtained by the known homology search software BLASTP can be adopted. For the identity between the amino acid sequences in the present invention, a value obtained by commercially available genetic information processing software GENETYX can be adopted as shown in Examples described later.

The PLE gene according to the present invention is any of the genes (D) to (F) described above.

In general, it is known that a protein having some physiological function can be deleted, substituted and / or added with one to several amino acids without impairing its original function.
In the protein (E), the number of amino acids in which 1 to several amino acids may be deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2 is preferably 1 to 30. 1 to 20 pieces are more preferable, 1 to 10 pieces are further preferable, and 1 to 5 pieces are further preferable.

In the protein (F), the identity with the amino acid sequence represented by SEQ ID NO: 2 is 80% or more and less than 100%, preferably 90% or more and less than 100%, and 95% or more and less than 100%. It is more preferable that it is 98% or more and less than 100%.
The identity between amino acid sequences can be determined by using various known homology search programs. For the identity between the amino acid sequences in the present invention, the value obtained by the known homology search software BLASTP can be adopted. For the identity between the amino acid sequences in the present invention, a value obtained by commercially available genetic information processing software GENETYX can be adopted as shown in Examples described later.

The proteins (A) to (F) have a transcriptional control function. The transcription control function is a function possessed by a transcription factor. Whether or not the protein has a transcription control function can be examined by a method using a known transcription factor measuring reagent or the like.
The proteins (B) and (C) preferably have a transcriptional control function equivalent to that of the protein (A), and the proteins (E) and (F) are equivalent to the protein of (D). It is preferable to have a transfer control function of.

The protein consisting of the amino acid sequence represented by SEQ ID NO: 1 in (A) may be a protein consisting only of the amino acid sequence, and is an arbitrary sequence in the protein consisting of the amino acid sequence as long as it has a transcriptional control function. May be added.
The protein consisting of the amino acid sequence represented by SEQ ID NO: 2 in (D) may be a protein consisting only of the amino acid sequence, and is an arbitrary sequence in the protein consisting of the amino acid sequence as long as it has a transcriptional control function. May be added.
Examples of the arbitrary sequence include a linker sequence, a tag sequence, a modified sequence for protein stabilization, and the like.

The protein consisting of the amino acid sequence represented by SEQ ID NO: 1 can be produced by a known method. Further, the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 can be produced by a known method. For example, a polynucleotide consisting of a base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 may be incorporated into an expression vector and expressed to synthesize the polynucleotide. Alternatively, a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 may be synthesized by a polypeptide synthesizer.

The FAR gene according to the present invention encodes the FAR protein according to the present invention, and is any of the following polynucleotides (a) to (c). Here, a gene is a concept including an intron and an exon. The FAR gene is said to have a promoter region in the second intron located on the 3'side of the MADS box domain, which is a DNA binding domain.
(A) Polynucleotide consisting of a base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (b) One to several amino acids are deleted, substituted and / in the amino acid sequence represented by SEQ ID NO: 1. Alternatively, a polynucleotide consisting of a base sequence encoding a protein having a transcriptional control function consisting of an added amino acid sequence (c) Amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function Polynucleotide consisting of a base sequence encoding a protein having

The PLE gene according to the present invention encodes a PLE protein according to the present invention, and is any of the following polynucleotides (d) to (f). Here, a gene is a concept including an intron and an exon. The PLE gene is said to have a promoter region in the second intron located on the 3'side of the MADS box domain, which is a DNA binding domain.
(D) Polynucleotide consisting of a base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (e) One to several amino acids are deleted, substituted and / in the amino acid sequence represented by SEQ ID NO: 2. Alternatively, a polynucleotide consisting of a base sequence encoding a protein having a transcriptional control function consisting of an added amino acid sequence (f) Amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcriptional control function Polynucleotide consisting of a base sequence encoding a protein having

The proteins in the polynucleotides shown in (a) to (f) are the same as the proteins described in the genes shown in (A) to (F).

The base sequence encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 in (a) may be the base sequence represented by SEQ ID NO: 3, or the base sequence represented by SEQ ID NO: 40. There may be.
The base sequence encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 in (d) may be the base sequence represented by SEQ ID NO: 4, or the base sequence represented by SEQ ID NO: 41. There may be.

The polynucleotide according to the present invention can be produced by a known method. The DNA encoding the FAR protein according to the present invention is, for example, PCR of the DNA encoding the FAR protein according to the present invention using the obtained cDNA library as a template and a primer designed based on the nucleotide sequence of SEQ ID NO: 3 or the like. It can be amplified and obtained by such means.

In the FAR gene and PLE gene according to the present invention, "the function of a gene is deleted or suppressed" means that the activity of the gene product is deleted or suppressed by controlling the gene or its expression. Alternatively, it means that the expression of the gene is deleted or suppressed.
For example, a plant in which the production of a functional gene product is deleted or suppressed may be obtained by artificially modifying or mutating the genome of the gene of interest. For example, there is a method of screening and obtaining a plant in which the function of a gene of interest is deleted or suppressed by treatment with a mutagen. In addition, for example, a plant in which the production of a functional gene product is deleted or suppressed by artificially modifying or mutating the genome of a target gene by a gene targeting method, genome editing technology, transgenic, or the like. May be obtained. The target genes are the FAR gene and the PLE gene according to the present invention.
Genome editing techniques include, for example, the CRISPR-Cas system and other techniques capable of modifying zinc finger nucleases, TALENs, and DNA sequences.
Alternatively, a plant in which the production of a gene product is deleted or suppressed may be obtained by artificially introducing a nucleic acid that deletes or suppresses the expression of the gene of interest.
In the sterile plant of the present invention, for each of the FAR gene and the PLE gene according to the present invention, the degree of deficiency or suppression of the activity of the gene product, or the degree of deficiency or suppression of the expression of the gene is the plant body. It suffices as long as the sterility of the plant is achieved, and it is preferable that the complete sterility of the plant is achieved.
In the sterile plant of the present invention, for each of the FAR gene and the PLE gene according to the present invention, the site where the activity of the gene product is deleted or suppressed, or the site where the expression of the gene is deleted or suppressed is determined. It suffices as long as the sterility of the plant is achieved, and it is preferable that the complete sterility of the plant is achieved. For example, plant sterility or complete sterility may be achieved by specifically deleting or suppressing the activity of the gene product in the flower.

In the present invention and the present specification, sterility means that the fertility of some or all of the flower organs possessed by an individual plant is lost. Female sterility is the loss of fertility of some or all of the flower organs of an individual plant. Male sterility is the loss of fertility of some or all of the flower organs of an individual plant. Complete sterility is the loss of the fertility of all male and female flower organs of an individual plant.
The sterility of male squirrels is due to the fact that male squirrels are not formed normally and pollen is not produced, the male squirrels are replaced by other organs and pollen is not produced, and pollen is produced but fertility. Some are due to not having it. Similarly, the sterility of females is due to the improper formation of females, the replacement of females with other organs, and the formation of females but not fertility. Things etc. can be mentioned.
The sterility on the male side may be examined by morphological observation, such as the replacement of the male rod with other organs such as petals, and it is also easy to determine whether seeds are formed by crossing with the female of a normal individual. You can look it up. The sterility on the female side may be examined by morphological observation, such as the replacement of the female vine with other organs such as petals, and it is also easy to determine whether seeds are formed by crossing with the male vine of a normal individual. You can look it up.

In the present invention, the term "sterile plant" is used not only for a plant but also for a cell as long as it is sterile when the plant is produced. The cell may be in a tissue or organ state. In the present invention, the sterile plant may be an organism or cell of a progeny or a clone thereof. For example, examples of the cloned plant include plants obtained by cuttings, cuttings and the like.

In the sterile plant of the present invention, it is preferable that the function of the FAR gene is deleted or suppressed by modifying the FAR gene and / or its promoter.
In the sterile plant of the present invention, it is preferable that the function of the PLE gene is deleted or suppressed by modifying the PLE gene and / or its promoter.

The sterile plant of the present invention
The function of the FAR gene is deleted or suppressed by having a modification site in the FAR gene and / or its promoter.
It is preferable that the function of the PLE gene is deleted or suppressed by having a modification site in the PLE gene and / or its promoter.

One embodiment of a nucleic acid for modifying a gene and / or its promoter includes nucleic acids used in the CRISPR-Cas system.
Examples of the nucleic acid for modifying the FAR gene and / or its promoter include the following nucleic acids (s).
(S) A guide RNA containing a base sequence selected from the sequence of the FAR gene and / or its promoter.
Examples of the nucleic acid for modifying the PLE gene and / or its promoter include the following nucleic acid (t).
(T) A guide RNA containing a base sequence selected from the sequence of the PLE gene and / or its promoter.

Guide RNA is a guide RNA in the CRISPR-Cas system. The sequence linked as a part of the guide RNA can be designed in consideration of the presence of the PAM sequence, the cleavage activity of the nucleic acid of CRISPR-Cas, and the like.

In the nucleic acid of (s), the sequence of the FAR gene and / or its promoter linked as a part of the guide RNA is, for example, one or more sequences as appropriate based on the sequence of the FAR gene and / or its promoter. It is designable and one or more sequences can be used as appropriate. When using two or more sequences, they can be used in combination as appropriate. The sequence may be, for example, a sequence of consecutive 17 to 24 bases in the sequence of the FAR gene represented by SEQ ID NO: 40, and the base sequence represented by SEQ ID NO: 26 and / or SEQ ID NO: 29 is preferable. It can be exemplified as a thing. If the FAR gene and / or its promoter can be modified, one to several bases in the base sequence represented by SEQ ID NO: 26 or 29 can be used instead of the base sequence represented by SEQ ID NO: 26 or 29. May consist of a deleted, substituted and / or added base sequence.

In the nucleic acid of (t), the sequence of the PLE gene and / or its promoter linked as a part of the guide RNA is, for example, one or more sequences as appropriate based on the sequence of the PLE gene and / or its promoter. It is designable and one or more sequences can be used as appropriate. When using two or more sequences, they can be used in combination as appropriate. The sequence may be, for example, a sequence of consecutive 17 to 24 bases in the sequence of the PLE gene represented by SEQ ID NO: 41, and the base sequence represented by SEQ ID NO: 32 and / or SEQ ID NO: 35 is preferable. It can be exemplified as a thing. If the PLE gene and / or its promoter can be modified, one to several bases in the base sequence represented by SEQ ID NO: 32 or 35 can be used instead of the base sequence represented by SEQ ID NO: 32 or 35. May consist of a deleted, substituted and / or added base sequence.

Here, the number of two or more sequences that can be appropriately designed as a part of the guide RNA may be 2 to 4 per gene and its promoter, and 2 is preferable.
In the base sequences represented by SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32 and SEQ ID NO: 35, the one to several may be 1 to 3 or 1 to 2. It may be one.

In the sterile plant of the present invention, it is preferable that the deletion or suppression of the function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene. ..
In the sterile plant of the present invention, it is preferable that the deletion or suppression of the function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene. ..

The sterile plant of the present invention
The function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene.
It is preferable that the function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene.

Examples of nucleic acids that suppress gene expression include RNAi-inducible nucleic acids, antisense nucleic acids, and ribozymes. Examples of RNAi-inducible nucleic acids include siRNA, miRNA, shRNA, and nucleic acids serving as precursors thereof.

In the present invention, the term nucleic acid is used to include not only RNA and DNA, but also nucleic acid analogs such as LNA, peptide nucleic acid (PNA), and mixtures thereof.

Examples of the antisense nucleic acid include a nucleic acid having a base sequence complementary to the sense sequence, which is the sequence of mRNA of the gene to be suppressed.
The base sequence represented by SEQ ID NO: 5 is the base sequence of the cDNA of the FAR gene according to the present invention. In the base sequence represented by SEQ ID NO: 5, the 759th to 1021st regions are the 3'UTR regions.
An antisense nucleic acid that suppresses the expression of the FAR gene according to the present invention can be designed by those skilled in the art based on the nucleotide sequence represented by SEQ ID NO: 5.
The base sequence represented by SEQ ID NO: 6 is the base sequence of the cDNA of the PLE gene according to the present invention. In the base sequence represented by SEQ ID NO: 6, the 784th to 999th regions are 3'UTR regions.
An antisense nucleic acid that suppresses the expression of the PLE gene according to the present invention can be designed by those skilled in the art based on the base sequence represented by SEQ ID NO: 6.

Ribozymes are RNAs that have catalytic activity. Ribozymes have an active site that reacts with the target nucleic acid and a substrate binding site that binds to the target nucleic acid. Examples of the ribozyme include a ribozyme having a sequence complementary to the mRNA sequence of the gene to be suppressed as a substrate binding site.
A ribozyme that suppresses the expression of the FAR gene according to the present invention can be designed by those skilled in the art based on the nucleotide sequence represented by SEQ ID NO: 5. A ribozyme that suppresses the expression of the PLE gene according to the present invention can be designed by those skilled in the art based on the nucleotide sequence represented by SEQ ID NO: 6.

Examples of RNAi-inducible nucleic acids include shRNA, siRNA, miRNA, and precursors thereof. For example, double-stranded RNA having the same base sequence as the mRNA sequence of the gene to be suppressed or a partial sequence thereof. Can be given. To the extent that the expression of the gene to be suppressed can be suppressed, the RNAi-inducible nucleic acid may be a double-stranded RNA having the same base sequence as the mRNA sequence of the gene to be suppressed or a partial sequence thereof. Good.

As one aspect of the nucleic acid that suppresses the expression of the FAR gene, any of the following nucleic acids (g) to (i) can be mentioned.
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a double strand, and a nucleic acid capable of suppressing the expression of the FAR gene,
(I) A sense strand consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the FAR gene

As one aspect of the nucleic acid that suppresses the expression of the PLE gene, any of the following nucleic acids (j) to (l) can be mentioned.
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene,
(L) A sense strand consisting of a base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the PLE gene.

Even the expression of the antisense strand corresponding to the nucleotide sequence represented by SEQ ID NO: 7 becomes an antisense nucleic acid and can suppress the expression of the FAR gene. Two nucleic acids are expressed by expressing a nucleic acid containing a sense strand consisting of the base sequence represented by SEQ ID NO: 7 or a part thereof and an antisense strand capable of forming a duplex with the sense strand or a part thereof. Strand RNA is formed, and silencing is efficiently induced in the plant body by the formation of siRNA and the like.
Similarly, even if the antisense strand corresponding to the nucleotide sequence represented by SEQ ID NO: 8 is expressed, it becomes an antisense nucleic acid and the expression of the PLE gene can be suppressed. Two nucleic acids are expressed by expressing a nucleic acid containing a sense strand consisting of the base sequence represented by SEQ ID NO: 8 or a part thereof and an antisense strand capable of forming a double strand with the sense strand or a part thereof. Strand RNA is formed, and silencing is efficiently induced in the plant body by the formation of siRNA and the like.

In general, it is known that a nucleic acid having some physiological function can be deleted, substituted and / or added with one to several base sequences without impairing the original function.
In the nucleic acid of (h), the number of bases in which 1 to several bases may be deleted, substituted and / or added in the base sequence represented by SEQ ID NO: 7 is preferably 1 to 30. , 1 to 20, more preferably 1 to 10, and even more preferably 1 to 5.

In the base of (i), the identity with the base sequence represented by SEQ ID NO: 7 is 80% or more and less than 100%, preferably 90% or more and less than 100%, and 95% or more and less than 100%. It is more preferable that it is 98% or more and less than 100%.
The identity between the base sequences can be determined by using various known homology search programs. For the identity between the base sequences in the present invention, the value obtained by the known homology search software BLAST can be adopted. As the identity between the base sequences in the present invention, a value obtained by commercially available genetic information processing software GENETYX can be adopted as shown in Examples described later.

In general, it is known that a nucleic acid having some physiological function can be deleted, substituted and / or added with one to several base sequences without impairing the original function.
In the nucleic acid of (k), the number of bases in which 1 to several bases may be deleted, substituted and / or added in the base sequence represented by SEQ ID NO: 8 is preferably 1 to 30. , 1 to 20, more preferably 1 to 10, and even more preferably 1 to 5.

In the base of (l), the identity with the base sequence represented by SEQ ID NO: 8 is 80% or more and less than 100%, preferably 90% or more and less than 100%, and 95% or more and less than 100%. It is more preferable that it is 98% or more and less than 100%.
The identity between the base sequences can be determined by using various known homology search programs. For the identity between the base sequences in the present invention, the value obtained by the known homology search software BLAST can be adopted. As the identity between the base sequences in the present invention, a value obtained by commercially available genetic information processing software GENETYX can be adopted as shown in Examples described later.

In the nucleic acids shown in (g) to (l), the antisense strand capable of forming a double strand with the sense strand or a part thereof is composed of a sequence completely complementary to the sense strand or a part thereof. Preferably, if it is possible to form a double strand with the sense strand or a part thereof in the plant and suppress the expression of the gene to be suppressed, the sequence is composed of a sequence partially complementary to the sense strand. It may be.

In the nucleic acids shown in (g) to (i) above, a part of the sense strand consisting of the base sequence represented by SEQ ID NO: 7 is 19 or more consecutive base sequences represented by SEQ ID NO: 7. An example consisting of a base can be exemplified.
In the nucleic acids shown in (g) to (i) above, the length of 19 or more consecutive bases in the base sequence represented by SEQ ID NO: 7, which is a part of the sense chain, is appropriately determined depending on the gene to be suppressed. It may be determined, and as an example, it may be about 19 to 493 bases, about 100 to 493 bases, about 300 to 493 bases, about 19 to 400 bases, about 20 to 100 bases, and about 21 to 50 bases.
In the nucleic acids shown in (g) to (i) above, 19 or more consecutive bases in the base sequence represented by SEQ ID NO: 7 that are a part of the sense strand are the base sequences represented by SEQ ID NO: 7. It is preferable that the region contains a part (19 or more consecutive bases) or all of the region consisting of the 366th to 494th base sequences. The region consisting of the 366th to 494th base sequences in the base sequence represented by SEQ ID NO: 7 corresponds to the 3'UTR region in the base sequence represented by SEQ ID NO: 5.

In the nucleic acids shown in (j) to (l), a part of the sense strand consisting of the base sequence represented by SEQ ID NO: 8 is 19 or more consecutive base sequences represented by SEQ ID NO: 8. An example consisting of a base can be exemplified.
In the nucleic acids shown in (j) to (l), the length of 19 or more consecutive bases in the base sequence represented by SEQ ID NO: 8 which is a part of the sense sequence is appropriately determined depending on the gene to be suppressed. As an example, it may be about 19 to 506 bases, about 100 to 506 bases, about 300 to 506 bases, about 19 to 400 bases, about 20 to 100 bases, and about 21 to 50 bases.
In the nucleic acids shown in (j) to (l), 19 or more consecutive bases in the base sequence represented by SEQ ID NO: 8 that are a part of the sense strand are the base sequences represented by SEQ ID NO: 8. It is preferable that the region contains a part (19 or more consecutive bases) or all of the region consisting of the 450th to 507th base sequences. The region consisting of the 450th to 507th base sequences in the base sequence represented by SEQ ID NO: 8 corresponds to the 3'UTR region in the base sequence represented by SEQ ID NO: 6.

The nucleic acids (g) to (i) have an activity of suppressing the expression of the FAR gene. Whether or not the nucleic acids (g) to (i) have an activity of suppressing the expression of the FAR gene can be examined by a conventional method. For example, as illustrated in Examples described later, a plant into which any of the nucleic acids (g) to (i) has been introduced and a plant into which any of the nucleic acids from (g) to (i) has not been introduced. In the plant into which any of the nucleic acids (g) to (i) has been introduced, when the expression level of the FAR gene is significantly reduced, the nucleic acid of any of (g) to (i) is introduced. However, it can be determined that it has an activity of suppressing the expression of the FAR gene.

The nucleic acids (j) to (l) have an activity of suppressing the expression of the PLE gene. Whether or not the nucleic acids (j) to (l) have an activity of suppressing the expression of the PLE gene can be examined by a conventional method. For example, as illustrated in Examples described later, a plant into which any of the nucleic acids (j) to (l) has been introduced and a plant into which any of the nucleic acids from (j) to (l) has not been introduced. In the plant into which any of the nucleic acids (j) to (l) has been introduced, when the expression level of the PLE gene is significantly reduced, the nucleic acid of any of (j) to (l) is introduced. However, it can be determined that it has an activity of suppressing the expression of the PLE gene.

The nucleic acids shown in (g) to (i) include the sense strand or a part thereof, and the antisense strand or a part thereof, as long as the expression of the FAR gene can be suppressed. Any nucleic acid may be added.
The nucleic acids shown in (j) to (l) include the sense strand or a part thereof, and the antisense strand or a part thereof, as long as the expression of the PLE gene can be suppressed. Any nucleic acid may be added.

The expression of the FAR gene and the PLE gene may be deleted or suppressed by introducing a nucleic acid capable of suppressing the expression of the FAR gene and the PLE gene.
As one aspect of the nucleic acid capable of suppressing the expression of the FAR gene and the PLE gene, any of the following nucleic acids (m) to (o) can be mentioned.
(M) A sense strand consisting of the base sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand or a part thereof capable of forming a duplex with the sense strand.
(N) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. With an antisense strand that can form a duplex with
In the base sequence represented by SEQ ID NO: 8, a sense strand consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and a part thereof, and the sense strand or a part thereof are duplicated. A nucleic acid containing an antisense strand capable of forming a strand and capable of suppressing the expression of the FAR gene and the PLE gene.
(O) A sense strand consisting of a base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. When,
A sense strand consisting of a base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. Nucleic acid containing the FAR gene and capable of suppressing the expression of the PLE gene,
Can be mentioned.

In the nucleic acids shown in (m) to (o), the sense strand, a part of the sense strand, and the antisense strand are the same as those described in the nucleic acids shown in (g) to (l). ..

The nucleic acids shown in (m) to (o) are optional as long as they can suppress the expression of the FAR gene and the PLE gene, in addition to the respective sense strands or a part thereof, and the antisense strands. Nucleic acid may be added.

As an example of the nucleic acid capable of suppressing the expression of the FAR gene and the PLE gene, any of the following nucleic acids (p) to (r) can be mentioned.
(P) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 9 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(Q) In the base sequence represented by SEQ ID NO: 9, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene and the PLE gene.
(R) A sense strand consisting of a base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 9 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the FAR gene and the PLE gene

Since the base sequence represented by SEQ ID NO: 9 is a concatenation of the base sequence represented by SEQ ID NO: 7 and the base sequence represented by SEQ ID NO: 8, the nucleic acids shown in (p) to (r) above. In, the sense strand, a part of the sense strand, and the antisense strand are the same as those described for the nucleic acids shown in (g) to (l) above.

The nucleic acids shown in (p) to (r) are optional as long as they can suppress the expression of the FAR gene and the PLE gene, in addition to the respective sense strands or a part thereof, and the antisense strands. Nucleic acid may be added.

As the nucleic acid of (p), a polynucleotide consisting of the base sequence represented by SEQ ID NO: 10 can be exemplified.
In the base sequence represented by SEQ ID NO: 10, the portion consisting of the 1st to 1001st bases is the part of the antisense strand, and the portion consisting of the 1002 to 1920th bases is the spacer part, 1921 to The part consisting of the 2921th base is the part of the sense strand.
As shown in << Method for producing sterile plant >> and Examples described later, the expression of the FAR gene and PLE gene can be expressed by introducing a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 10 into a plant. It can be suppressed.

The sterile plant of the present invention is preferably angiosperms, more preferably plants of the Linderniaceae family. As the plant of the family Azetogarashi, plants classified into the genus Torenia and the genus Torenia are preferable, and Torenia fournieri is preferable.

The sterile plant of the present invention
The function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene.
When the function of the PLE gene is deleted or suppressed by introducing nucleic acids that delete or suppress the expression of the PLE gene, it is preferable that these nucleic acids are expressed at least in flowers. ..
When the nucleic acid is expressed in a flower, the nucleic acid may be expressed by a transcriptional regulatory region that specifically expresses the nucleic acid in the flower, and a transcriptional regulatory region such as a constitutive promoter that expresses the nucleic acid in the whole plant including the flower. Nucleic acid may be expressed by.
Examples of the constitutive promoter include the CaMV35S (cauliflower mosaic virus 35S) promoter.

≪How to make sterile plants≫
The method for producing a sterile plant of the present invention is
In the plant
The function of any of the following FAR genes (A) to (C) is deleted or suppressed,
The function of any of the following PLE genes (D) to (F) is deleted or suppressed.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which one to several amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) One to several amino acids have been deleted, substituted and / or added to the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to

Since the FAR gene and the PLE gene according to the present invention are the same as those described in << Deteriorated Plant >> above, the description thereof will be omitted.

As a method for deleting or suppressing the function of a gene, for example, by artificially modifying or mutating the genome of the target gene, a plant in which the production of a functional gene product is deleted or suppressed is obtained. May be good. For example, there is a method of screening a plant in which the function of a gene of interest is deleted or suppressed by treatment with a mutagen. In addition, for example, a plant in which the production of a functional gene product is deleted or suppressed by artificially modifying or mutating the genome of a target gene by a gene targeting method, genome editing technology, transgenic, or the like. May be obtained. The target genes are the FAR gene and the PLE gene according to the present invention.
Alternatively, a plant in which the production of a gene product is deleted or suppressed may be obtained by introducing a nucleic acid that deletes or suppresses the expression of the gene of interest into the plant.
In the sterile plant of the present invention, for each of the FAR gene and the PLE gene according to the present invention, the degree of deficiency or suppression of the activity of the gene product, or the degree of deficiency or suppression of the expression of the gene is the plant body. It suffices as long as the sterility of the plant is achieved, and it is preferable that the complete sterility of the plant is achieved.

In the method for producing a sterile plant of the present invention, it is preferable that the function of the FAR gene is deleted or suppressed by modifying the FAR gene and / or its promoter.
In the method for producing a sterile plant of the present invention, it is preferable that the function of the PLE gene is deleted or suppressed by modifying the PLE gene and / or its promoter.

The method for producing a sterile plant of the present invention deletes or suppresses the function of the FAR gene by modifying the FAR gene and / or its promoter.
It is preferable that the function of the PLE gene is deleted or suppressed by modifying the PLE gene and / or its promoter.

The method for producing a sterile plant of the present invention is to delete or suppress the function of the FAR gene in a plant by introducing a nucleic acid for modifying the FAR gene and / or its promoter. preferable.
The method for producing a sterile plant of the present invention is to delete or suppress the function of the PLE gene in a plant by introducing a nucleic acid for modifying the PLE gene and / or its promoter. preferable.

The method for producing a sterile plant of the present invention deletes or suppresses the function of the FAR gene in a plant by introducing a nucleic acid for modifying the FAR gene and / or its promoter.
It is preferable that the function of the PLE gene is deleted or suppressed by introducing a nucleic acid for modifying the PLE gene and / or its promoter.

Since the nucleic acid for modifying the FAR gene and / or its promoter is the same as that described in << Deteriorated Plant >> above, the description thereof will be omitted.
The nucleic acid for modifying the PLE gene and / or its promoter is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.

The method for producing a sterile plant of the present invention preferably deletes or suppresses the function of the FAR gene by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene into the plant.
In the method for producing a sterile plant of the present invention, it is preferable that the function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene into the plant.

In the method for producing a sterile plant of the present invention, the function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene into the plant.
It is preferable that the function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene.

The method for producing a sterile plant of the present invention is to delete or suppress the functions of the FAR gene and the PLE gene by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene and the PLE gene into the plant. Is preferable.

Since the nucleic acid that suppresses the expression of the FAR gene is the same as that described in << Deteriorated Plant >> above, the description thereof will be omitted.
Since the nucleic acid that suppresses the expression of the PLE gene is the same as that described in << Deteriorated Plant >> above, the description thereof will be omitted.
The nucleic acids that suppress the expression of the FAR gene and the PLE gene are the same as those described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.

The method for producing a sterile plant of the present invention can also be carried out by a known gene recombination technique, and a nucleic acid capable of suppressing the expression of the FAR gene according to the present invention and the PLE gene according to the present invention is introduced into the plant. Examples thereof include a method of introducing a vector capable of expressing in a plant a nucleic acid capable of suppressing the expression of the FAR gene according to the present invention and the PLE gene according to the present invention into the plant. As another example, a vector capable of expressing a nucleic acid capable of suppressing the expression of the FAR gene according to the present invention in a plant, and a vector capable of expressing a nucleic acid capable of suppressing the expression of the PLE gene according to the present invention in a plant. Is introduced into the plant. The nucleic acid that suppresses the expression of the introduced gene may or may not be introduced into the genome, but it is preferably introduced into the genome.

Examples of plants into which a nucleic acid that suppresses gene expression is introduced include plant bodies, plant cells, cultured plant cells, and callus.

The method for producing a transformant using a vector is not particularly limited, and it can be carried out by a method usually used in the art. Examples of the method include an Agrobacterium method, a particle gun method, and an electroporation method, and the Agrobacterium method is preferable.

In the present invention, the term "sterile plant" is used to include not only a plant but also the cell from which the plant is derived if the plant is sterile when the plant is produced from cells. There is. The cell may be in a tissue or organ state. In the present invention, the sterile plant may be an organism or cell of a progeny or a clone thereof. For example, examples of the cloned plant include plants obtained by cuttings, cuttings and the like.

By introducing a nucleic acid that suppresses the expression of the FAR gene into a plant, the function of the FAR gene is deleted or suppressed, and by introducing a nucleic acid that suppresses the expression of the PLE gene, the function of the PLE gene is introduced. These nucleic acids are preferably expressed at least in flowers when deficient or suppressed.
When the nucleic acid is expressed in a flower, the nucleic acid may be expressed by a transcriptional regulatory region that specifically expresses the nucleic acid in the flower, and a transcriptional regulatory region such as a constitutive promoter that expresses the nucleic acid in the whole plant including the flower. Nucleic acid may be expressed by.
Examples of the constitutive promoter include the CaMV35S (cauliflower mosaic virus 35S) promoter.
A method of expressing a nucleic acid by a transcriptional regulatory region is known, and examples thereof include operably linking the transcriptional regulatory region to a polynucleotide consisting of a base sequence encoding a nucleic acid to be expressed.
By "operably linked" is meant that the transcriptional regulatory region is regulatory in nucleic acid expression.
The "transcriptional regulatory region" is a sequence capable of controlling transcription initiation and transcription efficiency, and includes promoters, enhancers, and response sequences.
The "transcriptional regulatory region that can regulate transcription in a flower" means that the transcription of nucleic acid can be regulated in the cells that make up the flower. More specifically, a transcriptional regulatory region that is transcriptionally regulated in a flower is a transcriptional regulatory region that is transcriptionally regulated so that the nucleic acid can act on the formation of male and / or female, and is a gene specifically in a flower. A transcriptional regulatory region capable of producing expression of nucleic acid is preferable, and a transcriptional regulatory region capable of specifically producing nucleic acid expression in male and female is more preferable.

The plant produced by the method for producing a sterile plant of the present invention is preferably angiosperms, and more preferably a plant of the Linderniaceae family. As the plant of the family Azetogarashi, plants classified into the genus Torenia and the genus Torenia are preferable, and Torenia fournieri is preferable.

≪Vector≫
The vector of the present invention lacks the function of any of the following FAR genes (A) to (C), or the function of any of the following PLE genes (D) to (F). Alternatively, it is possible to express a nucleic acid that suppresses it.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which one to several amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) One to several amino acids have been deleted, substituted and / or added to the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 80% or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to

The nucleic acid that deletes or suppresses the function of the FAR gene is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.
The nucleic acid that deletes or suppresses the function of the PLE gene is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.

It is preferable that the vector of the present invention is capable of expressing the FAR gene and / or its promoter and a nucleic acid for modifying the PLE gene and / or its promoter.

Since the nucleic acid for modifying the FAR gene and / or its promoter is the same as that described in << Deteriorated Plant >> above, the description thereof will be omitted.
The nucleic acid for modifying the PLE gene and / or its promoter is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.

The vector of the present invention preferably can express a nucleic acid that suppresses the expression of the FAR gene and the PLE gene.

The nucleic acid for deleting or suppressing the expression of the FAR gene is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.
The nucleic acid for deleting or suppressing the expression of the PLE gene is the same as that described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.
The nucleic acids for deleting or suppressing the expression of the FAR gene and the PLE gene are the same as those described in << Deteriorated Plant >> above, and thus the description thereof will be omitted.

In the vector of the present invention
The nucleic acid that suppresses the expression of the FAR gene is any of the following nucleic acids (g) to (i).
The nucleic acid that suppresses the expression of the PLE gene is preferably any of the following nucleic acids (j) to (l).
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene.
(I) A sense strand consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the FAR gene,
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which one to several bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene.
(L) A sense strand consisting of a base sequence having 80% or more identity with the base sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the PLE gene.

In the vector of the present invention
The nucleic acid that deletes or suppresses the function of the FAR gene is the nucleic acid of the following (s) for modifying the FAR gene and / or its promoter.
The nucleic acid that deletes or suppresses the function of the PLE gene is preferably the nucleic acid (t) below for modifying the PLE gene and / or its promoter.
(S) A guide RNA containing a base sequence selected from the sequence of the FAR gene and / or its promoter.
(T) A guide RNA containing a base sequence selected from the sequence of the PLE gene and / or its promoter.

Examples of the vector include a DNA having a promoter sequence, a DNA that suppresses the expression of the FAR gene, a DNA that suppresses the expression of the PLE gene, and a vector containing a DNA having a terminator sequence, and these are linked in order from the upstream. A vector containing the DNA is preferable. The vector of the present invention has a sequence such as a drug resistance sequence in addition to a nucleic acid that deletes or suppresses the expression of the FAR gene according to the present invention and a nucleic acid that deletes or suppresses the expression of the PLE gene according to the present invention. You may.

In the vector of the present invention, a nucleic acid that deletes or suppresses the expression of the FAR gene according to the present invention and a nucleic acid that deletes or suppresses the expression of the PLE gene according to the present invention are incorporated into the vector using a well-known gene recombination technique. It can be manufactured by. When incorporating the nucleic acid, a commercially available expression vector preparation kit may be used.

Next, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to the following Examples.

1. 1. Gene Isolation First, cDNA was obtained by RT-PCR from the total RNA extracted from the stamens and pistils of Torenia fournieri.
A sequence is amplified from the cDNA using primer: 5'-ATGGAGATTCAAAGCGATCAATC-3'(SEQ ID NO: 11) and primer: 5'-TATAATATAGCAGCAATCGAAGG-3' (SEQ ID NO: 12), and the nucleotide represented by SEQ ID NO: 5 is used. A polynucleotide containing the sequence was obtained.
A sequence is amplified from the cDNA using a primer: 5'-ATGGATTTTCCTAATGATGAATCCG-3'(SEQ ID NO: 13) and a primer: 5'-GTTTTCTTCTAGACACTTAATAACG-3'(SEQ ID NO: 14), and the nucleotide represented by SEQ ID NO: 6 is used. Obtained a polynucleotide containing the sequence

Open reading frames were deduced from the obtained sequence containing the nucleotide sequence represented by SEQ ID NO: 5, and they were converted into amino acid sequences to obtain the amino acid sequence represented by SEQ ID NO: 1. The gene encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 1 is the FAR gene according to the present invention.

Open reading frames were deduced from the obtained sequence containing the nucleotide sequence represented by SEQ ID NO: 6, and they were converted into amino acid sequences to obtain the amino acid sequence represented by SEQ ID NO: 2. The gene encoding the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 is the PLE gene according to the present invention.

When the identity was calculated using GENETYX (Ver.8), the identity between the amino acid sequence represented by SEQ ID NO: 1 and the amino acid sequence represented by SEQ ID NO: 2 was 63%. As for the base sequence, when the identity was calculated using GENETYX (Ver.8), the homology in the sequence part used for silencing was TfFAR (base sequence represented by SEQ ID NO: 7) and TfPLE. The homology with (the nucleotide sequence represented by SEQ ID NO: 8) was 66%. Including the whole not used for silencing, the homology between TfFAR (base sequence represented by SEQ ID NO: 3) and TfPLE (base sequence represented by SEQ ID NO: 4) was 69%.

2-1. Creation of torenia transformant As shown in FIG. 1, based on SEQ ID NO: 5 (sequence of TfFAR cDNA) obtained above, Table No. 7 is a partial sequence of SEQ ID NO: 5 so as not to include the MADS domain. The base sequence of 494b to be used was selected.
As shown in FIG. 1, based on SEQ ID NO: 6 (sequence of TfPLE cDNA) obtained above, the nucleotide sequence of 507b represented by SEQ ID NO: 8 which is a partial sequence of SEQ ID NO: 6 so as not to include the MADS domain. Was elected.

Downstream of the 35S promoter, a DNA consisting of a base sequence complementary to the base sequence represented by SEQ ID NO: 8 (a partial sequence of the antisense strand of TfPLE) and a base complementary to the base sequence represented by SEQ ID NO: 7 DNA consisting of a sequence (partial sequence of the antisense strand of TfFAR), DNA consisting of the base sequence represented by SEQ ID NO: 15 as a spacer (sequence of the GUS gene), and DNA consisting of the base sequence represented by SEQ ID NO: 7. (Partial sequence of the sense strand of TfFAR), DNA consisting of the base sequence represented by SEQ ID NO: 8 (partial sequence of the sense strand of TfPLE), and HSPter are linked in this order and represented by SEQ ID NO: 10. A DNA consisting of a base sequence was obtained (Fig. 2).

The expression cassette schematically shown in FIG. 2 was replaced with the position of the SmaI / SalI site (FIG. 3) on the vector (P35SSRDXG-HSPter), and the binary vector introduced into the pBCKK vector (FIG. 4) by the LR reaction was used. , Then introduced into Agrobacterium, and then using this Agrobacterium, it was introduced into Torenia by the Agrobacterium method to prepare a transformant (TfFAR / TfPLE-IR recombinant torenia).

2-2. Expression analysis Total RNA extracted from wild-type torenia leaves, petals, stamens, stamens, total RNA extracted from TfFAR / TfPLE-IR recombinant torenia leaves, petals, stamens (petalization), stamens (petalization) RT-PCR was performed on each RNA. The following primer [TfFAR; primer: 5'-ATGGAGATTCAAAGCGATCAATC-3'(SEQ ID NO: 16) and primer: 5'-GACAAGGTGAAGAGATGTCTGG-3' (SEQ ID NO: 17) and TfPLE are used to analyze the expression of the TfFAR and TfPLE genes. Primer: 5'-ATGGATTTTCCTAATGATGAATC-3'(SEQ ID NO: 18) and primer: 5'-CACGAGCCGAAGGGGTGTTT-3'(SEQ ID NO: 19)] were used. Expression analysis of the GUS gene was performed using the following primers [5'-GTCGTCATGAAGATGCGGAC-3'(SEQ ID NO: 20) and 5'-CCCTGCTGCGGTTTTTCACC-3' (SEQ ID NO: 21)]. Expression analysis (positive control) of the TfACT3 gene was performed using the following primers [5'-AAATACAGTGTTTGGATCGGAGGTTC-3'(SEQ ID NO: 22) and 5'-GAATAGCACACAGAGAATAGCAAACC-3' (SEQ ID NO: 23)].
FIG. 5 shows the results of RT-PCR. The expression of GUS was confirmed in the confirmation of the transgene (spacer portion), and the introduction of the silencing vector in TfFAR / TfPLE-IR recombinant torenia was confirmed. It was confirmed that the expression of the TfFAR gene and the TfPLE gene was almost silenced in the TfFAR / TfPLE-IR recombinant torenia.

2-3. Transformation of Torenia Transformant The flower morphology of the obtained transformant (TfFAR / TfPLE-IR recombinant torenia) is shown in FIG. The flowers of the transformant (TfFAR / TfPLE-IR recombinant torenia) had fully petalized pistils and completely petalized stamens as compared to the control torenia (wild type) flowers. As a result, the transformant (TfFAR / TfPLE-IR recombinant torenia) was completely sterile.
As described above, the torenia according to the present invention was a very useful plant having both high appreciation and complete sterility of the flower shape peculiar to torenia (Fig. 7).

3-1. Creation of torenia transformant Based on SEQ ID NO: 5 (sequence of TfFAR cDNA), primer: 5'-attgCAAGAGAAATCTCGCCGCAG-3'(SEQ ID NO: 24) and primer: 5'-aaacCTGCGGCGAGATTTCTCTTG-3'(SEQ ID NO: 25) Annealed to prepare and select an oligonucleotide represented by TfFAR target1 (CAAGAGAAATCTCGCCGCAG, SEQ ID NO: 26). Similarly, based on SEQ ID NO: 5 (sequence of TfFAR cDNA), primer: 5'-attgCGAGAACACGACGAATCGAC-3'(SEQ ID NO: 27) and primer: 5'-aaacGTCGATTCGTCGTGTTCCG-3' (SEQ ID NO: 28) are annealed and TfFAR Oligonucleotides represented by target2 (CGAGAACACGACGAATCGAC, SEQ ID NO: 29) were prepared and selected.

Based on SEQ ID NO: 6 (sequence of TfPLE cDNA), primer: 5'-attgCCTGAAGGAACTCAAGAACA-3'(SEQ ID NO: 30) and primer: 5'-aaacTGTTCTTGAGTTCCTTCAGG-3'(SEQ ID NO: 31) were annealed and TfPLE target1 (SEQ ID NO: 31) was annealed. The oligonucleotide represented by CCTGAAGGAACTCAAGAACA, SEQ ID NO: 32) was prepared and selected. Similarly, based on SEQ ID NO: 6 (sequence of TfPLE cDNA), primer: 5'-attgGCCAGGACCAAACACCCCTT-3'(SEQ ID NO: 33) and primer: 5'-aaacAAGGGGTGTTTGGTCCTGGC-3'(SEQ ID NO: 34) are annealed and TfPLE is used. Oligonucleotides represented by target2 (GCCAGGACCAAACACCCCTT, SEQ ID NO: 35) were prepared and selected.

TfFAR target1 (SEQ ID NO: 26), which is an oligonucleotide sequence based on SEQ ID NO: 5 (sequence of TfFAR cDNA), was introduced at the position of the BbsI site on the pMR217_pDONR_AtU6gRNA vector (Fig. 8) to prepare a new pMR217_pDONR_AtU6gRNA-TfFAR_target1 vector. (Fig. 9). The nucleotide sequence represented by TfFAR target2 (SEQ ID NO: 29) was introduced at the position of the BbsI site on the pMR219_pDONR_AtU6gRNA vector (Fig. 8), and a new pMR219_pDONR_AtU6gRNA-TfFAR_target2 vector was prepared (Fig. 9). As a result, the nucleotide sequence represented by TfFAR target1 (SEQ ID NO: 26) and the sgRNA scaffold sequence are linked in this order downstream of AtU6promoter, and the nucleotide sequence represented by TfFAR target2 (SEQ ID NO: 29) is obtained. , SgRNA scaffold sequences were ligated in this order (Fig. 9).

TfPLE target1 (SEQ ID NO: 32), which is an oligonucleotide sequence based on SEQ ID NO: 6 (sequence of TfPLE cDNA), was introduced at the position of the BbsI site on the pMR204_pDONR_AtU6 gRNA vector (Fig. 8) to prepare a new pMR204_pDONR_AtU6gRNA-TfPLE_target1 vector. did. The nucleotide sequence represented by TfPLE target2 (SEQ ID NO: 35) was introduced at the position of the BbsI site on the pMR205_pDONR_AtU6gRNA vector (Fig. 8), and a new pMR205_pDONR_AtU6gRNA-TfPLE_target2 vector was prepared. As a result, the nucleotide sequence represented by TfPLE target1 (SEQ ID NO: 32) and the sgRNA scaffold sequence are linked in this order downstream of AtU6promoter, and the nucleotide sequence represented by TfPLE target2 (SEQ ID NO: 35) is obtained. , SgRNA scaffold sequences were ligated in this order (Fig. 9).

The expression cassette schematically shown in FIG. 9 is a vector in which the selection marker of the pDeCas9_Kan vector (pDeCas9; Fauser et al. 2014) is changed from hygromycin to kanamycin by LR reaction. Fauser F, Schiml S, Puchta H ( 2014) Both CRISPR / Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J 79: 348-359) (Fig. 10) to introduce the pDeCas9-TfFAR_target-1 & 2 / TfPLE_target-1 & 2 binary vector. Made. The pDeCas9-TfFAR_target-1 & 2 / TfPLE_target-1 & 2 binary vector was introduced into Agrobacterium, and then this Agrobacterium was used to introduce into Torenia by the Agrobacterium method, and the transformant (TfFAR target 1 & 2 / TfPLE target 1 & 2 genome). Editing Torenia) was produced. In the transformant, it was confirmed that the base sequence of the TfFAR gene genome was shortened by about 60 bases and the base sequence of the TfPLE gene genome was shortened by about 460 bases.

3-2. Traits of torenia transformants The above pDeCas9-TfFAR_target-1 & 2 / TfPLE_target-1 & 2 binary vector was introduced into Torenia by the Agrobacterium method. The flower morphology of the obtained transformant (TfFAR target 1 & 2 / TfPLE target 1 & 2 genome editing torenia) is shown in FIG. The flowers of the transformant (TfFAR target 1 & 2 / TfPLE target 1 & 2 genome editing torenia) have petals of pistils and no stigma required for fertilization compared to the flowers of control torenia (wild type), and petals. The transformation was confirmed. In addition, the stamens disappeared or became completely petals. As a result, the transformant (TfFAR target 1 & 2 / TfPLE target 1 & 2 genome editing torenia) was completely sterile.
As described above, the torenia according to the present invention was a very useful plant having both high appreciation and complete sterility of the flower shape peculiar to torenia (Fig. 11).

3-3. Expression analysis RT-PCR was performed on the total RNA extracted from wild-type torenia females and the total RNA extracted from genome-edited torenia females (petalization). The following primers [TfFAR; primer: 5'-TGGAGATTCAAAGCGATCAATCAAG-3'(SEQ ID NO: 36) and primer: 5'-aaacCAGCATCACAAAGCACAGAC-3' (SEQ ID NO: 37) and TfPLE are used to analyze the expression of the TfFAR and TfPLE genes. Primer: 5'-ATGCCCCTGAAGGAACTCAAG-3'(SEQ ID NO: 38) and primer: 5'-TTGTTTGTAGCAAGCTAGTTATATC-3'(SEQ ID NO: 39)] were used. Expression analysis (positive control) of the TfACT3 gene was performed using the following primers [5'-AAATACAGTGTTTGGATCGGAGGTTC-3'(SEQ ID NO: 22) and 5'-GAATAGCACACAGAGAATAGCAAACC-3' (SEQ ID NO: 23)].
FIG. 12 shows the results of RT-PCR. In the petalized females of genome-edited torenia, the expression of the TfFAR gene and TfPLE gene found in wild-type torenia was not observed.

Each configuration and a combination thereof in each of the embodiments described above is an example, and the configuration can be added, omitted, replaced, and other changes are possible without departing from the spirit of the present invention. Moreover, the present invention is not limited to each embodiment, but is limited only to the scope of claims.

Claims (11)

The function of any of the following FAR genes (A) to (C) is deleted or suppressed, and
It is a plant of the Azetogarashi family in which the function of any of the following PLE genes (D) to (F) is deleted or suppressed , and the fertility of all the flower organs possessed by the individual plant is lost. Fertile plant.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which 1 to 30 amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) 1 to 30 amino acids have been deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to The pistil is flower-covered and the stamen is flower-covered (however, the wall of the flower-covered area is concentrically centered on the original carpel-forming area toward the inside of the pistil). The completely sterile plant according to claim 1, wherein the fertility of all the flower organs possessed by the individual plant is lost due to (excluding the double-flowered morphology in which two or more layers are repeated). The function of the FAR gene is deleted or suppressed by having a modification site in the FAR gene and / or its promoter.
The completely sterile plant according to claim 1 or 2 , wherein the function of the PLE gene is deleted or suppressed by having a modification site in the PLE gene and / or its promoter. The function of the FAR gene is deleted or suppressed by introducing a nucleic acid having a base sequence complementary to the sense sequence which is the mRNA sequence of the FAR gene and deleting or suppressing the expression of the FAR gene. And
The function of the PLE gene is deleted or suppressed by introducing a nucleic acid having a base sequence complementary to the sense sequence which is the mRNA sequence of the PLE gene and deleting or suppressing the expression of the PLE gene. The completely sterile plant according to claim 1 or 2 . The nucleic acid that suppresses the expression of the FAR gene is any of the following nucleic acids (g) to (i).
The completely sterile plant according to claim 4 , wherein the nucleic acid that suppresses the expression of the PLE gene is any of the following nucleic acids (j) to (l).
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene.
(I) A sense strand or a part thereof consisting of a base sequence having 90 % or more identity with the base sequence shown in SEQ ID NO: 7, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. , A nucleic acid capable of suppressing the expression of the FAR gene,
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene.
(L) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence shown in SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. , A nucleic acid capable of suppressing the expression of the PLE gene In plants of the family Azetogarashi
The function of any of the following FAR genes (A) to (C) is deleted or suppressed,
The following is function deficiency or inhibition of any of the PLE gene (D) ~ (F), wherein Ru to lose the fertility of all floral organs having individual plants are fully FuMinoruka method production of plants.
(A) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 (B) Amino acid in which 1 to 30 amino acids are deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 1. A gene consisting of a sequence and encoding a protein having a transcriptional control function (C) Encoding a protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 1 and having a transcriptional control function. Gene (D) A gene encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (E) 1 to 30 amino acids have been deleted, substituted and / or added in the amino acid sequence represented by SEQ ID NO: 2. A gene consisting of an amino acid sequence and encoding a protein having a transcription control function (F) A protein having an amino acid sequence having 90 % or more identity with the amino acid sequence represented by SEQ ID NO: 2 and having a transcription control function is encoded. Gene to The pistil is flower-covered and the stamen is flower-covered (however, the wall of the flower-covered area is concentrically centered on the original carpel-forming area toward the inside of the pistil). The method for producing a completely sterile plant according to claim 6, wherein the fertility of all the flower organs possessed by the individual plant is lost by (excluding the double-flowered morphology in which two or more layers are repeated). The function of the FAR gene is deleted or suppressed by modifying the FAR gene and / or its promoter.
The method for producing a completely sterile plant according to claim 6 or 7 , wherein the function of the PLE gene is deleted or suppressed by modifying the PLE gene and / or its promoter. The function of the FAR gene, has a sense sequence complementary to the nucleotide sequence is the sequence of mRNA of the FAR gene, by introducing a nucleic acid to be deficient or suppressed expression of the FAR genes into the plant, deficient or Suppress and
The function of the PLE gene, has a sense sequence complementary to the nucleotide sequence is the sequence of mRNA of the PLE gene, by introducing a nucleic acid to be deficient or suppressed expression of the PLE genes into the plant, deficient or The method for producing a completely sterile plant according to claim 6 or 7, which is suppressed. The nucleic acid that suppresses the expression of the FAR gene is any of the following nucleic acids (g) to (i).
The method for producing a completely sterile plant according to claim 9 , wherein the nucleic acid that suppresses the expression of the PLE gene is any of the following nucleic acids (j) to (l).
(G) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(H) In the base sequence represented by SEQ ID NO: 7, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the FAR gene.
(I) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence represented by SEQ ID NO: 7 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the FAR gene,
(J) A nucleic acid containing a sense strand consisting of the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof.
(K) In the base sequence represented by SEQ ID NO: 8, a sense strand or a part thereof consisting of a base sequence in which 1 to 30 bases are deleted, substituted and / or added, and the sense strand or a part thereof. And an antisense strand capable of forming a duplex, and a nucleic acid capable of suppressing the expression of the PLE gene.
(L) A sense strand consisting of a nucleotide sequence having 90 % or more identity with the nucleotide sequence represented by SEQ ID NO: 8 or a part thereof, and an antisense strand capable of forming a duplex with the sense strand or a part thereof. And, a nucleic acid capable of suppressing the expression of the PLE gene. The function of the FAR gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the FAR gene into the plant.
The function of the PLE gene is deleted or suppressed by introducing a nucleic acid that deletes or suppresses the expression of the PLE gene into the plant.
The nucleic acid that deletes or suppresses the function of the FAR gene is the nucleic acid of the following (s) for modifying the FAR gene and / or its promoter.
The production of a completely sterile plant according to claim 8 , wherein the nucleic acid lacking or suppressing the function of the PLE gene is the nucleic acid of the following (t) for modifying the PLE gene and / or its promoter. Method.
(S) A guide RNA containing a base sequence selected from the sequence of the FAR gene and / or its promoter.
(T) A guide RNA containing a base sequence selected from the sequence of the PLE gene and / or its promoter.