JP5812386B2 - Method for reducing high temperature damage of gramineous plants and high temperature resistant gramineous plants - Google Patents

Description

  The present invention relates to a method for reducing high temperature damage in gramineous plants, a vector for producing a high temperature resistant gramineous plant, and a gramineous plant in which high temperature damage is reduced.

  Paddy rice is known to cause a quality defect (hereinafter, also referred to as “high-temperature disorder”) in which white immature grains are formed when exposed to high temperatures during the ripening period. When such a quality failure occurs, there is a problem that the ratio of first-class rice to rice significantly decreases. For this reason, selection of varieties that are unlikely to cause high-temperature damage, research on cultivation methods, and the like have been conducted (Non-Patent Document 1). In addition, gene expression analysis at high temperatures has been attempted for rice (Non-patent Document 2).

  Patent Document 1 describes rice lines that are deficient in phospholipase D, and Patent Document 2 describes a plant-derived phospholipase D gene.

JP 2008-245638 A (released on October 16, 2008) International Publication No. 95/09234 (April 6, 1995)

Chiba et al., 2009, Nisakuri 78: 4555-464 Yamakawa H., Kuroda M., Hirose T., Yamaguchi T. 2007. Comprehensive expression profiling of rice grain filling-related genes under high temperature using DNA microarray.Plant Physiol. 144: 258-277.

  However, many of the conventional techniques for reducing high-temperature obstacles have relied on the improvement of varieties and the like, and are not techniques that can achieve remarkable results that can greatly reduce high-temperature obstacles. In particular, no technology has been reported so far to reduce the high temperature damage of rice by modifying a gene or suppressing the expression of a single gene. Therefore, further development of technology for reliably reducing high-temperature obstacles is desired.

  In addition, Patent Documents 1 and 2 described above do not describe or suggest any relationship between phospholipase D of rice and high-temperature injury.

  This invention is made | formed in view of the problem mentioned above, The objective is to provide the new technique which can reduce the high temperature disorder | damage | failure of a gramineous plant.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have found that phospholipase (PLD) is activated in the seed tissue during the ripening process of gramineous plants, and that normal conditions under high temperature conditions It was found that PLD activity of 5 times or more was detected. Then, when further analysis was carried out on phospholipase D of the grass family plant, when the expression of one gene of a plurality of phospholipases D was suppressed, it was found that high-temperature injury was greatly reduced, and the present invention was Completed.

The method for reducing high-temperature damage of gramineous plants according to the present invention is characterized by suppressing the expression of any of the following genes (A) to (C) in gramineous plants:
(A) a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1;
(B) a gene encoding a protein comprising an amino acid sequence in which one or several amino acids of the amino acid sequence shown in SEQ ID NO: 1 has been deleted, substituted or added, and expression is suppressed in a grass family plant Genes that reduce high temperature injury
(C) A gene that encodes a protein comprising an amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 1, and that reduces high-temperature damage when expression is suppressed in a grass family plant.

The method for reducing high-temperature damage of gramineous plants according to the present invention is characterized by suppressing the expression of a gene contained in any of the following DNAs (A) to (C) in gramineous plants:
(A) DNA comprising the base sequence shown in any one of SEQ ID NOs: 2 to 4;
(B) It consists of a base sequence in which one or several bases of any one of SEQ ID NOs: 2 to 4 are deleted, substituted or added, and high-temperature damage occurs when expression is suppressed in a grass family DNA comprising a gene that reduces
(C) Hybridization with DNA comprising a nucleotide sequence complementary to the nucleotide sequence shown in any one of SEQ ID NOs: 2 to 4 under stringent conditions to reduce high-temperature damage when expression is suppressed in gramineous plants DNA containing the gene to be made.

  Further, in the method for reducing high temperature damage of gramineous plants according to the present invention, at least one selected from base deletion, substitution and insertion is generated for the gene, thereby suppressing the expression of the gene. It is preferable to do.

  Moreover, in the method for reducing the high temperature damage of gramineous plants according to the present invention, the insertion is preferably T-DNA insertion.

  Moreover, in the method for reducing the high temperature damage of gramineous plants according to the present invention, it is preferable to suppress the expression of the gene by RNAi method.

  Moreover, in the method of reducing the high temperature damage of the gramineous plant according to the present invention, the gramineous plant is preferably rice.

  Moreover, in the method for reducing high temperature damage of gramineous plants according to the present invention, the high temperature damage is preferably the formation of white immature grains when exposed to high temperature during the ripening period.

The vector for producing a high temperature resistant gramineous plant according to the present invention generates at least one selected from deletion, substitution and insertion of a base for any of the following genes (A) to (C): , Characterized by suppressing the expression of the gene:
(A) a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1;
(B) a gene encoding a protein comprising an amino acid sequence in which one or several amino acids of the amino acid sequence shown in SEQ ID NO: 1 has been deleted, substituted or added, and expression is suppressed in a grass family plant Genes that reduce high temperature injury
(C) A gene that encodes a protein comprising an amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 1, and that reduces high-temperature damage when expression is suppressed in a grass family plant.

The vector for producing a high temperature resistant gramineous plant according to the present invention produces at least one selected from base deletion, substitution and insertion with respect to the gene contained in any of the following DNAs (A) to (C): To suppress the expression of the gene:
(A) DNA consisting of the base sequence shown in SEQ ID NO: 2;
(B) A gene comprising a base sequence in which one or several bases of the base sequence shown in SEQ ID NO: 2 are deleted, substituted or added, and which reduces high-temperature damage when expression is suppressed in a grass family plant. Containing DNA;
(C) DNA containing a gene that hybridizes with a DNA comprising a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2 under stringent conditions and reduces high-temperature damage when expression is suppressed in a grass family plant .

  The vector for producing a high temperature resistant gramineous plant according to the present invention includes at least a part of a sense strand sequence in the base sequence shown in SEQ ID NO: 4 and an antisense strand sequence complementary to the sense strand sequence. It suppresses the expression of the gene which contains by RNAi method, It is characterized by the above-mentioned.

  The gramineous plant according to the present invention is characterized in that high-temperature damage is reduced by any of the methods described above.

  The rice according to the present invention is characterized in that high-temperature damage is reduced by any one of the methods described above.

  Moreover, in the rice which concerns on this invention, it is preferable that the said high temperature disorder | damage | failure is formation of a white immature grain when exposed to high temperature in a ripening period.

  ADVANTAGE OF THE INVENTION According to this invention, the new method which can reduce the high temperature disorder | damage | failure of a Gramineae plant, the vector for high temperature tolerance gramineous plant production, and the Gramineae plant by which the high temperature disorder | damage | failure was reduced can be provided.

It is a figure which shows the structure of the OsPLDbeta2 gene region in rice genomic DNA. It is a figure which shows the structure of mRNA of OsPLDbeta2 gene. It is a figure which shows the construct of the vector for the expression suppression of OsPLDbeta2 gene by RNAi. It is a figure which shows the position of the area | region amplified in quantitative PCR of OsPLDbeta2. It is a graph which shows the expression level (mRNA amount) of OsPLDbeta2 in each of OsPLDbeta2-RNAi system | strain and vector control. It is a graph which shows the formation ratio (%) of the white immature grain by the high temperature process in OsPLDbeta2-RNAi system | strain. It is a figure which shows the OsPLDbeta2 gene region in OsPLDbeta2-Tos17 strain | stump | stock. It is a graph which shows the formation ratio (%) of the white immature grain by a high temperature process at the time of growing OsPLDbeta2-Tos17 system | strain in a closed greenhouse. It is a graph which shows the formation ratio (%) of the white immature grain by a high temperature process at the time of carrying out field cultivation of OsPLDbeta2-Tos17 system | strain. It is a graph which shows the formation ratio (%) of the white immature grain by each high temperature process in each suppression system | strain of a rice phospholipase D gene.

[Method to reduce high temperature failure]
The method according to the present invention is a method for reducing high-temperature damage in gramineous plants by suppressing the expression of a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a homologous gene thereof. Gramineae plants include rice, wheat, corn, barley and the like.

  The protein consisting of the amino acid sequence shown in SEQ ID NO: 1 is one of rice phospholipase D and is also referred to as OsPLDbeta2.

  Examples of the gene encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 1 include, for example, the base sequence shown in any of SEQ ID NOS: 2 to 4, or one or the number of base sequences shown in any of SEQ ID NOs: 2 to It may be a gene contained in DNA consisting of a base sequence in which one base is deleted, substituted or added.

  The base sequence shown in SEQ ID NO: 2 is a sequence (Accession number: AF411221) including the OsPLDbeta2 gene (RAP locus ID: Os03g01119100), and includes an exon sequence and an intron sequence of this gene.

  FIG. 1 is a diagram showing the structure of the OsPLDbeta2 gene region in rice genomic DNA. In FIG. 1, the exon region of the OsPLDbeta2 gene is indicated by a black square, the intron region is indicated by a thin line, and the untranslated region (UTR) on the 5 'side and the 3' side is indicated by a bold line.

  The DNA consisting of the base sequence shown in SEQ ID NO: 2 has a total length of 4572 bp and includes 10 exons and 9 introns between the exons as shown in FIG. Of the nucleotide sequence shown in SEQ ID NO: 2, 213-1337, 1557-1673, 1832-2026, 2126-2374, 2459-2572, 2615-2762, 2989-3137, 3269-3439, 3541-3738, 3816- 4109 bp is an exon.

  The base sequence shown in SEQ ID NO: 3 is a base sequence containing only the translation region (2715 bp) of the OsPLDbeta2 gene. The base sequence shown in SEQ ID NO: 4 is a base sequence of cDNA obtained by reverse transcription of mRNA that is a transcription product of OsPLDbeta2 gene.

  FIG. 2 is a diagram showing the structure of mRNA of the OsPLDbeta2 gene. As shown in FIG. 2, the mRNA of the OsPLDbeta2 gene consists of a sequence containing a translation region and untranslated regions (UTRs) on the 5 'side and 3' side of the translation region.

  A homologous gene of a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 is a gene consisting of a base sequence homologous to the base sequence of the gene and reducing high-temperature damage when expression is suppressed in gramineous plants If it is.

  The homologous gene may be, for example, a gene encoding a protein consisting of an amino acid sequence in which one or several amino acids of the amino acid sequence shown in SEQ ID NO: 1 are deleted, substituted or added.

  It is well known in the art that some amino acids in an amino acid sequence can be easily modified without significantly affecting the structure or function of a protein consisting of this amino acid sequence. Furthermore, it is also well known that there are variants that not only artificially modify, but also do not significantly change the structure or function of the protein.

  Further, the homologous gene encodes a protein comprising an amino acid sequence having 70% or more, preferably 85% or more, more preferably 90% or more, and further preferably 95% or more homology with the amino acid sequence shown in SEQ ID NO: 1, for example. It may be a gene.

  Further, the homologous gene may be a gene contained in a DNA comprising a base sequence in which one or several bases of the base sequence shown in any of SEQ ID NOs: 2 to 4 are deleted, substituted or added.

  In addition, the homologous gene may be a gene contained in a DNA that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence shown in any one of SEQ ID NOs: 2 to 4.

Hybridization is described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed. , Cold Spring
It can be performed by known methods such as the method described in Harbor Laboratory (1989). Usually, the higher the temperature and the lower the salt concentration, the higher the stringency (harder to hybridize), and a more homologous polynucleotide can be obtained. The appropriate hybridization temperature varies depending on the base sequence and the length of the base sequence. For example, when a DNA fragment consisting of 18 bases encoding 6 amino acids is used as a probe, a temperature of 50 ° C. or lower is preferable.

  As used herein, the term “stringent conditions” refers to hybridization solutions (50% formamide, 5 × SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7). .6) Incubate overnight at 42 ° C. in 5 × Denhart solution, 10% dextran sulfate, and 20 μg / ml denatured sheared salmon sperm DNA, then in 0.1 × SSC at about 65 ° C. The conditions under which the filter is washed are intended.

  The homologous gene is a nucleotide sequence having 70% or more, preferably 85% or more, more preferably 90% or more, and further preferably 95% or more homology with the base sequence shown in any one of SEQ ID NOs: 2 to 4. It may be a gene contained in the DNA.

  In the present specification, “DNA” includes a form of cDNA or genomic DNA. The DNA may be double-stranded or single-stranded. The single-stranded DNA may be a sense strand or an antisense strand. Further, the DNA may include an untranslated region (UTR) sequence, a vector sequence (including an expression vector sequence), and the like.

  Although it does not specifically limit as a supply source for acquiring DNA, It is preferable that it is a plant, More preferably, it is a gramineous plant, More preferably, it is rice.

  “Suppressing gene expression in a grass family plant” means to artificially suppress at least one step of transcription from DNA to mRNA or translation from mRNA to protein.

  Methods for suppressing gene expression include (a) a method of generating at least one selected from base deletion, substitution and insertion for a gene to be suppressed, (b) a method of suppressing by RNAi, etc. A known method can be used.

  When a deletion, substitution or insertion of a base is caused in a gene to be suppressed, the deletion, substitution or insertion is performed within the coding region (especially exon) of the gene, thereby destroying the function of this gene. There may be. In addition, deletion, substitution or insertion may be performed within the transcriptional regulatory region of the gene, thereby suppressing transcription of this gene.

  In the case of causing a base deletion or substitution, for example, a conventionally known mutant induction method may be used. In addition, in the case of causing base insertion, for example, a conventionally known method for inserting T-DNA may be used. Whether a base has been deleted, substituted or inserted into the target gene can be examined by a conventional method such as Southern hybridization, PCR, or DNA sequence analysis.

  When suppressing by RNAi method, a conventionally well-known method can be used. For example, use a vector in which at least a part of the sense strand sequence in the base sequence corresponding to the mRNA of the gene to be suppressed and the antisense strand sequence complementary to the sense strand sequence have an inverted repeat base sequence structure. May be. By introducing this vector into a gramineous plant by a known method, the expression of the OsPLDbeta2 gene can be suppressed by the RNAi method.

  A known method can be used as a method for introducing the vector into the gramineous plant. For example, a microinjection method, an electroporation method, a particle gun method, an Agrobacterium method, or the like can be used.

  “High-temperature injury” refers to a quality failure that occurs when a gramineous plant is exposed to high temperatures. For example, in the case of rice, high-temperature injury refers to the formation of white immature grains when exposed to high temperatures during the ripening period. “Exposed to high temperature” means being placed in an environment where the average temperature is about 28 ° C. or higher. The ripening period refers to a period of about 40 days after heading.

  “Reducing high temperature damage” refers to reducing quality damage caused by exposure of grasses to high temperatures. For example, in the case of rice, it means reducing the formation ratio of white immature grains when exposed to a high temperature during the ripening period, as compared with the above-described plant that does not suppress gene expression.

  The formation ratio of white immature grains is the ratio (%) of white immature grains to the total number of collected rice. Judgment as to whether or not it is a white immature grain can be made by visually observing the appearance of brown rice or using a grain discriminator. “Reducing the formation ratio of white immature grains” means reducing at least the formation ratio of white immature grains in the parent plant.

  In addition, the method according to the present invention can be realized using the following vector for producing a high temperature resistant gramineous plant according to the present invention.

[High temperature resistant gramineous plant production vector]
The present invention provides a vector for producing a high temperature resistant gramineous plant for use in the method according to the present invention. The vector for producing a high temperature resistant gramineous plant according to the present invention is a vector for suppressing the expression of a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a homologous gene thereof in a gramineous plant.

  If the vector for producing a high temperature resistant gramineous plant according to the present invention is used, the high temperature damage of the gramineous plant can be reduced, so that a high temperature resistant gramineous plant can be produced. That is, a grass family according to the present invention described later can be produced.

  As a vector used for the high temperature resistant gramineous plant production vector, known intermediate vectors, binary vectors and the like can be used.

  The vector for producing a high temperature resistant gramineous plant according to the present invention is at least one selected from deletion, substitution and insertion of a base relative to a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a homologous gene thereof. It is also possible to suppress the expression of the gene by causing

  Moreover, the high-temperature-resistant gramineous plant production vector according to the present invention may be one that suppresses the expression of a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a homologous gene thereof by the RNAi method.

  As an example of such a high temperature tolerant gramineous plant production vector, for example, at the downstream of the promoter sequence, at least a part of the sense strand sequence and the antisense strand sequence of the transcription region of the gene to be suppressed has an inverted repeat base sequence structure. The vector which is taken is mentioned. By introducing this high temperature resistant gramineous plant production vector into a gramineous plant, the expression of the OsPLDbeta2 gene can be suppressed by the RNAi method.

  The promoter sequence may be any promoter that can be transcribed in plant cells. For example, cauliflower mosaic virus 35S promoter can be used.

  The sense strand sequence and the antisense strand sequence may be, for example, at least a part of the sense strand sequence and the antisense strand sequence in the base sequence shown in SEQ ID NO: 4. The sense strand sequence may be an arbitrary portion of the base sequence shown in SEQ ID NO: 4, and the length of the sense strand sequence is not particularly limited. Preferably, the sense strand sequence is a sequence of 341 bp corresponding to 2900 bp to 3240 bp when the transcription start point is 1 in SEQ ID NO: 4.

  The antisense strand sequence may be a sequence complementary to the sense strand sequence to be combined.

  The spacer sequence between the sense strand sequence and the antisense strand sequence is not particularly limited, but is preferably an intron sequence, for example.

[Poaceae]
The present invention provides a grass plant in which high-temperature injury is reduced by the method according to the present invention. In particular, the present invention provides rice with reduced high temperature damage.

  In the present specification, the term “Poaceae” or “rice” includes not only seeds or plants themselves, but also cells, tissues, organs, induced callus, protoplasts, spheroplasts, etc. that form plants. Let it be a concept.

  In the gramineous plant according to the present invention, high temperature damage is reduced by suppressing the expression of a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 or a homologous gene thereof.

  The phrase “high temperature damage is reduced” means that the quality damage generated by exposure to a high temperature in a grass family plant is reduced. For example, in the case of rice, it means that the formation ratio of white immature grains when exposed to a high temperature during the ripening period is reduced, preferably compared to a plant in which the expression of the gene is not suppressed, preferably The formation ratio of white immature grains is reduced to 40% or less.

  Examples will be shown below, and the embodiments of the present invention will be described in more detail. Of course, the present invention is not limited to the following examples, and it goes without saying that various aspects are possible in detail.

[Example 1]
In this Example, a line in which the expression of rice phospholipase D gene OsPLDbeta2 was suppressed by RNAi (OsPLDbeta2-RNAi line) was produced.

(Construction of RNAi expression suppression vector)
First, a vector for suppressing expression by RNA interference (RNAi) of the OsPLDbeta2 gene was constructed by the following method.

  In this example, a pZH2Bik vector (Kuroda M, Kimizu M, Mikami C. 2010. A Simple Set of Plasmids for the Production of Transgenic Plants. Biosci. Biotech. Biochem. 74: 2348-2351) was used as a vector. . This vector is a binary vector that can be used for transformation with Agrobacterium.

  First, a DNA fragment a consisting of a partial sequence of mRNA of the OsPLDbeta2 gene was prepared. The prepared DNA fragment a is a 341 bp DNA fragment a consisting of a sequence corresponding to 2900 bp to 3240 bp when the transcription start point is 1 in the cDNA of the OsPLDbeta2 gene (SEQ ID NO: 4).

  Using the SDS-Phenol method, total RNA was extracted from the leaf blades of rice (Nipponbare). Single-stranded DNA was prepared from this total RNA using SuperScript II Reverse Transcriptase (Invitrogen). Using this single-stranded DNA as a template, DNA fragment a was prepared by PCR using primer 1F (SEQ ID NO: 5: GCCCATCCAAGAAAACCTCAC) and primer 1R (SEQ ID NO: 6: CGGAGAACCCTAATCCCTCA).

  The prepared DNA fragment a was inserted into two regions on the pZH2Bik vector in opposite directions to construct a vector for suppressing expression by RNAi. FIG. 3 is a diagram showing a construct of a vector for suppressing the expression of the OsPLDbeta2 gene by RNAi.

  In FIG. 3, LB and RB indicate T-DNA left and right border regions (about 0.7 kbp). P-CAMV35S represents the cauliflower virus 35S promoter (approximately 0.8 kbp). HPH indicates a hygromycin phosphotransferase gene (about 1.0 kbp). NosT represents a Nos terminator (about 0.3 kbp). OsmUbiP represents a modified rice polyubiquitin promoter (about 1.8 kbp). RAP intron indicates an intron (about 1.0 kbp) of the rice aspartic protease (Oryzasin1) gene (D32165).

(Preparation of OsPLDbeta2-RNAi strain)
Next, an OsPLDbeta2-RNAi strain was produced using the produced expression suppression vector.

  Expression suppression vectors were introduced into Nipponbare Callus by the Agrobacterium method (see WO 01/06844 pamphlet), and T0 generation seeds were obtained from the redifferentiated plants. The gene introduced by the generation promotion was fixed, and the OsPLDbeta2-RNAi line was established.

(Quantitative PCR)
The expression of OsPLDbeta2 in the prepared OsPLDbeta2-RNAi strain was analyzed by quantitative PCR. Moreover, vector control (rice which introduce | transduced only the pZH2Bik vector into Nipponbare) was used as control.

  The seeds of the OsPLDbeta2-RNAi strain and the vector control were aseptically sown in MS medium, and total RNA was extracted from each seedling after 15 days. Single-stranded DNA was prepared from this total RNA, and quantitative PCR was performed. In quantitative PCR, primer 2F (SEQ ID NO: 7: TTCCAATGTGGCCTGAAGGT) and primer 2R (SEQ ID NO: 8: CTAGGACTGCCGCCTGCTTC) were used. FIG. 4 is a diagram showing the position of the region amplified in the quantitative PCR of OsPLDbeta2.

  The results of quantitative PCR are shown in FIG. FIG. 5 is a graph showing the expression level (mRNA amount) of OsPLDbeta2 in each of the OsPLDbeta2-RNAi strain and the vector control. In addition, the amount of mRNA was expressed with the expression level of the rice polyubiquitin gene (RUBIQ1) (Wang et al. 2000 Plant Science 156: 201-211) as 100 (%).

  As a result of quantitative PCR, it was shown that the expression of OsPLDbeta2 was significantly reduced in the OsPLDbeta2-RNAi line compared to the vector control (FIG. 5).

(Formation of immature white grains by high-temperature treatment)
Next, for the produced OsPLDbeta2-RNAi line, the formation ratio (%) of white immature grains by high-temperature treatment was examined. As a control, the wild-type Nipponbare was used.

  The OsPLDbeta2-RNAi strain and the wild-type Nipponbare were cultivated at a normal temperature (27 ° C / 25 ° C) in a closed greenhouse (isolated greenhouse) and cultivated at a high temperature (33 ° C / 28 ° C) after heading. Seeds were collected 40 days after heading, and the formation ratio of white immature grains of rice was measured. In addition, it was judged whether it was a white immature grain by visually measuring the external appearance of brown rice, or measuring automatically using a grain discrimination machine (Shizuoka Seiki). When the method of visual observation was used, it was recognized as white immature grains when milky white was present even a little. Moreover, the formation ratio of white immature grains was calculated as the ratio (%) of white immature grains to the total number of collected rice.

  The result is shown in FIG. FIG. 6 is a graph showing the formation ratio (%) of white immature grains by high-temperature treatment in the OsPLDbeta2-RNAi line. Moreover, the number shown on the graph represents the number of cultivation tests.

  The formation ratio of white immature grains by high-temperature treatment in the OsPLDbeta2-RNAi line was significantly reduced compared to the wild-type Nipponbare (FIG. 6). From this, it was shown that the quality disorder | damage | failure by high temperature can be reduced by the expression suppression of OsPLDbeta2.

[Example 2]
In this example, an OsPLDbeta2-deficient line (OsPLDbeta2-Tos17 line) in which a retrotransposon Tos17 was inserted into the OsPLDbeta2 gene was prepared.

(Production of OsPLDbeta2-Tos17 line)
In Nipponbare, a strain (NE3817) in which Tos17 was inserted into the OsPLDbeta2 gene from a mutant population (mutant panel) that amplified retrotransposon Tos17 was transferred from the National Institute of Agrobiological Sciences Genome Resource Center. It was. The gene-fixed line (Mutant homo) by the generation promotion of this line was designated as OsPLDbeta2-Tos17 line.

  FIG. 7 is a diagram showing the OsPLDbeta2 gene region in the OsPLDbeta2-Tos17 strain. In the OsPLDbeta2-Tos17 strain, Tos17 is inserted at a position of 2075 bp in the base sequence shown in SEQ ID NO: 2.

(Formation of immature white grains by high-temperature treatment-closed greenhouse)
By using this OsPLDbeta2-Tos17 line, by the same method as in Example 1, it was cultivated in a closed greenhouse and subjected to a high temperature treatment, and the formation ratio of white immature grains was measured.

  The result is shown in FIG. FIG. 8 is a graph showing the formation ratio (%) of white immature grains by high-temperature treatment when the OsPLDbeta2-Tos17 line is cultivated in a closed greenhouse. Moreover, the number shown on the graph represents the number of cultivation tests.

  When the OsPLDbeta2-Tos17 line was cultivated in a closed greenhouse, the formation ratio of white immature grains by high-temperature treatment was significantly reduced compared to the wild-type Nipponbare (FIG. 8). From this, it was shown that the quality failure due to high temperature can be reduced by deleting OsPLDbeta2.

(Formation of white immature grains by high-temperature treatment-field)
Next, about the OsPLDbeta2-Tos17 line | system | group, the formation ratio (%) of the white immature grain by the high temperature process at the time of carrying out field cultivation was investigated. As a control, the wild-type Nipponbare was used.

  The OsPLDbeta2-Tos17 line and Nipponbare were cultivated in the field. At that time, just before heading (about 10 days before), high temperature treatment was performed by surrounding the cultivation area with 1.8-meter-high vinyl (seeding: April 10, 2010, field transplanting: May 18, 2010). Sun, high-temperature treatment start: August 2, 2010, heading date: Nipponbare August 9-11; OsPLDbeta2-Tos17 line August 12-13). Seeds were collected 40 days after heading, and the formation ratio of white immature grains of rice was measured in the same manner as in Example 1.

  The result is shown in FIG. FIG. 9 is a graph showing the formation ratio (%) of white immature grains by high-temperature treatment when the OsPLDbeta2-Tos17 line is grown in the field. Moreover, the number shown on the graph represents the average temperature for 20 days after heading.

  When the OsPLDbeta2-Tos17 line was cultivated in the field, the formation ratio of white immature grains by high-temperature treatment was significantly reduced compared to the wild-type Nipponbare (FIG. 9). From this, it was shown that the quality failure due to high temperature can be reduced even in field cultivation by deleting OsPLDbeta2.

  Therefore, the present invention is promising as a practical trait of agriculture, suggesting that it is useful for the development of high temperature resistant materials.

[Comparative Example]
For the following seven phospholipase D genes other than OsPLDbeta2 in rice, lines in which expression was suppressed by RNAi were prepared. The RAP locus ID of each gene is shown in parentheses.
OsPLDalfa1 (Os01g0172400)
OsPLDalfa3 (Os06g0604400)
OsPLDalfa4 (Os06g0604200)
OsPLDalfa5 (Os06g0604300)
OsPLDbeta1 (Os10g0524400)
OsPLDdelta2 (Os03g0840800)
OsPLDepsilon (Os09g0421300)
For the production of these suppression systems, the same method as in Example 1 was used.

  About each produced suppression system | strain, the formation ratio (%) of the white immature grain by a high temperature process was measured by the method similar to Example 1. FIG. As a control, the wild-type Nipponbare was used. The result is shown in FIG. FIG. 10 is a graph showing the formation ratio (%) of white immature grains by high-temperature treatment in each of the rice phospholipase D gene repression lines.

  As shown in FIG. 10, among the phospholipase D genes examined this time, it was shown that high-temperature injury could not be reduced or the effect was low even if the expression was suppressed for genes other than OsPLDbeta2.

  Since the present invention can efficiently reduce high temperature damage in rice, it is useful for developing practical agricultural technology.

Claims (10)

A method for reducing high-temperature damage in gramineous plants, comprising suppressing the expression of any of the following genes (A) to (C) in gramineous plants:
(A) a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 1;
(B) a gene encoding a protein comprising an amino acid sequence in which one or several amino acids of the amino acid sequence shown in SEQ ID NO: 1 has been deleted, substituted or added, and expression is suppressed in a grass family plant Genes that reduce high temperature injury
(C) A gene encoding a protein comprising an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 1, and reducing high-temperature injury when expression is suppressed in a grass family plant. A method for reducing high-temperature damage in gramineous plants, which comprises suppressing the expression of a gene contained in any of the following DNAs (A) to (C):
(A) DNA comprising the base sequence shown in any one of SEQ ID NOs: 2 to 4;
(B) It consists of a base sequence in which one or several bases of any one of SEQ ID NOs: 2 to 4 are deleted, substituted or added, and high-temperature damage occurs when expression is suppressed in a grass family DNA comprising a gene that reduces
(C) Hybridization with DNA comprising a nucleotide sequence complementary to the nucleotide sequence shown in any one of SEQ ID NOs: 2 to 4 under stringent conditions to reduce high-temperature damage when expression is suppressed in gramineous plants DNA containing the gene to be made.   The method according to claim 1 or 2, wherein the gene expression is suppressed by generating at least one selected from base deletion, substitution and insertion for the gene.   The method according to claim 3, wherein the insertion is T-DNA insertion.   The method according to claim 1 or 2, wherein the expression of the gene is suppressed by RNAi method.   The method according to any one of claims 1 to 5, wherein the gramineous plant is rice.   The method according to claim 6, wherein the high temperature disorder is formation of white immature grains when exposed to a high temperature during a ripening period.   A grass family plant, wherein high-temperature injury is reduced by the method according to any one of claims 1 to 7.   Rice having reduced high-temperature damage by the method according to any one of claims 1 to 7. The rice according to claim 9 , wherein the high-temperature disorder is formation of white immature grains when exposed to a high temperature during the ripening period.

Images