JP5840351B2 - Nucleic acids and corresponding proteins referred to as 98P4B6 useful in the treatment and detection of cancer - Google Patents

Description

(Citation of related application)
This application is a pending US patent application number USSN 10/407, filed April 4, 2003.
484, which is a continuation of US Patent Application No. USSN 10/2 filed on September 6, 2002.
US Patent Application No. US filed December 6, 1999, claiming priority from 36,878
Claims priority from SN09 / 455,486 and claims priority from US patent application number USSN 09 / 323,873 filed June 1, 1999 (currently US Pat. No. 6,329,503). . This application is filed with US provisional patent application number US filed on December 20, 2002.
SN 60 / 435,480 and US Provisional Patent Application No. 60/3 filed on September 6, 2001
U.S. Provisional Application No. 60 / 370,387, filed Apr. 17,840 and Apr. 5, 2002
Claim priority from. This application is a provisional patent application number 6 filed June 1, 1998.
US Provisional Application No. 60/091, filed June 30, 1998, 0 / 087,520.
U.S. Patent Application Nos. 10 / 011,095 filed December 6, 2001 and U.S. Provisional Application Nos. 10 / 010,667 and 2001 filed Dec. 6, 2001.
Related to US Provisional Patent Application No. 60 / 296,656, filed June 6, 2002, and US Patent Application No. 10 / 165,044, filed June 6, 2002. The contents of the applications listed in this paragraph are fully incorporated herein by reference.

(Statement of rights to the present invention under research supported by the US Government)
Not applicable.

(Field of Invention)
The invention described herein relates to the gene and the protein encoded thereby, which is referred to as 98P4B6 and is expressed in certain cancers. The present invention is 98P.
The present invention relates to diagnostic and therapeutic methods and compositions useful in the management of cancers that express 4B6.

(Background of the Invention)
Cancer is the second leading cause of death in humans after coronary artery disease. Worldwide, millions of people die from cancer each year. In the United States alone, American Cancer So
As reported by city, cancer causes death of well over 500,000 people each year, and more than 1.2 million new cases are diagnosed each year. While deaths from heart disease have decreased significantly, deaths from cancer are generally on the rise. In the early part of the next century, cancer is predicted to be a major cause of death.

Worldwide, several cancers are prominent as major killers. Especially the lungs,
Prostate, breast, colon, pancreas, and ovarian carcinomas represent the leading cause of death from cancer. These and virtually all other carcinomas share common lethal characteristics. With very few exceptions, metastatic disease caused by carcinoma is fatal. Furthermore, even in the early stages, even cancer patients who survived the primary cancer have shown a common experience that their lives have changed dramatically. Many cancer patients experience strong anxiety driven by recognizing the possibility of recurrence or treatment failure. Many cancer patients experience physical weakness after treatment. In addition, many cancer patients experience a recurrence.

Worldwide, prostate cancer is the fourth most prevalent cancer in men. In North America and Scandinavia, prostate cancer is by far the most common cancer in men and the second leading cause of cancer death in men. In the United States alone, well after pulmonary cancer, well over 30,000 men die each year from this disease. Despite the scale of these numbers, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy,
Hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modality. Unfortunately, these procedures are ineffective for many and often have undesirable consequences.

The lack of prostate tumor markers that can accurately detect early stage local tumors in the diagnostic setting leaves significant limitations in the diagnosis and management of the disease. Serum prostate specific antigen (PSA) assay is a very useful tool, but its specificity and general utility are widely considered lacking some significant points.

Advances in identifying additional specific markers for prostate cancer have been improved by the generation of prostate cancer xenografts that can reproduce different stages of the disease in mice. LAPC (Los Angeles Prostate Cancer) xenografts have demonstrated the ability to survive passage in severe combined immunodeficiency (SCID) mice and mimic the transition from androgen-dependent to androgen-independent A graft (Klein et al., 1997, Nat. Med. 3: 402). More recently identified prostate cancer markers include the following: PCTA-1 (Su et al., 1996, Pr
oc. Natl. Acad. Sci. USA 93: 7252), prostate specific membrane (PSM)
) Antigen (Pinto et al., Clin Cancer Res September 2, 1996 (9):
1445-51), STEAP (Hubert et al., Proc Natl Acad Sc
i USA. 1999 Dec 7; 96 (25): 14523-8) and prostate stem cell antigen (PSCA) (Reiter et al., 1998, Proc. Natl. Acad. Sc.
i. USA 95: 1735).

Previously identified markers such as PSA, PSM, PCTA and PSCA have facilitated efforts to diagnose and treat prostate cancer, but to further improve diagnosis and therapy, prostate cancer and related cancers There is a need to identify additional markers and therapeutic targets for.

Renal cell carcinoma (RCC) accounts for about 3% of adult malignancies. Once the adenoma is 2 to 3 in diameter
When reaching cm, there is the potential for malignancy. In adults, the two main malignant kidney tumors are renal cell adenomas and transitional cell carcinomas of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated to exceed 29,000 cases in the United States, and in 1998, more than 11,600 patients died from the disease. Transitional cell carcinoma is less frequent, with an incidence of about 500 cases per year in the United States.

Surgery has been the main treatment for renal cell adenocarcinoma for decades. Until recently, metastatic disease was refractory to any systemic treatment. With the recent development of systemic treatment (especially immunotherapy), metastatic renal cell carcinoma can be aggressively approached in appropriate patients with the possibility of an acceptable response. Nevertheless, there remains a need for effective treatments for these patients.

Of all new cases of cancer in the United States, bladder cancer represents approximately 5% in men (5th of the most common neoplasms) and 3% (8th of the most common neoplasms) in women . The number of outbreaks increases slowly, consistent with an increase in the elderly population. In 1998, an estimated 54,500 including 39,500 cases in men and 15,000 cases in women
It was a case. The age-adjusted incidence in the United States is 32 per 100,000 for men and 8 per 100,000 for women. The 3: 1 historical male / female ratio may decrease in relation to smoking patterns in women. In 1998, an estimated 11,000 people died of bladder cancer (7,800 men and 3,900 women). Bladder cancer incidence and mortality increase greatly with age, and the problems increase as the population ages.

Most bladder cancers recur in the bladder. Bladder cancer is managed using a combination of transurethral resection (TUR) of the bladder and intravesical chemotherapy or immunotherapy. The multifocal and recurrent nature of bladder cancer points to the limitations of TUR. Most muscle-invasive cancers are TUR
It does not heal alone. Radical cystectomy and urinary divers
ion) is the most effective means of removing cancer, but possesses undeniable effects on urine and sexual function. There continues to be a significant need for treatment modalities that are beneficial to patients with bladder cancer.

In the United States in 2000, an estimated 130,200 colorectal cancers occurred, including 93,800 colon cancers and 36,400 rectal cancers. Colorectal cancer is the third most common cancer in men and women. Incidence decreased significantly between 1992 and 1996 (−2.1% per year). Studies suggest that these reductions are due to increased screening and polyp removal that prevent the polyps from progressing to invasive cancers. An estimated 56,300 people died in 2000 (47,700 were colon cancer, 8,600
People accounted for about 11% of all cancer deaths in the United States.

Currently, surgery is the most common form of treatment for colorectal cancer and cancer that has not spread, which is often curative. Chemotherapy or radiation in addition to chemotherapy is provided to most patients whose cancer has penetrated deep into the intestinal wall or spread to lymph nodes before or after surgery. Permanent colostomy (formation of the abdominal opening to eliminate bodily excretion) is sometimes required for colon cancer and frequently required for rectal cancer. There remains a need for effective diagnostic and treatment modalities for colorectal cancer.

In 2000, there were an estimated 164,100 new cases of lung and bronchial cancer, accounting for 14% of all US cancer diagnoses. The incidence of lung and bronchial cancer has decreased significantly in men, from as high as 86.5 out of 100,000 in 1984 to 70.0 in 1996. In the 1990s, the rate of increase among women began to decline. In 1996, the incidence in women was 42.3 out of 100,000.

Lung and bronchial cancers caused an estimated 156,900 deaths in 2000,
It accounted for 28% of all cancer deaths. Between 1992 and 1996, mortality from lung cancer decreased significantly among men (-1.7% per year), while mortality for women still increased significantly (1 0.9% per year). Since 1987, more women have died every year due to lung cancer than breast cancer and have been the leading cause of cancer death in women for longer than 40 years. The decrease in lung cancer incidence and mortality is most likely due to a decrease in smoking rates over the past 30 years; Although the decline in tobacco use in adults has slowed, it is significant that tobacco use in youth has increased again.

Treatment options for lung cancer and bronchial cancer are determined by the type and stage of the cancer, and options include surgery, radiation therapy and chemotherapy. For many localized cancers, surgery is usually the preferred treatment. Because the disease is usually spread by the time it is discovered, radiation therapy and chemotherapy are often required in combination with surgery. Chemotherapy alone or in combination with radiation therapy is a selective treatment for small cell lung cancer; with this regimen, a large percentage of patients experience remission, which in some cases lasts long. However, there remains a need for effective treatment and diagnostic approaches for lung and bronchial cancer.

An estimated 182,800 new invasive cases of breast cancer were predicted to occur among US women during 2000. In addition, approximately 1,400 new cases of breast cancer were predicted to be diagnosed in men in 2000. After an increase of about 4% per year in the 1980s, the incidence of breast cancer in women peaked at about 110.6 cases per 100,000 in the 1990s.

In the United States alone, an estimated 41,200 people died in 2000 due to breast cancer (40,8
00 are women, 400 are men). Breast cancer is the second leading cause of cancer death in women. According to recent data, mortality decreased significantly between 1992 and 1996, with the largest decrease among both white and black young women. These reductions were probably the result of earlier detection and treatment improvements.

Taking into account the medical environment and patient preferences, breast cancer treatment may include the following: tumor removal (local removal of tumor) and removal of armpit lymph nodes; mastectomy (surgical removal of the breast)
And removal of armpit lymph nodes; radiation therapy; chemotherapy; or hormone therapy. Often 2
Two or more methods are used in combination. Numerous studies have shown that for early stage disease, long-term survival after radiation therapy in addition to tumor resection is similar to survival after modified radical mastectomy. Significant advances in reconstruction techniques offer several options for breast reconstruction after mastectomy. In recent years, such reconstruction has been performed simultaneously with mastectomy.

Local resection of in situ ductal carcinoma (DCIS) with an appropriate amount of surrounding normal breast tissue may prevent local recurrence of DCIS. Irradiation of the chest and / or tamoxifen can reduce the chance of DCIS occurring in the remaining breast tissue.
This is important because DCIS can develop into invasive breast cancer if left untreated. Nevertheless, these treatments have serious side effects or sequelae.
Therefore, there is a need for effective breast cancer treatment.

There were an estimated 23,100 new cases of ovarian cancer in the United States in 2000. Ovarian cancer accounts for 4% of all cancers in women and is ranked second in gynecological cancers. 19
Between 1992 and 1996, the incidence of ovarian cancer decreased significantly. As a result of ovarian cancer, an estimated 14,000 people died in 2000. Ovarian cancer causes more deaths than any other cancer in the female reproductive system.

Surgery, radiation therapy, and chemotherapy are treatment options for ovarian cancer. Surgical procedures typically include excision of one or both of the ovaries, resection of the fallopian tube (tubal ovariectomy), and uterine resection (hysterectomy). In some very early tumors, only the involved ovaries are removed, especially in young women who want to have children.
In advanced disease, attempts are made to eliminate all intra-abdominal disease and enhance the effectiveness of chemotherapy. There remains an important need for effective treatment options for ovarian cancer.

There were an estimated 28,300 new cases of pancreatic cancer in the United States in 2000. Over the past 20 years, the proportion of pancreatic cancer has decreased in men. The proportion among women remains roughly constant but may begin to decrease. Pancreatic cancer caused an estimated 28,200 deaths in the United States in 2000. Over the past 20 years, mortality in men has been modestly reduced (significantly -0.9% per year), while that rate has increased slightly in women.

Surgery, radiation therapy, and chemotherapy are treatment options for pancreatic cancer. These treatment options can prolong survival and / or alleviate the symptoms in many patients, but do not appear to produce cure for most people. There is a significant need for additional therapeutic and diagnostic options for pancreatic cancer.

(Summary of the Invention)
The present invention relates to the gene designated 98P4B6, which has been found to be overexpressed in the cancers listed in Table I. Northern blot expression analysis of 98P4B6 gene expression in normal tissues shows a restricted expression pattern in adult tissues. 9
The nucleotide sequence (FIG. 2) and amino acid sequence (FIGS. 2 and 3) of 8P4B6 are provided. The tissue-related profile of 98P4B6 in normal adult tissues, combined with the overexpression observed in the tissues listed in Table 1, is that 98P4B6 is abnormally overexpressed in at least some cancers and is therefore listed in Table I To serve as a useful diagnostic, prophylactic, prognostic and / or therapeutic target for cancers of tissues such as the treated tissue.

The present invention provides the following: polynucleotides corresponding or complementary to all or part of the 98P4B6 gene, mRNA and / or coding sequence (preferably in isolated form), including: : 98P4B6-related proteins, and 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 1
A polynucleotide encoding a 98P4B6-related fragment of 9, 20, 21, 22, 23, 24, 25 or more consecutive amino acids); at least 3 98P4B6-related proteins
0, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 10
0 or more than 100 consecutive amino acids, as well as the peptide / protein itself;
DNA, RNA, DNA / RNA hybrids and related molecules, polynucleotides or oligonucleotides that are complementary to or have at least 90% homology to the gene sequence or mRNA sequence of 98P4B6, or a portion thereof, and 98P
A polynucleotide or oligonucleotide that hybridizes to a 4B6 gene, mRNA or a 98P4B6-encoding polynucleotide. Also provided are means for isolating cDNA and genes encoding 98P4B6. A recombinant DNA molecule comprising a 98P4B6 polynucleotide, cells transformed or transduced with such a molecule, and 98P
A host-vector system for expression of the 4B6 gene product is also provided. The present invention further includes
Antibodies that bind to 98P4B6 proteins and polypeptide fragments thereof are provided, including polyclonal and monoclonal antibodies, mouse and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and detection Antibodies labeled with possible markers or therapeutic agents. In certain embodiments,
However, the entire nucleic acid sequence of FIG. 2 is not encoded and / or the entire amino acid sequence of FIG. 2 is not prepared. In certain embodiments, the entire nucleic acid sequence of FIG. 2 is encoded and / or the entire amino acid sequence of FIG. 2 is prepared, any of which are individual human unit dosage forms.

The present invention further provides methods for detecting the presence and status of 98P4B6 polynucleotides and proteins in various biological samples, and methods for identifying cells that express 98P4B6. Exemplary embodiments of the present invention provide a method for monitoring 98P4B6 gene product in tissue samples or hematological samples that have or are suspected of having some form of growth dysregulation such as cancer. To do.

The present invention relates to various immunogenic or therapeutic compositions for treating cancers that express 98P4B6 (eg, cancers of tissues listed in Table I), and strategies (98P4B6 transcription, translation, processing or Further provided are cancer vaccines, including treatments aimed at inhibiting function. In one aspect, the invention provides 98P in a human subject.
Provided are compositions for treating cancers expressing 4B6, and methods comprising them, wherein the composition comprises a carrier suitable for human use and one or more that inhibits the production or function of 98P4B6. Includes a human unit dose of the drug. Preferably, this carrier is a unique human carrier. In another aspect of the invention, the agent is a moiety that is immunoreactive with 98P4B6 protein. Non-limiting examples of such moieties include antibodies (eg, single chain, monoclonal antibodies, polyclonal antibodies, humanized antibodies, chimeric antibodies or human antibodies), those that exist (naturally occurring or synthesized) Functional equivalents thereof, as well as combinations thereof, but are not limited thereto. These antibodies can be conjugated to a diagnostic or therapeutic moiety. In another aspect, the agent is a small molecule as defined herein.

In another aspect, the agent comprises one or more peptides comprising a cytotoxic T lymphocyte (CTL) epitope that binds to an HLA class I molecule in humans to induce a CTL response to 98P4B6 and / or an HLA class in humans. HT by binding to II molecule
One or more peptides comprising a helper T lymphocyte (HTL) epitope that elicits an L response The peptides of the invention can be the same or one or more separate polypeptide molecules. In a further aspect of the invention, the agent comprises one or more nucleic acid molecules that express one or more of the peptides that stimulate the CTL response or HTL response as described above. In yet another aspect of the invention, the one or more nucleic acid molecules can express a moiety that immunologically reacts with 98P4B6 as described above. The one or more nucleic acid molecules can also be or encode a molecule that inhibits the production of 98P4B6. Non-limiting examples of such molecules include molecules complementary to a nucleotide sequence essential for the production of 98P4B6 (eg, an antisense sequence or a molecule that forms a triple helix with a nucleotide duplex that is essential for 98P4B6 production). Alternatively, ribozymes effective to lyse 98P4B6 mRNA are included, but are not limited thereto.

Tables VIII-XXI and XXII-XLIX (collectively HLA Peptides Table) for parent proteins (eg, Variant 1, Variant 2, etc.)
Note the following three factors to determine the starting position of any peptide shown in e)): specific variants, peptide lengths in the HLA peptide table,
And search peptides in Table VII. In general, a unique search peptide is used to obtain a specific HLA peptide for a specific variant. The position of each search peptide relative to its respective parent molecule is listed in Table VII. Thus, if the search peptide starts at position “X”, Table VIII-XX to obtain the actual position of the HLA peptide in these parent molecules
The value “X-1” must be added for each position in I and XXII-XLIX. For example, if a particular search peptide starts at position 150 of its parent molecule, 150-1 or 149 must be added to each HLA peptide amino acid position to calculate the amino acid position in the parent molecule.

One embodiment of the present invention is collectively shown in Tables VIII through XXI and Table XXII through Table X.
Includes an HLA peptide that appears at least twice in LIX, or an oligonucleotide encoding the HLA peptide. Another embodiment of the present invention is provided by Tables VIII to XXI
HLA peptides that appear at least once and at least once in Tables XXII to XLIX, or oligonucleotides that encode the HLA peptides.

Another embodiment of the invention is an antibody epitope comprising a peptide region having one, two, three, four, or five of the following characteristics, or an oligonucleotide encoding the peptide region:
i) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG.
, 0.6, 0.7, 0.8, 0.9 or more, or including amino acid positions having a value equal to 1.0);
ii) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3, 0.5, 0.4, 0.3 in the hydropathic profile of FIG. , 0.2, 0.1 or less, or including an amino acid position having a value equal to 0.0);
iii) a peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (percent accessible residues (Per) in any integer increment up to the full length of the protein in FIG. 3;
cent Accessible Residues) profile, 0.5,
Including amino acid positions having values greater than or equal to 0.6, 0.7, 0.8, 0.9 or equal to 1.0);
iv) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (Average Fl in FIG. 8 in any integer increment up to the full length of the protein in FIG.
(exibility) profile, 0.5, 0.6, 0.7, 0.8, 0.9
Including amino acid positions having a value greater than or equal to 1.0);
v) A peptide region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG.
Including amino acid positions having values greater than or equal to 5, 0.6, 0.7, 0.8, 0.9 or equal to 1.0).

(Detailed description of the invention)
(Summary of section)
I. ) Definition II. ) 98P4B6 polynucleotide II. A. ) Uses of 98P4B6 polynucleotides II. A. 1. ) Monitoring genetic abnormalities II. A. 2. ) Antisense Embodiments II. A. 3. ) Primers and primer pairs II. A. 4). ) Isolation of 98P4B6-encoding nucleic acid molecule II. A. 5. ) Recombinant nucleic acid molecules and host-vector systems III. ) 98P4B6-related protein III. A. ) Embodiment of motif-bearing protein III. B. ) Expression of 98P4B6-related proteins III. C. ) Modification of 98P4B6-related proteins III. D. ) Use of 98P4B6-related protein IV. ) 98P4B6 antibody V. ) 98P4B6 cell immune response VI. ) 98P4B6 transgenic animals VII. ) 98P4B6 detection method VIII. ) Methods for monitoring the status of 98P4B6-related genes and their products IX. ) Identification of molecules that interact with 98P4B6 X. ) Treatment methods and compositions X. A. ) Anti-cancer vaccine X. B. ) 98P4B6 as a target for antibody-based therapy
X. C. ) 98P4B6 as a target for cellular immune response
X. C. 1. Minigene vaccine X. C. 2. Combination of CTL peptide and helper peptide X. C. 3. Combination of CTL peptide and T cell priming agent X. C. 4). Vaccine composition comprising DC pulsed with CTL peptide and / or HTL peptide X. D. ) Adoptive immunotherapy X. E. ) Administration of vaccines for therapeutic or prophylactic purposes XI. ) 98P4B6 diagnostic and prognostic embodiments XII. ) Inhibition of 98P4B6 protein function XII. A. ) Inhibition of 98P4B6 using intracellular antibodies XII. B. ) Inhibition of 98P4B6 using recombinant proteins XII. C. ) Inhibition of transcription or translation of 98P4B6 XII. D. ) General considerations for therapeutic strategies XIII. ) Identification, characterization and use of modulators of 98P4B6 XIV. ) Manufacture of kits / products.

(I.) Definition)
Unless otherwise defined, all terms, symbols, and other scientific or technical terms used in the field are used generically by those of ordinary skill in the art to which this invention pertains. It is intended to have the meaning understood by In some cases, terms having a generally understood meaning are defined herein for clarity and / or easy reference, and such definitions herein. The inclusion of is not necessarily to be construed as indicating a substantial difference in meaning beyond what is commonly understood in the art. Techniques and procedures described or referenced herein (eg, Sambrook
k et al., Molecular Cloning: A Laboratory Manual
, 2nd Edition, (1989), Cold Spring Harbor Laborato
ry Press, Cold Spring Harbor, N.A. Y. The widely used molecular cloning methodologies described in (1) are well understood and are commonly used by those skilled in the art using conventional methodologies. Where appropriate, procedures involving the use of commercially available kits and reagents generally follow protocols defined by the manufacturer and / or otherwise described parameters. Done.

The terms "advanced prostate cancer", "locally advanced prostate cancer", "advanced disease", and "locally advanced disease" mean prostate cancer that has spread through the prostate capsule and is an American Stage C disease under the Urological Association (AUA) system, stage C1-C2 disease under the Whitmore-Jewett system, and TNM (tumor, node, meta,
tasasis) system) is meant to include stages T3-T4 and N + disease. In general, surgery is not recommended for patients with locally advanced disease, and these patients have prostate cancer that is clinically localized (organ limited) Have substantially less favorable results compared to existing patients. Locally advanced disease is clinically identified by obvious evidence such as a lump beyond the lateral edges of the prostate or an asymmetry or lump above the base of the prostate. Locally advanced prostate cancer is now considered after radical prostatectomy if the tumor invades or invades the prostate capsule, extends to the surgical margin, or invades the sperm parcel. Diagnosed pathologically.

“Modifying the native glycosylation pattern” is intended for the purposes herein, removing one or more carbohydrate moieties found in the native sequence 98P4B6 (removing an endogenous glycosylation site). By chemical means and / or
Or by removing glycosylation by enzymatic means) and / or adding one or more glycosylation sites that are not present in native sequence 98P4B6. Furthermore, this phrase includes qualitative changes in glycosylation of natural proteins and relates to changes in the nature and proportion of the presence of various carbohydrate moieties.

The term “analog” refers to a molecule that is structurally similar or that shares similar or consistent properties with another molecule (eg, 98P4B6-related protein). For example, 98P4B
An analog of 6 proteins can be specifically bound by antibodies or T cells that specifically bind to 98P4B6.

The term “antibody” is used in the broadest sense. Thus, “antibodies” can be naturally occurring or artificially produced, such as monoclonal antibodies produced by conventional hybridoma technology. Anti-98P4B6 antibodies include monoclonal and polyclonal antibodies as well as fragments that contain an antigen binding domain and / or one or more complementary determining regions of these antibodies.

An “antibody fragment” is defined as at least a portion of a variable region of an immunoglobulin molecule that binds to a target (ie, an antigen binding region). In one embodiment, this specifically covers a single anti-98P4B6 antibody and clones thereof (including agonists, antagonists and neutralizing antibodies) and anti-98P4B6 antibody compositions having polyepitopic specificity. .

The term “codon optimized sequence” refers to a nucleotide sequence that has been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences optimized for expression in a given host species by removal of pseudopolyadenylation sequences, removal of exon / intron splicing signals, removal of transposon-like repeats and / or optimization of GC content in addition to codon optimization Are referred to herein as “expression enhancing sequences”.

A “combinatorial library” is a collection of diverse compounds generated by either chemical synthesis or biosynthesis by combining a number of chemical “base units” (eg, reagents). For example, linear combinatorial chemical libraries, such as polypeptide (eg, mutein) libraries, are all possible methods for a given compound length (ie, number of amino acids in a polypeptide compound). Formed by combining a series of chemical building blocks called amino acids. Numerous compounds are synthesized through combinatorial mixing of such chemical building blocks (Gallop et al., J. M.
ed. Chem. 37 (9): 1233-1251 (1994)).

The preparation and screening of combinatorial libraries is well known to those skilled in the art.
Such combinatorial chemical libraries include peptide libraries (eg, US Pat. No. 5,010,175, Furka, Pept. Prot. Res. 37:
487-493 (1991), Houghton et al., Nature, 354: 84-88.
(1991)), peptoids (PCT publication number WO91 / 19735), encoded peptides (PCT publication WO93 / 20242), random biooligomers (PCT publication WO9).
2/00091), benzodiazepines (US Pat. No. 5,288,514), diversomers (eg, hydantoins), benzodiazepines and dipeptides (Hobbs et al., Proc. Nat. Acad. Sci. USA 90: 6909).
-6913), vinylogous polypeptides (Hagihara et al., J. Amer. Chem. Soc. 114: 6568 (1992)), non-peptidal peptidomimetics with a β-D-glucose skeleton (Hirs
chmann et al. Amer. Chem. Soc. 114: 9217-9218 (19
92)), organic synthesis of similar small molecule libraries (Chen et al., J. Amer. Chem).
. Soc. 116: 2661 (1994)), oligocarbamates (Cho et al., Scie).
nce 261: 1303 (1993)), and / or peptidyl phosphonate (C
ampbell et al. Org. Chem. 59: 658 (1994)), but is not limited thereto. See generally Gordon et al. Med. Chem. 37:
1385 (1994), nucleic acid libraries (eg, Stratagene, Corp.
), Peptide nucleic acid libraries (see, eg, US Pat. No. 5,539,083), antibody libraries (see, eg, Vaughn et al., Nature Biotec).
hnology 14 (3): 309-314 (1996), and PCT / US96 /
10287), carbohydrate libraries (eg, Liang et al., Scien
ce 274: 1520-1522 (1996), and US Pat. No. 5,593,853.
), Small organic molecule libraries (eg, benzodiazepine, Baum, C
& EN, Jan. 18, p. 33 (1993); isoprenoids, US Pat. No. 5,569,5
88; thiazolidinones and metathiazanones, US Pat. No. 5,549,974; pyrrolidines, US Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, US Pat. No. 5,506,337 Benzodiazepines, US Pat. No. 5,288,
See 514 etc.).

Devices for the preparation of combinatorial libraries are commercially available (eg, 357 NIPS, 390 NIPS, Advanced Chem Tech, Louisville KY; Symphony, Rainin, Woburn MA; 433A, Applied Biosystems, Foster 90, Flu 90 , Bedford, NIA). Many well-known robotic systems have also been developed for liquid phase chemistry. These systems include automated workstations that mimic manual synthesis operations performed by chemists (eg, automated synthesizers developed by Takeda Chemical Industries, LTD. (Osaka, Japan), and many using robotic arms. Robot systems (Zymate H, Zymark Corporation, Hopkinton, Mass .; Orca, Hewlett-Packard, Palo Alto, Calif.)). Any of the above devices are suitable for use with the present invention. Modifications to the nature and implementation thereof will be apparent to those skilled in the art so that these devices may operate as described herein (if necessary). In addition, numerous combinatorial libraries are commercially available (eg, ComGenex, Princeton, NJ; Asinex, Moscow, RU; Tripos, Inc., St. Louis, MO; ChemStar, Ltd, Moscow, RU; 3D Pharmaceuticals, Exton, PA; see Martek Biosciences, Columbia, MD, etc.)
The term “cytotoxic agent” refers to a substance that inhibits or prevents cell expression activity, cell function, and / or causes destruction of cells. The term includes radioactive isotope chemotherapeutic agents and toxins (eg, small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and / or variants thereof). Is intended. Examples of cytotoxic agents include, but are not limited to: auristatins, auromycins , maytansinoids , yttrium, bismuth, lysine, ricin A chain, combrestatin, duocarmycin , Drostatins, doxorubicin, daunorubicin, taxol, cisplatin, cc1065, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxyanthracindione, actinomycin, diphtheria toxin, Pseudomonas exotoxin PE (PE) PE , Abrin, abrin A chain, modeccin A chain, α-sarcin, gelonin, mitage Mitogellin, retortostrictin, phenomycin, enomycin, curicin, crotin, calicheamicin, saponaria officinalis inhibitor, and other glucocorticoids, and Radioisotopes (eg, radioisotopes of Lu including At ²¹¹ , I ¹³¹ , I ¹²⁵ , Y ⁹⁰ , Re ¹⁸⁶ , Re ¹⁸⁸ , Sm ¹⁵³ , Bi ^{212 or 213} , P32 and Lu ¹⁷⁷ ). The antibody can also bind to an anti-cancer prodrug activating enzyme that can convert the prodrug to an active form.

A “gene product” is sometimes referred to herein as a protein or mRNA.
For example, “gene product of the present invention” refers herein to “cancer amino acid sequence”, “cancer protein”, “cancer proteins listed in Table I”, “cancer mRNA”, “Table I”. It may be referred to as “cancer mRNA”. In one embodiment, the oncoprotein is in FIG.
Of nucleic acids. The oncoprotein can be a fragment or it can be a full-length protein for the fragment encoded by the nucleic acid of FIG. In one embodiment, cancer amino acid sequences are used to determine sequence identity or sequence similarity. In another embodiment, the sequence is a naturally occurring mutant of the protein encoded by the nucleic acid of FIG. In another embodiment, the sequence is a sequence variant as described below and described.

“High-throughput screening” assays for the presence, absence, quantification, or other properties of a particular nucleic acid or protein product are well known to those of skill in the art. Similarly, binding assays and reporter assays are well known. Thus, for example, US Pat. No. 5,55.
9,410 discloses a high-throughput screening method for proteins;
US Pat. No. 5,585,639 discloses a high-throughput screening method for nucleic acid binding (ie, in an array); while US Pat. Nos. 5,576,220 and 5,541,061 disclose ligand / antibodies. Disclosed are high-throughput screening methods for binding.

In addition, high throughput screening systems are commercially available (eg, Ame
rsham Biosciences, Piscataway, NJ; Zymark C
orp. , Hopkinton, MA; Air Technical Industry
es, Mentor, OH; Beckman Instruments, Inc. Ful
erton, CA; Precision Systems, Inc. , Natick,
MA; etc.). These systems typically include pipetting all samples and reagents, preparing liquids, scheduled incubation steps,
And finally automate the entire procedure including reading the microplate with a detector suitable for the assay. These configurable systems provide high throughput and fast start-up, as well as a high degree of flexibility and customization.
The manufacture of such systems provides detailed protocols for various high throughput systems. Thus, for example, Zymark Corp. Provides a technical bulletin describing screening systems for detecting modulation of gene transcription, ligand binding, and the like.

The term “homologue” refers to a molecule that exhibits homology to another molecule (eg, having a sequence of chemical residues that are similar or similar at corresponding positions).

A “human leukocyte antigen” or “HLA” is a human class I or class II major histocompatibility complex (MHC) protein (eg, Stites et al., IMMUNOL).
OGY, 8th edition, Lang Publishing, Los Altos, CA (19
94)).

The term “hybridiz” is used in the context of polynucleotides.
e) "," hybridizing "," hybridizing (
hybridize) "and the like are conventional hybridization conditions (preferably, for example, 50% formamide / 6 × SSC / 0.1% SDS / 100 μg / ml ss.
It is meant to refer to (hybridization in DNA). Here, the temperature of hybridization is above 37 ° C. and the temperature for washing in 0.1 × SSC / 0.1% SDS is higher than 55 ° C.

The phrase “isolated” or “biologically pure” refers to material that is substantially or essentially free from components that normally accompany the material as found in its native state. Thus, an isolated peptide according to the present invention is preferably free of substances normally associated with the peptide in an in situ environment. For example, if the polynucleotide corresponds to or is complementary to a gene other than the 98P4B6 gene, or is substantially separated from a contaminant polynucleotide encoding a polypeptide other than the 98P4B6 gene product or fragment thereof, Said to be “isolated”. One skilled in the art can readily utilize nucleic acid isolation procedures to obtain isolated 98P4B6 polynucleotides. A protein is said to be “isolated” if, for example, physical, mechanical or chemical methods are utilized to remove the 98P4B6 protein from the cellular components normally associated with the protein. One skilled in the art can readily utilize standard purification methods to obtain isolated 98P4B6 protein. Alternatively, isolated protein can be prepared by chemical means.

The term “mammal” refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.

The terms “metastatic prostate cancer” and “metastatic disease” refer to prostate cancer that has spread to local lymph nodes or distant sites, and stage D disease under the AUA system,
And stage T × N × M + under the TNM system. In cases of locally advanced prostate cancer, surgery is generally not intended for patients with metastatic disease, and hormone (androgen excision) treatment is
A preferred mode of treatment. Patients with metastatic prostate cancer eventually develop an androgen therapy refractory condition within 12-18 months of the start of treatment. Nearly half of these androgen refractory patients die within 6 months after the onset of the condition. The most common site of prostate cancer metastasis is the bone. Prostate cancer bone metastases are often osteoblastic (ie, resulting in net bone formation) rather than osteolysis. Bone metastases are most frequently found in the spine, followed by the femur, pelvis, rib cage, skull, and humerus. Other common sites of metastasis include lymph nodes, lungs, liver, and brain. Metastatic prostate cancer is typically diagnosed by open pelvic lymphadenectomy or laparoscopic pelvic lymphadenectomy, whole body radionuclide scan, skeletal radiography, and / or biopsy of bone lesions Is done.

As used herein, the terms “modulator” or “test compound” or “drug candidate” or their synonyms are used to describe a cancer phenotype or expression of a cancer sequence (eg, a nucleic acid sequence). Or any protein sequence), or any molecule (eg, protein, oligopeptide, organic) that is tested for the ability to directly or indirectly alter the effects of a cancer sequence (eg, signal transduction, gene expression, protein interactions, etc.) Small molecules, polysaccharides, polynucleotides, etc.). In one aspect, the modulator neutralizes the effects of the oncoprotein of the present invention. “Neutralize” means that the activity of the protein is inhibited or blocked, with subsequent effects on the cell. In another aspect, the regulator neutralizes the effects of the gene of the invention, and its corresponding protein, by normalizing the protein level. In preferred embodiments, the modulator alters the expression profile, or the expression profile of a nucleic acid or protein provided herein, or a downstream effector pathway. In one embodiment, the modulator controls a cancer phenotype (eg, a phenotype for a normal tissue fingerprint). In another embodiment, the modulator induces a cancer phenotype. In general, multiple assay mixtures are run in parallel at different reagent concentrations, resulting in different responses to different concentrations. Typically, one of these concentrations serves as a negative control (ie, zero concentration or below detection level).

Modulators, drug candidates, or test compounds comprise many chemical classes, but typically they are organic molecules, preferably small organic compounds having a molecular weight greater than 100 and less than about 2,500 daltons. It is. Preferred small molecules are less than 2000D, or less than 1500D or less than 1000D or less than 500D. Candidate factors include functional groups necessary for structural interaction (particularly hydrogen bonding) with proteins, and typically include at least one amine group, carbonyl group, hydroxyl group, or carboxyl group, preferably Contains at least two functional chemical groups. Candidate factors often include ring carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Modulators also include biomolecules such as peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof. Peptides are particularly preferred. One class of modulator is a peptide, eg, about 5 to
A peptide of about 35 amino acids, preferably about 5 to about 20 amino acids, particularly preferably about 7 to about 15 amino acids. Preferably, the cancer regulator protein is soluble, includes a non-transmembrane region, and / or has an N-terminal Cys that aids solubility. In one embodiment, the C-terminus of the fragment is maintained as a free acid and the N-terminus is a free amine to aid in coupling (ie, coupling to cysteine). In one embodiment, oncoproteins of the invention are conjugated to immunogenic factors as discussed herein. In one embodiment, the oncoprotein is conjugated to BSA. Polypeptides of the invention (eg, preferred length polypeptides) can be linked together or linked to other amino acids to produce longer peptides / proteins. A regulatory peptide can be a digest of a naturally occurring protein, a random peptide, or a “biased” random peptide, as described above. In a preferred embodiment, the peptide / protein based modulator is an antibody and fragments thereof as defined herein.

The regulator of cancer can also be a nucleic acid. Nucleic acid modulators can be naturally occurring nucleic acids, random nucleic acids, or “biased” random nucleic acids. For example, digested products of prokaryotic or eukaryotic genomes can be used in an approach similar to that described above for proteins.

The term “monoclonal antibody” refers to an antibody that is obtained from a substantially homogeneous population (ie, an antibody that is present in small amounts, including populations that are identical except in nature).

A “motif” as a biological motif of a 98P4B6-related protein is any pattern of amino acids that form part of the primary sequence of the protein (specific function (eg, protein-protein interaction, protein-DNA interaction, etc.)). , Or modification (eg, phosphorylation, glycosylation, or amidation), or localization (eg, secretion sequence, nuclear localization sequence, etc.), or immunogenic (either humoral or cellular) )) And related sequences. A motif generally can either be adjacent to or aligned with a particular location associated with a particular function or property. In the context of the HLA motif, “
A “motif” is a residue in a peptide of a defined length that is recognized by a particular HLA molecule (usually about 8 to about 13 amino acids for a class I HLA motif, and about 6 to about a class II HLA motif. Pattern of 25 amino acids). The peptide motif for HLA binding is typically different for each protein encoded by each human HLA allele and is different in the pattern of primary and secondary anchor residues.

“Pharmaceutical excipients” include substances such as adjuvants, carriers, pH adjusting and buffering agents, isotonic agents, wetting agents, preservatives and the like.

“Pharmaceutically acceptable” refers to a composition that is non-toxic, inert, and / or physiologically compatible with humans or other mammals.

The term “polynucleotide” refers to polymorphic forms of nucleotides (either ribonucleotides or deoxynucleotides, or modified forms of either nucleotide type) of at least 10 bases or base pairs in length. And is meant to include single and double stranded forms of DNA and / or RNA. In the art, this term is often used interchangeably with “oligonucleotide” if necessary. A polynucleotide can comprise the nucleotide sequence disclosed herein, wherein thymidine (T) (
For example, as shown in SEQ ID NO: 702 can also be uracil (U). This explanation is based on the differences between the chemical structures of DNA and RNA, especially when one of the four main bases is RNA
Then, it is related with the knowledge that it is uracil (U) instead of thymidine (T).

The term “polypeptide” means a polymer of at least about 4, 5, 6, 7 or 8 amino acids. Throughout this specification, standard three-letter or single-letter code for amino acids is used. In the art, this term is often used interchangeably with “peptide” or “protein”.

A “primary anchor residue” of HLA is an amino acid at a particular position along the peptide sequence that is understood to provide a point of contact between the immune peptide and the HLA molecule. The primary anchor residues within one to three, usually two, defined length peptides generally define a “motif” for an immunogenic peptide. It is understood that these residues are in intimate contact with the peptide binding groove of the HLA molecule and their side chains embedded in the specific pocket of the binding glove. In one embodiment, for example, the primary anchor residue for an HLA class I molecule is in accordance with the present invention at position 2 (from the amino terminal position) and residue peptide epitopes 8, 9, 10 in the carboxy terminal position. , Localized at the 11th or 12th position.
In another embodiment, for example, the primary anchor residues of a peptide that binds to an HLA class II molecule are spaced relative to each other rather than at the end of the peptide. here,
Peptides are generally at least 9 amino acids long. The primary anchor positions for each motif and supermotif are shown in Table IV. For example,
Analog peptides can be made by altering the presence or absence of certain residues at the primary and / or secondary anchor positions shown in Table IV. Such analogs are used to adjust the binding affinity and / or population coverage of peptides containing a particular HLA motif or supermotif.

“Radioactive isotopes” include, but are not limited to, (non-limiting exemplary uses are also as follows):
Examples of medical isotopes:
Description of isotope use Actinium-225
(AC-225)
See Thorium-229 (Th-229). Actinium-227
(AC-227)
The parent bismuth-212 of radium-223 (Ra-223), an alpha emitter used to treat cancer (ie, breast and prostate cancer) and intraskeletal metastases resulting from cancer radioimmunotherapy
(Bi-212)
See Thorium-228 (Th-228), Bismuth-213
(Bi-213)
See Thorium-229 (Th-229) Cadmium-109
(Cd-109)
Cancer detection cobalt-60
(Co-60)
Radiation source copper-64 for cancer radiotherapy, food irradiation, and pharmaceutical sterilization
(Cu-64)
Positron emitter copper-67 used in cancer therapy and SPECT imaging
(Cu-67)
Β / γ emitter dysprosium-166 used for cancer radioimmunotherapy and diagnostic tests (ie, breast cancer, colon cancer and lymphoma)
(Dy-166)
Cancer radioimmunotherapy erbium-169
(Er-169)
Rheumatoid arthritis treatment Europium-152, especially for small joints connected with fingers and toes
(Eu-152)
Radiation source Europium-154 for food irradiation and pharmaceutical sterilization
(Eu-154)
Radiation source gadolinium-153 for food irradiation and pharmaceutical sterilization
(Gd-153)
Osteoporosis Detection and Nuclear Medical Quality Assurance Device Gold-198
(Au-198)
Transplantation and intracavitary treatment of ovarian, prostate, and brain tumors Holmium-166
(Ho-166)
Multiple myeloma treatment, cancer radioimmunotherapy, bone marrow dissection, and rheumatoid arthritis treatment iodine-125 in targeted bone treatment
(I-125)
Osteoporosis detection, diagnostic imaging, follow-up drugs, brain cancer treatment, radiolabeling, tumor imaging, receptor mapping in the brain, interstitial radiation therapy, brachytherapy for prostate cancer treatment, glomerular filtration rate (GFR)
Measurement, plasma volume measurement, detection of deep vein thrombosis in the leg iodine-131
(I-131)
Thyroid function assessment, detection of thyroid disease, thyroid cancer and another non-malignant thyroid disease (i.e.
Treatment of Graves disease, goiter, and hyperthyroidism), treatment of leukemia, lymphoma, and other cancer forms (eg, breast cancer) using cancer radioimmunotherapy iridium-192
(Ir-192)
Brachytherapy, treatment of brain tumors and myeloma, treatment of arterial occlusion (ie, arteriosclerosis and restenosis), and implant lutetium-177 for breast and prostate tumors
(Lu-177)
Cancer radioimmunotherapy and arterial occlusion treatment (ie, arteriosclerosis and restenosis)
Molybdenum-99
(Mo-99)
Technetium-99m (T) used for imaging of the brain, liver, lungs, heart, and other organs
c-99m) parent. Currently, Tc-99 is used for imaging of various cancers and diseases including brain, heart, liver, lung, and is the most radioisotope used to detect deep vein thrombosis in the legs Widely used.
Osmium-194
(Os-194)
Cancer Radioimmunotherapy Palladium-103
(Pd-103)
Prostate cancer treatment platinum-195m
(Pt-195m)
Test of cisplatin, chemotherapeutic drug biodistribution and metabolism Phosphorus-32
(P-32)
Treatment of polycythemia vera (blood cell disease) and leukemia, diagnosis / treatment of bone cancer; treatment of colon cancer, pancreatic cancer, and liver cancer; radiolabeling of nucleic acids for in vitro testing, diagnosis of surface tumors, arterial occlusion Treatment of (ie, arteriosclerosis and restenosis) and intraluminal therapy phospho-33
(P-33)
Treatment of leukemia, diagnosis / treatment of bone disease, radiolabeling, and arterial occlusion (ie, arteriosclerosis and restenosis) Radium-223
(Ra-223)
Actinium-227 (Ac-227) Reference Rhenium-186
(Re-186)
Reduction of bone cancer pain, rheumatoid arthritis treatment, and diagnosis of lymphoma, bone cancer, breast cancer, colon cancer, and liver cancer using radioimmunotherapy, and treatment rhenium-188
(Re-188)
Diagnosis and treatment of cancer using radioimmunotherapy, reduction of bone cancer pain, treatment of rheumatoid arthritis, and treatment of prostate cancer Rhodium-105
(Rh-105)
Cancer radioimmunotherapy samarium-145
(Sm-145)
Eye Cancer Treatment Samarium-153
(Sm-153)
Cancer radioimmunotherapy and bone cancer pain relief scandium-47
(Sc-47)
Cancer Radioimmunotherapy and Bone Cancer Pain Relief Selenium-75
(Se-75)
Radiotracer used for brain examination, imaging of the adrenal cortex using γ-scintigraphy, lateral location of steroid-secreting tumors, pancreatic scanning, detection of hyperparathyroidism, bile acids from the endogenous pool Decrease rate measurement Strontium-85
(Sr-85)
Bone cancer detection and brain scan strontium-89
(Sr-89)
Reduction of bone cancer pain, treatment of multiple myeloma, and osteoblast therapy Technetium-99m
(Tc-99m)
See Molybdenum-99 (Mo-99) Thorium-228
(Th-228)
Thorium-229, parent of bismuth-212 (Bi-212), an alpha emitter used in cancer radioimmunotherapy
(Th-229)
The parent of actinium-225 (Ac-225) and the grand parent of bismuth-213 (Bi-213), which are alpha emitters used in cancer radioimmunotherapy
t)
Thulium-170
(Tm-170)
Gamma ray source for blood irradiator, energy source tin-117m for medical device for implantation
(Sn-117m)
Cancer radioimmunotherapy and bone cancer pain relief Tungsten-188
(W-188)
Parental xenon for rhenium-188 (Re-188) used in cancer diagnosis / treatment, bone cancer pain reduction, rheumatoid arthritis treatment, and arterial occlusion (ie, arteriosclerosis and restenosis) 127
(Xe-127)
Neuroimaging of brain disorders, high resolution SPECT examination, pulmonary function examination, and cerebral blood flow examination ytterbium-175
(Yb-175)
Cancer radioimmunotherapy yttrium-90
(Y-90)
Micro-species yttrium-91 obtained from irradiation of yttrium-89 (Y-89) for the treatment of liver cancer
(Y-91)
Yttrium-90 (Y-90) gamma radiation used for cancer radioimmunotherapy (ie, lymphoma, breast cancer, colon cancer, kidney cancer, lung cancer, ovarian cancer, prostate cancer, pancreatic cancer, and inoperable liver cancer) As applied herein in labeled nucleic acids and proteins, “randomized” (randomized)
Or the grammatical equivalent thereof means that each of the nucleic acids and peptides consists essentially of randomized nucleotides and amino acids, respectively. These randomized peptides (or nucleic acids as discussed herein) can incorporate any nucleotide or amino acid at any position. This synthetic process generates random proteins or nucleic acids, allowing the formation of all or most possible combinations over the length of the sequence, thereby randomizing candidate bioactive proteinaceous agents Can be designed to form a library of

In one embodiment, the library is “fully randomized” and there is no sequence trend or sequence uniformity at any position. In another embodiment, the library is a “biased randomized” library. That is, some locations within this array are either kept constant or selected with limited probability. For example, nucleotide or amino acid residues can be generated by, for example, generating nucleic acid binding domains, generating cysteines for cross-linking, proline for SH3 domains, serine for phosphorylation sites, etc., threonine, tyrosine or histidine, etc., or Random in a defined class that is a hydrophobic amino acid residue, a hydrophilic amino acid residue, or a spatially biased (either small or large) residue for purines, etc. It becomes.

A “recombinant” DNA molecule or RNA molecule is DNA that is subjected to molecular manipulation in vitro.
Molecule or RNA molecule.

Non-limiting examples of small molecules include compounds that bind or interact with 98P4B6 ligands (hormones, neuropeptides, chemokines, odorants, phospholipids, and preferably their function to inhibit 98P4B6 protein function. Equivalents). Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably about 9 kDa, about 8 kDa, about 7 kDa, about 6 kDa, about 5 kDa, or about 4 kDa.
It has a molecular weight less than Da. In certain embodiments, the small molecule physically associates with 98P4B6 protein or binds to 98P4B6; not found in naturally occurring metabolic pathways; and / or: more soluble in aqueous solution than non-aqueous solution .

The “stringency” of a hybridization reaction can be readily determined by one skilled in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes require lower temperatures. Hybridization generally depends on the ability of denatured nucleic acids to reanneal when complementary strands exist in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, higher relative temperatures tend to make the reaction conditions more stringent, while lower temperatures result in less. For further details and explanation of the stringency of hybridization reactions,
Ausubel et al., Current Protocols in Molecular
Biology, Wiley Interscience Publishers (19
95).

“Stringent conditions” or “high stringent conditions”, as defined herein, may be identified by, but not limited to: (1) low ionic strength and High temperature (eg, 0.015M sodium chloride / 0.0015
(M sodium citrate / 0.1% sodium dodecyl sulfate, 50 ° C.);
2) A denaturant (eg, formamide) is used during hybridization (eg, 50% (v / v) formamide / 0.1% with 0.1% bovine serum albumin
Ficoll / 0.1% polyvinylpyrrolidone / 750 mM sodium chloride, 75
pH 50, 50 mM sodium phosphate buffer with mM sodium citrate, 42
° C); or (3) 50% formamide, 5 × SSC (0.75 M NaCl, 0.0
75 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%
Sodium pyrophosphate, 5 × Denhardt's solution, sonicated salmon sperm DNA (5
0 μg / ml), 0.1% SDS, and 10% dextran sulfate at 42 ° C., at a temperature of 42 ° C. in 0.2 × SSC (sodium chloride / sodium citrate), and 50% Wash in formamide at a temperature of 55 ° C. followed by a high stringency wash consisting of 0.1 × SSC containing EDTA at 55 ° C. “Moderate stringent conditions” include, but are not limited to, Sambrook et al., Molecular C
loning: A Laboratory Manual, New York: Cold
The use of washing solutions and hybridization conditions (eg, temperature, ionic strength and% SDS) that are less stringent than the hybridization conditions described by Spring Harbor Press, 1989 and described above. An example of moderately stringent conditions is 20% formamide, 5 × SSC (15
0 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (
pH 7.6) 5 × Denhardt's solution, 10% dextran sulfate, and 20 mg / mL
Overnight incubation at 37 ° C. in a solution containing the denatured sheared salmon sperm DNA, followed by washing the filter at about 37 ° C. to 50 ° C. in 1 × SSC. Those skilled in the art will recognize methods for adjusting temperature, ionic strength, etc., as needed to accommodate factors such as probe length.

An HLA “supermotif” is a peptide bond specifically shared by HLA molecules encoded by two or more HLA alleles. H in various ethnic groups
The overall phenotypic frequency of the LA-supertype is shown in Table IV (F) below. Non-limiting components of the various supertypes are as follows:
A2: A ^* 0201, A ^* 0202, A ^* 0203, A ^* 0204, A ^* 0205, A
^* 0206, A ^* 6802, A ^* 6901, A ^* 0207
A3: A3, A11, A31, A ^* 3301, A ^* 6801, A ^* 0301, A ^* 11
01, A ^* 3101
B7: B7, B ^* 3501-03, B ^* 51, B ^* 5301, B ^* 5401, B ^* 55
01, B ^* 5502, B ^* 5601, B ^* 6701, B ^* 7801, B ^* 0702, B ^*
5101, B ^* 5602
B44: B ^* 3701, B ^* 4402, B ^* 4403, B ^* 60 (B ^* 4001), B
61 (B ^* 4006)
A1: A ^* 0102, A ^* 2604, A ^* 3601, A ^* 4301, A ^* 8001
A24: A ^* 24, A ^* 30, A ^* 2403, A ^* 2404, A ^* 3002, A ^* 30
03
B27: B ^* 1401-02, B ^* 1503, B ^* 1509, B ^* 1510, B ^* 15
18, B ^* 3801-02, B ^* 3901, B ^* 3902, B ^* 3903-04, B ^* 4
801-02, B ^* 7301, B ^* 2701-08
B58: B ^* 1516, B ^* 1517, B ^* 5701, B ^* 5702, B58
B62: B ^* 4601, B52, B ^* 1501 (B62), B ^* 1502 (B75),
B ^* 1513 (B77)
The calculated population ranges obtained with the various HLA-supertype combinations are shown in Table IV (G).

As used herein, “treating” or “therapeutic” and grammatically related terms refer to any consequence of the disease (eg, prolonged survival, less morbidity, and / or
Or any improvement in side effects (by-products of alternative treatment modalities; complete eradication of the disease is not required).

A “transgenic animal” (eg, a mouse or rat) is an animal that has cells that contain a transgene that has been introduced into the animal or is ancestor of the animal prior to birth (eg, at the embryonic stage). Was introduced. A “transgene” is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.

As used herein, an HLA or cellular immune response “vaccine” refers to a composition comprising or encoding one or more peptides of the invention. Such a vaccine (eg a cocktail of one or more distinct peptides; included by a polyepitope peptide,
There are numerous embodiments of one or more peptides of the invention; or a nucleic acid encoding such a distinct peptide or polyepitope (eg, a small gene encoding a polyepitope peptide). “One or more peptides” refers to 1-150 or more (eg,
At least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 of the present invention
, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 4
1, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70
75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125,
130, 135, 140, 145, or 150 or more) any whole integer unit. A peptide or polypeptide can be modified as needed (eg, by lipidation, targeting sequences, or addition of other sequences). The HLA class I peptides of the present invention can be used to promote the activation of both cytotoxic and helper T lymphocytes.
It can be mixed or linked with class II molecules. The HLA vaccine may also include peptide pulse antigen presenting cells (eg, dendritic cells).

The term “variant” refers to the type or criterion described (eg, the specifically described protein (
For example, it refers to a molecule that exhibits a modification from a protein having one or more different amino acid residues in the corresponding portion of the 98P4B6 protein) shown in FIG. 2 or FIG. An analog is an example of a modified protein. Splicing isoforms and single nucleotide polymorphisms (SNPs) are examples of further variants.

The “98P4B6-related proteins” of the present invention include the proteins specifically identified herein, as well as allelic variants (methods outlined herein or methods readily available in the art). Conservative substitution variants, analogs and homologues that can be isolated / generated and characterized without performing experiments according to 98 different
Also included are fusion proteins that bind to portions of the P4B6 protein or fragments thereof, as well as fusion proteins of 98P4B6 protein and heterologous polypeptides.
Such 98P4B6 protein is collectively referred to as 98P4B6-related protein, or 98P4B6, which is the protein of the present invention. The term “98P4B6-related protein” refers to 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
, 18, 19, 20, 21, 22, 23, 24, 25 or more than 25, or
At least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90
95, 100, 105, 110, 115, 120, 125, 130, 135, 140,
145, 150, 155, 160, 165, 170, 175, 180, 185, 190,
195, 200, 225, 250, 275, 300, 325, 350, 375, 400,
Refers to a polypeptide fragment or 98P4B6 protein sequence of 425, 450, 475, 500, 525 or 529 or more amino acids.

(II.) 98P4B6 polynucleotide)
One aspect of the invention provides a polynucleotide, preferably in isolated form, corresponding to or complementary to all or part of the 98P4B6 gene, mRNA and / or coding sequence, including 98P4B6 related Polynucleotides encoding proteins and fragments thereof, DNA, RNA, DNA / RNA hybrids, and related molecules, 98
A polynucleotide or oligonucleotide complementary to the P4B6 gene or mRNA sequence, or a portion thereof, and the 98P4B6 gene, mRNA, or 98P4
Examples include polynucleotides or oligonucleotides (collectively “98P4B6 polynucleotides”) that hybridize to B6-encoding polynucleotides. As referenced in this section, in all examples, T can also be U in FIG.

Embodiments of 98P4B6 polynucleotides include the following: shown in FIG.
98P4B6 polynucleotide having the sequence: 98P4B6 nuclei as shown in FIG.
Leotide sequence (where T is U); a polynucleotide having the sequence as shown in FIG.
At least 10 consecutive nucleotides of an tide; or a polynucleotide having the sequence shown in FIG.
At least 10 consecutive nucleotides of a renucleotide (where T is U). Example
For example, embodiments of 98P4B6 nucleotides include, but are not limited to:
(I) contain or consist essentially of such a sequence as shown in FIG.
A polynucleotide comprising such a sequence (where T can also be U);
(II) nucleotide number 355 to nucleotide number 1719 in FIG.
Including, or consisting essentially of such a sequence, or
A polynucleotide consisting of such a sequence (where T may also be U);
(III) nucleotide number 4 to nucleotide number 138 of FIG. 2B (including stop codon)
) Or consist essentially of such a sequence, or
A polynucleotide consisting of a unique sequence (where T can also be U);
(IV) nucleotide number 188 to nucleotide number 1552 in FIG.
Including, or consisting essentially of such a sequence, or
A polynucleotide consisting of such a sequence (where T may also be U);
(V) Nucleotide number 318 to nucleotide number 1682 of FIG. 2D (including the stop codon)
A polynucleotide comprising or consisting essentially of such a sequence
Or a polynucleotide consisting of such a sequence (where T can also be U);
(VI) nucleotide number 318 to nucleotide number 1577 in FIG.
Including, or consisting essentially of such a sequence, or
A polynucleotide consisting of such a sequence (where T may also be U);
(VII) nucleotide number 318 to nucleotide number 1790 of FIG. 2F (stop codon)
Or consist essentially of such a sequence or this
A polynucleotide consisting of such a sequence (where T may also be U);
(VIII) nucleotide number 295 to nucleotide number 2025 of FIG. 2G (termination code)
Including, or consisting essentially of, or consisting of such sequences.
A polynucleotide comprising a sequence such as (where T can also be U);
(IX) nucleotide number 394 to nucleotide number 1866 in FIG.
Or consist essentially of such a sequence, or
A polynucleotide consisting of such sequences (where T may also be U);
(X) nucleotide number 355 to nucleotide number 1719 in FIG. 2I (including stop codon)
Or consist essentially of such a sequence, or
A polynucleotide consisting of such sequences (where T may also be U);
(XI) nucleotide number 355 to nucleotide number 1719 in FIG.
Or consist essentially of such a sequence, or
A polynucleotide consisting of such sequences (where T may also be U);
(XII) nucleotide number 355 to nucleotide number 1719 of FIG. 2K (stop codon
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XIII) nucleotide number 355 to nucleotide number 1719 in FIG. 2L (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XIV) nucleotide number 355 to nucleotide number 1719 in FIG. 2M (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XV) nucleotide number 355 to nucleotide number 1719 in FIG.
Including, or consisting essentially of such a sequence, or
A polynucleotide consisting of such a sequence (where T may also be U);
(XVI) nucleotide number 355 to nucleotide number 1719 of FIG. 2O (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XVII) nucleotide number 355 to nucleotide number 1719 in FIG. 2P (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XVIII) Nucleotide number 355 to nucleotide number 1719 of FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XIX) nucleotide number 355 to nucleotide number 1719 in FIG. 2R (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XX) nucleotide number 355 to nucleotide number 1719 in FIG.
Including, or consisting essentially of such a sequence, or
A polynucleotide consisting of such a sequence (where T may also be U);
(XXI) nucleotide number 295 to nucleotide number 2025 in FIG. 2T (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XXII) nucleotide number 295 to nucleotide number 2025 in FIG. 2U (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XXIII) Nucleotide number 295 to nucleotide number 2025 of FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXIV) Nucleotide number 295 to nucleotide number 2025 of FIG. 2W (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XXV) nucleotide number 295 to nucleotide number 2025 of FIG. 2X (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XXVI) nucleotide number 394 to nucleotide number 1866 in FIG. 2Y (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XXVII) nucleotide number 394 to nucleotide number 1866 in FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXVIII) nucleotide number 394 to nucleotide number 1866 of FIG.
Including a sequence as shown in) or consisting essentially of such a sequence,
Or a polynucleotide consisting of such a sequence (where T can also be U);
(XXIX) Nucleotide number 394 to nucleotide number 1866 of FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXX) nucleotide number 394 to nucleotide number 1866 in FIG. AC (stop codon)
Or consist essentially of such a sequence or
A polynucleotide comprising a sequence such as (where T can also be U);
(XXXI) nucleotide number 394 to nucleotide number 1866 in Figure AD (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XXXII) nucleotide number 394 to nucleotide number 1866 of FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXXIII) Nucleotide No. 394 to Nucleotide No. 1866 in Figure AF (termination)
(Including codons) or consist essentially of such sequences
Or a polynucleotide consisting of such a sequence (where T can also be U);
(XXXIV) Nucleotide No. 394 to Nucleotide No. 1866 in FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXXV) nucleotide number 394 to nucleotide number 1866 of Figure AH (terminating code)
Or essentially consists of such a sequence, or
A polynucleotide consisting of such a sequence, wherein T may also be U;
(XXXVI) nucleotide number 394 to nucleotide number 1866 of FIG.
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XXXVII) nucleotide number 394 to nucleotide number 1866 in Figure AJ (end)
(Including codons) or consist essentially of such sequences
Or a polynucleotide consisting of such a sequence (where T can also be U);
(XXXVIII) nucleotide number 394 to nucleotide number 1866 of Figure AK (end)
Including a sequence as shown in) or consisting essentially of such a sequence,
Or a polynucleotide consisting of such a sequence (where T can also be U);
(XXXIX) nucleotide number 394 to nucleotide number 1866 in Figure AL
Including, or consisting essentially of, such sequences as
A polynucleotide comprising such a sequence (where T can also be U);
(XL) at least 90, 91 with respect to the entire amino acid sequence shown in FIGS.
, 92, 93, 94, 95, 96, 97, 98, 99, or 98P that is 100% homologous
A polynucleotide encoding a 4B6-related protein;
(XLI) at least 90,9 relative to the entire amino acid sequence shown in Figures A-AL
1, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical 98
A polynucleotide encoding a P4B6-related protein;
(XLII) at least one of those shown in Tables VIII-XXI and XXII-XLIX
A polynucleotide encoding the peptide of;
(XLIII) Less having a value greater than 0.5 in the hydrophilic profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3A, 3G and 3H, including the 30, 31, 32, 33, 34, 35 amino acid positions.
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3
Pep in any integer increment from 0, 31, 32, 33, 34, 35 amino acids to 454
A polynucleotide encoding a tide region;
(XLIV) A small value having a value greater than 0.5 in the hydropathic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
3A, 3G and 3H, including 9, 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 amino acids up to 454 in any integer increment
A polynucleotide encoding a peptide region;
(XLV) A value greater than 0.5 in the accessible residue percentage profile of FIG.
Having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
3A, 3G, including 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions.
And at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 3H peptides
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2
Any integer from 8, 29, 30, 31, 32, 33, 34, 35 amino acids to 454
A polynucleotide encoding an incremental peptide region of
(XLVI) a small number having a value greater than 0.5 in the average flexibility profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 of FIG.
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 of the peptide
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35 amino acids up to 454 in any integer increment
A polynucleotide encoding a peptide region;
(XLVII) A small value with a value greater than 0.5 in the β-turn profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
3A, 3G and 3H, including 9, 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 amino acids up to 454 in any integer increment
A polynucleotide encoding a peptide region;
(XLVIII) a small number having a value greater than 0.5 in the hydrophilic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 of the peptide of FIG.
Both 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 1
9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
Encodes peptide regions of any integer increment from 33, 34, 35 amino acids up to 45
Polynucleotides to:
(XLIX) having a value greater than 0.5 in the hydropathic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
A small number of peptides in FIG. 3B containing 29, 30, 31, 32, 33, 34, 35 amino acid positions.
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18
19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
Coordinate regions of any integer increment from 32, 33, 34, 35 amino acids up to 45
Polynucleotides to be loaded;
(L) Has a value greater than 0.5 in the accessible residue percentage profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2
The peptide of FIG. 3B comprising 8, 29, 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3
Any integer increment peptide region from 1, 32, 33, 34, 35 amino acids to 45
A polynucleotide encoding
(LI) Less having a value greater than 0.5 in the average flexibility profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3 of the peptide of FIG. 3B comprising 30, 31, 32, 33, 34, 35 amino acid positions.
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
Encodes any integer increment peptide region from 33, 34, 35 amino acids up to 45
A polynucleotide;
(LII) Less than 0.5 in the β-turn profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3 of the peptide of FIG. 3B comprising 30, 31, 32, 33, 34, 35 amino acid positions.
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
Encodes any integer increment peptide region from 33, 34, 35 amino acids up to 45
A polynucleotide;
(LIII) at least having a value greater than 0.5 in the hydrophilic profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3
At least one of the peptides of FIG. 3C comprising amino acid positions 0, 31, 32, 33, 34, 35
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 3
Encodes peptide regions in any integer increment from 3, 34, 35 amino acids to 419
A polynucleotide;
(LIV) a small number having a value greater than 0.5 in the hydropathic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 of the peptide of FIG.
Both 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 1
9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
, 33, 34, 35 amino acids to 419 in any integer increment peptide region
Polynucleotides to be loaded;
(LV) Has a value greater than 0.5 in the accessible residue percentage profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2
The peptide of FIG. 3C comprising 8, 29, 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3
Any integer increment peptide region from 1, 32, 33, 34, 35 amino acids to 419
A polynucleotide encoding the region;
(LVI) Less having a value greater than 0.5 in the average flexibility profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3 of the peptide of FIG. 3C comprising 30, 31, 32, 33, 34, 35 amino acid positions.
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
Encodes peptide regions of any integer increment from 33, 34, 35 amino acids to 419
Polynucleotides to:
(LVII) Less having a value greater than 0.5 in the β-turn profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3 of the peptide of FIG. 3C comprising 30, 31, 32, 33, 34, 35 amino acid positions.
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
Encodes peptide regions of any integer increment from 33, 34, 35 amino acids to 419
Polynucleotides to:
(LVIII) Less having a value greater than 0.5 in the hydrophilic profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3D, 3F, and 3J, including 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 of the peptide
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35 amino acids up to 490 in any integer increment
A polynucleotide encoding the peptide region;
(LIX) a small number having a value greater than 0.5 in the hydropathic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
3D, 3F, and 3J, including amino acid positions 30, 31, 32, 33, 34, 35
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 34, 35 amino acids up to 490 in any integer increment
A polynucleotide encoding a peptide region;
(LX) Has a value greater than 0.5 in the accessible residue percentage profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2
3, 29, 30, 31, 32, 33, 34, 35, including amino acid positions, FIGS.
And at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 3J peptides,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 2
Any integer from 8, 29, 30, 31, 32, 33, 34, 35 amino acids to 490
A polynucleotide encoding an incremental peptide region of
(LXI) Less having a value greater than 0.5 in the average flexibility profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3D, 3F, and 3J, including 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 of the peptide
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35 amino acids up to 490 in any integer increment
A polynucleotide encoding the peptide region;
(LXII) Less having a value greater than 0.5 in the β-turn profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
3D, 3F, and 3J, including 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 of the peptide
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35 amino acids up to 490 in any integer increment
A polynucleotide encoding the peptide region;
(LXIII) Less having a value greater than 0.5 in the hydrophilic profile of FIG.
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
The peptides of FIGS. 3E and 3I comprising 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3
Peptide region in any integer increment from 1, 32, 33, 34, 35 amino acids to 576
A polynucleotide encoding the region;
(LXIV) A small value with a value greater than 0.5 in the hydropathic profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
The pep of FIGS. 3E and 3I containing 9, 30, 31, 32, 33, 34, 35 amino acid positions.
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 1
7, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30
, 31, 32, 33, 34, 35 amino acids up to 576 in any integer increment
A polynucleotide encoding the coding region;
(LXV) A value greater than 0.5 in the accessible residue percentage profile of FIG.
Having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
3E and 3 including 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
Any integer increment from 9, 30, 31, 32, 33, 34, 35 amino acids to 576
A polynucleotide encoding a peptide region of
(LXVI) a small number having a value greater than 0.5 in the average flexibility profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
3E and 3I peptides comprising amino acid positions 30, 31, 32, 33, 34, 35
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
Peptides in any integer increment from 31, 32, 33, 34, 35 amino acids to 576
A polynucleotide encoding the region;
(LXVII) a small number with a value greater than 0.5 in the β-turn profile of FIG.
At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
3E and 3I peptides comprising amino acid positions 30, 31, 32, 33, 34, 35
At least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
Peptides in any integer increment from 31, 32, 33, 34, 35 amino acids to 576
A polynucleotide encoding the region;
Any one of the polynucleotides (LXVIII) (I) to (LXVII) and
A fully complementary polynucleotide;
A peptide encoded by any of (LXIX) (I)-(LXVIII);
(LXX) with pharmaceutical excipients and / or in human unit dosage form (I
)-(LXVIII) any one of the peptides encoded by;
(LXXI) In a method for regulating cells expressing 98P4B6, (I) to (I)
LXVIII) any polynucleotide or peptide of (LXIX) or (L
XX) a method of using the composition;
(LXXII) diagnosis, prevention, prognosis determination of an individual carrying cells expressing 98P4B6,
Or a method for treating any of the polynucleotides (I) to (LXVIII)
A method of using a peptide of Tide or (LXIX) or a composition of (LXX);
(LXXIII) 98P4B6 expressing cells (this cell is one of the tissues listed in Table I
A method for diagnosing, preventing, prognosing, or treating an individual who has cancer)
Any one of the polynucleotides (I) to (LXVIII) or (LXIX)
A method of using a composition of tide or (LXX);
(LXXIV) In a method for diagnosing, preventing, prognosing, or treating cancer, (I
) To (LXVIII) any polynucleotide or (LXIX) peptide or
Using a composition of (LXX);
(LXXV) To diagnose, prevent, prognose, or treat cancer in the tissues listed in Table I
In any one of the polynucleotides (I) to (LXVIII) or (LXI)
A method using a peptide of X) or a composition of (LXX);
Identify or characterize modulators of cells expressing (LXXVI) 98P4B6
A method for the preparation of any of the polynucleotides (I) to (LXVIII) or (L
A method of using a peptide of (XIX) or a composition of (LXX).

As used herein, a range is understood to specifically disclose all of its unit positions.

Exemplary embodiments of the invention disclosed herein include 98P4B6 polynucleotides (and polynucleotides complementary to such sequences) that encode specific portions of the 98P4B6 mRNA sequence (eg, polynucleotides complementary to such sequences). (A) 4 of 98P4B6 variant 1,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 6
5, 70, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125
, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175
, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225
, 250, 275, 300, 325, 350, 375, 400, 410, 420, 430
Polynucleotides encoding proteins and / or fragments thereof of 440, 450 or 454 consecutive amino acids; the maximum associated length of other variants is 44 amino acids for variant 2; 419 amino acids for variant 5; Variant 6 is 490 amino acids; Variant 7 is 576 amino acids; Variant 8 is 490 amino acids; Variant 13 is 454 amino acids; Variant 14
Is 454 amino acids; variant 21 is 576 amino acids; variant 25 is 490 amino acids.

For example, representative embodiments of the invention disclosed herein include the following: at the end of the carboxy terminal amino acid shown in FIG. 2 or FIG. Polynucleotides encoding about amino acids 1 to about amino acids 10 of the 98P4B6 protein shown in FIG. 3 and the encoded peptides themselves, polys encoding about amino acids 10 to about amino acids 20 of the 98P4B6 protein shown in FIG. 2 or FIG. A polynucleotide encoding from about amino acid 20 to about amino acid 30 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, a polynucleotide encoding from about amino acid 30 to about amino acid 40 of the 98P4B6 protein shown in FIG. 2 or FIG. 98P4B6 protein shown in FIG. 2 or 3 A polynucleotide encoding about amino acid 40 to about amino acid 50, a polynucleotide encoding about amino acid 50 to about amino acid 60 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, and about a 98P4B6 protein shown in FIG. 2 or FIG. A polynucleotide encoding amino acid 60 to about amino acid 70, a polynucleotide encoding about amino acid 70 to about amino acid 80 of the 98P4B6 protein shown in FIG. 2 or FIG. 3, and about amino acid 90 of the 98P4B6 protein shown in FIG. 2 or FIG. ~
A polynucleotide encoding about amino acid 100. Accordingly, a polynucleotide encoding a portion of the amino acid sequence (of about 10 amino acids) from amino acid 100 to the carboxyl terminal amino acid of 98P4B6 protein is an embodiment of the present invention. Here, it is understood that each specific amino acid position discloses a position of ± 5 amino acid residues.

Polynucleotides that encode a relatively long portion of the 98P4B6 protein are also within the scope of the invention. For example, a polynucleotide encoding about amino acid 1 (or 20 or 30 or 40 or the like) to about amino acid 20 (or 30 or 40 or 50 or the like) of the 98P4B6 protein shown in FIG. 2 or FIG. 3 is well known in the art. Can be produced by various techniques. These polynucleotide fragments can comprise any portion of the 98P4B6 sequence as shown in FIG. 2 or FIG.

Further exemplary embodiments of the invention disclosed herein include 98P4B6 polynucleotide fragments that encode one or more biological motifs contained within the 98P4B6 protein sequence, including those in Tables V- One or more motif-bearing partial sequences of the 98P4B6 protein shown in XVIII can be mentioned. In another embodiment, an exemplary polynucleotide fragment of the invention is 98P4 exhibiting homology to a known molecule.
It encodes one or more regions of the B6 protein or variant. In another embodiment of the invention, the representative polynucleotide fragment is an N-glycosylation site, cAMP-dependent and cGMP-dependent protein kinase phosphorylation site, casein kinase II phosphorylation site or N- of the 98P4B6 protein. It may encode one or more of the myristoylation sites, as well as the amidation sites.

To determine the starting position of any peptide shown in Tables VIII-XXI and Tables XXII-XLIX compared to the parent protein (eg, Variant 1, Variant 2, etc.), reference is made to three factors: Specific variants, peptide lengths in the HLA peptide table and Table V
Note that this is done for the search peptides listed in II. In general, a unique search peptide is used to obtain an HLA peptide for a particular variant. Each search peptide associated with its respective parent molecule is listed in Table VII. Therefore, the search peptide is “
If starting at the “X” position, the value “X + 1” must be added to each position in Tables VIII-XXI and XXII-IL to obtain the actual position of the HLA peptide of their parent molecule. For example, if a particular search peptide begins at position 150 of the parent molecule, 150-1 (ie, 149) must be added to each HLA peptide amino acid position and the amino acid position of the parent molecule calculated.

(II.A.) Use of 98P4B6 polynucleotide)
(II.A.1. Monitoring of gene abnormality)
The above items of polynucleotides have a number of different specific uses. Human 98P4B6
The gene is mapped to the chromosomal location exemplified in Example 3. For example, since the 98P4B6 gene is mapped to this chromosome, polynucleotides encoding different regions of the 98P4B6 protein may cause cytogenetic abnormalities at this chromosomal location (eg, abnormalities identified as being associated with various cancers). Used to characterize. In certain genes,
Various chromosomal abnormalities, including rearrangements, have been identified as frequent cytogenetic abnormalities in a number of different cancers (see, eg, Krajinovic et al., Mutat. Res. 382 (3-
4): 81-83 (1998); Johansson et al., Blood 86 (10): 3
905-3914 (1995) and Finger et al. N. A. S. 85 (23):
9158-9162 (1988)). Thus, a polynucleotide encoding a particular region of the 98P4B6 protein could previously be used to account for cytogenetic abnormalities in the chromosomal region encoding 98P4B6 that may contribute to a malignant phenotype. Provide new tools that are more accurate than tools. In this context, these polynucleotides meet the need in the art for expanding the sensitivity of chromosome screening to identify more subtle and less common chromosomal abnormalities (eg, Evans Et al., Am.J.Obset.Gyneco
l 171 (4): 1055-1057 (1994)).

In addition, since 98P4B6 has been shown to be highly expressed in prostate and other cancers, 98P4B6 polynucleotides can be expressed in normal versus cancerous tissue.
Used in a method to assess the status of the P4B6 gene product. Typically, 98P4B6
A polynucleotide encoding a specific region of a protein may be disrupted (eg, a deletion, insertion, point mutation resulting in loss of antigen, etc.) in a specific region of the 98P4B6 gene (eg, such a region containing one or more motifs) Or used to assess the presence of changes).
Exemplary assays include RT-PCR assays and single-stranded conformation polymorphisms (
SSCP) analysis (eg, Marrogi et al., J. Cutan. Pathol. 26 (8
): 369-378 (1999)), both of which are
In order to test a particular region within a protein, a polynucleotide encoding a particular region within the protein is utilized.

(II.A.2. Antisense Embodiment)
Other specifically contemplated nucleic acid embodiments of the invention disclosed herein, whether genomic DNA, cDNA, ribozymes and antisense molecules, and natural sources or synthetic sources. There are no alternative backbone based nucleic acid molecules or nucleic acid molecules containing alternative bases, and include molecules that can inhibit RNA or protein expression of 98P4B6. For example, antisense molecules are DNA in a base-pair dependent manner.
Or a peptide nucleic acid (PNA) or non-nucleic acid molecule that specifically binds RNA (eg,
RNA or other molecules, including phosphorothioate derivatives). One skilled in the art can readily obtain these classes of nucleic acid molecules using the 98P4B6 polynucleotides and polynucleotide sequences disclosed herein.

Antisense technology involves the administration of exogenous oligonucleotides that bind to target polynucleotides located within the cell. The term “antisense” refers to the fact that such an oligonucleotide is complementary to its intracellular target (eg, 98P4B6). For example,
Jack Cohen, Oligodeoxynucleotides, Antisen
se Inhibitors of Gene Expression, CRC Pr
ess, 1989; and Synthesis 1: 1-5 (1988).
The 98P4B6 antisense oligonucleotide of the present invention includes derivatives (eg, S-
Oligonucleotides (phosphorothioate derivatives or S-oligos, Jack Cohe
n (see above)), which show enhanced cancer cell growth inhibitory activity.
S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of oligonucleotides (O-oligos) in which the non-bridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention can be prepared by treatment of the corresponding O-oligo with 3H-1,2-benzodithiol-3-one-1,1-dioxide, which is a sulfur transfer reagent. For example, Iyer, R .; P. Et al. Org. Chem. 55: 4693-4698
(1990); and Iyer, R .; P. Et al. Am. Chem. Soc. 112: 1
253-1254 (1990). Additional 98P4B6 antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (eg, Partridge et al., 1996, Antisense & Nucl).
eic Acid Drug Development 6: 169-175).

The 98P4B6 antisense oligonucleotides of the invention are typically complementary to the first 100 5 ′ codons or the last 100 3 ′ codons of the 98P4B6 genomic sequence or corresponding mRNA, and It can be RNA or DNA that hybridizes stably. Although complete complementarity is not required, a high degree of complementarity is preferred. The use of oligonucleotides complementary to this region allows selective hybridization to 98P4B6 mRNA, but does not allow selective hybridization to mRNAs that specify other regulatory subunits of protein kinases. . In one embodiment, the 98P4B6 antisense oligonucleotide of the invention is 98P4B6 mRN.
A 15-30 mer fragment of an antisense DNA molecule having a sequence that hybridizes to A. Optionally, 98P4B6 antisense oligonucleotides can be
30B oligonucleotide complementary to the region in the first 10 5 ′ codons or the last 10 3 ′ codons of 4B6. Alternatively, the antisense molecule is 98P
Modified to use ribozymes in the inhibition of 4B6 expression (eg, LAC
outbound & D. T.A. Stinchcomb; Trends Genet 12:
510-515 (1996)).

(II.A.3. Primers and primer pairs)
More specific embodiments of this nucleotide of the invention include primers and primer pairs (which allow specific amplification of the polynucleotide of the invention or any particular portion thereof) and probes (which Selectively or specifically hybridizes to the nucleic acid molecules of the invention or any portion thereof. The probe can be labeled with a detectable marker (eg, radioisotope, fluorescent compound, bioluminescent compound, chemiluminescent compound, metal chelator or enzyme). Such probes and primers are used as a means for detecting the presence of 98P4B6 polynucleotides in a sample and for detecting cells expressing 98P4B6 protein.

Examples of such probes include polynucleotides that include all or part of the human 98P4B6 cDNA sequence shown in FIG. Examples of primer pairs that can specifically amplify 98P4B6 mRNA are also described in the Examples. As will be appreciated by those skilled in the art, a large number of different primers and probes can be prepared based on the sequences provided herein and effectively used to amplify and / or detect 98P4B6 mRNA. obtain.

The 98P4B6 polynucleotides of the present invention are useful for a variety of purposes, including but not limited to the following: probes for amplification and / or detection of 98P4B6 genes, mRNA or fragments thereof, and As a primer; as a reagent for the diagnosis and / or prognosis of prostate cancer and other cancers; as a coding sequence capable of directing the expression of 98P4B6 polypeptide; to regulate or inhibit expression of 98P4B6 gene and / or translation of 98P4B6 transcript As a tool to do; and as a therapeutic agent.

The present invention relates to 98P4 from naturally occurring sources (eg, humans or other mammals).
Use of any probe as described herein to identify and isolate a B6 nucleic acid sequence or a 98P4B6-related nucleic acid sequence, as well as the isolated nucleic acid sequence itself (which
Including all or most of the sequences found in the probes used).

(II.A.4.) Isolation of 98P4B6-encoding nucleic acid molecule)
The 98P4B6 cDNA sequence described herein isolates other polynucleotides that encode the 98P4B6 gene product, as well as 98P4B6 gene product homologs, alternatively spliced isoforms, allelic variants and mutations of the 98P4B6 gene product. Allows isolation of other polynucleotides encoding the form as well as polynucleotides encoding analogs of 98P4B6-related proteins. Various molecular cloning methods that can be used to isolate full length cDNA encoding the 98P4B6 gene are well known (eg, Sambrook, J. et al., Molecular Cloning).
: A Laboratory Manual, 2nd edition, Cold Spring Har
Bor Press, New York, 1989; Current Protocol
s in Molecular Biology. Ausubel et al., Hen, Wiley
and Sons, 1995). For example, λ phage cloning methodologies include commercially available cloning systems (eg, Lambda ZAP Express, St
ratagene) can be used conveniently. Phage clones containing the 98P4B6 gene cDNA can be identified by probing with labeled 98P4B6 cDNA or fragments thereof. For example, in one embodiment, 98P4
B6 cDNA (eg, FIG. 2) or a portion thereof can be synthesized and used as a probe to search for the overlap to the 98P4B6 gene and the full-length cDNA corresponding to the 98P4B6 gene. The 98P4B6 gene itself includes genomic DNA libraries, bacterial artificial chromosome libraries (BAC), yeast artificial chromosome libraries (YAC), etc.
It can be isolated by screening with 8P4B6 DNA probes or primers.

(II.A.5.) Recombinant nucleic acid molecules and host-vector systems)
The present invention also includes recombinant DNA or RNA molecules comprising 98P4B6 polynucleotides, fragments, analogs, or homologs thereof (phages, plasmids, phagemids, cosmids, YACs, BACs, and various viral vectors and non-well known in the art. Including but not limited to viral vectors), and such recombinant DNA
Cells transformed or transfected with a molecule or RNA molecule are provided. Methods for generating such molecules are well known (eg, Sambrook et al., 1989,
See above).

The present invention further provides a host-vector system comprising a recombinant DNA molecule comprising a 98P4B6 polynucleotide, fragment, analog, or homolog thereof in a suitable prokaryotic or eukaryotic host cell. Examples of suitable eukaryotic host cells include yeast cells, plant cells, or animal cells (eg, mammalian cells or insect cells (eg, baculovirus infectious cells such as Sf9 cells or High Five cells)). It is done.
Examples of suitable mammalian cells include various prostate cancer cell lines (eg, DU145 and T
suPr1), other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), and many mammalian cells conventionally used for expression of recombinant proteins (eg, COS cells, CHO cells, 293 cells, 293T cells). More particularly, a polynucleotide comprising the coding sequence of 98P4B6, or a fragment, analog or homologue thereof, is used in a number of host-vector systems conventionally used and widely known in the art, It can be used to produce 98P4B6 protein or fragments thereof.

A wide range of host-vector systems suitable for expression of 98P4B6 protein or fragments thereof are available (eg, Sambrook et al., 1989, supra; Curre
nt Protocols in Molecular Biology, 1995, supra). A preferred vector for expression in mammals is pcDNA3.1.
myc-His-tag (Invitrogen) and retroviral vector pSR
include, but are not limited to, αtkneo (Muller et al., 1991, MCB 11: 1785). Using these expression vectors, 98P4B6 is expressed in several prostate cancer cell lines and non-prostate cell lines (eg, 293, 293T, rat-1, NIH3T).
3 and TsuPr1). The host-vector system of the present invention comprises
Useful for producing 98P4B6 protein or fragments thereof. Such host-vector systems can be used to study the functional properties of 98P4B6 and 98P4B6 variants or analogs.

Recombinant human 98P4B6 protein or analog or homologue or fragment thereof can be produced by mammalian cells transfected with a construct encoding 98P4B6-related nucleotides. For example, 293T cells can be transfected with an expression plasmid encoding 98P4B6 or a fragment, analog, or homolog thereof, 98P4B6 or related proteins are expressed in 293T cells, and recombinant 98P4B6 protein is purified by standard purification. Isolated using methods (eg, affinity purification using anti-98P4B6 antibody). In another embodiment, the 98P4B6 coding sequence is subcloned into the retroviral vector pSRαMSVtkneo and various mammalian cell lines (eg, to establish a 98P4B6 expressing cell line)
Used to infect NIH3T3, TsuPr1,293, and rat-1). Various other expression systems well known in the art can also be used. An expression construct encoding a leader peptide linked in frame to the 98P4B6 coding sequence can be used for the production of secreted forms of recombinant 98P4B6 protein.

As discussed herein, genetic code redundancy allows for variations in the 98P4B6 gene sequence. In particular, it is known in the art that particular host species often have particular codon preferences, and thus one skilled in the art will adapt the disclosed sequences to be preferred in the desired host. Can do. For example, a preferred analog codon sequence typically has a rare codon (ie, a codon having a usage frequency of less than about 20% in the known sequence of the desired host) replaced with a more frequent codon. . The codon preference for a particular species can be determined, for example, on the Internet (e.g. URL www.dna.aff
rc. go. jp / ~ nakamura / codon. calculated by using the codon usage table available in html).

Further sequence modifications are known to enhance protein expression in cellular hosts. These include removal of sequences encoding pseudopolyadenylation signals, exons /
Intron splice site signals, transposon-like repeats, and / or other such well-characterized sequences that are detrimental to gene expression. The GC content of the sequence is adjusted to an average level for a given cellular host (calculated by reference to known genes expressed in that host cell). Where possible, the sequence is modified to avoid the predicted hairpin secondary mRNA structure. Other useful modifications include Ko
zak, Mol. Cell. Biol. 9: 5073-5080 (1989), including the addition of a translation initiation consensus sequence at the start of the open reading frame. One skilled in the art understands that the general role that eukaryotic ribosomes initiate translation exclusively at the 5 ′ proximal AUG codon is eliminated only under rare conditions (eg,
Kozak PNAS 92 (7): 2662-2666, (1995) and Koza
k NAR 15 (20): 8125-8148 (1987)).

(III.) 98P4B6-related protein)
Another aspect of the invention provides 98P4B6-related proteins. Particular embodiments of 98P4B6 proteins include polypeptides having all or part of the amino acid sequence of human 98P4B6 as shown in FIG. 2 or FIG. Alternatively, 98P4B6 protein embodiments include variants, homologues, or analog polypeptides having changes in the amino acid sequence of 98P4B6 shown in FIG. 2 or FIG.

Embodiments of 98P4B6 polynucleotides include: 98P4B6 polynucleotide having the sequence shown in FIG. 2, 98P4B6 nucleotide sequence as shown in FIG. 2 (where T is U); At least 10 contiguous nucleotides of a polynucleotide having the sequence as shown; or at least 10 contiguous nucleotides of a polynucleotide having the sequence shown in FIG. 2 (where T is U). For example, embodiments of 98P4B6 nucleotides include, but are not limited to:
(I) a protein comprising, consisting essentially of, or consisting of an amino acid sequence as shown in FIGS. 2A-AL or FIGS. 3A-J;
(II) the entire amino acid sequence as shown in FIGS.
92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous, 98
P4B6-related proteins;
(III) the entire amino acid sequence as shown in FIG. 2A-AL or FIG. 3A-J and at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100
% Identical, 98P4B6-related protein;
(IV) a protein comprising at least one peptide shown in Tables VIII-XLIX, but optionally, not the entire protein of FIG. 2;
(V) a protein comprising at least one peptide shown in Tables VIII-XLIX (collectively, this peptide is also shown in Tables XXII-XLIX), but collectively, as needed, Protein, not the whole protein of FIG. 2;
(VI) a protein comprising at least two peptides selected from the peptides shown in Tables VIII-XLIX, but optionally not the entire protein of FIG. 2;
(VII) a protein comprising at least two peptides selected from the peptides shown in Tables VIII-XLIX, but collectively, not a constitutive sequence derived from the protein of FIG.
(VIII) a protein comprising at least one peptide selected from the peptides shown in Tables VIII-XXI; and at least one peptide selected from the peptides shown in Tables XXII-XLIX, but collectively A protein that is not a constitutive sequence from the protein of FIG. 2;
(IX) At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, having a value greater than 0.5 in the hydrophilic profile of FIG. 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 3
454, 45, 490, 5 including amino acid positions 0, 31, 32, 33, 35, respectively
3A, 3B, 3C, 3D, 3 in increments up to 76, 454, 576, or 490
E, 3F, 3G, 3H, 3I or 3J of at least 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22
A polypeptide comprising the amino acids 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35;
(X) at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, having a value greater than 0.5 in the hydropathic profile of FIG. 1
6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29
, 30, 31, 32, 33, 35, including 454, 45, 490, respectively.
3A, 3B, 3C, 3D in increments up to 576, 454, 576 or 490
3E, 3F, 3G, 3H, 3I or 3J protein of at least 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 3
A polypeptide comprising 5 amino acids;
(XI) At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1, having a value greater than 0.5 in the accessible residue percentage profile of FIG.
4, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27
, 28, 29, 30, 31, 32, 33, 35 amino acid positions, 454,
3A, 3B in increments up to 45, 490, 576, 454, 576, or 490
3C, 3D, 3E, 3F, 3G, 3H, 3I or 3J protein of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 ,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 3
A polypeptide comprising 3, 34, 35 amino acids;
(XII) at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, having a value greater than 0.5 in the average flexibility profile of FIG. 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
454, 45, 49, including 9, 30, 31, 32, 33, 35 amino acid positions, respectively
3A, 3B, 3C, 3 in increments up to 0, 576, 454, 576, or 490
At least 5, 6, 7 of D, 3E, 3F, 3G, 3H, 3I or 3J protein
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
A polypeptide comprising 35 amino acids;
(XIII) At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, having a value greater than 0.5 in the β-turn profile of FIG.
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 2
454, 45, 49, including 9, 30, 31, 32, 33, 35 amino acid positions, respectively
3A, 3B, 3C, 3 in increments up to 0, 576, 454, 576, or 490
At least 5, 6, 7 of D, 3E, 3F, 3G, 3H, 3I or 3J protein
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
A polypeptide comprising 35 amino acids;
(XIV) Collectively, at least 2 in Tables VIII-XXI and XXII-XLIX
Presents times, peptides;
(XV) a peptide collectively present at least three times in Tables VIII-XXI and XXII-XLIX;
(XVI) Collectively, at least 4 in Tables VIII-XXI and XXII-XLIX
Presents times, peptides;
(XVII) a peptide collectively present at least 5 times in Tables VIII-XXI and XXII-XLIX;
(XVIII) At least once in Tables VIII-XXI, and XXII-XL
A peptide present at least once in IX;
(XIX) At least once in Tables VIII-XXI, and XXII-XLIX
Present at least twice in the peptide;
(XX) a peptide present at least twice in Tables VIII-XXI and at least once in XXII-XLIX;
(XXI) At least twice in Tables VIII-XXI, and XXII-XLIX
Present at least twice in the peptide;
(XXII) a peptide comprising one, two, three, four, or five of the following features, or an oligonucleotide encoding such a peptide;
i) A region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the hydrophilic profile of FIG.
Including amino acid positions having a value greater than or equal to 5, 0.6, 0.7, 0.8, 0.9 or equal to 1.0);
ii) A region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the hydrophilic profile of FIG.
. Including amino acid positions having values less than or equal to 5, 0.4, 0.3, 0.2, 0.1 or equal to 0.0);
iii) A region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the accessible residue percentage profile of FIG. 7, 0.5, 0.6, Has a value of 0.7, 0.8, 0.9 or greater or 1
. Including amino acid positions having a value equal to 0);
iv) A region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the mean flexibility profile of FIG. 8, 0.5, 0.6, 0 Including amino acid positions having a value greater than or equal to 7, 0.8, 0.9 or equal to 1.0);
v) A region of at least 5 amino acids of the particular peptide of FIG. 3 (in any integer increment up to the full length of the protein in FIG. 3) (in the β-turn profile of FIG.
. Including amino acid positions having a value greater than or equal to 5, 0.6, 0.7, 0.8, 0.9 or equal to 1.0);
(XXIII) A composition comprising an antibody or binding region thereof together with a peptide of (I) to (XXII) or a pharmaceutical excipient and / or in a human unit dosage form;
(XXIV) In a method for modulating a cell expressing 98P4B6 or a peptide of (I) to (XXII), or a method of using the antibody of (XXIII) or a binding region thereof, or a composition;
(XXV) a method of using a peptide of (I) to (XXII) or an antibody of (XXIII) or a binding region or composition thereof in a method of diagnosing, preventing, predicting or treating an individual having cells expressing 98P4B6;
(XXVI) A method of using the peptide of (I) to (XXII) or the antibody of (XXIII) or a binding region or composition thereof in a method for diagnosing, preventing, predicting or treating an individual having cells expressing 98P4B6. Wherein the cell is derived from a cancer of the tissues listed in Table I;
(XXVII) (I) to (X) in a method for diagnosing, preventing, predicting or treating cancer
A method of using a peptide of XII) or an antibody of (XXIII) or a binding region thereof, or a composition;
(XLVIII) Use of a peptide of (I) to (XXII) or an antibody of (XXIII) or a binding region thereof, or a composition in a method of diagnosing, preventing, predicting or treating cancer of the tissues listed in Table I And (XXIX) a method of using a peptide of (I) to (XXII) or an antibody (XXIII) or a binding region thereof, or a composition in a method for identifying or characterizing a modulator of a cell expressing 98P4B6.

As used herein, a range is understood to specifically disclose the entire unit position.

Exemplary embodiments of the invention disclosed herein encode specific positions in the 98P4B6 mRNA sequence (and sequences complementary to such sequences), such as encoding proteins and / or fragments thereof. Including 98P4B6, for example:
(A) 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 1 of 98P4B6 variant 1
4, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 30, 35, 40
45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 10
5, 110, 115, 120, 125, 130, 135, 140, 145, 150, 15
5, 160, 165, 170, 175, 180, 185, 190, 195, 200, 22
5, 250, 275, 300, 325, 350, 375, 400, 410, 420, 43
0, 440, 450, or 454 or more contiguous amino acids; maximum lengths relevant for other variants are: variant 52, 45 amino acids; variant 5, 419 amino acids, variant 6, 49
0 amino acids, variant 7, 576 amino acids, variant 8, 490 amino acids, variant 13, 45
4 amino acids, variant 14, 454 amino acids, variant 21, 576 amino acids and variant 2
5, 490 amino acids.

In general, naturally occurring allelic variants of human 98P4B6 share a high degree of structural identity and homology (eg, greater than 90% homology). Typically 98P4B
Allelic variants of the 6 protein contain conservative amino acid substitutions in the 98P4B6 sequence described herein, or contain amino acid substitutions from the corresponding position in the 98P4B6 homolog. One class of 98P4B6 alleles shares a high degree of homology with at least a small portion of a particular 98P4B6 amino acid sequence, but fundamental deviations from that sequence (eg, non-conservative substitutions, truncations, insertions, or A protein further comprising a frame shift). In comparing protein sequences, the terms similarity, identity, and homology each have a distinct meaning as understood in the field of genetics. Furthermore, orthology and paralogy can be an important concept that describes the relationship of members of a given protein family in one organism to members of the same family in another organism.

Amino acid abbreviations are provided in Table II. Conservative amino acid substitutions can often occur in a protein without altering either the protein's conformation or function. The protein of the present invention comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
It may contain 13, 14, or 15 conservative substitutions. Such modifications include substitution of any of these hydrophobic amino acids with any of isoleucine (I), valine (V), and leucine (L); aspartic acid with glutamic acid (E) ( Substitution of D) and vice versa; substitution of glutamine (Q) with asparagine (N) and vice versa; and substitution of serine (S) with threonine (T) and vice versa. Other substitutions can also be considered conservative depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein. For example, glycine (G) and alanine (A) are often interchangeable, as can alanine (A) and valine (V). The relatively hydrophobic methionine (M) can often be exchanged for leucine and isoleucine, and sometimes can be exchanged for valine. Lysine (K) and arginine (R) are often interchangeable at positions where the important feature of their amino acid residues is their charge and the different pKs of these two amino acid residues are not important. Still other changes may be considered “conservative” in certain circumstances (eg, Table III herein; pages 13-15 “Biochemistry” 2nd
Edition, edited by Lubert Stryer (Stanford University); He
nikoff et al., PNAS 1992 Vol 89 10915-10919; Lei et al., J Biol Chem 1995 May 19; 270 (20): 11882-6.
checking).

Embodiments of the invention disclosed herein include a wide variety of art-recognized variants or analogs of the 98P4B6 protein (eg, polypeptides having amino acid insertions, deletions, and substitutions). . 98P4B6 variants can be made using methods known in the art (eg, site-directed mutagenesis, alanine scanning, and PCR mutagenesis). Site-directed mutagenesis (Carter et al., Nucl. Acids
Res. 13: 4331 (1986); Zoller et al., Nucl. Acids R
es. 10: 6487 (1987)), cassette mutagenesis (Wells et al., Gene,
34: 315 (1985)), restriction selective mutagenesis (Wells et al., Philos. Tra).
ns. R. Soc. London SerA, 317: 415 (1986)), or other known techniques, have been cloned to produce 98P4B6 variant DNA.
Can be implemented.

Scanning amino acid analysis can also be used to identify one or more amino acids along a contiguous sequence associated with a particular biological activity (eg, protein-protein interaction). Relatively small and neutral amino acids are included in preferred scanning amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically the preferred scanning amino acid in this group.
This is because alanine is less likely to eliminate the side chain behind the β carbon and alter the conformation of the variant backbone. Alanine is also typically
This is preferred because it is the most common amino acid. Furthermore, alanine is often found in both buried and exposed positions (Creighton, The Pro
teins, (WH Freeman & Co., NY); Chothia, J
. Mol. Biol. 150: 1 (1976)). If the alanine substitution does not yield a sufficient amount of modification, an equal volume of amino acids can be used.

As defined herein, a 98P4B6 variant, analog, or homolog is at least one that is “cross-reactive” with a 98P4B6 protein having the amino acid sequence of FIG.
It has the characteristic property of having one epitope. As used in this sentence, “cross-reactivity” means that an antibody or T cell that specifically binds to a 98P4B6 variant also specifically binds to a 98P4B6 protein having the amino acid sequence shown in FIG. means. A polypeptide is not a variant of the protein shown in FIG. 3 if it does not contain an antibody that specifically binds to the 98P4B6 protein or any epitope that can be recognized by T cells. Those skilled in the art will recognize that antibodies recognizing proteins bind to epitopes of different sizes, and a group of about 4 or 5 amino acids (whether contiguous or not) has a representative number of amino acids in the minimal epitope. Understand what is considered. For example, Nair
Et al. Immunol 2000 165 (12): 6949-6955; Hebbe
s et al., Mol Immunol (1989) 26 (9): 865-73; Schwartt.
See z et al., J Immunol (1985) 135 (4): 2598-608.

Another class of 98P4B6-related protein variants share more than 70%, 75%, 80%, 85%, or 90% similarity with the amino acid sequence of FIG. 3 or fragments thereof. Another specific class of 98P4B6 protein variants or analogs includes one or more of the 98P4B6 biological motifs described herein or currently known in the art. Accordingly, analogs of 98P4B6 fragments (nucleic acids or amino acids) having altered functional (eg, immunogenic) properties compared to the original fragment are encompassed by the present invention. It is understood that motifs that are currently part of the field or that are part of the field apply to the nucleic acid or amino acid sequences of FIG. 2 or FIG.

As discussed herein, embodiments of the present invention are shown in FIG. 2 or FIG.
A polypeptide comprising an amino acid sequence less than the full length of the P4B6 protein is included. For example, an exemplary embodiment of the present invention is any 4 of the 98P4B6 protein shown in FIG. 2 or FIG.
Includes peptides / proteins having 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more consecutive amino acids.

Further, exemplary embodiments of the invention disclosed herein include amino acids about 1 to 98 of the 98P4B6 protein shown in FIG. 2 or 3 throughout the 98P4B6 amino acid sequence.
A polypeptide comprising about 10 amino acids, a polypeptide comprising about 10 to about 20 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG. 3, and about 20 to about 30 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG. Polypeptide, FIG.
Or a polypeptide comprising about 30 to about 40 amino acids of the 98P4B6 protein shown in FIG. 3, or about 40 to about 40 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG.
A polypeptide consisting of about 50 amino acids, a polypeptide consisting of about 50 to about 60 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG. 3, and about 60 to about 70 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG. Polypeptide, FIG.
Or a polypeptide comprising about 70 to about 80 amino acids of the 98P4B6 protein shown in FIG. 3, about 80 to about 80 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG.
A polypeptide comprising about 90 amino acids, a polypeptide comprising about 90 to about 100 amino acids of the 98P4B6 protein shown in FIG. 2 or FIG. In addition, FIG.
Alternatively, a polypeptide consisting of about amino acid 1 (or 20 or 30 or 40 or the like) to about 20 amino acid (or 130 or 140 or 150 or the like) of the 98P4B6 protein shown in FIG. 3 is an embodiment of the present invention. The start position and stop position in this paragraph refer to a specific position and a position of plus 5 residues minus 5 residues.

98P4B6-related proteins are produced using standard peptide synthesis techniques or using chemical cleavage methods well known in the art. Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode 98P4B6-related proteins. In one embodiment, the nucleic acid molecule provides a means of generating a defined fragment of 98P4B6 protein (or a variant, homolog or analog thereof).

(III. A.) Embodiment of motif-bearing protein)
Further exemplary embodiments of the invention disclosed herein are 98P4B6 polys containing amino acid residues of one or more biological motifs contained in the 98P4B6 polypeptide sequence shown in FIG. 2 or FIG. Includes peptides. Various motifs are well known in the art, and proteins are available from many publicly available internet sites (eg, URL address: pfam.wustl.edu/;searchlauncher.bcm.t
mc. edu / seq-search / struc-predict. html; pso
rt. ims. u-tokyo. ac. jp /; www. cbs. dtu. dk /; www
w. ebi. ac. uk / interpro / scan. html; www. expas
y. ch / tools / scnpsil. html; Epimatrix ^™ and E
pimer ^™ , Brown University, www. brown. edu / R
search / TB-HIV_Lab / epimatrix / epimatrix. h
tml; and BIMAS, bimas. dcrt. nih. gov /) can be evaluated for the presence of such motifs.

The motif-bearing partial sequence of 98P4B6 protein is shown in Tables VIII-XXI and XXI.
Shown and identified in I-XLIX.

Table V shows some frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu/). The columns in Table V are: (1) Abbreviations for motif names, (2) Identity found between different members of this motif family (%
), (3) motif names or details, and (4) list the most common functions; position information is included if the motif is related to position.

Polypeptides containing one or more of the 98P4B6 motifs discussed above are in view of the observation that the 98P4B6 motif discussed above is associated with growth dysregulation, and 98P4
Because B6 is overexpressed in certain cancers, it is useful to elucidate the specific features of the malignant phenotype (see, for example, Table I). Casein kinase II, cAMP and camp dependent protein kinase, and protein kinase C are, for example, enzymes known to be associated with the expression of malignant phenotypes (eg, Chen et al., Lab.
Invest. 78 (2): 165-174 (1998); Gaiddon et al., End.
ocrinology 136 (10): 4331-4338 (1995); Hall et al., Nucleic Acids Research 24 (6): 1119-1126 (
1996); Peterziel et al., Oncogene 18 (46): 6322-63.
29 (1999), and O'Brian, Oncol. Rep. 5 (2): 305-3
09 (1998)). Furthermore, both glycosylation and myristoylation are protein modifications that are also associated with cancer and cancer progression (eg, Dennis et al., Bi
ochem. Biophys. Acta 1473 (1): 21-34 (1999); R
aju et al., Exp. Cell Res. 235 (1): 145-154 (1997)). Amidation is another protein modification that is also associated with cancer and cancer progression (see, eg, Treston et al., J. Natl. Cancer Inst. Monogr. (1
3): 169-175 (1992)).

In another embodiment, the protein of the invention has one or more immunoreactive epitopes identified according to art recognized methods (eg, Tables VIII-XXI and XXII).
-A peptide represented by XLIX). CTL epitopes can be determined using special algorithms to identify peptides in the 98P4B6 protein that can optimally bind to a particular HLA allele (eg, Table IV: Epimatrix ^™ and Epim
er ^TM , Brown University, URL www. brown. edu /
Research / TB-HIV_Lab / epimatrix / epimatrix.
html; and BIMAS, URL bimas. dcrt. nih. gov /. ).
In addition, processes for identifying peptides with sufficient binding affinity for HLA molecules and associated with being immunogenic epitopes are well known in the art and without undue experimentation To be implemented. In addition, processes for identifying peptides that are immunogenic epitopes are well known in the art and are performed without undue experimentation, either in vitro or in vivo.

The principles for making analogs of such epitopes to modulate immunogenicity are also known in the art. For example, one of skill in the art starts with an epitope having a CTL or HTL motif (see, eg, HLA class I and HLA class II motif / supermotif in Table IV). This epitope is one of the specific positions
An analog is made by replacing one amino acid and replacing it with another amino acid specified for that position. For example, those skilled in the art will recognize any other residue (e.g.,
Select harmful residues in favor of residues with priority as defined in Table IV; residues with lower priority as residues in priority as defined in Table IV Or a preferential residue present from the beginning can be replaced with another preferred residue as defined in Table IV. Substitutions can occur at major anchor positions or other positions in the peptide;
See V.

Various references reflect techniques relating to the identification and generation of epitopes in the protein of interest and its analogs. For example, WO 97/3 against Chesnut et al.
3602; Sette, Immunogenetics 1999 50 (3-4): 2
01-212; Sette et al. Immunol. 2001 166 (2): 1389
-1397; Sidney et al., Hum. Immunol. 1997 58 (1): 12-
20; Kondo et al., Immunogenetics 1997 45 (4): 249-
258; Sidney et al., J. MoI. Immunol. 1996 157 (8): 3480-9
0; and Falk et al., Nature 351: 290-6 (1991); Hunt et al.,
Science 255: 1261-3 (1992); Parker et al., J. Biol. Immun
ol. 149: 3580-7 (1992); Parker et al., J. Biol. Immunol. 15
2: 163-75 (1994); Kast et al., 1994 152 (8): 3904-12.
Borras-Cuesta et al., Hum. Immunol. 2000 61 (3): 2
66-278; Alexander et al., J. MoI. Immunol. 2000 164 (3);
164 (3): 1625-1633; Alexander et al., PMID: 7895164
UI: 95202582; O'Sullivan et al. Immunol. 1991
147 (8): 2663-2669; Alexander et al., Immunity 199.
4 1 (9): 751-761, and Alexander et al., Immunol. Res
. 1998 18 (2): 79-92.

Related embodiments of the invention include different motifs shown in Table VI, and / or Table V
III-XXI and XXII-XLIX one or more putative CTL epitopes, and / or
Or a polypeptide comprising a combination of one or more T cell binding motifs known in the art. Preferred embodiments do not include insertions, deletions or substitutions in any of the polypeptide motifs or intervening sequences. Furthermore, embodiments that include any of a number of N-terminal and / or C-terminal amino acid residues on either side of these motifs may be desirable (eg, a larger portion of the polypeptide structure in which the motif is located). To include). Typically, the number of N-terminal and / or C-terminal amino acid residues on either side of the motif is between about 1 and about 100 amino acid residues, preferably between 5 and about 50 amino acid residues. .

98P4B6-related proteins are embodied in many forms, preferably in isolated forms. The prepared 98P4B6 protein molecule is substantially free of other proteins or molecules that impair the binding of 98P4B6 to antibodies, T cells or other ligands. The nature and degree of isolation and purification will depend on the intended use. Embodiments of 98P4B6-related proteins include purified 98P4B6-related proteins and functional soluble 98P
Contains 4B6-related proteins. In one embodiment, the functional soluble 98P4B6 protein or fragment thereof maintains the ability to be bound by antibodies, T cells or other ligands.

The present invention also provides a 98P4B6 protein comprising a biologically active fragment of the 98P4B6 amino acid sequence shown in FIG. 2 or FIG. Such proteins exhibit the properties of the starting 98P4B6 protein as follows: the ability to induce the production of antibodies that specifically bind to epitopes associated with the 98P4B6 protein; the ability to induce activation of HTL or CTL; and / Or the ability to be recognized by HTL or CTL that also specifically binds to this starting protein.

98P4B6-related polypeptides containing specific interesting structures can be predicted and / or identified using various analytical techniques well known in the art or based on immunogenicity, including Chou- Fasman, Garnier-Robson, Kyte
-Doolittle, Eisenberg, Karplus-Schultz or J
The method of an Ameson-Wolf analysis is mentioned. Fragments containing such structures can be used in the production of subunit-specific anti-98P4B6 antibodies or T cells, or 9
It is particularly useful in identifying cellular factors that bind to 8P4B6. For example, Hopp, T .;
P and Woods, K.M. R. 1981, Proc. Natl. Sci. U. S. A. 7
8: 3824-3828 can be used to generate hydrophilic profiles and to identify immunogenic peptide fragments. Kyte, J. et al. And Doolittle, R .; F.
, 1982, J. et al. Mol. Biol. Using the method of 157: 105-132, a hydrophilic profile can be generated and immunogenic peptide fragments can be identified. Janin J
. , 1979, Nature 277: 491-492, using the percent (
%) Accessible profiles can be generated and immunogenic peptide fragments can be identified.
Bhaskaran R.D. Ponuswamy P. K. , 1988, Int. J. et al.
Pept. Protein Res. Using the method of 32: 242-255, an average flexibility profile can be generated and immunogenic peptide fragments can be identified. Delag
e, G. et al. , Roux B. , 1987, Protein Engineering 1:
Using the method of 289-294, a beta turn profile can be generated and immunogenic peptide fragments can be identified.

CTL epitopes can bind to designated HLA alleles as needed 98P4
To identify polypeptides within the B6 protein, a specific algorithm is used (e.g., World Wide Web URL syffpeithi.bmi-heid).
elberg. com / SYFPEITHI site; Tables IV (A)-(E); Ep
imatrix ^™ and Epimer ^™ , Brown University, UR
L (World Wide Web URL brown. Edu / Research /
TB-HIV_Lab / epimatrix / epimatrix. html); and BIMAS, URL bimas. dcrt. nih. can be determined by using gov /). To illustrate this, a peptide epitope derived from 98P4B6 (HLA-A1, A2, A3, A11, A24) shown in the context of human MHC class I molecules.
, B7 and B35) were predicted (eg, Table VIII-XXI, XXII-XLI).
X). Specifically, the complete amino acid sequence of the 98P4B6 protein and related portions of other variants (ie, predicted 9 flanking fragment residues on either the point mutation or exon junction side for HLA class I, and HLA For class II, the predicted 14 flanking fragment residues on either side of the point mutation or exon junction corresponding to the variant) are described above in Bioinformatics and Molecular
Input into the HLA Peptide Motif Search algorithm found on the ar Analysis Section (BIMAS) website.

HLA peptide motif search algorithm is HLA class I molecule, specially HLA-A
Based on the binding of specific peptide sequences in the two grooves, Dr. Ken Park
(eg, Falk et al., Nature 351: 290-6 (19
91); Hunt et al., Science 255: 1261-3 (1992); Parke.
r et al. Immunol. 149: 3580-7 (1992); Parker et al., J. Biol.
Immunol. 152: 163-75 (1994)). This algorithm locates and ranks 8-mer, 9-mer, and 10-mer peptides from the complete protein sequence for predicted binding to HLA-A2 and many other HLA class I molecules. to enable. A number of HLA class I binding peptides are 8-mer, 9-mer, 10-mer or 11-mer. For example, for class I HLA-A2, the epitope preferably includes leucine (L) or methionine (M) at position 2 and valine (V) or leucine (L) at the C-terminus (eg, Parker et al. ,
J. et al. Immunol. 149: 3580-7 (1992)). 98P4B6
The results of selection of predicted binding peptides are shown in Tables VIII-XXI and XXII-XL herein.
Shown in IX. In Tables VIII-XXI and XXII-XLIX, the selected candidates, 9-mers and 10-mers for each family member, are shown along with their position, the amino acid sequence of each particular peptide, and a putative binding score. Table XLVI-
In XLIX, the 15-mer for each family member, the candidate to be selected, is shown along with their position, the amino acid sequence of each particular peptide, and the putative binding score. This binding score corresponds to the estimated half-life of the dissociation of the complex containing the peptide at 37 ° C. (pH 6.5). The peptide with the highest binding score is expected to be bound most closely to HLA class I on the cell surface over the best period, indicating the best immunogenic target for T cell recognition.

The actual binding of the peptide to the HLA allele can be assessed by stabilizing HLA expression on the antigen processing deficient cell line T2 (eg, Xue et al., Prost
ate 30: 73-8 (1997) and Peshwa et al., Prostate 36:
129-38 (1998)). The immunogenicity of a particular peptide can be assessed in vitro by stimulating CD + 8 cytotoxic T lymphocytes (CTLs) in the presence of antigen presenting cells (eg, dendritic cells).

By HLA class I motifs or HLA class II motifs predicted by BIMAS sites, Epimer ^TM sites and Epimatrix ^TM sites or available in the field or part of the fields as shown in Table IV Specified (or World Wide Web site URL syfpei
thi. bmi-heidelberg. It is understood that all epitopes are “applied” to the 98P4B6 protein. As used in this context, “applied” means that the 98P4B6 protein is evaluated, for example, by visual or by computer-based pattern recognition methods as understood by one skilled in the art. Has an HLA class I motif, 8, 9, 1
All partial sequences of 98P4B6 protein of 0 or 11 amino acid residues, or HL
Partial sequences of 9 amino acid residues or more carrying the A class II motif are within the scope of the present invention.

(III.B.) Expression of 98P4B6-related protein)
In the embodiments described in the examples below, 98P4B6 is a commercially available expression vector (eg, C-terminal 6 × His and MYC tag (pcDNA3.1 / mycHIS,
Invitrogen or Tag5, GenHunter Corporation,
Nashville TN) can be conveniently expressed in cells (eg, 293T cells) transfected with a CMV-driven expression vector that encodes 98P4B6. T
The ag5 vector provides an IgGK secretion signal that can be used to facilitate the production of secreted 98P4B6 protein in transfected cells. Secreted HIS-tagged 98P4B6 in the culture medium can be purified, for example, using a nickel column using standard techniques.

(III.C.) 98P4B6-related protein modification)
Modifications of 98P4B6-related proteins (eg, covalent modifications) are included within the scope of the present invention. One type of covalent modification involves reacting a targeted amino acid residue of a 98P4B6 polypeptide with an organic derivatizing factor (which is a selected side chain residue or N-terminal or C-terminal residue of the 98P4B6 protein). And reacting with). Another type of covalent modification of the 98P4B6 polypeptide included within the scope of the invention involves altering the native glycosylation pattern of the protein of the invention. Another type of covalent modification of 98P4B6 is one that binds 98P4B6 polypeptide to various non-proteinaceous polymers (
For example, one of polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylene) includes U.S. Pat. No. 4,640,835;
No. 689; No. 4,301,144; No. 4,670,417; No. 4,791,
192; or 4,179,337.

The 98P4B6-related proteins of the present invention can also be modified to form a chimeric molecule, which is fused to another heterologous polypeptide or amino acid sequence.
6 is included. Such chimeric molecules can be synthesized chemically or recombinantly. A chimeric molecule may have a protein of the invention fused to another tumor associated antigen or fragment thereof. Alternatively, a protein according to the invention may comprise a fusion (amino acid or nucleic acid) of a fragment of the 98P4B6 sequence, so that due to its length, FIG. 2 or FIG.
A molecule that is not directly homologous to the amino acid or nucleic acid sequence shown in Such a chimeric molecule may comprise multiple identical partial sequences of 98P4B6. The chimeric molecule is 98
A fusion of a P4B6-related protein with a polyhistidine epitope tag may be included, which provides a cytokine or growth factor for the epitope to which the immobilized nickel can selectively bind. The epitope tag is generally located at the amino terminus or carboxyl terminus of 98P4B6. In an alternative embodiment, the chimeric molecule may comprise a fusion of a 98P4B6-related protein with an immunoglobulin or a specific region of an immunoglobulin. Bivalent form of the chimeric molecule (also called “immunoadhesin”)
For such a fusion, the fusion may be to the Fc region of an IgG molecule. This I
The g-fusion preferably comprises a substitution with a soluble (deleted or inactivated transmembrane domain) form of 98P4B6 polypeptide replacing at least one variable region within the Ig molecule. In a preferred embodiment, the immunoglobulin fusion is a hinge region of an IgGI molecule,
CH2 region and CH3 region, or hinge region, CH1 region, CH2 region and CH3
Includes area. See also US Pat. No. 5,428,130 (issued June 27, 1995) for the production of immunoglobulin fusions.

(III.D.) Use of 98P4B6-related protein)
The proteins of the present invention have many different specific uses. When 98P4B6 is highly expressed in prostate and other cancers, 98P4B6-related proteins are used in methods to assess the status of normal 98P4B6 gene products against cancerous tissue, thereby revealing a malignant phenotype Become. Typically, polypeptides from specific regions of the 98P4B6 protein assess the presence of perturbations (eg, deletions, insertions, point mutations, etc.) in those regions (eg, regions that contain one or more motifs) Used to do. Exemplary assays are included in antibodies, or 98P4B6 polypeptide sequences, to assess the characteristics of normal regions against cancerous tissue or to elicit an immune response against an epitope 1
A T cell targeted 98P4B6-related protein containing amino acid residues of more than one biological motif is used. Alternatively, 98P4B6 related proteins containing amino acid residues of one or more biological motifs in the 98P4B6 protein are used to screen for factors that interact with a region of 98P4B6.

The 98P4B6 protein fragment / subsequence is a domain specific antibody (eg 9
In order to identify agents or cellular factors that bind to 98P4B6 or specific structural domains thereof, and in various therapeutic situations and diagnostics. It is particularly useful in situations, including but not limited to diagnostic assays, cancer vaccines and methods of preparing such vaccines.

Proteins encoded by the 98P4B6 gene, or proteins encoded by analogs, homologs or fragments thereof, have a variety of uses, including the production of antibodies and ligands that bind to the 98P4B6 gene product. Methods include but are not limited to methods for identifying other drugs and cell constructs. Antibodies raised against 98P4B6 protein or fragments thereof are imaging methods in diagnostic and prognostic assays, and in the management of human cancers characterized by expression of 98P4B6 protein (eg, cancers as listed in Table 1) Useful for. Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers. 98P4B6-related nucleic acids or 98P4B6-related proteins are also used in generating HTL or CTL responses.

Various immunological assays useful for detecting 98P4B6 protein are used, including various types of radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofluorescent assay (ELIFA). ), Immunocytochemical methods and the like, but are not limited thereto. Antibodies can be used as immunological imaging reagents that can detect 98P4B6-expressing cells (eg, radionuclide).
c) in imaging methods), can be labeled and used. The 98P4B6 protein is also
As described further herein, it is particularly useful in making cancer vaccines.

(IV.) 98P4B6 antibody)
Another aspect of the invention provides antibodies that bind to 98P4B6-related proteins. Preferred antibodies specifically bind to 98P4B6-related proteins and, under physiological conditions, do not bind (or bind weakly) to peptides or proteins that are not 98P4B6-related proteins. In this context, examples of physiological conditions include: 1) phosphate buffered saline; 2) Tris buffered saline containing 25 mM Tris and 150 mM NaCl; or normal saline (0.9% NaCl) 4) animal serum (eg human serum); or 5) any combination from 1) to 4); these reactions are preferably pH
7.5, or in the range of pH 7.0 to 8.0, or in the range of pH 6.5 to 8.5; and these reactions are performed at temperatures between 4 ° C. and 37 ° C. . For example, 98P4B
Antibodies that bind 6 may bind to 98P4B6-related proteins (eg, homologs or analogs thereof).

The 98P4B6 antibodies of the invention are particularly useful in diagnostic and prognostic assays for cancer (see, eg, Table 1), and imaging methodology. Similarly, such antibodies are useful in treating, diagnosing and / or prognosing these other cancers to the extent that 98P4B6 is also expressed or overexpressed in these other cancers. It is.
Furthermore, antibodies expressed intracellularly (eg, single chain antibodies) are therapeutically useful in the treatment of cancers that involve 98P4B6 expression (eg, advanced or metastatic prostate cancer).

The present invention also provides various immunological assays useful for the detection and quantification of 98P4B6 protein and mutant 98P4B6-related proteins. Such an assay can, if appropriate, recognize one or more 98P4B6-related proteins.
4B6 antibodies may be included. These assays can be performed within various immunological assay formats well known in the art, including various types of radioimmunoassays,
Enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofluorescence assay (ELI)
FA) and the like, but are not limited thereto.

The immunological non-antibody assays of the present invention also include T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.

In addition, immunological imaging methods that can detect prostate and other cancers expressing 98P4B6 are also provided by the present invention, including radionuclide imaging methods that use labeled 98P4B6 antibodies. Although it is mentioned, it is not limited to these. Such assays are clinically useful in the detection, monitoring, and prognosis of cancers that express 98P4B6 (eg, prostate cancer).

The 98P4B6 antibody can also be used in methods for purifying 98P4B6-related proteins and methods for isolating 98P4B6 homologs and 98P4B6-related molecules. For example, a method for purifying 98P4B6-related protein includes the following steps: 98P4B6 antibody bound to a solid matrix is combined with lysate or other solution containing 98P4B6-related protein, and 98P4B6 antibody becomes 98P4B6-related protein. Incubating under conditions capable of binding; washing the solid matrix to remove impurities; and eluting 98P4B6-related protein from the bound antibody. Other uses of the 98P4B6 antibody according to the present invention include 98P4
For example, an anti-idiotype antibody that mimics the B6 protein is prepared.

Various methods for preparing antibodies are well known in the art. For example, the antibody is 98P
It can be prepared in isolated or immunoconjugate form by immunizing a suitable mammalian host using 4B6-related proteins, peptides, or fragments (Anti
bodies: A Laboratory Manual, CSH Press, Hen, H
arrow, and Lane (1988); Harlow, Antibodies, C
old Spring Harbor Press, NY (1989)). In addition, 98
A 98P4B6 fusion protein such as a P4B6 GST fusion protein can also be used. In certain embodiments, a GST fusion protein comprising all or most of the amino acid sequence of FIG. 2 or FIG. 3 is generated and then used as an immunogen to generate an appropriate antibody. In another embodiment, 98P4B6-related protein is synthesized and used as an immunogen.

In addition, naked DNA immunization techniques known in the art are used (with or without purified 98P4B6-related protein or 98P4B6-expressing cells) to generate an immune response against the encoded immunogen (as a review). Donnelly et al., 1997, A.
nn. Rev. Immunol. 15: 617-648).

The amino acid sequence of the 98P4B6 protein shown in FIG. 2 or FIG. 3 can be analyzed to select specific regions of the 98P4B6 protein for generating antibodies. For example, 98P4
Hydrophobic analysis and hydrophilicity analysis of the B6 amino acid sequence is used to identify hydrophilic regions in the 98P4B6 structure. Regions of the 98P4B6 protein that exhibit immunogenic structure, as well as other regions and domains, can be obtained by various other methods known in the art (eg, Chou-Fasm
an, Garnier-Robson, Kyte-Doolittle, Eisenbe
rg, Karplus-Schultz or Jameson-Wolf analysis). The hydrophilic profile is described in Hopp, T .; P and Wood
s, K.E. R. 1981, Proc. Natl. Acad. Sci. U. S. A. 78:
3824-3838 method can be used. The hydrophobic profile is Kyte,
J. et al. and Doolittle, R .; F. 1982, J. Am. MOl. Biol. 157
: 105-132. Accessible residue profile percentage (%
) Janin J .; 1979, Nature 277: 491-492. The average flexibility profile was determined by Bhaskaran R.C. Ponn
uswamy P.M. K. 1988, Int. J. et al. Pept. Protein. Res.
32: 242-255. The Beta-turn profile is described by Delage, G. et al. , Roux B. , 1987, Protein E
ngineering 1: 289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. Methods for making 98P4B6 antibodies are further illustrated by the examples provided herein. Methods for preparing proteins or polypeptides for use as immunogens are well known in the art. Methods for preparing immunogenic conjugates of a carrier (eg, BSA, KLH or other carrier protein) and protein are also well known in the art. In some situations, for example, direct conjugation using a carbodiimide reagent is used; in other examples, Pierce Chemical
Co. Binding reagents supplied by Rockford, IL are effective. 98P4B
Administration of the 6 immunogen is often performed by injection using an appropriate adjuvant over an appropriate period of time, as is understood in the art. During the immunization schedule,
Antibody titers can be collected to determine the validity of antibody formation.

98P4B6 monoclonal antibodies can be generated by various means well known in the art. For example, an immortalized cell line that secretes the desired monoclonal antibody is prepared using standard hybridoma technology from Kohler and Milstein, or a modification that immortalizes antibody-producing B cells, as is generally known. Immortalized cell lines secreting the desired antibody are screened by immunoassay (in this assay the antigen is 98P
4B6-related protein). If a suitable immortalized cell culture is identified, the cells can be expanded and antibodies can be generated from either in vitro culture or ascites.

The antibodies or fragments of the invention can also be produced by recombinant means. 98P
Regions that specifically bind to the desired region of the 4B6 protein can also be produced in the context of chimeric or complementarity determining region (CDR) grafted antibodies from multiple species. Humanized 98P4B6 antibodies or human 98P4B6 antibodies can also be produced and are preferred for use in therapeutic situations. Methods for humanizing mouse antibodies and other non-human antibodies by replacing one or more non-human antibody CDRs with the corresponding human antibody sequences are well known (eg, Jones et al., 1986, Nature). 321: 522
525; Riechmann et al., 1988, Nature 332: 323-327; V
erhoeyen et al., 1988, Science 239: 1534-1536). Carter et al., 1993, Proc. Natl. Acad. Sci. USA
89: 4285, and Sims et al., 1993, J. MoI. Immunol. 151: 2296
See also.

Methods for producing fully human monoclonal antibodies include phage display methods and transgenic methods (for review see Vaughan et al.,
1998, Nature Biotechnology 16: 535-539). Fully human 98P4B6 monoclonal antibodies can be generated using cloning techniques using large human Ig gene combinatorial libraries (ie, phage display) (Protein Engineering of Antib
ody Molecules for Prophylactic and Thera
peutic Applications (Man. Clark, edited by M.), Notti
ngham Academic, pages 45-64 (1993), Griffiths and Hoogenboom, Building an in vitro immunos.
system: human antigens from phase display
y libraries; Burton and Barbas, Human Antibo
dies from combinatorial libraries (ibid.) 65-
82). The fully human 98P4B6 monoclonal antibody is also described in PCT patent application WO 98/24893 (Kucherlapati and Jakob, published December 3, 1997).
can be produced using transgenic mice engineered to contain human immunoglobulin loci (Jakobovits, 1998).
, Exp. Opin. Invest. Drugs 7 (4): 607-614; U.S. Patent No. 6,162,963 (issued December 19, 2000); U.S. Patent No. 6,150,58.
4 (issued 12 November 2000); and US Pat. No. 6,114,598 (200).
(See also September 5, 0)). This method avoids the in vitro manipulation required for phage display technology and efficiently produces high affinity authentic human antibodies.

The reactivity of 98P4B6 antibodies with 98P4B6-related proteins can be established by a number of well-known methods, including, where appropriate, 98P4B6-related proteins, 98
Western blot, immunoprecipitation, E using P4B6 expressing cells or extracts thereof
Examples include LISA and FACS analysis. The 98P4B6 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule.
Suitable detectable markers include, but are not limited to, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelators or enzymes. further,
Bi-specific antibodies specific for two or more 98P4B6 epitopes are generated using methods generally known in the art. Homodimer antibodies are also
Can be made by cross-linking techniques known in the art (eg, Wolff et al., Cancer
r Res. 53: 2560-2565).

(V.) 98P4B6 cell immune response)
The mechanism by which T cells recognize antigens has been elucidated. An effective peptide epitope vaccine composition of the present invention induces a therapeutic or prophylactic immune response in a very broad segment of the worldwide population. In order to understand the value and efficacy of the compositions of the present invention for inducing cellular immune responses, a brief review of immunology related techniques is provided.

Complexes of HLA molecules and peptide antigens act as ligands recognized by HLA-restricted T cells (Bus, S et al., Cell 47: 1071, 1986; Babbi
tt, B. P. Et al., Nature 317: 359, 1985; Townsend, A. et al.
And Bodmer, H .; , Annu. Rev. Immunol. 7: 601, 1989
Germain, R .; N. , Annu. Rev. Immunol. 11: 403, 19
93). Through sequencing studies of single amino acid substituted antigen analogs and naturally bound naturally processed peptides, key residues corresponding to motifs required for specific binding to HLA antigen molecules are identified And are listed in Table IV (eg, So
Utwood, et al. Immunol. 160: 3363, 1998; Rammens
ee et al., Immunogenetics 41: 178, 1995; Ramsensee
Et al., SYFPEITHI (World Wide Web via URL (134.2.
96.221 / scripts. hserver. dll / home. access to html); Sette, A .; And Sidney, J .; Curr. Opin. Imm
unol. 10: 478, 1998; Engelhard, V .; H. Curr. Opi
n. Immunol. 6:13, 1994; Sette, A .; And Grey, H .; M.M.
Curr. Opin. Immunol. 4:79, 1992; Sinigaglia,
F. And Hammer, J .; Curr. Biol. 6:52, 1994; Rupper
t et al., Cell 74: 929-937, 1993; Kondo et al., J. MoI. Immunol
. 155: 4307-4312, 1995; Sidney et al. Immunol. 15
7: 3480-3490, 1996; Sidney et al., Human Immunol. 4
5: 79-93, 1996; Sette, A .; And Sidney, J .; Immunog
ethics 1999 Nov; 50 (3-4): 201-12, see review).

Furthermore, X-ray crystallographic analysis of the HLA-peptide complex reveals a pocket within the peptide binding gap / groove of the HLA molecule that accommodates residues carried by the peptide ligand in an allele-specific manner; These residues determine the HLA binding ability of the peptide in which this residue is present (eg, Madden, DR Annu. Rev. Immu).
nol. 13: 587, 1995; Smith et al., Immunity 4: 203, 19
96; Fremont et al., Immunity 8: 305, 1998; Stern et al., S
structure 2: 245, 1994; Jones, E .; Y. Curr. Opin.
Immunol. 9:75, 1997; Brown, J. et al. H. , Nature 364
: 33, 1993; Guo, H .; C. Et al., Proc. Natl. Acad. Sci. US
A 90: 8053, 1993; Guo, H .; C. Et al., Nature 360: 364
1992; Silver, M .; L. Et al., Nature 360: 367, 1992; Ma
tsusumura, M .; Science 257: 927, 1992; Madden et al., Cell 70: 1035, 1992; Fremont, D. et al. H. Et al., Science
257: 919, 1992; A, Bjorman, P.A. J. et al. And Wiley, D .; C. , J .; Mol. Biol. 219: 277, 1991).

Thus, the definition of class I and class I allele-specific HLA binding motifs, or class I or class II supermotifs, allows the identification of regions within proteins that are associated with binding to specific HLA antigens.

Thus, the HLA motif identification process has identified epitope-based vaccine candidates; such candidates determine the binding affinity and / or duration of the association of the epitope with its corresponding HLA molecule. In addition, it can be further evaluated by an HLA-peptide binding assay. From these vaccine candidates, further validation experiments can be performed to select epitopes with favorable characteristics in terms of population coverage and / or immunogenicity.

A variety of strategies can be used to assess cellular immunogenicity, including the following:
1) Evaluation of primary T cell cultures from normal individuals (eg Wentworth, PA)
. Et al., Mol, Immunol. 32: 603, 1995; Celis, E .; Et al., Pro
c. Natl. Acad. Sci. USA 91: 2105, 1994; Tsai, V .;
Et al. Immunol. 158: 1796, 1997; Kawashima, I .; Et al.
Human Immunol. 59: 1, 1998). This procedure involves stimulating peripheral blood lymphocytes (PBL) from normal subjects with a test peptide in the presence of antigen presenting cells for a period of several weeks in vitro. T specific for this peptide
Cells are activated during this time and detected using, for example, a lymphokine release assay or ⁵¹ Cr release assay involving target cells sensitized with the peptide.

2) Immunization of HLA transgenic mice (eg Wentworth, PA et al., J. Immunol. 26:97, 1996; Wentworth, PA et al., In
t. Immunol. 8: 651, 1996; Alexander, J. et al. Et al. Imm
unol. 159: 4753, 1997). For example, in such a method, peptides in incomplete Freund's adjuvant are administered subcutaneously to HLA transgenic mice. Several weeks after immunization, splenocytes are removed and cultured in vitro in the presence of the test peptide for about a week. Peptide-specific T cells are detected using a ⁵¹ Cr release assay, including, for example, target cells sensitized with peptides and target cells that express endogenously generated antigens.

3) Demonstration of recall T cell responses from either effectively vaccinated immunized individuals and / or chronically ill patients (eg, Rehermann, B. et al., J. Exp
. Med. 181: 1047, 1995; Doolan, D .; L. Et al, Immunity
7:97, 1997; Bertoni, R .; Et al. Clin. Invest. 100
: 503, 1997; Threlkeld, S .; C. Et al. Immunol. 159:
1648, 1997; M.M. Et al. Virol. 71: 601
1, 1997). Thus, a recall response is achieved by culturing PBL from a subject that has been exposed to an antigen due to disease and thus produced a “naturally” immune response, or from a patient vaccinated against the antigen. Detected. Subject-derived PB
L is cultured in vitro for 1-2 weeks in the presence of test peptide + antigen presenting cells (APC) to allow activation of “memory” T cells compared to “unstimulated” T cells. At the end of this culture period, T cell activity is detected using assays involving ⁵¹ Cr release, T cell proliferation or lymphokine release including peptides sensitized targets.

(VI.) 98P4B6 transgenic animals)
Nucleic acids encoding 98P4B6-related proteins can also be used to create either transgenic or “knockout” animals, which are then useful in the development and screening of therapeutically useful reagents. . By established techniques, cDNA encoding 98P4B6 can be used to clone genomic DNA encoding 98P4B6. This cloned genomic sequence is then 98
It can be used to create transgenic animals containing cells that express DNA encoding P4B6. Transgenic animals (especially animals such as mice or rats)
Methods for making are routine in the art and are described, for example, in US Pat.
736,866 (issued on April 12, 1988) and 4,870,009 (19
Issued on Sep. 26, 1989). Typically, specific cells are targeted for 98P4B6 transgene integration using a tissue-specific enhancer.

A transgenic animal containing one copy of the transgene encoding 98P4B6 is 9
It can be used to test the effect of increasing the expression of DNA encoding 8P4B6. Such animals can be used, for example, as tester animals for reagents thought to confer protection from pathological conditions associated with its overexpression. According to this aspect of the invention, the animal is treated with a reagent and the incidence of reduced pathological condition compared to an untreated animal with the transgene is a potential for this pathological condition. Indicates therapeutic intervention.

Alternatively, a non-human homologue of 98P4B6 can be used to construct a 98P4B6 “knockout” animal that contains an endogenous gene encoding 98P4B6 and 98P4B6 introduced into the embryonic cells of the animal. As a result of homologous recombination with the altered genomic DNA encoding, there is a defective or altered gene encoding 98P4B6. For example, cDNA encoding 98P4B6 can be used to clone genomic DNA encoding 98P4B6 according to established techniques. A portion of the genomic DNA encoding 98P4B6 can be deleted or replaced with another gene (eg, a gene encoding a selectable marker that can be used to monitor integration). Typically, several kilobases of adjacent DNs that have not changed
A (both at the 5 'and 3' ends) is included in the vector (see, eg, Thomas and Capecchi, Cell, 51 for a description of homologous recombination vectors).
: 503 (1987)). This vector is introduced into an embryonic stem cell line (eg, by electroporation), and cells in which the introduced DNA is homologously recombined with endogenous DNA are selected (eg, Li et al., Cell, 69: 915 (19
92)). The selected cells are then injected into an animal (eg, mouse or rat) blastocyst to form an aggregated chimera (eg, Bradley, Te).
ratocarcinomas and Embryonic Stem Cells:
A Practical Approach, E .; J. et al. Robertson (IRL,
Oxford, 1987), pp. 113-152). The chimeric embryo can then be transferred to an appropriate pseudopregnant female surrogate mother and the embryo is born to create a “knockout” animal. Offspring with DNA homologously recombined in germ cells can be identified by standard techniques and used to breed animals that contain DNA in which all cells are homologous recombination. Knockout animals can be characterized, for example, for the ability to protect against a particular pathological condition, or for the development of a pathological condition resulting from the absence of 98P4B6 polypeptide.

(VII.) 98P4B6 Detection Method)
Another aspect of the invention relates to methods for detecting 98P4B6 polynucleotides and 98P4B6-related proteins, and methods for identifying cells that express 98P4B6. The expression profile of 98P4B6 makes 98P4B6 a diagnostic marker for metastatic disease. Thus, the status of the 98P4B6 gene product provides useful information for estimating various factors including susceptibility to advanced stage disease, rate of progression, and / or tumor aggressiveness. As discussed in detail herein, 98P in a patient sample
The status of the 4B6 gene product can be analyzed by various protocols well known in the art, including immunohistochemical analysis, various Northern blot techniques (including in situ hybridization), RT-PCR analysis (eg, Laser capture microdissection samples), Western blot analysis and tissue array analysis.

More particularly, the present invention provides assays for the detection of 98P4B6 polynucleotides in biological samples (eg, serum, bone, prostate and other tissues, urine, semen, cell preparations, etc.). Detectable 98P4B6 polynucleotides include, for example, 98P4
Recombinant DNA or RNA molecules comprising the B6 gene or fragments thereof, 98P4B6 mRNA, alternative splice variants 98P4B6 mRNA, and 98P4B6 polynucleotides. Numerous methods for amplifying a 98P4B6 polynucleotide and / or detecting the presence of a 98P4B6 polynucleotide are well known in the art and can be used in the practice of this aspect of the invention.

In one embodiment, a method for detecting 98P4B6 mRNA in a biological sample comprises cDN from this sample by reverse transcription using at least one primer.
Generating A; 98P4B6 as sense and antisense primers
Using the polynucleotide to amplify the cDNA thus generated to amplify the 98P4B6 cDNA therein; and the amplified 98P4B6 cDNA
Detecting the presence of. If necessary, this amplified 98P4B6 cD
The sequence of NA can be determined.

In another embodiment, a method for detecting 98P4B6 gene in a biological sample comprises:
First, isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 98P4B6 polynucleotides as sense and antisense primers; and the amplified 98P4B6 gene. Detecting the presence. A number of suitable sense and antisense probe combinations are available.
It can be designed from the 8P4B6 nucleotide sequence (see, eg, FIG. 2) and can be used for this purpose.

The invention also includes tissue or other biological samples (eg, serum, semen, bone, prostate,
Assays for detecting the presence of 98P4B6 protein in urine, cell preparations, etc.) are provided. Methods for detecting 98P4B6-related proteins are also well known and include, for example, immunoprecipitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA, and the like. For example, 98P4B in a biological sample
A method for detecting the presence of a 6-related protein comprises first contacting the sample with a recombinant protein comprising a 98P4B6 antibody, a 98P4B6 reactive fragment thereof, or an antigen binding region of a 98P4B6 antibody; Detecting the binding of the 98P4B6-related protein therein.

Methods for identifying cells that express 98P4B6 are also within the scope of the invention. In one embodiment, the assay for identifying a cell that expresses the 98P4B6 gene comprises detecting the presence of 98P4B6 mRNA in the cell. Specific m in the cell
Methods for detecting RNA are well known and include, for example, hybridization assays using complementary DNA probes (eg, in situ hybridization using labeled 98P4B6 riboprobe, Northern blot and related techniques).
, And various nucleic acid amplification assays (eg, RT-PCR using complementary primers specific for 98P4B6, and other amplified detection methods (eg, branched DNA, SI
SBA, TMA, etc.)). Alternatively, an assay for identifying a cell that expresses a 98P4B6 gene includes detecting the presence of a 98P4B6-related protein present in or secreted by the cell. Various methods for the detection of proteins are well known in the art and are used for the detection of 98P4B6-related proteins and for the detection of cells expressing 98P4B6-related proteins.

98P4B6 expression analysis is also useful as a tool for identifying and evaluating factors that modulate 98P4B6 gene expression. For example, 98P4B6 expression is significantly upregulated in prostate cancer and is expressed in cancers of tissues listed in Table I. The identification of molecules or biological factors that inhibit 98P4B6 expression or 98P4B6 overexpression in cancer cells has therapeutic value. For example, such factors can be identified by using a screen that quantifies 98P4B6 expression by RT-PCR, nucleic acid hybridization, or antibody binding.

(VIII.) Methods for monitoring the status of 98P4B6-related genes and their products)
Tumor formation is known to be a multi-step process in which cell growth becomes progressively dysregulated and cells progress from a normal physiological state to a precancerous state and then to a cancerous state (
See, for example, Allers et al., Lab Invest. 77 (5): 437-438 (1997)
) And Isaacs et al., Cancer Surv. 23: 19-32 (1995)). In this situation, testing biological samples for evidence of dysregulated cell growth (eg, abnormal 98P4B6 expression in cancer) makes pathological conditions such as cancer more restrictive of treatment options It is possible to detect such abnormal physiology early before proceeding to a stage and / or before prognosis worsens. In such a test, the status of 98P4B6 in the biological sample of interest is, for example, in the corresponding normal sample (eg, a sample from this individual or another alternative individual not affected by pathology). Can be compared with the state of 98P4B6. 98P4 in biological samples
Changes in the state of B6 (compared to normal samples) provide evidence of dysregulated cell growth. In addition to using a biological sample unaffected by pathology as a normal sample, a predetermined normative value (eg, a predetermined normal level of mRNA expression) (eg, Grever et al., J. Comp. Neurol). 1996 Dec 9; 3
76 (2): 306-14 and US Pat. No. 5,837,501) can also be used to compare the status of 98P4B6 in samples.

In this context, the term “condition” is used according to the art recognized meaning and refers to the condition of a gene and its products. Typically, those skilled in the art will use a number of parameters to determine the status of a gene and its product (condi).
(state or state). This includes the location of the expressed gene product (98
Including the location of P4B6 expressing cells), as well as the expressed gene product (eg 98P4B
6 mRNA, polynucleotides and polypeptides) levels and biological activity, including but not limited to. Typically, the change in the state of 98P4B6 is
Including changes in the location of 98P4B6 and / or 98P4B6 expressing cells, and / or increased expression of 98P4B6 mRNA and / or 98P4B6 protein.

The status of 98P4B6 in a sample can be analyzed by a number of means well known in the art, including immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser-captured microdissection samples, Western blot analysis and Examples include, but are not limited to, tissue array analysis. Representative protocols for assessing the status of the 98P4B6 gene and gene product are described, for example, in Ausubel et al., 199
5, Current Protocols in Molecular Biology
, Units 2 (Northern Blotting), 4 (Southern B
lotting), 15 (Immunoblotting) and 18 (PCR Ana)
lysis). Thus, the status of 98P4B6 in a biological sample can be assessed by various methods used by those skilled in the art, including genomic Southern analysis (eg, to test perturbation in the 98P4B6 gene). ), Northern analysis and / or PCR analysis of 98P4B6 mRNA (eg to test changes in polynucleotide sequence or expression level of 98P4B6 mRNA), and Western analysis and / or immunohistochemical analysis (eg changes in polypeptide sequence) , Changes in the localization of the polypeptide within the sample, changes in the expression level of the 98P4B6 protein, and / or association of the 98P4B6 protein with the polypeptide binding partner). But it is not limited to these. Detectable 98P4B6 polynucleotides include, for example, 98P4B6 gene or fragments thereof, 98P4B6 mRNA, alternative splice variants, 98P4B6 m
Recombinant DNA molecule or recombinant RN comprising RNA and 98P4B6 polynucleotide
A molecule is mentioned.

The expression profile of 98P4B6 makes 98P4B6 a diagnostic marker for local and / or metastatic disease and provides information about the potential for growth or tumor formation of biological samples. In particular, the 98P4B6 status provides information useful for estimating susceptibility to a particular disease stage, progression and / or tumor aggressiveness. The present invention provides methods and assays for determining the status of 98P4B6 and diagnosing cancers that express 98P4B6 (eg, cancers of tissues listed in Table I). For example, 98P4B6 m
Since RNA is highly expressed in prostate cancer and other cancers compared to normal prostate tissue, assays that assess the level of 98P4B6 mRNA transcript or 98P4B6 protein in biological samples are dysregulated in 98P4B6 Can be used to diagnose diseases associated with and provide prognostic information useful in defining appropriate treatment options.

98P4B6 expression status assesses information to predict susceptibility to various stages of disease, including the presence, stage and location of dysplastic cells, precancerous cells and cancer cells, and / or tumor aggressiveness Provide information for Furthermore, the expression profile is 98P4B
6 makes it useful as an imaging reagent for metastatic disease. Consequently, an aspect of the invention is a sample from an individual suffering from a biological sample (eg, a pathology characterized by dysregulated cell growth (eg, cancer), or suffering from such a pathology. The present invention relates to various molecular prognostic methods and molecular diagnostic methods for testing the status of 98P4B6 in a sample from a suspected individual.

As described above, the status of 98P4B6 in a biological sample can be tested by a number of procedures well known in the art. For example, the status of 98P4B6 in a biological sample taken from a specific location on the body can be used to identify this sample as 98P4B6 expressing cells (eg, 98P4B
B6 mRNA or 98P4B6 protein expressing cells) can be tested by assessing for the presence or absence. This test can provide evidence of dysregulated cell growth, for example, when 98P4B6 expressing cells are found in biological samples that normally do not contain such cells (eg, lymph nodes). . This is because such changes in the state of 98P4B6 in a biological sample are often associated with dysregulated cell growth. In particular, one indication of dysregulated cell growth is metastasis of cancer cells from an organ of origin (eg, prostate) to a different region of the body (eg, lymph nodes). In this situation, evidence of dysregulated cell growth is important. For example, in a significant proportion of patients with prostate cancer, latent lymph node metastases can be detected and such metastases are associated with known predictors of disease progression (eg, , M
urphy et al., Prostate 42 (4): 315-317 (2000); Su et al.,
Semin. Surg. Oncol. 18 (1): 17-28 (2000) and Fre
eman et al., J Urol 1995 Aug 154 (2 Pt 1): 474-8).

In one aspect, the present invention determines the status of the 98P4B6 gene product expressed by cells from an individual suspected of having a disease (eg, hyperplasia or cancer) associated with dysregulated cell proliferation, The state determined in this way is defined as 98 in the corresponding normal sample.
A method for monitoring the 98P4B6 gene product is provided by comparison with the status of the P4B6 gene product. Abnormal 9 in the test sample compared to the normal sample
The presence of the 8P4B6 gene product provides an indication of the presence of dysregulated cell growth in the individual's cells.

In another aspect, the present invention provides an assay useful in determining the presence of cancer in an individual, wherein the assay is a test cell sample compared to expression levels in corresponding normal cells or normal tissues. Or detecting a significant increase in expression of 98P4B6 mRNA or protein in the test tissue sample. For example, 98P4B6 mRN
The presence of A can be assessed in tissues including but not limited to those listed in Table I. The presence of significant 98P4B6 expression in any of these tissues is indicative of cancer development,
Useful for indicating presence and / or severity. Because the corresponding normal tissue is
This is because 98P4B6 mRNA is not expressed or expressed only at a low level.

In a related embodiment, 98P4B6 status is determined at the protein level rather than at the nucleic acid level. For example, such methods determine the level of 98P4B6 protein expressed by cells in the test tissue sample and compare the level thus determined to the level of 98P4B6 expressed in the corresponding normal sample. Process. In one embodiment, the presence of 98P4B6 protein is assessed using, for example, immunohistochemical methods. A 98P4B6 antibody or 98P4B6 binding partner capable of detecting 98P4B6 protein expression is used for this purpose in various assay formats well known in the art.

In further embodiments, the status of 98P4B6 nucleotide and 98P4B6 amino acid sequences in a biological sample can be evaluated to identify variations in the structure of these molecules. These variations can include insertions, deletions, substitutions, and the like. Such an evaluation is useful. Because variations in nucleotide and amino acid sequences are observed in a number of proteins associated with growth dysregulated phenotypes (see, eg, Marrogi et al., 1999, J. Cutan. Pathol. 26 (8)).
: 369-378). For example, mutations in the sequence of 98P4B6 may indicate the presence of a tumor or an oncogenic effect. Thus, such assays have diagnostic and predictive value when mutations in 98P4B6 indicate potential loss of function or increased tumor growth.

A wide variety of assays for observing variations in nucleotide and amino acid sequences are well known in the art. For example, the size and structure of the 98P4B6 gene product nucleic acid or amino acid sequence is observed by the Northern, Southern, Western, PCR, and DNA sequencing protocols discussed herein. In addition, other methods for observing variations in nucleotide and nucleic acid sequences (eg, single chain conformational polymorphism analysis) are well known in the art (eg, US Pat. No. 5,382,510 ( Issued on September 7, 1999) and 5,952,170
Issue (issued January 17, 1995)).

In addition, the methylation status of the 98P4B6 gene in a biological sample can be tested. Aberrant demethylation and / or hypermethylation of CpG islands in the 5 ′ regulatory region of genes often occurs in immortalized and transformed cells, resulting in altered expression of various genes. For example, promoter hypermethylation of the π class glutathione S-transferase (a protein that is expressed in normal prostate and not expressed in more than 90% of prostate cancers) seems to permanently stop transcription of this gene. And the most frequently detected genomic changes in prostate cancer (De Marzo et al., Am
. J. et al. Pathol. 155 (6): 1985-1992 (1999)). Furthermore, this change is present in at least 70% of cases of advanced prostate intraepithelial neoplasia (PIN) (Brooks et al., Cancer Epidemiol. Biomarkers).
Prev. 1998, 7: 531-536). In another example, the expression of a LAGE-I tumor specific gene (which is not expressed in normal prostate but
(Expressed in 50%) is induced by deoxy-azacytidine in lymphoblasts, suggesting that tumor expression is due to demethylation (Leth)
e et al., Int. J. et al. Cancer 76 (6): 903-908 (1998)). Various assays for testing the methylation status of a gene are well known in the art. For example, in a Southern hybridization approach, the methylation status of CpG islands can be assessed using a methylation sensitive restriction enzyme that cannot cleave sequences containing methylated CpG sites. Furthermore, MSP (methylation specific PCR) can easily profile the methylation status of all CpG sites present in a CpG island of a given gene. This procedure is specific for DNA that is first modified with sodium bisulfite (which converts all unmethylated cytosine to uracil) and then methylated against unmethylated DNA. Amplification using simple primers. Protocols involving methylation interference are also e.g. Current Protocols In Mo.
legal Biology, Unit 12, Frederick M. et al. Ausu
bel et al., 1995.

Gene amplification is a further method for assessing the status of 98P4B6. Gene amplification is based on the sequences provided herein, eg, conventional Southern or Northern blotting (Thomas, 1980, Proc. Natl. Acad. Sci.
, 77: 5201-5205), dot blotting (DNA analysis), or in situ hybridization. Alternatively, specific duplexes (DNA duplex, RNA duplex, and DNA-RNA hybrid duplex or D
An antibody that recognizes NA-protein duplexes) is used. This antibody is then
Labeled and an assay is performed in which the duplex is bound to the surface so that when a duplex is formed on the surface, the presence of an antibody bound to the duplex Can be detected.

Biopsy tissue or peripheral blood can be analyzed, for example, by Northern analysis, dot blot analysis or RT-P.
Using CR analysis, 98P4B6 expression can be detected conveniently assayed for the presence of cancer cells. The presence of RT-PCR amplifiable 98P4B6 mRNA provides an indication of the presence of cancer. RT-PCR assays are well known in the art. RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of many human solid tumors. In the field of prostate cancer, this assay includes PSA.
And RT-PCR assays for detection of cells expressing PSM (Ver.
kaik et al., 1997, Urol. Res. 25: 373-384; Ghossein et al., 1995, J. MoI. Clin. Oncol. 13: 1195-2000; Heston et al.,
1995, Clin. Chem. 41: 1687-1688).

A further aspect of the invention is an assessment of the susceptibility an individual has for developing cancer. In one embodiment, the method for predicting susceptibility to cancer is 98P4 in a tissue sample.
B6 mRNA or 98P4B6 protein (the presence of which indicates susceptibility to cancer)
Wherein the degree of 98P4B6 mRNA expression correlates with the degree of sensitivity. In certain embodiments, the presence of 98P4B6 in the prostate or other tissue is tested, wherein the presence of 98P4B6 in this sample provides an indication of prostate cancer susceptibility (or prostate tumor development or presence). . Similarly, 98 in biological samples
The integrity of the P4B6 nucleotide and 98P4B6 amino acid sequences can be evaluated to identify variations in the structure of these molecules (eg, insertions, deletions, substitutions, etc.). The presence of one or more variations of the 98P4B6 gene product in the sample is an indication of cancer susceptibility (or tumor development or presence).

The invention also includes a method for assessing tumor aggressiveness. In one embodiment,
A method for assessing tumor aggressiveness is the 98P4B6 mR expressed by tumor cells.
Determining the level of NA or 98P4B6 protein, comparing the level thus determined to the level of 98P4B6 mRNA or 98P4B6 protein expressed in corresponding normal tissue taken from the same individual or normal tissue reference sample Where 98P4B6 mRN in tumor samples versus normal samples
The degree of expression of A or 98P4B6 protein indicates the degree of aggressiveness. In certain embodiments, tumor aggressiveness is assessed by determining the extent to which 98P4B6 is expressed in tumor cells, where a higher expression level indicates a more aggressive tumor. Another embodiment is an assessment of the integrity of this 98P4B6 nucleotide and amino acid sequence in a biological sample to identify variations in the structure of 98P4B6 nucleotides and amino acids (eg, insertions, deletions, substitutions, etc.) . The presence of one or more fluctuations indicates a more aggressive tumor.

Another embodiment of the invention relates to a method for observing the progression of malignancy in an individual over time. In one embodiment, the method for observing the progression of malignancy in an individual over time is 98P4B6 mRNA or 98P expressed by cells in a tumor sample.
Determining the level of 4B6 protein, the level thus determined is expressed in equivalent tissue samples taken from the same individual at different times 98P4B6 mR
Comparing to the level of NA or 98P4B6 protein, wherein the degree of expression of 98P4B6 mRNA or 98P4B6 protein in the tumor sample over time provides information about the progression of the cancer. In certain embodiments, cancer progression is assessed by determining 98P4B6 expression in tumor cells over time, wherein increased expression over time indicates cancer progression. Also, the integrity of 98P4B6 nucleotide and 98P4B6 amino acid sequences in biological samples can be assessed to identify variations in the structure of these molecules (eg, insertions, deletions, substitutions, etc.), where 1 The presence of more than one variation indicates cancer progression.

The above diagnostic approaches can be combined with any one of a wide variety of prognostic and diagnostic protocols known in the art. For example, another embodiment of the present invention provides 98P
Co-occurrence between 4B6 gene expression and 98P4B6 gene product expression (or 98P4B6 gene variation and 98P4B6 gene product variation) and factors associated with malignant tumors as a means to diagnose and predict tissue sample status Relates to a method for observing. A wide variety of factors associated with malignant tumors (eg, expression of genes associated with malignant tumors (eg, expression of PSA, PSCA and PSM for prostate cancer), as well as visible cytological findings are used. Obtain (eg, Bocking et al., 1984).
, Anal. Quant. Cytol. 6 (2): 74-88; Epstein, 199
5, Hum. Pathol. 26 (2): 223-9; Thorson et al., 1998, M
od. Pathol. 11 (6): 543-51; Baisden et al., 1999, Am.
J. et al. Surg. Pathol. 23 (8); 918-24). 98P4B6
Methods for observing the co-occurrence between gene expression and 98P4B6 gene product expression (or variation in the 98P4B6 and 98P4B6 gene products) and another factor associated with malignancy are useful. This is because, for example, the presence of a specific set of factors that coincide with the disease provides important information for diagnosing and predicting the condition of a tissue sample.

In one embodiment, the method for observing co-occurrence between expression of 98P4B6 gene and expression of 98P4B6 gene product (or variation in 98P4B6 gene and 98P4B6 gene product) and another factor associated with malignancy is: 98P4 in tissue samples
Detecting overexpression of B6 mRNA or 98P4B6 protein, detecting overexpression (or PSCA or PSM expression) of PSA mRNA or PSA protein in a tissue sample, and overexpression of 98P4B6 mRNA or 98P4B6 protein, and PSA Overexpression of mRNA or PSA protein (or P
With observing coincidence with SCA expression or PSM expression). In certain embodiments, the expression of 98P4B6 mRNA and PSA mRNA in prostate tissue is
Tested, where 98P4B6 mRNA overexpression and PSA mRN in this sample
Co-occurrence with A overexpression indicates the presence of prostate cancer, prostate cancer susceptibility or prostate tumor onset or condition.

A method for detecting and quantifying the expression of 98P4B6 mRNA or protein comprises:
Standard nucleic acid and protein detection and quantification techniques are well known in the art, as described herein. Standard methods for detection and quantification of 98P4B6 mRNA include in situ hybridization using labeled 98P4B6 riboprobe, Northern blot using 98P4B6 polynucleotide probe and related techniques, using primers specific for 98P4B6 RT-PCR analysis, as well as other amplification type detection methods (eg, branched DNA, SISBA, TMA, etc.) can be mentioned. In certain embodiments, 98P4B6 mRNA is used using semi-quantitative RT-PCR.
Expression is detected and quantified. Any number of primers capable of amplifying 98P4B6 can be used for this purpose, including but not limited to the various primer sets specifically described herein. . In certain embodiments, polyclonal or monoclonal antibodies that specifically react with wild type 98P4B6 protein may be used in immunohistochemical assays of biopsy tissues.

(Identification of molecules that interact with IX.98P4B6)
98P4B6 protein and nucleic acid sequences disclosed herein are 98P4
It makes it possible to identify the pathway activated by 98P4B6 via any one of proteins, small molecules and other drugs that interact with 4B6, and protocols accepted in various fields. For example, one of the so-called interaction trap systems (also referred to as “two hybrid assays”) may be utilized. In such a system, the molecule interacts with and reconstitutes a transcription factor that directs expression of the reporter gene, while assaying for expression of this reporter gene. Other systems identify protein-protein interactions in vivo via reconstruction of eukaryotic transcriptional activators (eg, 1999).
U.S. Pat. No. 5,955,280 issued on Sep. 21, 1999, U.S. Pat. No. 5,925,523 issued on Jul. 20, 1999, issued on Dec. 8, 1998 5,846
No. 722, and No. 6,004,746 issued Dec. 21, 1999). Algorithms are also available in the art for genome-based prediction of protein function (see, eg, Marcotte et al., Nature 402: November 4, 1999, 83-86).

Alternatively, peptide libraries can be screened to identify molecules that interact with the 98P4B6 protein sequence. In such methods, peptides that bind to 98P4B6 are identified by screening a library that encodes a random or controlled collection of amino acids. The peptides encoded by this library are expressed as bacteriophage coat protein fusion proteins, and then the bacteriophage particles are screened against the 98P4B6 protein.

Thus, peptides having a wide variety of uses (eg, therapeutic, prognostic or diagnostic agents) are identified without previous information regarding the structure of the expected ligand or receptor molecule. Representative peptide libraries and screening methods that can be used to identify molecules that interact with the 98P4B6 protein sequence are described, for example, in March 1998.
U.S. Pat. No. 5,723,286 issued on the same day, and U.S. Pat. No. 5,733,731 issued March 31, 1998.

Alternatively, cell lines expressing 98P4B6 are used to identify protein-protein interactions mediated by 98P4B6. Such interactions can be achieved by immunoprecipitation techniques (eg, Hamilton BJ et al., Biochem. Biophys. R).
es. Commun, 1999, 261: 646-51). 98P4B6 protein can be immunoprecipitated from a 98P4B6 expressing cell line using an anti-98P4B6 antibody. Alternatively, antibodies against His-tag can be used in cell lines engineered to express a fusion of 98P4B6 and His-tag (the above vector). This immunoprecipitation complex can be tested for proteins by procedures such as Western blot, ³⁵ S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.

Small molecules and ligands that interact with 98P4B6 can be identified through related embodiments of such screening assays. For example, small molecules (including molecules that interfere with 98P4B6's ability to mediate phosphorylation and dephosphorylation) may cause interference with protein function to be an indication of the regulation of cell cycle, second messenger signaling, or tumorigenesis. As an interaction with a DNA or RNA molecule. Similarly, 98
Small molecules that modulate P4B6-related ion channels, protein pumps, or cell communication functions are identified and used to process proteins with cancer that express 98P4B6 (eg, Hille, B., Ionic Channels of Excitab).
le Membranes 2nd edition, Sinauer Assoc. , Sundella
nd, MA, 1992). In addition, ligands that modulate 98P4B6 function can be identified based on their ability to bind to 98P4B6 and activate the reporter construct. Exemplary methods are discussed, for example, in US Pat. No. 5,928,868, issued July 27, 1999, and to form a hybrid ligand in which at least one ligand is a small molecule. Including methods. In an exemplary embodiment, cells engineered to express 98P4B6 fusion protein and DNA binding protein are used to produce a hybrid ligand / small molecule fusion protein and cDN.
A library transcriptional activation protein is co-expressed. This cell has a reporter gene (
This expression further regulates the first and second fusion proteins adjacent to each other), and this event occurs only when the hybrid ligand binds to the target sites of both hybrid proteins. Those cells expressing the reporter gene are selected and the unknown small molecule or unknown ligand is identified. This method provides a means to identify modulators that activate or inhibit 98P4B6.

Embodiments of the invention include a method of screening for molecules that interact with the 98P4B6 amino acid sequence shown in FIG. 2 or FIG. 3, which comprises a group of molecules and 98P4B.
Contacting with 6 amino acid sequences; interacting the group of molecules with the 98P4B6 amino acid sequence under conditions that facilitate interaction; determining the presence of molecules that interact with the 98P4B6 amino acid sequence; Then, separating the molecule that does not interact with the 98P4B6 amino acid sequence from the molecule that interacts with the 98P4B6 amino acid sequence is included. In certain embodiments, the method further comprises purifying, characterizing and identifying molecules that interact with the 98P4B6 amino acid sequence. This identified molecule can be used to modulate the function performed by 98P4B6. In a preferred embodiment, the 98P4B6 amino acid sequence is contacted with a peptide library.

(X. Treatment methods and compositions)
The identification of 98P4B6, such as a protein that is normally expressed in a limited set of tissues but is also expressed in cancers (eg, those listed in Table 1), has led to numerous therapeutic approaches for such cancers. Spread to treatment. It should be noted that targeted anti-tumor treatment was useful even when the targeted protein was expressed in normal tissue, life-threatening normal organ tissue. A life-threatening organ is one of the organs necessary to maintain life (eg, heart or colon). An organ that is not a life-threatening organ is an organ that can still survive if the organ is removed. Examples of organs that are not life-threatening are ovaries,
Breast and prostate.

Accordingly, therapeutic approaches that inhibit the activity of 98P4B6 protein are useful for patients suffering from cancers that express 98P4B6. Such therapeutic approaches generally fall into two classes. One class includes various methods for inhibiting the binding or association of 98P4B6 protein with its binding partner or other proteins. Another class is 9
Various methods for inhibiting transcription of the 8P4B6 gene or translation of 98P4B6 mRNA are included.

(X.A. Anticancer vaccine)
The present invention provides a cancer vaccine comprising 98P4B6-related protein or 98P4B6-related nucleic acid. With respect to the expression of 98P4B6, cancer vaccines prevent and / or treat 98P4B6 expressing cancer with minimal or no effect on non-target tissues. The use of tumor antigens in vaccines that produce humoral and / or cell-mediated immune responses as anti-cancer treatments is well known in the art, and human PSMA and rodent PAP
Used in prostate cancer using immunogens (Hodge et al., 1995, Int.
J. et al. Cancer 63: 231-237; Fong et al., 1997, J. MoI. Immunol
. 159: 3113-3117).

Such a method utilizes a 98P4B6-related protein, or a recombinant vector capable of expressing and displaying a 98P4B6-encoding nucleic acid molecule and a 98P4B6 immunogen, which typically includes multiple antibodies or T cell epitopes. Can be easily implemented. One skilled in the art understands that a wide variety of vaccine systems for delivery of immunoreactive epitopes are known in the art (eg, Herln et al., Ann Med 1999 Fe
b 31 (1): 66-78; Maruyama et al., Cancer Immunol I
munother 2000 Jun 49 (3): 123-32). Briefly, such methods for generating an immune response (eg, a humoral immune response and / or a cell-mediated immune response) in a mammal include the following steps: an immunoreactive epitope (eg, an epitope is Exposing the mammal's immune system to the 98P4B6 protein shown in FIG. 3, or an analog or homologue thereof, which results in the mammal generating a specific immune response against the epitope (eg, Generating an antibody that specifically recognizes this epitope). In preferred methods, the 98P4B6 immunogen comprises a biological motif (eg, Tables VIII-XXI and XXII-XLIX or FIGS. 5, 6).
See the constant size range of peptides derived from 98P4B6 as shown in FIGS. 7, 8, and 9).

The entire 98P4B6 protein, immunogenic region or epitopes thereof can be combined and delivered by various means. Such vaccine compositions include, for example: lipopeptides (eg, Vitiello, A. et al., J. Clin. In
vest. 95: 341, 1995), poly (DL-lactide-co-glycolide) ("P
LG ") peptide composition encapsulated in microspheres (eg Eldrigg
e et al., Molec. Immunol. 28: 287-294, 1991: Alonso et al., Vaccine 12: 299-306, 1994; Jones et al., Vaccine.
13: 675-681, 1995), peptide compositions contained in immune stimulating complexes (ISCOMS) (eg Takahashi et al., Nature 344: 873).
-875, 1990; Hu et al., Clin Exp Immunol. 113: 235-2
43, 1998), multi-antigen peptide systems (MAP) (eg Tam, J.P.
. , Proc. Natl. Acad. Sci. U. S. A. 85: 5409-5413,
1988; Tam, J .; P. , J .; Immunol. Methods 196: 17-3
2, 1996), peptides formulated as multivalent peptides, peptides for use in ballistic delivery systems (typically crystallized peptides), viral delivery vectors (Perkus, ME et al., Concepts in vaccine develop
pment, Kaufmann, S.M. H. E. Ed., P. 379, 1996; Chakra.
barti, S.M. Et al., Nature 320: 535, 1986; L. Et al., N
nature 320: 537, 1986; Kiney, M .; -P. Et al., AIDS Bio
/ Technology 4: 790, 1986; H. J. et al. Infec
t. Dis. 124: 148, 1971; Chanda, P .; K. Et al., Virology
175: 535, 1990), particles of viral or synthetic origin (eg Kofl
er, N .; J. et al. Immunol. Methods. 192: 25, 1996; Eld
ridge, J .; H. Et al., Sem. Hematol. 30:16, 1993; Falo,
L. D. , Jr. Et al., Nature Med. 7: 649, 1995), adjuvant (
Warren, H.C. S. Vogel, F .; R. And Chedid, L .; A. Annu
. Rev. Immunol. 4: 369, 1986; Gupta, R .; K. Et al, Vacc
ine 11: 293, 1993), liposomes (Reddy, R. et al., J. Immun.
ol. 148: 1585, 1992; Rock, K .; L. , Immunol. Today
17: 131, 1996) or naked or particle-absorbing cDNA (Ulmer
, J .; B. Et al., Science 259: 1745, 1993; Robinson, H. et al.
L. Hunt, L .; A. And Webster, R .; G. , Vaccine 11: 9
57, 1993; Shiver, J. et al. W. Et al., Concepts in vaccine
development, Kaufmann, S .; H. E. Hen, p. 423, 1996.
Cease, K .; B. And Berzofsky, J. et al. A. , Annu. Rev. Im
munol. 12: 923, 1994 and Eldridge, J. et al. H. Et al., Sem. H
ematol. 30:16, 1993). Toxin targeted delivery technology (receptor-mediated targeting (eg, Avant Immunotherapeutics, Inc. (Needham
, Massachusetts), also known as receptor-mediated targeting), can also be used.

In patients with cancer associated with 98P4B6, the vaccine compositions of the invention are also used in conjunction with other treatments used for cancer (eg, surgery, chemotherapy, drug therapy, radiation therapy, etc.). (Including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, etc.).

(Cell vaccine)
CTL epitopes can be determined using a specific algorithm to identify peptides within the 98P4B6 protein that bind to the corresponding HLA allele: (eg, Table I
V; Epimer ^™ and Epimatrix ^™ , Brown Universit
y (URL brown. edu / Research / TB-HIV_Lab / epim
atrix / epimatrix. html); and BIMAS (URL bimas
. dcrt. nih. gov /; SYFPEITHI at URL syfepeith
i. bmi-heidelberg. com /)). In a preferred embodiment, 98P
The 4B6 immunogen comprises one or more amino acid sequences identified using techniques well known in the art, which include the sequences shown in Tables VIII-XXI and XXII-XLIX, or the HLA class I motif / Super motifs (eg, Table IV (A), Table IV (D),
Or a peptide of 8, 9, 10 or 11 amino acids and / or HLA class II motif / supermotif (e.g., Table IV (B), or Table IV ( A peptide of at least 9 amino acids, including C)). As understood in the art, the HLA class I binding groove is essentially closed, so that peptides of only a specific size region can fit into and be bound to the groove,
In general, HLA class I epitopes are 8, 9, 10, or 11 amino acids long. In contrast, the HLA class II binding groove is essentially openly terminated, so that peptides of about 9 or more amino acids can be bound by HLA class II molecules. Due to the difference in binding groove between HLA class I and HLA class II, HLA class I
The motif is length specific. That is, the two positions of the class I motif are the second amino acid from the amino direction to the carboxyl direction of this peptide. The amino acid positions of class II motifs only correlate with each other and not with the whole peptide. That is, additional amino acids can be attached to the amino terminus and / or carboxyl terminus of the motif bearing sequence. HLA class II epitopes are often 9 amino acids long, 10
Amino acid length, 11 amino acid length, 12 amino acid length, 13 amino acid length, 14 amino acid length, 15
Amino acid length, 16 amino acid length, 17 amino acid length, 18 amino acid length, 19 amino acid length, 20
Amino acid length, 21 amino acid length, 22 amino acid length, 23 amino acid length, 24 amino acid length, or 25 amino acid length, or longer than 25 amino acid length.

(Antibody-based vaccine)
A wide variety of methods for generating an immune response in a mammal are known in the art (eg, as a first step in the generation of hybridomas). A method of generating an immune response in a mammal includes exposing the mammalian immune system to an immunogenic epitope on a protein (eg, 98P4B6 protein), thereby generating an immune response. Exemplary embodiments contact a host with a sufficient amount of at least one 98P4B6B cell or cytotoxic T cell epitope or analog thereof; and after at least one periodic interval, the 98P4B6B cell or cytotoxicity Consists of a method for generating an immune response against 98P4B6 in a host by re-contacting the sex T cell epitope or analog thereof with the host. Certain embodiments consist of a method of generating an immune response against a 98P4B6-related protein or an artificial multi-epitope peptide, the method comprising a 98P4B6 immunogen (eg, 98P4B6 protein or peptide fragment thereof, 98P4B6 fusion protein or analog, etc.) In a vaccine preparation to a human or another mammal. Typically, such vaccine preparations further comprise a suitable adjuvant (see, eg, US Pat. No. 6,146,635) or a universal helper epitope (Epi) such as the PADRE ^™ peptide.
mmune Inc. San Diego, CA; for example, Alexander et al., J
. Immunol. 2000 164 (3); 164 (3): 1625-1633; Al
expander et al., Immunity 1994 1 (9): 751-761 and Al
expander et al., Immunol. Res. 1998 18 (2): 79-92). An alternative method is to administer in vivo to individual body muscles or skin, a DNA molecule comprising a DNA sequence encoding a 98P4B6 immunogen, a DNA sequence operably linked to a regulatory sequence that controls the expression of the DNA sequence. Generating an individual immune response against the 98P4B6 immunogen; wherein the DNA molecule is taken up by the cell, the DNA sequence is expressed in the cell, and the immune response is (See, for example, US Pat. No. 5,962,428). Optionally, genetic vaccine facilitators (eg, anionic lipids; saponins; lectins; estrogen compounds; hydroxylated lower alkyls; dimethyl sulfoxides; and ureas) are also administered. In addition, anti-idiotype antibodies that mimic 98P4B6 can be administered to generate a response to the target antigen.

(Nucleic acid vaccine)
The vaccine composition of the present invention comprises a nucleic acid mediated mode. D encoding the protein of the invention
NA or RNA can be administered to the patient. Genetic immunization methods can be utilized to generate prophylactic or therapeutic humoral and cellular immune responses against cancer cells expressing 98P4B6. A construct comprising DNA encoding a 98P4B6-related protein / immunogen and appropriate regulatory sequences can be injected directly into the muscle or skin of an individual so that the muscle or skin cells take up the construct and code Expressed 98P4B6 protein / immunogen. Alternatively, the vaccine comprises 98P4B6-related protein.
Expression of the 98P4B6-related protein immunogen results in the development of prophylactic or therapeutic humoral and cellular immunity against cells carrying the 98P4B6 protein. Various prophylactic and therapeutic gene immunization techniques known in the art can be used (for review, see information and references published on the Internet address World Wide Web ULR genweb.com) . Nucleic acid-based delivery is described, for example, by Wolff et al., Science 247: 1465 (1990) and US Pat. No. 5,580,859.
No. 5,589,466; No. 5,804,566; No. 5,739,118; No. 5,736,524; No. 5,679,647; WO 98/647 04720. Examples of DNA-based delivery techniques include “naked DNA”, facilitated (bupivacaine, polymer, peptide mediated) delivery, cationic lipid complexes, and particle mediated delivery (“gene gun”) or pressure Mediated delivery (see, eg, US Pat. No. 5,922,687).

For therapeutic or prophylactic immunization purposes, the proteins of the invention can be expressed via viral or bacterial vectors. Various viral gene delivery systems that can be used in the practice of the present invention include vaccinia virus, fowlpox virus, canarypox virus, adenovirus, influenza virus, poliovirus, adeno-associated virus, lentivirus, and Sindbis virus (eg, , Restifo, 1996, Cur
r. Opin. Immunol. 8: 658-663; Tsang et al., J. MoI. Natl. C
anchor Inst. 87: 982-990 (1995)), but is not limited thereto. Non-viral delivery systems also provide patients with naked DNA encoding 98P4B6-related proteins (eg, intramuscularly or intradermally) to induce an anti-tumor response.
It can be used by introducing.

Vaccine viruses are used, for example, as vectors for expressing nucleotide sequences encoding the peptides of the present invention. Upon introduction into the host, the recombinant vaccine virus expresses a protein immunogenic peptide and thereby elicits a host immune response. Vaccine vectors and methods useful in immunization protocols are described, for example, in US Pat.
, 722,848. Another vector is BCG (Bacille Ca
lmette Guerin). The BCG vector is described by Stover et al., Nature.
e 351: 456-460 (1991). A wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention (eg, adenovirus vectors and adeno-associated virus vectors, retrovirus vectors, Salmonel).
la typhi vectors, detoxified anthrax toxin vectors, etc.) will be apparent to those skilled in the art from the description herein.

Thus, gene delivery systems are used to deliver 98P4B6-related nucleic acid molecules. In one embodiment, full length human 98P4B6 cDNA is used. In another embodiment, 98P4B6 nucleic acid molecules encoding specific cytotoxic T lymphocytes (CTLs) and / or antibody epitopes are used.

(Ex vivo vaccine)
A variety of ex vivo strategies can also be used to generate an immune response. One approach involves the use of antigen presenting cells (APCs) such as dendritic cells (DCs) that present the 98P4B6 antigen to the patient's immune system. Dendritic cells are MHC class I molecules and MHC
It expresses class II molecules, B7 costimulators, as well as IL-12 and is therefore a highly specific antigen presenting cell. In prostate cancer, autologous dendritic cells pulsed with a peptide of prostate specific membrane antigen (PSMA) are used in phase I clinical trials to stimulate the immune system of prostate cancer patients (Tjoa et al., 1996, Prostate 28: 6
5-69; Murphy et al., 1996, Prostate 29: 371-380). Thus, dendritic cells are 98% of the contents of MHC class I or MHC class II molecules.
P4B6 peptide can be used to present T cells. In one embodiment, autologous dendritic cells can bind to MHC class I and / or MHC class II molecules.
Pulsed with 8P4B6 peptide. In another embodiment, the dendritic cell is complete 98P4.
Pulsed with B6 protein. Yet another embodiment relates to manipulating overexpression of the 98P4B6 gene in dendritic cells using various execution vectors known in the art (
For example, adenovirus (Arthur et al., 1997, Cancer Gene The
r. 4: 17-25), retroviruses (Henderson et al., 1996, Cancer)
r Res. 56: 3763-3770), lentivirus, adeno-associated virus, DN
A transfection (Ribas et al., 1997, Cancer Res. 57:28
65-2869), or tumor-induced RNA transfection (Ashley et al., 19
97, J.A. Exp. Med. 186: 1177-1182)). Cells expressing 98P4B6 can also be engineered to express immunomodulators (eg, GM-CSF) and used as immunizing agents.

(98B4B6 as a target for XB antibody-based therapy)
98P4B6 is an attractive target for antibody-based therapeutic strategies. A number of antibody strategies are known in the art to target both extracellular and intracellular molecules (see, eg, complement- and ADCC-mediated killing and use in intrabodies). ) Since 98P4B6 is expressed by various lines of cancer cells against the corresponding normal cells, toxic effects, non-specific effects and / or non-targets produced by binding immunoactive compositions to non-target organs and tissues A systemic administration of 98P4B6 immunoreactive composition is prepared that exhibits excellent sensitivity without effect. Antibodies that specifically react with the domain of 98P4B6 are cancers that express 98P4B6 systemically, either as a conjugate with a toxin or therapeutic agent or as a naked antibody that can inhibit cell proliferation or cell function. Is useful for treating.

A 98P4B6 antibody binds to 98P4B6 and modulates function (eg, interaction with a binding partner) and consequently mediates tumor cell destruction and / or
Or it can be introduced into a patient to inhibit the growth of tumor cells. The mechanisms by which such antibodies exert therapeutic effects include complement-mediated cell lysis, antibody-dependent cellular cytotoxicity, modulating physiological functions of 98P4B6, inhibiting ligand binding or signaling pathways, tumors Modulating cell differentiation, altering tumor angiogenic profile, and / or
Or it can include apoptosis.

One skilled in the art understands that antibodies can be used to specifically target and bind immunogenic molecules (eg, the immunogenic region of the 98P4B6 sequence shown in FIG. 2 or FIG. 3). Furthermore, one skilled in the art understands that it is conventional to conjugate antibodies to cytotoxic agents (eg, Slivers et al., Blood 93:11 3678-3684 (1
(See June 1, 999)). Cytotoxic agents and / or therapeutic agents are, for example,
When delivered directly to cells by conjugating the agent to an antibody specific for a molecule expressed by the cell (eg, 98P4B6), the cytotoxic agent is Exerts a known biological effect (eg, cytotoxicity).

A wide variety of compositions and methods for killing cells using antibody-cytotoxic drug conjugates are known in the art. In the context of cancer, an exemplary method involves administering a biologically effective amount of a conjugate to an animal having a tumor, wherein the conjugate is expressed or accessible for binding, Or a marker localized on the cell surface (eg 98P
4B6) comprising a selected cytotoxic agent and / or therapeutic agent linked to a target agent (eg, an anti-98P4B6 antibody). An exemplary embodiment is a method of delivering a cytotoxic agent and / or therapeutic agent to a cell expressing 98P4B6, the method comprising:
Conjugating a cytotoxic agent to an antibody that immunospecifically binds to a 98P4B6 epitope, and exposing the cell to the antibody-drug conjugate. Another exemplary embodiment is a method of treating an individual suspected of having metastatic cancer comprising a therapeutically effective amount conjugated to a cytotoxic agent and / or therapeutic agent A parenteral administration of a pharmaceutical composition comprising the antibody of

Cancer immunotherapy using anti-98P4B6 antibodies can be made according to various approaches that have been successfully used to treat other types of cancer, including but not limited to: colon cancer (Arlen et al., 1998, Crit. Rev. Immunol. 18: 133-138), multiple myeloma (Ozaki et al., 1997, Blood 90: 3179-3186; Tsusunari et al., 1997, Blood 90: 2437-2444), gastric cancer. (Kasprzyk et al., 1992, Cancer Res. 52: 2771-2277), B cell lymphoma (Funakoshi et al., 1996, J. Immunother. Emphasis Tumor Immunol. 19: 903-101), leukemia (Zhong et al., 1996). Leuk.Res. 20: 581-589), colorectal cancer (Moun et al., 1994, Cancer Res. 54: 6160-6166; Velders et al., 1995, Cancer Res. 55: 4398-4403), and breast cancer (Shepard et al., 1991, J. Clin. Immunol. 11: 117-127). Some therapeutic approaches include the binding of naked antibodies to toxins or radioisotopes (eg, binding of Y ⁹¹ or I ¹³¹ to anti-CD20 antibodies (eg, Zevalin ^™ , IDEC Pharmaceuticals Corp., or Bexar ^™ , Coulter). While other approaches include co-administration of antibodies and other therapeutic agents (eg, Herceptin ^™ (with trastuzumab and paclitaxel (Genentech, Inc.)), the antibodies include: For the treatment of prostate cancer, for example, 98P4B6 antibody can be administered in combination with irradiation, chemotherapy or hormonal resection, and the antibody can be conjugated to calicheamicin (eg, ^{Mylotarg TM, Wyeth-Ayerst, Madison} , NJ) ( toxins or maytansinoid such as antitumor antibiotics calicheamicin conjugated to recombinant humanized IgG ₄ kappa antibody) (e.g., taxane-based Tumor Activity Pro Can be conjugated to drugs, TAP, platform, ImmunoGen, Gambridge, MA; see also, for example, US Pat. No. 5,416,064).

Although 98P4B6 antibody therapy is useful for all stages of cancer, antibody therapy may be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients receiving one or more chemotherapy. Alternatively, the antibody therapy of the invention is combined with a chemotherapeutic or irradiation regimen for patients not receiving chemotherapy treatment. In addition, antibody therapy may allow the use of reduced amounts of concurrent chemotherapy, particularly for patients that are less tolerant of the toxicity of the chemotherapeutic agent. Fan et al.
r Res. 53: 4637-4642, 1993), Prewett et al. (Intern)
national J. et al. of Onco. 9: 217-224, 1996), and Han.
cock et al. (Cancer Res. 51: 4575-4580, 1991) describe the use of various antibodies with chemotherapeutic agents.

Although 98P4B6 antibody therapy is useful for all stages of cancer, antibody therapy may be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients receiving one or more chemotherapy. Alternatively, the antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapy treatment. In addition, antibody therapy may allow the use of reduced amounts of concurrent chemotherapy, particularly for patients that are less tolerant of the toxicity of the chemotherapeutic agent.

Cancer patients preferably have immunohistochemical assessment of tumor tissue, quantitative 98P4B6 imaging,
Or using other techniques that certainly indicate the presence and extent of 98P4B6 expression,
6 The presence and level of expression can be assessed. Tumor biopsies or immunohistochemical analysis of surgical specimens are preferred for this purpose. Methods for immunohistochemical analysis of tumor tissue are well known in the art.

Anti-98P4B6 monoclonal antibodies that treat prostate cancer and other cancers include antibodies that exhibit a strong immune response against the tumor or antibodies that are directly cytotoxic.
In this regard, anti-98P4B6 monoclonal antibody (mAb) can trigger tumor cell lysis by either complement-mediated cytotoxicity or antibody-dependent cellular cytotoxicity (ADCC) mechanisms, both of which are Interaction with the effector cell Fc receptor site on the body protein requires the intact Fc portion of the immunoglobulin molecule. Furthermore, anti-98P4B6 mAbs that exert a direct biological effect on tumor growth are 98
Useful for treating cancers that express P4B6. The mechanisms by which cytotoxic mAbs act directly include inhibition of cell proliferation, regulation of cell differentiation, regulation of tumor angiogenic factor profiles, and induction of apoptosis. The mechanism by which a particular anti-98P4B6 mAb exerts an anti-tumor effect is any number of in vitro assessing cell death such as ADCC, ADMMC, complement-mediated cell lysis, as is generally known in the art. Using the assay
Be evaluated.

In some patients, the use of mouse monoclonal antibodies or other non-human monoclonal antibodies, or the use of human / mouse chimeric mAbs can induce a moderate to strong immune response against non-human antibodies. This can lead to clearance of the antibody from the circulation and reduced efficacy. In the most severe cases, such an immune response can result in extensive formation of immune complexes that can potentially cause renal failure. Accordingly, preferred monoclonal antibodies used in the therapeutic methods of the present invention are fully human antibodies that specifically bind to the target 98P4B6 antigen with high affinity but exhibit low or no antigenicity in the patient. Or a humanized antibody.

The therapeutic methods of the present invention contemplate administration of a single anti-98P4B6 mAb, as well as a combination or cocktail of different mAbs. Such mAb cocktails combine mAbs directly with cytotoxic mAbs that contain mAbs that target different epitopes, use different effector mechanisms, or depend on immune effector function,
It may have certain advantages. Such mAbs in combination may show a synergistic therapeutic effect.
In addition, anti-98P4B6 mAb is administered concurrently with other therapeutic agents including, but not limited to, various chemotherapeutic agents, androgen blockers, immunomodulators (eg, IL-2, GM-CSF), surgery or radiation. obtain. The anti-98P4B6 mAb can be administered in its “naked” or unbound form, or can have a therapeutic agent bound to them.

The anti-98P4B6 antibody formulation is administered via any route that can deliver the antibody to tumor cells. The route of administration includes, but is not limited to, intravenous route, intraperitoneal route, intramuscular route, intratumoral route, intradermal route and the like. Treatment is typically about 0.1 m
g / kg body weight, 0.2 mg / kg body weight, 0.3 mg / kg body weight, 0.4 mg / kg body weight,
0.5 mg / kg body weight, 0.6 mg / kg body weight, 0.7 mg / kg body weight, 0.8 mg / k
g body weight, 0.9 mg / kg body weight, 1 mg / kg body weight, 2 mg / kg body weight, 3 mg / kg body weight, 4 mg / kg body weight, 5 mg / kg body weight, 6 mg / kg body weight, 7 mg / kg body weight, 8 m
g / kg body weight, 9 mg / kg body weight, 10 mg / kg body weight, 15 mg / kg body weight, 20 mg
Including repeated administration of an anti-98P4B6 antibody preparation via an acceptable route of administration (eg, intravenous injection (IV)) at a dose in the range of / kg body weight or 25 mg / kg body weight. Generally 1
A dose in the range of 10-1000 mg mAb per week can be effective and well tolerated.

Based on clinical experiments using Herceptin ^™ mAb in the treatment of metastatic breast cancer, an initial loading dose of about 4 mg / kg patient weight (IV) of anti-98P4B6 mAb preparation was followed by a weekly dose of about 2 mg / kg (IV). The dose indicates an acceptable dosing regimen.
Preferably, this initial loading dose is administered as a 90 minute or longer infusion. If the initial dose is well tolerated, a regular maintenance dose is administered as an infusion over 30 minutes. As those skilled in the art will appreciate, a variety of factors can affect the ideal dosage regimen in a particular case. Such factors include, for example, the binding affinity and half-life of the Ab or mAb used, the extent of 98P4B6 expression in the patient, the circulating released 98P
The degree of 4B6 antigen, the desired steady state antibody concentration level, the frequency of treatment, and the effects of chemotherapeutic drugs or other factors used in combination with the treatment methods of the present invention, as well as the health status of a particular patient, Can be mentioned.

If necessary, patients are evaluated for the level of 98P4B6 in a given sample (eg, the level of circulating 98P4B6 antigen and / or 98P4B6 expressing cells) to help determine the most effective dosing regimen, etc. Should. Such assessments are also used for monitoring purposes throughout the treatment, and other parameters (eg, urinary cytology and / or ImmunoCyt levels in bladder cancer treatment, or, by analogy, in prostate cancer treatment) Useful for assessing therapeutic success in combination with assessing serum PSA levels.

Anti-idiotype anti-98P4B6 antibodies can also be used as vaccines to induce an immune response against cells expressing 98P4B6-related proteins in anti-cancer therapy. In particular, the generation of anti-idiotypic antibodies is well known in the art;
Can be readily adapted to generate anti-idiotype anti-98P4B6 antibodies that mimic epitopes on 8P4B6-related proteins (eg, Wagner et al., 1997, Hybr
idoma 16: 33-40; Foon et al., 1995, J. MoI. Clin. Invest.
96: 334-342; Herlyn et al., 1996, Cancer Immunol. I
mmunother. 43: 65-76). Such anti-idiotype antibodies can be used in cancer vaccine strategies.

(XC) 98P4B6 as a target for cellular immune response)
Vaccines comprising an immunogenically effective amount of one or more HLA-binding peptides and methods for preparing the vaccines described herein are further embodiments of the invention. further,
The vaccine according to the present invention comprises one or more compositions of the present peptides. Peptides are
It can be present individually in the vaccine. Alternatively, the peptide can exist as a homopolymer containing multiple copies of the same peptide or as a heteropolymer of various peptides. The polymer has the advantage of increased immunological response, and different antigens of pathogenic organisms or tumor-related peptides targeted for immune response when different peptide epitopes are used to make up the polymer It has the additional ability to induce antibodies and / or CTLs that react with determinants. The composition can be present in a naturally occurring region of the antigen or can be prepared, for example, by recombinant or chemical synthesis.

Carriers that can be used with the vaccines of the invention are well known to those skilled in the art and include, for example, thyroglobulin, albumin (eg, human serum albumin), tetanus toxoid, polyamino acids (eg, poly L-lysine, poly L-glutamic acid). ,influenza,
Examples include hepatitis B virus core protein. The vaccine is physiologically acceptable (
That is, it can include an acceptable diluent (eg, water, or saline, preferably, phosphate-releasing saline). Vaccines also typically include an adjuvant. Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Further, as disclosed herein, a CTL response causes the peptides of the present invention to become lipids (eg, tripalmitoyl-S
- Glyceryl Resid cysteinyl glycerylcysteinlyseryl - by conjugating to serine (P 3 _CSS)), it may be primed. Furthermore, adjuvants (eg, synthetic cytosine-phosphorothiolated guanine-containing (CpG) oligonucleotides) were found to increase the CTL response by 10-100 fold (eg, Davila and Celis, J. Immunol. 1).
65: 539-547 (2000)).

Upon immunization with a peptide composition according to the present invention by injection, aerosol, oral route, transdermal route, transmucosal route, intrathoracic route, intrathecal route, or other suitable route, the host immune system is desired Responds to the vaccine by producing large amounts of CTL and / or HTL specific for the antigens. As a result, the host is at least partially immunized against the development of cells that subsequently express or overexpress the 98P4B6 antigen, or at least some treatment if the antigen was tumor associated. Leading profits.

In some embodiments, it may be desirable to combine a class I peptide component with a neutralizing antibody to the target antigen and / or a component that induces or promotes a helper T cell response. Preferred embodiments of such compositions comprise class I and class II epitopes according to the present invention. Alternative embodiments of such compositions include cross-reactive HTL epitopes (eg, PADRE ^™ (Epimmune, San Di
ego, CA) molecules (such as those described in US Pat. No. 5,736,142)), together with class I and / or class II epitopes according to the present invention.

The vaccines of the present invention also provide antigen presenting cells (APC) (eg, dendritic cells (DC)),
It can be included as a vehicle for presenting the peptides of the invention. Mobilize dendritic cells (mobi)
The vaccine composition can be made in vitro after lysing and collecting, thereby creating a load of dendritic cells in vitro. For example, dendritic cells are, for example, transfected with a minigene according to the invention or pulsed with a peptide. The dendritic cells can then be administered to the patient to elicit an immune response in vivo.
Vaccine compositions (either DNA-based or peptide-based) can also be administered in vivo in combination with dendritic cell mobilization, which causes dendritic cell loading in vivo.

Preferably, the following principles include separate epitopes to be included in a polyepitope composition for use in a vaccine, or / and to be included in a vaccine and / or encoded by a nucleic acid (eg, a minigene). Used to select a group of epitopes for selection. Each of the following principles is preferably balanced to make a selection: The multi-epitope incorporated into a given vaccine composition can be a contiguous sequence in the native antigen from which the epitope is derived, but this need not be the case.

1. When administered, an epitope is selected that mimics the immune response observed to correlate with tumor clearance. For HLA class I, this includes 3-4 epitopes derived from at least one tumor associated antigen (TAA). About HLA class II
Similar principles are used; again, 3-4 epitopes are selected from at least one TAA (eg, Rosenberg et al., Science 278: 1447-14.
50). One TAA-derived epitope can be used in combination with one or more additional TAA-derived epitopes to produce a vaccine that targets tumors with various expression patterns of frequently expressed TAA.

2. ) Epitopes with the essential binding affinity established to be associated with immunogenicity are selected: for HLA class I, an I of 500 nM or less (often 200 nM or less)
C ₅₀ ; and for class II, an IC _{50 of} 1000 nM or less.

3. A sufficient supermotif-bearing peptide or a sufficient group of allele-specific motif-bearing peptides are selected to give a broad population range. For example, at least 80
% Population range is preferred. Monte Carlo analysis (statistical assessments known in the art) can be used to assess the breadth or overlap of population ranges.

4). ) When epitopes from cancer-associated antigens are selected, it is often useful to select an analog. This is because this patient can develop tolerance to the native epitope.

5. ) Epitopes called “nested epitopes” are particularly suitable. A nested epitope occurs when at least two epitopes overlap with a given peptide sequence. The nested peptide sequence is a B cell epitope, HLA
It may comprise class I epitopes and / or HLA class II epitopes. When providing nested epitopes, the general goal is to provide the highest number of epitopes per sequence. Thus, one aspect is to avoid providing peptides that are somewhat longer than the amino terminus of the amino terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide. When providing multi-epitope sequences (eg, sequences containing nested epitopes), it is common to screen sequences to ensure that they do not have pathological or other harmful biological properties is important.

6). ) When making polyepitope protein or making minigene,
The goal is to create a minimal peptide containing the epitope of interest. This principle is similar if it is not the same as that used when selecting peptides containing nested epitopes. However, when using artificial polyepitope peptides, the objective of size minimization is balanced against the need to incorporate any spacer sequence between the epitopes in the polyepitope protein. For example, a spacer amino acid residue may be a junctional epitope (jun
ctional epitope) (recognized by the immune system and not present in the target antigen)
And to avoid epitopes created only by artificial juxtaposition of epitopes) or to facilitate cleavage between epitopes, thereby enhancing epitope presentation
Can be introduced. Junction epitopes should generally be avoided. This is because the recipient can generate an immune response against that non-native epitope. "
Of particular interest are junctional epitopes that are “dominant epitopes”. Dominant epitopes can lead to a strong response such that the immune response to other epitopes is reduced or suppressed.

7). If there are multiple variant sequences of the same target protein, potential peptide epitopes can also be selected based on their conservation. For example, a criterion for conservation is that the entire sequence of HLA class I binding peptides or the entire 9-mer core of class II binding peptides is conserved at a specified percentage of the sequence evaluated for a particular protein antigen. Can be defined.

(X.C.1.) Minigene vaccine)
Many different approaches are available that allow for co-delivery of multiple epitopes. Nucleic acids encoding the peptides of the present invention are particularly useful embodiments of the present invention. The epitope for inclusion in the minigene is preferably selected according to the guidelines described in the previous section. A preferred means of administering a nucleic acid encoding a peptide of the invention uses a minigene construct that encodes a peptide comprising one epitope or multiple epitopes of the invention.

The use of multi-epitope minigenes is described below and by Ishioka et al. Immun
ol. 162: 3915-3925, 1999; An, L .; And Whitton, J .;
L. , J .; Virol. 71: 2292, 1997; Thomson, S .; A. Et al.
Immunol. 157: 822, 1996; Whitton, J. et al. L. Et al. Vir
ol. 67: 348, 1993; Hanke, R .; Et al., Vaccine 16: 426,
1998. For example, a super-motif carrying epitope derived from 98P4B6 and / or a multi-epitope DNA plasmid encoding the motif carrying epitope,
The PADRE® universal helper T cell epitope (or multiple HTL epitopes derived from 98P4B6), and the endoplasmic reticulum translocation signal sequence can be manipulated. The vaccine may also include other TAA-derived epitopes.

The immunogenicity of the multi-epitope minigene can be confirmed in transgenic mice to assess the magnitude of the CTL-induced response to the epitope being tested. Furthermore, the immunogenicity of DNA-encoded epitopes in vivo can correlate with the in vitro response of specific CTL lines to target cells transfected with a DNA plasmid. Thus, these experiments can show that the minigene serves both 1) to generate a CTL response and 2) that the induced CTL has recognized cells that express the encoded epitope.

For example, the amino acid sequence of an epitope can be back-translated to create a DNA sequence that encodes an epitope (minigene) selected for expression in human cells. A human codon usage table can be used to guide codon selection for each amino acid. These epitope-encoding DNA sequences can be directly adjacent, resulting in a continuous polypeptide sequence when translated. To optimize expression and / or immunogenicity,
Additional elements can be incorporated into the minigene design. Examples of amino acid sequences that can be back-translated into and included in a minigene sequence include: HLA class I epitope, HLA class II epitope, antibody epitope, ubiquitination signal sequence,
And / or endoplasmic reticulum targeting signal. Further, HLA presentation of CTL and HTL epitopes can be improved by including synthetic (eg, poly-alanine) or naturally occurring flanking sequences adjacent to the CTL or HTL epitope; Large peptides are within the scope of the present invention.

The minigene sequence can be converted to DNA by assembling an oligonucleotide that encodes the plus strand of the minigene and an oligonucleotide that encodes the minus strand. Overlapping oligonucleotides (30-100 bases long) can be synthesized, phosphorylated, purified, and annealed using well-known techniques and under appropriate conditions. The ends of the oligonucleotides can be joined using, for example, T4 DNA ligase. This synthetic minigene (encoding the epitope polypeptide) can then be cloned into the desired expression vector.

Standard regulatory sequences well known to those skilled in the art are preferably included in the vector to ensure expression in the target cells. Several vector elements: a promoter with a downstream cloning site for minigene insertion; a polyadenylation signal for efficient transcription termination; E. coli origin of replication; E. coli selectable markers (eg, ampicillin resistance or kanamycin resistance) are desirable. A number of promoters can be used for this purpose, such as the human cytomegalovirus (hCMV) promoter. For other suitable promoter sequences, see, for example, US Pat. Nos. 5,580,859 and 5
589,466.

Further vector modifications may be desired to optimize minigene expression and immunogenicity. In some cases, introns are required for efficient gene expression, and one or more synthetic or naturally occurring introns can be incorporated into the transcription region of the minigene. Inclusion of mRNA stabilizing sequences and sequences for replication in mammalian cells can also be considered to increase minigene expression.

Once an expression vector is selected, the minigene is cloned into the polylinker region downstream of the promoter. This plasmid is suitable E. coli. transformed into an E. coli strain,
DNA is then prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements contained in the vector, include restriction mapping and DNA
Confirmed using sequence analysis. Bacterial cells with the correct plasmid can be stored as a master cell bank and a working cell bank.

Furthermore, immunostimulatory sequences (ISS or CpG) appear to play a role in the immunogenicity of DNA vaccines. These sequences are useful when it is desired to enhance immunogenicity.
Outside the minigene coding sequence, it can be included in the vector.

In some embodiments, a bi-cistronic expression vector that allows for the production of both a minigene-encoded epitope and a second protein (included to enhance or reduce immunogenicity) is used. obtain. Examples of proteins or polypeptides that can advantageously enhance the immune response when co-expressed include cytokines (eg IL-2, IL-12, GM-CSF), cytokine-inducing molecules (eg LeIF
), Costimulatory molecule, or pan-DR binding protein (PADR) for HTL response
E ^TM , Epimmune, San Diego, CA). Helper (HT
L) The epitope can be bound to the intracellular targeting signal and expressed separately from the expressed CTL epitope; this is an HTL to a different cellular compartment than the CTL epitope
Allows epitope orientation. If required, this means that the HTL epitope is H
It can facilitate more efficient entry into the LA class II pathway, thereby improving HTL induction. In contrast to HTL induction or CTL induction, immunosuppressive molecules (eg TGF-β
Specifically reducing the immune response by co-expression of) may be beneficial in certain diseases.

A therapeutic amount of plasmid DNA is described in, for example, E. coli. It can be produced by fermentation in E. coli followed by purification. An aliquot from the working cell bank is used to inoculate growth medium and grown to saturation in a shaker flask or bioreactor according to well known techniques. Plasmid DNA is available from QIAGEN, Inc. (Valencia, California
And purified using standard bioseparation techniques such as solid phase anion exchange resins. If necessary, supercoiled DNA can be isolated from open and linear forms using gel electrophoresis or other methods.

Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is lyophilized D in sterile phosphate buffered saline (PBS).
NA reconfiguration. This approach (known as “naked DNA”) is currently used for intramuscular (IM) administration in clinical trials. Minigene D
In order to maximize the immunotherapeutic effect of NA vaccines, alternative methods for formulating purified plasmid DNA may be desirable. Various methods have been described and new techniques can be made available. Cationic lipids, glycolipids, and fusogenic liposomes can also be used in formulations (eg, WO 93/24640; Mannino &
Gould-Fogerite, BioTechniques 6 (7): 682 (1
988); US Pat. No. 5,279,833; WO 91/06309; and Felgn
er et al., Proc. Nat'l Acad. Sci. USA 84: 7413 (1987)
checking). In addition, peptides and compounds collectively referred to as protective interactive non-condensing compounds (PINCs) may also affect variables such as stability, intramuscular dispersibility, or transport to specific organs or cell types. Alternatively, it can be complexed to purified plasmid DNA.

Target cell sensitization can be used as a functional assay for expression of minigene-encoded CTL epitopes and HLA class I presentation. For example, plasmid DNA is introduced into a mammalian cell line suitable as a target for a standard CTL chromium release assay. The transfection method used will depend on the final formulation. Electroporation can be used for “naked” DNA, but cationic lipids allow direct in vitro transfection. A plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of the transfected cells using a fluorescence cell separation analyzer (FACS). These cells then become chromium-51.
( ⁵¹ Cr) -labeled and used as target cells for epitope-specific CTL lines; cell lysis (detected by ⁵¹ Cr release) indicates both production of minigene-encoded CTL epitopes and HLA presentation. Expression of HTL epitopes can be assessed in a similar manner using an assay to assess HTL activity.

In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations. Transgenic mice expressing the appropriate human HLA protein are immunized with the DNA product. The dose and route of administration is formulation dependent (eg, D in PBS
IM for NA, intraperitoneal (ip) for lipid complexed DNA). After 21 days of immunization, splenocytes are collected and restimulated for 1 week in the presence of peptides encoding each epitope to be tested. The CTL effector cells are then assayed for cytolysis of peptide-loaded ⁵¹ Cr labeled target cells using standard techniques. Lysis of target cells sensitized by HLA loaded with a peptide epitope corresponding to the minigene-encoded epitope demonstrates DNA vaccine function for in vivo introduction of CTL. HTL
The immunogenicity of the epitope is confirmed in transgenic mice in a similar manner.

Alternatively, the nucleic acid can be administered using ballistic delivery, for example, as described in US Pat. No. 5,204,253. Using this technology, DNA
Particles composed solely of are administered. In a further alternative embodiment, the DNA can be attached to particles (eg, gold particles).

Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art (eg, an expression construct encoding an epitope of the invention can be incorporated into a viral vector such as vaccinia. ).

(XC.2.) Combination of CTL peptide and helper peptide)
Vaccine compositions comprising CTL peptides of the invention are modified (eg, analogs) to provide desired attributes (eg, improved serum half-life, extended population coverage, or enhanced immunogenicity). ).

For example, the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence comprising at least one epitope that can induce a T helper cell response. CTL peptides can be linked directly to T helper peptides, but often CTL epitope / HTL epitope conjugates are linked by this spacer molecule. This spacer is typically a relatively small neutral molecule (eg, an amino acid or amino acid mimetic).
(Which is substantially uncharged under physiological conditions). This spacer is typically selected from, for example, Ala, Gly, or other neutral spacers of nonpolar or neutral polar amino acids. It will be appreciated that optionally present spacers need not be composed of the same residues and thus may be hetero-oligomers or homo-oligomers. When present, the spacer is usually at least one or two residues, more usually 3 to 6 residues, sometimes 10 or more residues. The CTL peptide epitope can be linked to the T helper peptide, either directly or through a spacer, at either the amino terminus or the carboxy terminus of the CTL peptide. The amino terminus of either the immunogenic peptide or the T helper peptide can be acylated.

In certain embodiments, T helper peptides are peptides that are recognized by T helper cells that are present in the majority of genetically diverse populations. This can be achieved by selecting peptides that bind to many, most, or all of the HLA class II molecules. Examples of such amino acids that bind to many HLA class II molecules include tetanus toxoid positions 830-843 QYIKANSKFIGITE (SEQ ID NO: 44), Plasmod.
ium falciparum circumsporozoite (circumsporozoit)
e) 378-398 position of (CS) protein DIEKKIAKMEKASSVFFNVVN
S (SEQ ID NO: 45), and 116 of the Streptococcus 18 kD protein
˜131 contains an antigen derived sequence such as GAVDSILGGVATYGAA (SEQ ID NO: 46). Other examples include peptides having either the DR 1-4-7 supermotif or the DR3 motif.

Alternatively, amino acid sequences not found in nature can be used to prepare synthetic peptides that can stimulate T helper lymphocytes in a loose HLA-restricted manner (eg, PCT
See published WO 95/07707). Pan-DR binding epitopes (eg, PA
DRE ^™ , Epimmune, Inc. , San Diego, CA), these synthetic compounds are most preferably designed to bind to most HLA-DR (human HLA class II) molecules. For example, the formula: XKXVAAWTLKAAX (SEQ ID NO: 47
) Where “X” is either cyclohexylalanine, phenylalanine, or tyrosine, and a is either D-alanine or L-alanine. It was found to bind to most HLA-DR alleles and to stimulate the response of T helper lymphocytes from most individuals regardless of their HLA type. Alternatives to pan-DR binding epitopes all contain the “L” natural amino acid and can be provided in the form of nucleic acids encoding this epitope.

HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified to include D-amino acids to increase their resistance to proteases and thus extend their serum half-life, or they can enhance their biological activity. To increase, it can be coupled to other molecules such as lipids, proteins, carbohydrates and the like. For example, a T helper peptide can be conjugated to one or more palmitic acids, either at the amino terminus or the carboxyl terminus.

(XC.3.) Combination of CTL peptide and T cell priming agent)
In some embodiments, it may be desirable to include in the pharmaceutical composition of the invention at least one component that primes B lymphocytes or T lymphocytes. Lipids
CTL has been identified as an agent that can prime in vivo. For example, palmitic acid residues can be linked to the ε-amino and α-amino groups of lysine residues, and then one or more of, for example, Gly, Gly-Gly-, Ser, Ser-Ser, etc. It can be linked to an immunogenic peptide via a linking residue. The lipidated peptide can then be either administered directly in the micelle or particulate state, can be incorporated into a liposome, or can be emulsified in an adjuvant (eg, incomplete Freund's adjuvant). In a preferred embodiment, a particularly effective immunogenic composition comprises palmitic acid attached to the ε-amino and α-amino groups of Lys (which is linked to the amino terminus of the immunogenic peptide (eg, Ser- Ser)).

As another example of lipid priming of a CTL response, coli lipoproteins (eg, tripalmitoyl-S-glycerylcysteinyl seryl-serine (P ₃ CSS))
When covalently attached to the appropriate peptide, it can be used to prime virus-specific CTL (see, eg, Deres et al., Nature 342: 561, 1989). The peptides of the invention can be conjugated, for example, to P ₃ CSS, and the lipopeptide can be administered to an individual to specifically prime an immune response against a target antigen. In addition, since the introduction of neutralizing antibodies can also be primed with a P ₃ CSS binding epitope, two such compositions will elicit both humoral and cell-mediated responses more efficiently. Can be combined.

(X.C.4.) Vaccine composition comprising DC pulsed with CTL peptide and / or HTL peptide)
Embodiments of vaccine compositions according to the present invention include ex vivo administration of a cocktail of epitope-bearing peptides to PBMC from patient blood, or isolated DCs derived therefrom. Drugs that facilitate the collection of DCs (eg, Progenipoietin ^™ (Pha
rmacia-Monsanto, St. Louis, MO) or GM-CSF / IL
-4) can be used. After pulsing DC with peptide and before reinjecting the patient,
Wash the DC to remove unbound peptide. In this embodiment, the vaccine is
On their surface are included peptide pulsed DCs that present pulsed peptide epitopes complexed with HLA molecules.

DCs can be pulsed ex vivo with a cocktail of peptides, some of which stimulate a CTL response to 98P4B6. If necessary, helper T cells (
HTL) peptides (eg, natural or artificial loosely constrained HLA class II peptides) can be included to promote CTL responses. Therefore, the vaccine according to the invention is 9
Used to treat cancers that express or overexpress 8P4B6.

(X.D.) Adoptive immunotherapy)
Antigenic 98P4B6-related peptides are used to elicit CTL and / or HTL responses ex vivo. The resulting CTL cells or HTL cells are used to treat tumors of patients who do not respond to other conventional forms of therapy, or patients who do not respond to therapeutic vaccine peptides or therapeutic vaccine nucleic acids according to the present invention. obtain. An ex vivo CTL response or HTL response to a particular antigen is expressed in tissue culture by transforming patient or genetically compatible CTL or HTL progenitor cells into antigen presenting cells (APCs).
Induced by incubation with a source of (eg, dendritic cells) and an appropriate immunogenic peptide. An appropriate incubation time (typically about 7-28
Day) (where progenitor cells are activated and proliferate into effector cells)
The cells are injected back into the patient, where they destroy (CTL) or promote destruction (HTL) of specific target cells (eg, tumor cells). Transfected dendritic cells can also be used as antigen presenting cells.

(X.E.) Administration of vaccines for therapeutic or prophylactic purposes)
The pharmaceutical and vaccine compositions of the invention are typically used to treat and / or prevent cancers that express or overexpress 98P4B6. In therapeutic applications, the peptide composition and / or nucleic acid composition can be an effective B cell response to an antigen, CT
Administered to the patient in an amount sufficient to induce an L response and / or an HTL response and to cure or at least partially stop or delay symptoms and / or complications. An amount adequate to accomplish this is defined as a “therapeutically effective dose”. Effective amounts for this use will depend, for example, on the particular composition being administered, the method of administration, the stage and severity of the disease being treated, the weight and general condition of the patient, and the judgment of the prescribing physician. .

For pharmaceutical compositions, the immunogenic peptides of the invention, or the DNA encoding them
Is generally administered to individuals who already have a tumor that expresses 98P4B6. The peptides or the DNA encoding them can be administered individually or as a fusion of one or more peptide sequences. Patients can be treated with immunogenic peptides separately or in conjunction with other treatments (eg, surgery) as appropriate.

For therapeutic use, administration should generally begin at the first diagnosis of 98P4B6-related cancer. This is followed by boosting the dose at least until symptoms are substantially stopped and for a period of time thereafter. Embodiments of vaccine compositions delivered to patients (ie, including but not limited to peptide cocktails, polyepitope polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells) ) May vary according to the stage of the disease or the health status of the patient. For example, 98P4B6
In patients with a tumor that expresses, a vaccine comprising 98P4B6-specific CTL may be more effective at killing tumor cells in patients with advanced disease than alternative embodiments.

It is generally important to provide a certain amount of peptide epitope delivered by a mode of administration sufficient to effectively stimulate a cytotoxic T cell response; compositions that stimulate a helper T cell response are It can also be given according to this embodiment of the invention.

Dosages for initial therapeutic immunization generally have lower limits of about 1 μg, 5 μg, 50 μg,
500 μg or 1,000 μg, and the upper limit is about 10,000 μg; 20,000
Present in a unit dose range that is 00 μg; 30,000 μg; or 50,000 μg.
Dosage values for humans are typically about 500 μg to about 50,0 per 70 kg patient.
The range is 00 μg. According to the boost regimen over weeks to months, about 1.0μ
g boosted peptides between about 50,000 μg and C obtained from the patient's blood
Depending on the patient's response and condition as determined by measuring the specific activity of TL and HTL, it can be administered. Administration should continue until at least clinical symptoms or laboratory tests indicate that neoplasia has been eliminated or reduced and for a period thereafter. Dosages, routes of administration, and dosing schedules are adjusted according to methodologies known in the art.

In certain embodiments, the peptides and compositions of the invention are used in severe disease states (ie, life-threatening or potentially life-threatening conditions). In such cases,
In the preferred compositions of the present invention, a substantial excess of these peptide compositions compared to their stated dosages as a result of the minimal amount of extraneous material and the relatively non-toxic nature of the peptides. It is possible to administer the object and may be desirable by the treating physician.

The vaccine composition of the present invention can also be used purely as a prophylactic agent. In general, dosages for primary prophylactic immunization are generally low values of about 1 μg, 5 μg, 50 μg, 500 μg or 1000 μg and high values of about 10,000 μg; 20,000 μg;
Present in a unit dosage range of 00 μg; or 50,000 μg. Dosage values for humans typically range from about 500 μg to about 50,000 μg per 70 kg patient. This is followed by a boost dosage of between about 1.0 μg and about 50,000 μg of peptide at defined intervals about 4 weeks to 6 months after the initial vaccine administration.
The immunogenicity of a vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a patient blood sample.

The pharmaceutical composition for therapeutic treatment is for parenteral, topical, oral, nasal, intrathecal, or local administration (eg, as a cream or topical ointment) Intended for. Preferably, the pharmaceutical composition is administered parenterally (eg intravenously, subcutaneously, intradermally or intramuscularly). Accordingly, the present invention provides a composition for parenteral administration comprising a solution of an immunogenic peptide dissolved or suspended in an acceptable carrier (preferably an aqueous carrier).

A variety of aqueous carriers can be used (eg, water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid, etc.). These compositions can be sterilized by conventional, well-known sterilization techniques, or can be sterile filtered. The resulting aqueous solution can be packaged as is for use or lyophilized (the lyophilized preparation is combined with a sterile solution prior to administration).

This composition may be pharmaceutically acceptable auxiliary substances (eg, pH and buffering agents, tonicity adjusting agents, wetting agents, preservatives, etc.) as necessary to approximate physiological conditions (eg, ,
Sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, and the like)).

The concentration of the peptide of the invention in the pharmaceutical formulation can vary widely (ie, about 0. 0 by weight).
From less than 1%, usually about 2% or at least from about 2%, 20% to 50%
And so on) and is selected primarily by fluid volume, viscosity, etc., according to the particular mode of administration selected.

The human unit dosage form of the composition is typically included in a pharmaceutical composition comprising a human unit dose of an acceptable carrier (in one embodiment, an aqueous carrier) and such composition to humans. Known to those skilled in the art (eg, Remington's
s Pharmaceutical Sciences, 17th edition, Editor A. Genna
ro, Mack Publishing Co. , Easton, Pennsylvan
ia, see 1985). For example, the peptide dose for the first immunization is about 1 to about 50,000 μg for a 70 kg patient, typically 100
It can be ˜5,000 μg. For example, for nucleic acids, priming can be performed using expression vectors in the form of naked nucleic acids, IM (or S) in multiple sites in an amount of 0.5-5 mg.
C or ID). Nucleic acids (0.1-1000 μg) can also be administered using a gene gun. After a 3-4 week incubation period, a booster dose is then administered. The booster can be a recombinant fowlpox virus administered at a dose of 5 × 10 ^{7 to} 5 × 10 ⁹ pfu.

For antibodies, treatment is generally via an acceptable route of administration, such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg / kg body weight to prepare an anti-98P4B6 antibody preparation. Is repeatedly administered. Generally 10 to 500 mg mA per week
A dose in the range of b is effective and well tolerated. In addition, anti-98P4B6 mAb
Giving the preparation at an initial loading dose of about 4 mg / kg patient body weight IV, followed by weekly IV doses of about 2 mg / kg represents an acceptable dosing regimen. As will be appreciated by those skilled in the art, various factors can affect the ideal dose in a particular case. Such factors include, for example, the half-life of the composition, the binding affinity of the Ab, the immunogenicity of the substance, the degree of expression of 98P4B6 in the patient, the degree of circulating shed 98P4B6 antigen desired Examples include steady state concentration levels, frequency of treatment, and the effects of chemotherapeutic or other agents used in combination with the treatment methods of the present invention, and the health status of a particular patient. Non-limiting preferred human unit doses are, for example, 500 μl to 1 mg, 1
mg-50 mg, 50 mg-100 mg, 100 mg-200 mg, 200 mg-300
mg, 400 mg to 500 mg, 500 mg to 600 mg, 600 to 700 mg, 700
mg-800 mg, 800 mg-900 mg, 900 mg-1 g, or 1 mg-700
mg. In certain embodiments, the dose is in the range of 2-5 mg / kg
Body weight (eg, weekly doses of 1-3 mg / kg); 0.5 mg, 1, 2, 3, 4, 5, 6,
7, 8, 9, 10 mg / kg body weight (eg, 2, 3 or 4 weeks at weekly doses; 0.5-
10 mg / kg body weight (eg, weekly dose for 2, 3 or 4 weeks; weekly body range of 225
250, 275, 300, 325, 350, 375, 400 mg m ² ; weekly body range 1-600 mg m ² ; weekly body range 225-400 mg m ² ;
It can be performed with weekly doses for 4, 5, 6, 7, 8, 9, 19, 11, 12 or more weeks.

In one embodiment, the human unit dosage form of the polynucleotide comprises a suitable dosage range or effective amount that provides any therapeutic effect. As will be appreciated by those skilled in the art, the therapeutic effect is
It depends on a number of factors, including the sequence of the polynucleotide, the molecular weight of the polynucleotide, and the route of administration. The medication is generally selected by a physician or other medical professional according to various parameters known in the art, such as the severity of the symptoms, the patient's medical history, and the like. In general, for a polynucleotide of about 20 bases, the dosage range is, for example, about 0.1, 0.25.
, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 10
From an independently selected lower limit such as 0, 200, 300, 400 or 500 mg / kg, greater than the lower limit by about 60, 80, 100, 200, 300, 400, 500, 7
50, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 70
It can be selected from up to an independently selected upper limit of 00, 8000, 9000 or 10,000 mg / kg. For example, the dose may be approximately any of the following: 0.1-100
mg / kg, 0.1-50 mg / kg, 0.1-25 mg / kg, 0.1-10 mg / k
g, 1-500 mg / kg, 100-400 mg / kg, 200-300 mg / kg,
-100 mg / kg, 100-200 mg / kg, 300-400 mg / kg, 400-
500 mg / kg, 500-1000 mg / kg, 500-5000 mg / kg, or 500-10,000 mg / kg. In general, parenteral routes of administration may require higher doses of polynucleotides as compared to more direct nucleotide applications to diseased tissue (when done with increasing lengths of polynucleotides).

In one embodiment, the human unit dosage form of T cells comprises an appropriate dosage range or effective amount that provides any therapeutic effect. As will be appreciated by those skilled in the art, the therapeutic effect depends on a number of factors. The dosage is generally selected by a physician or other medical professional according to various parameters known in the art, such as the severity of the symptoms, the patient's medical history, and the like. Dose is about 10 ⁴ cells to about 10 ⁶ cells, about 10 ⁶ cells to about 10 ⁸ cells, about 10 ⁸ cells to about 10 ^{1
It can be 1} cell, or from about 10 ⁸ cells to about 5 × 10 ¹⁰ cells. The dose can also be about 10 ⁶ cells / m ² to about 10 ¹⁰ cells / m ² , or about 10 ⁶ cells / m ² to about 10 ⁸ cells / m ² .

The protein (s) of the invention and / or nucleic acids encoding the protein (s) can also be administered via liposomes, which can also serve for: 1) the lymphatic system Targeting protein (s) to a specific tissue, such as a tissue; 2) selective targeting to diseased cells; or 3) increasing the half-life of the peptide composition. Liposomes include emulsions, foams, micelles, insoluble monolayers,
Examples thereof include liquid crystals, phospholipid dispersions, and layered layers. In these preparations, the peptide to be delivered is a molecule that binds to a receptor that is alone or is prevalent in lymphoid cells (
For example, it is incorporated as part of a liposome in combination with a monoclonal antibody that binds to the CD45 antigen) or in combination with other therapeutic or immunogenic compositions. Thus, liposomes that are either loaded or applied with the desired peptide of the invention can be directed to the site of lymphoid cells, which then deliver the peptide composition to the lymphoid cells. To do. Liposomes for use in accordance with the present invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids, and sterols (eg, cholesterol). The choice of lipid is generally guided by considerations of, for example, liposome size, acid instability, and liposome stability in the bloodstream. For preparing liposomes, see, for example, Szoka et al., Ann. Rev
. Biophys. Bioeng. 9: 467 (1980) and U.S. Pat. No. 4,23.
No. 5,871, No. 4,501,728, No. 4,837,028, and No. 5,
Various methods are available as described in US Pat. No. 019,369.

To target cells of the immune system, ligands that should be incorporated into liposomes include:
For example, an antibody or fragment thereof specific for the cell surface determinant of the desired immune system cell may be mentioned. Liposomal suspensions containing peptides can be administered intravenously, locally, topically, etc., in particular at doses that vary according to the mode of administration, the peptide to be delivered, and the stage of the disease being treated.

For solid compositions, conventional non-toxic solid carriers may be used including, for example, pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate Etc. For oral administration, a pharmaceutically acceptable non-toxic composition will generally be 10-95% active with any commonly used excipient, such as the carriers listed above. A component (ie, one or more peptides of the invention) and more preferably 25% to 75
% Of the active ingredient is incorporated.

For aerosol administration, the immunogenic peptide is preferably supplied in finely divided form with a surfactant and a propellant. A typical percentage of peptides is about 0.
From 01% to 20% by weight, preferably from about 1% to 10%. Of course, the surfactant must be non-toxic and preferably soluble in the propellant. Representative examples of such agents include aliphatic polyhydric alcohols or cyclic anhydrides thereof, from about 6 to
Fatty acids containing 22 carbon atoms (eg caproic acid, octanoic acid, lauric acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, olesteric acid (olesteri
c acid), and esters and partial esters of oleic acid). Mixed esters such as mixed glycerides or natural glycerides can be used. Surfactant is
It may constitute from about 0.1% to 20% by weight of the composition, preferably from about 0.25 to 5%. The remainder of the composition is usually a propellant. A carrier may also be included if desired, such as in the case of lecithin for intranasal delivery.

(XI.) 98P4B6 Diagnostic and Prognostic Embodiments)
As disclosed herein, 98P4B6 polynucleotides, 98P4B6 polypeptides, 98P4B6 reactive cytotoxic T cells (CTL), 98P4B6 reactive helper T cells (HTL) and anti-polypeptide antibodies are Conditions associated with dysregulated cell growth, such as the cancers listed in Table I (eg, specific patterns of their tissue expression, and eg, “analysis of 98P4B6 expression in normal tissues and patient specimens” Used in well-known diagnostic, prognostic, and therapeutic assays to test both for its overexpression in specific cancers as described in the examples entitled The

98P4B6 can be similar to PSA, a prostate-related antigen. PSA is a prototypical marker that has been used by healthcare professionals for several years to identify and monitor the presence of prostate cancer (eg Merrill et al., J. Urol. 163 (2): 503-5).
120 (2000); Polasik et al., J. MoI. Urol. Aug; 162 (2): 29
3-306 (1999) and Fortier et al., J. Biol. Nat. Cancer Inst
. 91 (19): 1635-1640 (1999)). A variety of other diagnostic markers are also used under similar circumstances, including p53 and K-ras (eg, Tulckinsky et al., Int J Mol Med 1999 Jul.
4 (1): 99-102 and Minimoto et al., Cancer Detect Pr
ev 2000; 24 (1): 1-12). Thus, with this disclosure regarding 98P4B6 polynucleotides and 98P4B6 polypeptides (and 98P4B6 polynucleotide probes and anti-98P4B6 antibodies used to identify the presence of these molecules) and their properties, one of skill in the art was used. In a manner similar to that (eg, in various diagnostic assays for testing a condition associated with cancer).
These molecules can be used.

Exemplary embodiments of diagnostic methods utilizing 98P4B6 polynucleotide, 98P4B6 polypeptide, 98P4B6 reactive T cells and antibodies include, for example, PSA polynucleotides, PSA polypeptides and PSA reactive T cells and antibodies. Similar to methods from well-established diagnostic assays used. For example, in methods of monitoring PSA overexpression or prostate cancer metastasis, to observe the presence and / or level of PSA mRNA, just a PSA polynucleotide can be detected in a probe (eg, Northern analysis (eg, Sharief et al., Biochem.Mol.Biol.Int.
33 (3): 567-74 (1994))) and primers (eg P
In CR analysis (eg, Okagawa et al., J. Urol. 163 (4): 1189).
-1190 (2000)))), 98P4B6 polynucleotides described herein detect overexpression of 98P4B6 or metastasis of prostate cancer and other cancers that express this gene. Can be utilized in the same manner to do. Or
Exactly the PSA polypeptide is used to generate an antibody specific for PSA, which is then expressed by overexpression of PSA protein (eg, Stephan et al., Urology 55
(4): See 560-3 (2000)) or prostate cell metastasis (eg Al
anen et al., Pathol. Res. Pract. 192 (3): 233-7 (1996)
The 98P4B6 polypeptide described herein is an overexpression of 98P4B6 or this gene so that it can be used to observe the presence and / or level of PSA protein in the method of monitoring Can be used to generate antibodies for use in detecting metastasis of prostate cells and other cancer cells expressing.

Specifically, since metastasis involves the migration of cancer cells from the original organ (eg, lung or prostate) to a different region of the body (eg, lymph nodes), the 98P4B6 polynucleotide and / or 98P4B6 polypeptide Assays that test biological samples for the presence of expressing cells can be used to provide evidence of metastasis. For example, 98P4
Biological samples from tissues that normally do not contain B6 expressing cells (lymph nodes), such as 98P4B6 expression found in LAPC4 and LAPC9 (xenografts isolated from lymph node and bone metastasis, respectively), If found to contain 98P4B6-expressing cells, this finding indicates metastasis.

Alternatively, the 98P4B6 polynucleotide and / or 98P4B6 polypeptide can be expressed in a biological sample that does not normally express 98P4B6 or express 98P4B6 at a different level, for example, express 98P4B6 or increase expression of 98P4B6. Can be used to provide evidence of cancer when found to have (see, eg, 98P4B6 expression in cancers listed in Table I and patient samples shown in the accompanying drawings) . In such assays, one of ordinary skill in the art can provide additional evidence regarding metastasis by testing biological samples for the presence of a second tissue restriction marker (eg, PSA, PSCA, etc.) (in addition to 98P4B6). It may be further desired to produce (eg Alanen et al., Pathol. Res. Pract. 192 (
3): 233-237 (1996)).

Just as PSA polynucleotide fragments and PSA polynucleotide variants are utilized by those skilled in the art for use in methods of monitoring PSA, 9
The 8P4B6 polynucleotide fragment and the 98P4B6 polynucleotide variant are:
Used in a similar manner. In particular, typical PSA polynucleotides used in methods for monitoring PSA are probes or primers composed of fragments of PSA cDNA sequences. Taking this as an example, the primers used to PCR amplify the PSA polynucleotide are such that they function in the polymerase chain reaction.
It must contain a shorter sequence than the entire A sequence. In the context of such a PCR reaction, one of ordinary skill in the art generally creates a variety of different polynucleotide fragments that can be used as primers to amplify different portions of the polynucleotide of interest or to optimize the amplification reaction. (E.g., Caetano-Anoles, G. Biote
chniques 25 (3): 472-476, 478-480 (1998); Rob
ertson et al., Methods Mol. Biol. 98: 121-154 (1998
)checking). A further illustration of the use of such a fragment is provided in the example titled “Expression analysis of 98P4B6 in normal tissues and patient subjects”,
Here, the 98P4B6 polynucleotide fragment is 98P4B6 in cancer cells.
Used as a probe to show RNA expression. Furthermore, variant polynucleotide sequences are typically used as primers and probes for the corresponding mRNA in PCR and Northern analysis (eg, Sawai et al., Fetal D
iagn. Ther. 1996 Nov-Dec; 11 (6): 407-13 and Cu
Rent Protocols In Molecular Biology, Vol
ume 2, Unit 2, Frederick M. et al. (See Ausubel et al., 1995). Polynucleotide fragments and variants are useful in situations where they can bind to a target polynucleotide sequence (eg, a 98P4B6 polynucleotide shown in FIG. 2 or a variant thereof) under high stringency conditions.

In addition, PSA polypeptides comprising an epitope that can be recognized by an antibody or T cells that specifically bind to that epitope are used in methods of monitoring PSA.
98P4B6 polypeptide fragments, and 98P4B6 polypeptide analogs or variants can also be used in a similar manner. This practice of using polypeptide fragments or polypeptide variants to generate antibodies (eg, anti-PSA antibodies or T cells) is well known in the art along with a wide variety of systems such as fusion proteins used by practitioners. Typical in technology (eg, Current Protocols In M
molecular biology, Volume 2, Unit 16, Freder
ick M.M. (See Ausubel et al., 1995). In this situation, each epitope or epitopes functions to provide a structure that is reactive with antibodies or T cells. Typically, those skilled in the art generate a variety of different polypeptide fragments that can be used to generate an immune response specific for different portions of the polypeptide of interest (see, eg, US Pat. No. 5,840,501). And U.S. Pat. No. 5,939,533). For example, one of the motif-bearing subsequences readily identified by one of ordinary skill in the art based on the biological motifs 98P4B6 discussed herein or available in the art
It may be preferred to utilize a polypeptide comprising one. A fragment of a polypeptide,
Variants or analogs are typically useful in this situation as long as they contain antibodies or epitopes that can generate T cells specific for the target polypeptide sequence (eg, 98P4B6 polypeptide shown in FIG. 3). is there.

As shown herein, 98P4B6 and 98P4B6 polypeptides (and 98P4B6 polynucleotide probes and anti-98P4B6 antibodies or T cells used to identify the presence of these molecules) are listed in Table I. It shows the specific properties that make them useful in diagnosing cancers such as those listed. To assess the presence or development of the disease states described herein, such as prostate cancer, 98P4
Diagnostic assays that measure the presence of the B6 gene product are used to identify patients for prophylactic measurements or further monitoring, as has been done very successfully with PSA. In addition, these substances can be used, for example, when a clear diagnosis of metastases of prostate origin is
Only on the basis of testing for (eg Alanen et al., Pathol. R).
es. Pract. 192 (3): 233-237 (1996)), and as a result, 98P4B6 and 98P4B6 polypeptides (and
In situations where substances such as 98P4B6 polynucleotide probes and anti-98P4B6 antibodies used to identify the presence of these molecules need to be used to confirm metastasis of prostate origin, PSA It meets the need in the art for molecules with similar or complementary characteristics.

Finally, in addition to their use in diagnostic assays, the 98P disclosed herein
The 4B6 polynucleotide is a chromosomal region to which the 98P4B6 gene is mapped (“98
It has many other uses, such as their use in the identification of oncogene-related chromosomal abnormalities in the following example entitled “Chromosome Mapping of P4B6”. Further, in addition to their use in diagnostic assays, 9 disclosed herein.
8P4B6-related proteins and 98P4B6-related polynucleotides have other utilities such as their use in forensic analysis of tissues of unknown origin (eg, Takah
ama K Forensic Sci Int 1996 Jun 28; 80 (1-
2): See 63-9).

Furthermore, the 98P4B6-related proteins or 98P4B6-related polynucleotides of the present invention can be used to treat pathological conditions characterized by overexpression of 98P4B6. For example, the amino acid sequence or nucleic acid sequence of FIG. 2 or FIG. 3, or any fragment can be used to generate an immune response against the 98P4B6 antigen. An antibody or other molecule reactive with 98P4B6 can be used to modulate the function of this molecule, thereby providing a therapeutic benefit.

(XII.) Inhibition of 98P4B6 protein function)
The present invention provides various methods and compositions for inhibiting the binding of 98P4B6 to its binding partner or for inhibiting its binding to other protein (s) and to inhibit the function of 98P4B6. Including methods.

(XII.A.) Inhibition of 98P4B6 using intracellular antibodies)
In one approach, a recombinant vector encoding a single chain antibody that specifically binds to 98P4B6 is introduced into cells expressing 98P4B6 via gene transfer techniques.
Thereby, the encoded single chain anti-98P4B6 antibody is expressed intracellularly, and 98P4B
It binds to 6 proteins and thereby inhibits its function. Methods for manipulating such intracellular single chain antibodies are well known. Such intracellular antibodies (“internal antibodies (intra
body) ”, also known as“ body ”), is specifically targeted to specific compartments within the cell and provides control over where the inhibitory activity of the treatment is focused. This technique has been successfully applied in the art (for review, see Richardson and Marasco, 1
995, TIBTECH, Vol. 13). Intrabodies have been shown to substantially eliminate the expression of other abundant cell surface receptors (eg, Richardson).
Et al., 1995, Proc. Natl. Acad. Sci. USA 92: 3137-31
41; Beerli et al., 1994, J. MoI. Biol. Chem. 289: 23931-23
936; Desane et al., 1994, Gene Ther. 1: 332-337).

Single chain antibodies comprise heavy and light chain variable domains joined by a flexible linker polypeptide and are expressed as a single polypeptide. If desired, single chain antibodies are expressed as single chain variable region fragments linked to their light chain constant regions. Well-known intracellular transport signals are engineered into recombinant polynucleotide vectors encoding such single chain antibodies to accurately target the internal antibody to the desired intracellular compartment. For example, an internal antibody targeted to the endoplasmic reticulum (ER) is engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal (eg, a KDEL amino acid motif). An internal antibody that is intended to exert activity in the nucleus is engineered to contain a nuclear localization signal. A lipid moiety is linked to the internal antibody to connect it to the cytosolic side of the plasma membrane. Intrabodies can also be targeted to exert function in the cytosol. For example, cytosolic internal antibodies are used to sequester factors within the cytosol, thereby preventing them from being transported to their natural destination in the cell.

In one embodiment, an internal antibody is used to capture 98P4B6 in the nucleus, thereby preventing its activity in the nucleus. A nuclear targeting signal is engineered into such 98P4B6 internal antibody to achieve the desired targeting. Such 98P4B6 internal antibody is a specific 98
Designed to specifically bind to the P4B6 domain. In another embodiment, 98P
Cytosolic internal antibodies that specifically bind to 4B6 protein are used to prevent 98P4B6 from approaching the nucleus, thereby preventing 98P4B6 from exerting any biological activity in the nucleus (eg, Prevents 98P4B6 from forming transcription complexes with other factors).

In order to specifically direct the expression of such an internal antibody to a particular cell, the transcription of that internal antibody is placed under the regulatory control of an appropriate tumor-specific promoter and / or enhancer. For example, the PSA promoter and / or promoter / enhancer can be utilized to specifically target expression of the internal antibody to the prostate (eg, July 1999).
(See U.S. Pat. No. 5,919,652, issued on Jan. 6).

(XII.B.) Inhibition of 98P4B6 using recombinant protein)
In another approach, the recombinant molecule binds to 98P4B6, thereby causing 98P4
Interfering with the function of B6. For example, such recombinant molecules prevent or inhibit 98P4B6 from accessing / binding to its binding partner (s) or binding to other protein (s). Such recombinant molecules are, for example, 98P4
It may contain the reactive part (s) of a B6 specific antibody molecule. In certain embodiments, the 98P4B6 binding domain of the 98P4B6 binding partner is engineered into a dimeric fusion protein whereby the fusion protein is human IgG (eg, human IgG1
) Of two 98P4B6 ligand binding domains linked to the Fc portion. Such IgG moieties can include, for example, C _H 2 and C _H 3 domains and a hinge region, but do not include a C _H 1 domain. Such a dimeric fusion protein is 98P4B6
Is administered in a soluble form to patients suffering from a cancer associated with the expression of this, whereby this dimeric fusion protein specifically binds to 98P4B6 and blocks its interaction with the binding partner of 98P4B6. Such dimeric fusion proteins are further combined into multimeric proteins using known antibody linking techniques.

(XII.C.) Inhibition of transcription or translation of 98P4B6)
The present invention also includes various methods and compositions for inhibiting transcription of the 98P4B6 gene. Similarly, the present invention also provides methods and compositions for inhibiting 98P4B6 mRNA to protein translation.

In one approach, a method for inhibiting transcription of the 98P4B6 gene is 98P4B.
Contacting 6 genes with a 98P4B6 antisense polynucleotide. In another approach, a method of inhibiting the translation of 98P4B6 mRNA is 98P4B6.
contacting the mRNA with an antisense polynucleotide. In another approach, 98P4B6 specific ribozymes are used to cleave the 98P4B6 message, thereby inhibiting translation. Such antisense-based methods and ribozyme-based methods can also relate to regulatory regions of the 98P4B6 gene (eg, 98P4B6 promoter and / or enhancer elements). Similarly, 9
A protein capable of inhibiting the 8P4B6 gene transcription factor is used to inhibit transcription of 98P4B6 mRNA. Various polynucleotides and compositions useful in the above methods are described above. The use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.

Other factors that inhibit transcription of 98P4B6 by interfering with transcriptional activation of 98P4B6 are also useful for treating cancers that express 98P4B6. Similarly, 98P4B
Factors that interfere with the processing of 6 are useful for treating cancers that express 98P4B6. Cancer treatment methods utilizing such factors are also within the scope of the present invention.

(XII.D.) General considerations for therapeutic strategies)
Gene transfer and gene therapy techniques deliver therapeutic polynucleotide molecules (ie, antisense, ribozymes, polynucleotides encoding internal antibodies, and other 98P4B6 inhibitory molecules) to tumor cells synthesizing 98P4B6 Can be used for.
A number of gene therapy approaches are known in the art. Recombinant vectors encoding 98P4B6 antisense polynucleotides, ribozymes, factors that can interfere with transcription of 98P4B6, and the like can be delivered to target tumor cells using such gene therapy approaches.

The therapeutic approaches described above can be combined with any one of a wide variety of surgical, chemotherapeutic or radiation therapy regimens. The therapeutic approach of the present invention is:
Use of reduced doses of chemotherapy (or other therapy) and / or less frequent benefits for all patients and especially for patients who are not well tolerated by the toxicity of chemotherapeutic agents Can be used.

The antitumor activity of a particular composition (eg, antisense, ribozyme, internal antibody), or a combination of such compositions can be assessed using a variety of in vitro and in vivo assay systems. In vitro assays for evaluating therapeutic activity include cell proliferation assays, soft agar assays, and other assays that exhibit tumor promoting activity, binding assays that can determine the extent to which the therapeutic composition inhibits 98P4B6 binding to a binding partner. Etc.

In vivo, the efficacy of the 98P4B6 therapeutic composition can be evaluated in an appropriate animal model. For example, a cross-species prostate cancer model (where human prostate cancer explants or passaged xenograft tissue is introduced into immunocompromised animals (eg, nude mice or SCID mice)) is used (Klein et al., 1997, Nature Medi
cine 3: 402-408). For example, PCT patent application WO 98/16628 and US Pat. No. 6,107,540 describe a human who can repeat the formation of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of later stages of the disease. Various xenograft models of prostate cancer are described. Efficacy can be predicted using assays that measure inhibition such as tumor formation, tumor regression or metastasis.

In vivo assays that evaluate the promotion of apoptosis are useful in evaluating therapeutic compositions. In one embodiment, xenografts from tumor-bearing mice treated with the therapeutic composition can be tested for the presence of apoptotic lesions and compared to untreated control xenograft-bearing mice. The degree to which apoptotic lesions are found in the tumors of treated mice provides an indication of the therapeutic efficacy of the composition.

The therapeutic composition used in the practice of the foregoing methods can be formulated into a pharmaceutical composition comprising a carrier suitable for the desired delivery method. Suitable carriers include any substance that, when combined with a therapeutic composition, retains the antitumor function of the therapeutic composition and is generally unresponsive to the patient's immune system. Examples include, but are not limited to, any number of standard pharmaceutical carriers (eg, sterile phosphate buffered saline solution, bacteriostatic water, etc.) (generally Remington's Pharmaceutical Sc
ienses (16th edition), A.I. Osal. Ed., 1980).

The therapeutic formulation can be solubilized and administered via any route that can deliver the therapeutic composition to the tumor site. Potentially effective routes of administration include intravenous, parenteral, intraperitoneal,
Examples include, but are not limited to, intramuscular, intratumoral, intradermal, intraorgan, orthotopic, and the like. Preferred formulations for intravenous injection are diluted in a solution of preserved bacteriostatic water, sterile non-preserved water and / or in polyvinyl chloride or polyethylene bags (USP) containing 0.9% sterile sodium chloride for injection. Containing a therapeutic composition. The therapeutic protein preparation can be lyophilized and stored as a sterile powder, preferably under reduced pressure, and then reconstituted in bacteriostatic water (eg, containing benzyl alcohol preservatives) or sterile water prior to injection. Can be configured.

Dosages and administration protocols for the treatment of cancer using the methods described above will vary with the method and target cancer and will generally depend on a number of other factors understood in the art.

(XIII.) Identification, characterization and use of modulators of 98P4B6)
(Identification methods and use of regulators)
In one embodiment, screening is performed to identify modulators that induce or suppress specific expression profiles, induce or suppress specific pathways, and preferably thereby generate related phenotypes. In another embodiment, when identifying differentially expressed genes that are important in a particular condition; screening to identify modulators that alter (increase or decrease) the expression of individual genes Run. In another embodiment, screening is performed to identify modulators that alter the biological function of the expression product of a differentially expressed gene. Again, in identifying the importance of a gene in a particular state, screening is performed to identify factors that bind to the gene product and / or modulate the biological activity of the gene product.

In addition, screening is performed on genes that are induced in response to the candidate agent. After identifying a regulator (a regulator that suppresses the cancer expression pattern that causes the normal expression pattern, or a regulator of the oncogene that causes the expression of the gene, as in normal tissues)
Screening is performed to identify genes that are specifically regulated in response to drugs. Comparison of expression profiles between normal and drug-treated cancer tissues reveals genes that are not expressed in normal or cancerous tissues but are expressed in drug-treated tissues or vice versa . These drug specific sequences are identified and used by the methods described herein for oncogenes or oncoproteins. In particular, these sequences and the proteins they encode are used in the production or identification of cells treated with drugs. In addition, antibodies are raised against drug-induced proteins and are used to target novel therapeutic agents to treated cancer tissue samples.

(Identification and screening assays related to modulators)
(Assays related to gene expression)
The proteins, nucleic acids and antibodies of the invention are used in screening assays. Cancer-related proteins, antibodies, nucleic acids, modified proteins and cells containing these sequences are
Used in screening assays (eg, evaluation of the effect of drug candidates on alteration of a “gene expression profile”, polypeptide expression profile or biological function). In one embodiment, the expression profile is preferably used in combination with high-throughput screening techniques to monitor genes after treatment with a candidate agent for the expression profile (eg, Davis, GF et al., J Biol Scr
een 7:69 (2002); Zlokarnik et al., Science 279: 84.
-8 (1998); Heid, Genome Res 6: 986-94, 1996).

Cancer proteins, antibodies, nucleic acids, modified proteins, and cells containing native or modified cancer proteins or genes are used in screening assays. That is, the present invention includes a method for screening for a composition that modulates the cancer phenotype or physiological function of the cancer protein of the present invention. This can be done on the gene itself or by evaluating the effect of drug candidates on a “gene expression profile” or biological function. In one embodiment, the expression profile is preferably used in combination with a high-throughput screening technique that allows monitoring after treatment with a candidate agent. See Zlokamik (supra).

Various assays are performed on the genes and proteins of the invention. Assays are performed for individual nucleic acid or protein levels. That is, once a particular gene is identified as being upregulated in cancer, test compounds are screened for the ability to modulate gene expression or for binding to the oncoproteins of the invention. In this context, “modulation” includes an increase or decrease in gene expression. The preferred amount of modulation is based on the natural change in gene expression in normal versus cancer-affected tissue, and this change is at least 10%, preferably 50%, more preferably 100-300%.
, And in some embodiments 300-1000% or more. Thus, if the gene shows a 4-fold increase in cancer tissue compared to normal tissue, a reduction of about 4-fold is often desirable; similarly, the gene is cancerous compared to normal tissue. A target value of a 10-fold increase in expression by a test compound is often desirable if it exhibits a 10-fold decrease in tissue. Regulators that exacerbate the type of gene expression observed in cancer are also useful as up-regulated targets, for example, in further analysis.

The amount of gene expression is monitored using nucleic acid probes and quantification of gene expression levels, or the gene product itself is monitored, for example, by using antibodies against cancer proteins and standard immunoassays. Is done. Proteomics and separation techniques also allow quantification of expression.

(Expression monitoring to identify compounds that alter gene expression)
In one embodiment, monitoring gene expression (ie, expression profile) comprises:
Multiple entities are monitored simultaneously. Such profiles are typically
Contains one or more of the genes of FIG. In this embodiment, for example, a cancer nucleic acid probe is attached to the biochip to detect and quantify cancer sequences in specific cells. Alternatively, PCR can be used. Thus, for example, a series of microtiter plate wells can be used with primers distributed to the desired wells. A PCR reaction is then performed and analyzed for each well.

Expression monitoring is performed to identify compounds that alter the expression of one or more cancer-related sequences (eg, the polynucleotide sequences set forth in FIG. 2). In general, the test regulator is
Added to cells prior to analysis. In addition, the screen also modulates cancer, modulates a cancer protein of the invention, binds to a cancer protein of the invention, or prevents binding of a cancer protein of the invention and an antibody or other binding partner. Provided to identify drugs.

In one embodiment, the high-throughput screening method includes providing a library comprising a large number of potential therapeutic compounds (candidate compounds). Such “combinatorial chemical libraries” are then screened in one or more assays to identify library members (specific chemical species or subclasses) that exhibit the desired characteristic activity. The compounds thus identified can serve as convenient “lead compounds”, as compounds for screening, or as therapeutic agents.

In certain embodiments, a combinatorial library of potential modulators is screened for the ability to bind to a cancer polypeptide or to modulate activity.
Conveniently, a new chemical entity with useful properties identifies a compound (referred to as a “lead compound”) that has the desired property or activity (eg, inhibitory activity) and creates a variant of this lead compound. And by evaluating the properties and activities of these variant compounds. Often, high throughput screening (HTS) methods are used for such analyses.

As noted above, gene expression monitoring is conveniently used to test candidate modulators (eg, proteins, nucleic acids or small molecules). After adding the candidate compound and incubating the cells for a period of time, the sample containing the target sequence to be analyzed is, for example,
Added to the biochip.

If desired, the target sequence is prepared using known techniques. For example, the sample is processed to lyse cells using known lysis buffers, electroporation, etc., and purification and / or amplification (eg, PCR) is performed as needed. For example, in vitro transcription is performed using a label covalently attached to a nucleotide. In general, these nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5.

The target sequence can be labeled with, for example, a fluorescent signal, a chemiluminescent signal, a chemical signal, or a radioactive signal to provide a means of detecting specific binding of the target sequence to the probe. The label can also be an enzyme, such as alkaline phosphatase or horseradish peroxidase, which, when provided with an appropriate substrate, produces a product that is detected. Alternatively, the label can be a labeled compound or a small molecule (eg, an epitope tag or biotin that specifically binds to streptavidin). For the biotin example, streptavidin is labeled as described above, so that
Provide a detectable signal to the bound target sequence. Unbound labeled streptavidin is typically removed prior to analysis.

As will be appreciated by those skilled in the art, these assays may be direct hybridization assays or may include “sandwich assays”, which include the use of multiple probes, U.S. Pat. Nos. 5,681,702; 5,597,909; 5,545,730;
No. 5,594,117; No. 5,591,584; No. 5,571,670; No. 5,580,731; No. 5,571,670; No. 5,591 , 584; 5,624,802; 5,635,352; 5,594,118;
359,100; 5,124,246; and 5,681,697. In this embodiment, generally the target nucleic acid is prepared as outlined above, then
It is added to a biochip containing multiple nucleic acid probes under conditions that allow the formation of a hybridization complex.

A variety of hybridization conditions as outlined above are used, including high stringency conditions, moderate stringency conditions and low stringency conditions. These assays are generally performed under stringency conditions that allow the formation of target probe hybridization complexes in the presence of target alone. Stringency is by changing process parameters that are thermodynamic variables, including but not limited to temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. Can be controlled. These parameters can also be used to control non-specific binding, as generally outlined in US Pat. No. 5,681,697. Therefore, certain steps are performed at higher stringency conditions,
It may be desirable to reduce non-specific binding.

The reactions outlined herein can be accomplished in a variety of ways. These reaction components can be added simultaneously or sequentially in a different order and preferred embodiments are outlined below.
In addition, the reaction can include a variety of other reagents. These include salts, buffers, neutral proteins (eg, albumin), detergents, etc., to facilitate optimal hybridization and detection and / or non-specific interactions or Can be used to reduce background interactions. Reagents that improve the efficiency of the assay in other manners (eg, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc.) can also be used as needed, depending on the sample preparation method and target purity. The assay data is analyzed to determine the expression level of individual genes and the change in expression level between states to form a gene expression profile.

(Assays related to biological activity)
The present invention provides methods for identifying or screening for compounds that modulate the activity of the cancer-related genes or cancer-related proteins of the present invention. This method comprises the step of adding a test compound as defined above to a cell containing the oncoprotein of the invention. These cells contain a recombinant nucleic acid encoding the oncoprotein of the present invention. In another embodiment, the library of candidate agents is tested on a plurality of cells.

In one aspect, the assay can include physiological signals (eg, hormones, antibodies,
Pharmacological agents including peptides, antigens, cytokines, growth factors, action potentials, chemotherapeutic agents,
Evaluated in the presence or absence of pre-exposure or subsequent exposure to radiation, carcinogens or other cells (ie, cell-cell contacts). In another example, this determination is made at different stages of the cell cycle process. In this manner, compounds that modulate the gene or protein of the invention are identified. A compound having pharmacological activity can increase the activity of the cancer protein of the present invention or can interfere with the activity of the cancer protein of the present invention. Once identified, similar structures are evaluated to identify important structural properties of the compound.

In one embodiment, a method of modulating (eg, inhibiting) cancer cell division is provided; the method includes administration of a cancer modulator. In another embodiment, a method of modulating (eg, inhibiting) cancer is provided; the method includes administration of a cancer modulator. In a further embodiment, a method of treating a cell or individual having cancer is provided; the method includes administration of a cancer modulator.

In one embodiment, a method is provided for modulating the state of a cell that expresses a gene of the invention. As used herein, conditions include parameters accepted in the art, such as cell growth, proliferation, survival, function, apoptosis, senescence, location, enzymatic activity, signal transduction and the like. . In one embodiment, the cancer inhibitor is an antibody as discussed above. In another embodiment, the cancer inhibitor is an antisense molecule.
Various cell growth assays, cell proliferation assays, and cell metastasis assays are known to those of skill in the art, as described herein.

(High-throughput screening to identify regulators)
Assays to identify appropriate modulators are adapted for high throughput screening. Accordingly, preferred assays detect oncogene transcription increase or inhibition, polypeptide expression inhibition or increase, and polypeptide activity inhibition or increase.

In one embodiment, the modulator evaluated in a high-throughput screening method is a protein, often a naturally occurring protein, or a fragment of a naturally occurring protein. Thus, for example, cell extracts containing proteins or random or directed digests of proteinaceous cell extracts are used. In this manner, a library of proteins is created for screening in the methods of the invention. Bacterial, fungal, viral and mammalian protein libraries are particularly preferred in this embodiment, the latter is preferred, and human proteins are particularly preferred. Particularly useful test compounds relate to the class of protein to which the target belongs (eg, substrates for enzymes, or ligands and receptors).

(Use of soft agar growth and colonization to identify and characterize modulators)
Normal cells require a solid substrate to bind and grow. When cells are transformed, they lose their phenotype and grow and detach from the substrate. For example, transformed cells can be grown in stirred suspension cultures or suspended in semi-solid media (eg, semi-solid agar or soft agar). The transformed cells can regenerate a normal phenotype when transfected with a tumor suppressor gene and again require a solid support to bind and grow. Soft agar growth or colony formation in the assay is used to identify regulators of cancer sequences that, when expressed in host cells, inhibit abnormal cell growth and transformation. Modulators reduce or eliminate the ability of host cells suspended in solid or semi-solid media (eg, agar) to grow.

Techniques for soft agar growth or colony formation in suspension assays are described by Freshne.
y, Culture of Animal Cells a Manual of Ba
sic Technique (3rd edition, 1994). Garkavtsev
(1996) (supra) also see the method section.

(Evaluation of contact inhibition and growth density limitation to identify and characterize modulators)
Normal cells typically grow in a flat organized pattern in cell culture until they come into contact with other cells. When these cells come into contact with each other, they are contact-inhibited and stop growing. However, transformed cells are not contact-inhibited and continue to grow to high density in unorganized lesions. Thus, the transformed cells grow to a higher saturation density than the corresponding normal cells. This is detected morphologically by the formation of an undirected monolayer of cells in the lesion. Alternatively, a labeling indicator with ( ³ H) -thymidine at saturating density is used to measure the density limit of proliferation, and similarly, the MTT assay or Alamar blue assay is used to determine whether the cell's proliferation ability and regulators are Demonstrate the ability to affect the growth ability of See Freshney (1994) (supra). When transformed cells are transfected with tumor suppressors, they regenerate the normal phenotype and are contact-inhibited to grow to low density.

In this assay, the saturation density ^{(3 H)} - labeled indicators thymidine is a preferred method of measuring density limitation of growth. Transformed host fat is transfected with cancer associated sequences and grown for 24 hours at saturating density in non-limiting medium conditions. (3 ^H) - percentage of cells labeling with thymidine is determined by incorporated cpm.

Contact-independent growth is used to identify regulators of cancer sequences that have resulted in abnormal cell growth and transformation. Regulators reduce or eliminate contact-independent growth and return cells to a normal phenotype.

(Evaluation of growth factor dependence or serum dependence to identify and characterize modulators)
Transformed cells have a lower serum dependence than their normal counterparts (eg, Temi
n, Natl. J. et al. Cancer Inst. 37: 167-175 (1966); Ea
gle et al. Exp. Med 131: 836-879 (1970); Freshne
y, (see above)). This is partly due to the release of various growth factors by the transformed cells. The degree of growth factor dependence or serum dependence of the transformed host cell can be compared to that under control. For example, cell growth factor dependence or serum dependence is monitored in a method for identifying and characterizing compounds that modulate cancer-associated sequences of the invention.

(Use of tumor-specific marker levels to identify and characterize modulators)
Tumor cells release an increased amount of certain factors (hereinafter “tumor-specific markers”) over their normal counterparts. For example, plasminogen activator (P
A) is released from human glioma at higher levels from normal brain cells (eg Gu
llino, Angiogenesis, Tumor Vascularization
, And Potential interface with Tumor G
rowe, Biological Responses in Cancer, 178
-184 (see Mich (ed.) 1985). Similarly, tumor angiogenic factor (TAF) is released in tumor cells at a higher level than its normal counterpart. For example, F
olkman, Angiogenesis and Cancer, Sem Cancer
r Biol. (1992)). On the other hand, bFGF is released from endothelial cell tumors (Ensoli, B et al.).

Various techniques for measuring the release of these factors are described by Freshney (1994) (supra).
It is described in. Unkless et al. Biol. Chem. 249: 4295-4
305 (1974); Strickland & Beers, J.A. Biol. Chem
. 251: 5694-5702 (1976); Whur et al., Br. J. et al. Cancer 4
2: 305 312 (1980); Gullino, Angiogenesis, Tum.
or Vascularization, and Potential Interface
rence with Tumor Growth, Biological Respo
nses in Cancer, pp. 178-184 (Mich (ed.) 1985); F
reshney, Anticancer Res. 5: 111-130 (1985). For example, tumor-specific marker levels are monitored with methods for identifying and characterizing compounds that modulate the cancer-associated sequences of the present invention.

(Invasion into Matrigel to identify and characterize modulators)
The degree of invasiveness to Matrigel or extracellular matrix components can be used as an assay to identify and characterize compounds that modulate cancer-associated sequences. Tumor cells exhibit a positive correlation between malignancy and the invasiveness of cells into Matrigel or some other extracellular matrix component. In this assay, tumorigenic cells are typically used as host cells. Expression of tumor suppressors in these host cells reduces the invasiveness of the host cells. Cancer Res. 1999; 59: 6010; Freshney (1
994) (supra) can be used. Briefly, the level of host cell invasion is measured by using a filter coated with Matrigel or some other extracellular matrix component. Permeation into the gel, or through the distal side of the filter, is scored as invasive and either pre-labeled with ¹²⁵ I or by cell number and distance traveled, and distal to the filter It is scored histologically by counting the radioactivity on the side or bottom of the dish. See, for example, Freshney (1984) (supra).

(Evaluation of tumor growth in vivo to identify and characterize modulators)
The effect of cancer associated sequences on cell proliferation is tested in transgenic or immunosuppressed organisms. Transgenic organisms are prepared in a variety of ways accepted in the art. For example, a knockout transgenic organism (eg, a mammal such as a mouse) is produced in which the oncogene is disrupted or the oncogene is inserted. Knockout transgenic mice are created by inserting a marker gene or other heterologous gene into the endogenous oncogene site in the mouse genome via homologous recombination. Such mice can also be made by replacing an endogenous oncogene with a mutated version of an oncogene or by mutating the endogenous oncogene, for example by exposure to a carcinogen.

In order to prepare a transgenic chimeric animal (eg, a mouse), a DNA construct is introduced into the nucleus of the embryonic stem cell. Cells containing the newly engineered genetic lesion are injected into the host mouse embryo, which is reimplanted into the recipient female. Some of these embryos develop into chimeric mice with germ cells. Some of these germ cells are derived from mutant cell lines. Therefore, by breeding this chimeric mouse, it is possible to obtain a new mouse strain containing the introduced genetic damage (eg, Capecchi et al., S
Science 244: 1288 (1989)). Chimeric mice are 200
US Pat. No. 6,365,797 issued April 2, 2; US Pat. No. 6,107,540 issued August 22, 2000; Hogan et al., Manipulating
the Mouse Embryo: A laboratory Manual, Col
d Spring Harbor Laboratory (1988) and Terat
ocarcinomas and Embryonic Stem Cells: AP
longitudinal Approach, edited by Robertson, IRL Press, W
ashtonton, D.M. C. , (1987).

Alternatively, various immunosuppressed or immunodeficient host animals can be used. For example, genetically athymic “nude” mice (see, eg, Giovanella et al., J. Natl
. Cancer Inst. 52: 921 (1974)), SCID mice, thymectomized mice, or irradiated mice (see, eg, Bradley et al., Br.
J. et al. Cancer 38: 263 (1978); Selby et al., Br. J. et al. Cancer
41:52 (1980)) can be used as a host. Transplantable tumor cells (typically about 10 ⁶ cells) injected into a syngeneic host produce invasive tumors in high proportions, while normal cells of similar origin Does not produce invasive tumors. In hosts that have developed invasive tumors, cells expressing cancer-associated sequences are injected subcutaneously or at a normal position. The mice are then separated into groups comprising a control group and a treatment experimental group (eg, treated with a modulator). An appropriate amount of time (preferably 4
˜8 weeks) (for example, by volume or its two largest dimensions or weight)
Tumor growth is measured and compared to a control. Tumors that have a statistically significant decrease (eg, using Student's t test) are said to have inhibited growth.

(In vitro assay to identify and characterize modulators)
Assays to identify compounds with modulatory activity can be performed in vitro. For example, a cancer polypeptide is first contacted with a potential modulator and incubated for an appropriate amount of time (eg, 0.5-48 hours). In one embodiment, the level of cancer polypeptide is determined by measuring the level of protein or mRNA.
Determined in vitro. Protein levels are measured using immunoassays (eg, Western blotting, ELISA, etc.) using antibodies that selectively bind to cancer polypeptides or fragments thereof. For measurement of mRNA, amplification (eg,
PCR, LCR is used), or hybridization assays (eg, Northern hybridization, RNase protection, dot blotting)) are preferred. The level of protein or mRNA can be measured directly or with a labeled detection reagent (eg, fluorescently labeled or radiolabeled nucleic acid, radiolabeled antibody or Detected indirectly using an enzyme-labeled antibody or the like).

Alternatively, a reporter gene system can be developed using an oncoprotein promoter operably linked to a reporter gene (eg, luciferase, green fluorescent protein, CAT, or P-gal). The reporter construct is typically transfected into the cell. After treatment with a potential regulator, the amount of transcription, translation, or activity of the reporter gene is measured according to standard techniques known to those skilled in the art (Davis GF,
Supra; Gonzalez, J .; & Negulescu, P .; Curr. Opin. Bi
otechnol. 1998: 9: 624).

As outlined above, in vitro screening is done on individual genes and gene products. That is, if a particular differentially expressed gene is identified as being important in a particular state, screening for regulators of expression of this gene or gene product itself is performed.

In one embodiment, screening for regulators of expression of a particular gene is performed. Typically, the expression of only one or a few genes is evaluated. In another embodiment, the screen is designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for their ability to modulate differentially expressed activity. Furthermore, once the first candidate compound is identified, variants can be further screened to better evaluate the structure-activity relationship.

(Binding assay to identify and characterize modulators)
In a binding assay according to the invention, a purified or isolated gene product of the invention is generally used. For example, antibodies are generated against the protein of the invention and an immunoassay is performed to determine the amount and / or location of the protein. Alternatively, cells containing oncoproteins are used in the assay.

Accordingly, these methods include the steps of mixing a cancer protein of the invention with a candidate compound, such as a ligand, and determining the binding of the compound to the cancer protein of the invention. Preferred embodiments utilize human oncoproteins; animal models of human disease can also be developed and used. Other similar mammalian proteins can also be used, as will be appreciated by those skilled in the art. Further, in some embodiments, variant oncoproteins or derived oncoproteins are used.

In general, the oncoproteins or ligands of the invention are non-diffusively bound to an insoluble support. The support can be, for example, one having a region for receiving an isolated sample (microtiter plate, array, etc.). Insoluble supports can be made from any composition to which the composition can be bound, are easily separated from soluble material, and are otherwise compatible with the overall screening method. The surface of such a support can be solid or porous and can be of any convenient shape.

Examples of suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically glass, plastic (eg polystyrene)
, Polysaccharides, nylon, nitrocellulose, or Teflon ^™ . Microtiter plates and arrays are particularly advantageous. This is because multiple assays can be performed simultaneously using small amounts of reagents and samples. The particular manner in which the composition is bound to the support is not critical so long as it is compatible with the overall reagents and methods of the invention, maintains the activity of the composition and is non-diffusible. Preferred methods of conjugation include the use of antibodies that do not sterically block either the ligand binding site or the activation sequence when the protein is attached to the support, or direct binding to a “sticky” or ionic support. Chemical cross-linking, protein or drug synthesis on the surface, and the like. Following binding of the protein or ligand / binding agent to the support, excess unbound material is removed by washing. The sample receiving area can then be blocked by incubating with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.

Once the oncoprotein of the invention is bound to the support, a test compound is added to the assay. Alternatively, the candidate binding agent is bound to the support and then the oncoprotein of the invention is added. Binding agents include specific antibodies, non-natural binding agents identified by screening chemical libraries, peptide analogs, and the like.

Of particular interest are assays for identifying agents that have low toxicity to human cells.
A wide variety of assays can be used for this purpose, including proliferation assays, cAMP assays, labeled in vitro protein-protein binding assays,
Electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (such as phosphorylation assays) and the like.

Determining the binding of a test compound (ligand, binding agent, modulator, etc.) to an oncoprotein of the invention can be done in a number of ways. The test compound can be labeled and binding can be accomplished, for example, by attaching all or part of the oncoprotein of the invention to a solid support, adding a labeled candidate compound (eg, a fluorescent label), and removing excess reagent. It can be determined directly by washing away and determining whether the label is present on the solid support. Various blocking and cleaning steps can be utilized as appropriate.

In certain embodiments, only one of the components is labeled. For example, the protein or ligand of the invention is labeled. Alternatively, more than one component is labeled with different labels (eg, I ¹²⁵ for proteins and fluorophores for compounds). Proximity reagent (
For example, quenching agents or energy transfer agents) are also useful.

(Competitive binding to identify and characterize modulators)
In one embodiment, binding of a “test compound” is determined by a competitive binding assay using a “competitor”. A competitor is a target molecule (eg, a cancer protein of the present invention).
It is a binding part that binds to Competitors include compounds such as antibodies, peptides, binding partners, ligands and the like. Under certain circumstances, the competitive binding between the test compound and the competitor replaces the test compound. In one embodiment, the test compound is labeled. Either the test compound, the competitor, or both are added to the protein for a time sufficient to allow binding. Incubations are performed at a temperature that facilitates optimal activity (typically between 4 ° C. and 40 ° C.). Incubation times are typically optimized to facilitate, for example, rapid high throughput of screening; typically between 0 and 1 hour is sufficient. Excess reagent is generally removed or washed away. A second component is then added and the presence or absence of the labeled component is followed to indicate binding.

In one embodiment, the competitor is added first, followed by the test compound.
Displacement of the competitor is an indication that the test compound binds to the oncoprotein, and thus can bind to the oncoprotein and potentially modulate the activity of the oncoprotein. In this embodiment, any component can be labeled. Thus, for example, if the competitor is labeled, the presence of the label in the post-test compound wash solution indicates replacement by the test compound. Alternatively, when the test compound is labeled, the presence of the label on the support is an indication of displacement.

In an alternative embodiment, the test compound is added first, incubated and washed, and then the competitor is added. The absence of binding by the competitor is that the test compound
Shows binding to oncoproteins with higher affinity than competitors. Thus, when the test compound is labeled, the presence of the label on the support (combined with the lack of binding of the competitor) will cause the test compound to bind to and thus potentially modulate the cancer protein of the invention. It is an indicator.

Thus, competitive binding methods include differential screening to identify agents that can modulate the activity of the oncoproteins of the present invention. In this embodiment, the method includes mixing the oncoprotein and the competitor in the first sample. The second sample contains the test compound, oncoprotein, and competitor. The binding of the competitor is determined for both samples, and the change or difference in binding between these two samples is indicative of the presence of an agent that can bind to the cancer protein and potentially modulate its activity. Show. That is, if the binding of the competitor differs in the second sample relative to the first sample, the agent can bind to the oncoprotein.

Alternatively, differential screening is used to identify drug candidates that bind to the native oncoprotein but cannot bind to the modified oncoprotein. For example, the structure of oncoproteins can be modeled and used in rational drug design to synthesize factors that interact with the site, i.e., factors that do not generally bind to site-modified proteins. . In addition, drug candidates that affect the activity of native oncoproteins are also identified by screening drugs for the ability to either enhance or decrease the activity of such proteins.

Positive and negative controls can be used in this assay. Preferably, control and test samples are performed at least in triplicate to obtain statistically significant results. Incubation of all samples is performed for a time sufficient to allow binding of this factor to the protein. Following incubation, the sample is washed free of non-specific binding material and the amount of genetically labeled factor bound is determined. For example, if a radiolabel is used, these samples can be counted using a scintillation counter to determine the amount of compound bound.

A variety of other reagents may be involved in this screening assay. These reagents include:
Salts, neutral proteins (e.g., used to facilitate optimal protein-protein binding and / or reduce non-specific or background interactions)
And reagents such as albumin) surfactants. Reagents that improve the efficiency of this assay in other ways (eg, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc.) can also be used. The mixture of ingredients is added in an order that provides the requisite binding.

(Use of polynucleotides to down-regulate or inhibit proteins of the invention)
Polynucleotide modulators of cancer can be introduced into cells containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to:
Cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the conjugate of the ligand-binding molecule does not interfere sufficiently with the ability of the ligand-binding molecule to bind to its corresponding molecule or receptor, and the sense oligonucleotide or antisense oligonucleotide or conjugate version thereof to the cell. Do not block the entry sufficiently. Alternatively, the polynucleotide modulator of cancer is, for example, W
As described in O 90/10448, it can be introduced into cells containing the target nucleic acid sequence by formation of a polynucleotide-lipid complex. It will be appreciated that the use of antisense molecules or knock-out models and knock-in models can also be used in screening assays as discussed above, in addition to processing methods.

(Inhibition and antisense nucleotides)
In certain embodiments, the activity of a cancer-associated protein is associated with an antisense polynucleotide or inhibitory micronuclear RNA (snRNA) (ie, a coding mRNA nucleic acid sequence (eg, a cancer protein, mRNA of the invention, or a subsequence thereof). Complementary and preferably down-regulated or completely inhibited by the use of nucleic acids) that are preferably capable of hybridizing to them. Binding of the antisense polynucleotide to the mRNA reduces the translation and / or stability of the mRNA.

In the context of the present invention, antisense polynucleotides can include naturally occurring nucleotides, or synthetic species formed from naturally occurring subunits or related homologues thereof. Antisense polynucleotides can also have altered sugar moieties or linkages between sugars. Phosphorothioates and other sulfur-containing species known to be used in the art are illustratively included among these. Analogs are included in the invention as long as they function effectively so that they hybridize to the nucleotides of the invention. For example, Is
is Pharmaceuticals, Carlsbad, CA;
Inc. See, Natick, MA.

Such antisense polynucleotides can be readily synthesized using recombinant means, or can be synthesized in vitro. Equipment for such synthesis is commercially available from a variety of vendors including Applied Biosystems. The preparation of other oligonucleotides (eg, phosphorothioates and alkylated derivatives) also
Well known to those skilled in the art.

As used herein, an antisense molecule includes an antisense oligonucleotide or a sense oligonucleotide. Sense oligonucleotides can be used, for example, to block transcription by binding to the antisense strand. The antisense and sense oligonucleotides are single-stranded nucleic acid sequences (RNA that can bind to a target mRNA (sense) sequence or target DNA (antisense) sequence for a cancer molecule.
Or any one of DNA). An antisense oligonucleotide or sense oligonucleotide according to the invention is generally at least about 12 nucleotides, preferably
Includes fragments of about 12 nucleotides to about 30 nucleotides. The ability to derive antisense or sense oligonucleotides based on cDNA sequences encoding a given protein is described, for example, by Stein & Cohen (Cancer Res.
48: 2659 (1988) and van der Krol et al. (BioTechni
ques 6: 958 (1988).

(Ribozyme)
In addition to antisense polynucleotides, ribozymes can be used to target or inhibit transcription of cancer-associated nucleotide sequences. Ribozymes are RNA molecules that catalytically cleave other RNA molecules. Various types of ribozymes have been described. These ribozymes include group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and axhead ribozymes (see, eg, Castanotto et al., Adv. In Ph for a general review of the properties of various ribozymes).
armalogy 25: 289-317 (1994)).

The genetic characteristics of hairpin ribozymes are described, for example, in Hampel et al., Nucl. Acid
Res. 18: 299-304 (1990); European Patent Application No. 0360257; U.S. Pat. No. 5,254,678. Methods of preparation are well known to those skilled in the art (eg, WO 94/26877; Ojwang et al., Proc. Natl. Acad. Sci.
USA 90: 6340-6344 (1993); Yamada et al., Human Gen.
e Therapy 1: 39-45 (1994); Leavitt et al., Proc. Na
tl. Acad Sci. USA 92: 699-703 (1995); Leavitt
Et al., Human Gene Therapy 5: 1151-120 (1994); and Yamada et al., Virology 205: 121-126 (1994)).

(Use of regulators in phenotypic screening)
In one embodiment, the test compound is administered to a population of cancer cells having an associated cancer expression profile. As used herein, “administering” or “contacting” refers to the modulation in such a manner that the modulator acts on the cell either by uptake and intracellular action or by action on the cell surface. It means adding a factor to the cell. In some embodiments, a nucleic acid encoding a proteinaceous factor (ie, a peptide) is added to a viral construct (eg, an adenoviral construct or a retroviral construct) and added to a cell to express the peptide factor. Is achieved (for example,
PCT US97 / 01019). Regulatable gene therapy systems can also be used. Once the modulator is administered to the cells, the cells are washed if desired and incubated for some period of time under favorable physiological conditions. These cells are then collected and a new gene expression profile is created. Thus, for example, cancerous tissue is screened for factors that modulate (eg, induce or suppress) the cancer phenotype. A change in at least one gene, preferably many genes, in the expression profile indicates that this factor has an effect on the activity of the cancer. Similarly, altering a biological function or signal transduction pathway indicates the activity of a modulator. By defining such a signature for the cancer phenotype, screening for new drugs that alter the phenotype is devised. In this approach, the drug target need not be known, need not be represented in the original gene / protein expression screening platform, and the level of transcript for the target protein need not change. Regulators that inhibit function serve as surrogate markers.

Screening is performed to evaluate the gene or gene product as outlined above. That is, a step of identifying a specific differentially expressed gene as important in a specific state and a step of screening for any regulator of expression of the gene or gene product itself are performed.

(Use of modulators affecting the peptides of the invention)
Measurement of cancer polypeptide activity, or cancer phenotype, is performed using various assays.
For example, the effect of a modulator on the function of a cancer polypeptide is measured by testing the above parameters. Physiological changes that affect activity are used to assess the effect of a test compound on the polypeptides of the invention. When functional results are determined using intact cells or animals, various effects can occur (eg, solid tumors, tumor growth, tumor metastasis,
For cancers associated with neovascularization, hormone release, transcriptional changes to both known and uncharacterized genetic markers (eg, by Northern blot), changes in cell metabolism (eg, cell growth or pH) Change) and intracellular secondary messengers (eg in the case of changes in cGNIP).

(Method for identifying and characterizing cancer-related sequences)
The expression of various gene sequences is associated with cancer. Accordingly, a disorder based on a mutant oncogene or a modified oncogene is determined. In one embodiment, the present invention provides a method for identifying a cell comprising a variant oncogene (eg, determining the presence of all or part of a sequence of at least one endogenous oncogene in the cell). provide. This is accomplished using any number of sequencing techniques. The invention encompasses a method of identifying an individual's cancer genotype (eg, determining all or part of the sequence of at least one gene of the invention in an individual). This is generally done in at least one tissue of the individual (eg, the tissue shown in Table 1) and may include evaluation of multiple tissues or different samples of the same tissue. The method includes the step of comparing the sequence of the sequenced gene with the sequence of a known oncogene (ie, wild type gene) to determine the presence of a family member, homolog, variant, or variant. obtain. The sequence of all or part of this gene can then be compared to the sequence of known oncogenes to determine if any differences exist. This is done using any number of known homology programs (eg, BLAST, Bestfit, etc.). The presence of sequence differences between a patient oncogene and a known oncogene is associated with a disease state or trend for a disease state, as outlined herein.

In a preferred embodiment, these oncogenes are used as probes to determine the copy number of oncogenes in the genome. These oncogenes are used as probes for determining the chromosomal location of the oncogene. Information such as chromosomal location finds use in diagnosis or prognosis, particularly when chromosomal abnormalities (eg, translocations, etc.) are identified at the oncogene locus.

(XIV.) Kit / article of manufacture)
Kits are also within the scope of the invention for use in the diagnostic and therapeutic applications described herein. Such a kit may comprise a carrier, a package or a container that is partitioned to receive one or more containers (eg, vials, tubes, etc.), each of which is used in the method. Contains one separate element. For example, the container can include a probe that is detectably labeled or can be labeled. Such probes can be antibodies or polynucleotides specific for the protein associated with FIG. 2 or the gene or message of FIG. 2, respectively. If the method uses nucleic acid hybridization to detect the target nucleic acid, the kit may also include a container containing nucleotides for amplifying the target nucleic acid sequence and / or reporter means (eg, a reporter molecule (eg, an enzyme A container containing a biotin-binding protein (eg, avidin or streptavidin)) bound to a label, a fluorescent label, or a radiolabel). The kit can include all or part of the amino acid sequence in FIG. 2 or FIG. 3 or an analog thereof, or a nucleic acid molecule encoding such an amino acid sequence.

The kits of the present invention typically contain the desired materials (buffers, diluents, filter paper, needles, syringes; carriers, packages, containers,
One or more other containers, including vials and / or tubes, labels listing the contents, and / or instructions for use, and package inserts with instructions for use).

The label may be present on the container to indicate that the composition is to be used for a particular therapeutic or non-therapeutic application (eg, diagnostic or research application) and used in vivo or in vitro (eg, as described herein). Instructions for use) described in the document. Instructions and / or
Or other information may also be included with the kit or on an insert or label provided on the kit.

  The terms “kit” and “article of manufacture” may be used as synonyms.

In another embodiment of the invention, the composition (eg, amino acid sequence, small molecule, nucleic acid sequence,
Articles of manufacture comprising antibodies and / or antibodies (eg, materials useful for diagnosis, prognosis, prevention and / or treatment of tissue neoplasia as shown in Table 1) are provided. Articles of manufacture typically comprise at least one container and at least one label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. These containers can be formed from a variety of materials, such as glass or plastic. The container may hold amino acid sequences, small molecules, nucleic acid sequences, and / or antibodies, and in one embodiment, the container may contain a polynucleotide for use in testing cellular mRNA expression profiles. Can be retained with the reagents used for the purpose.

The container may alternatively comprise a composition effective for treating, diagnosing, prognosing or preventing a particular condition and may comprise a sterile access port (eg, the container may be an intravenous solution bag or (It can be a vial having a stopper that can be penetrated by a hypodermic needle)
. The active agent in the composition can be an antibody that can specifically bind 98P4B6 and modulate the function of 98P4B6.

The label can be on the container or attached to the container. If the letters, numbers or other features forming this label are formed or etched on the container itself, the label can be on the container; it also holds the container (receptacl)
e) or if present in a carrier (eg a package insert), a label may be attached to the container. The label may indicate that the composition is used for diagnosing, treating, preventing or prognosing a condition (eg, tissue neoplasia shown in Table 1). The article of manufacture may further comprise a second container, the second container comprising a pharmaceutically acceptable buffer (
(E.g., phosphate buffered saline, Ringer's solution, and / or dextrose solution)
including. The container may contain other materials desired from commercial and user standpoints (other buffers, diluents, filter paper, stir bars, needles, syringes, and / or package inserts and / or uses with instructions. (Instructions for).

Various aspects of the invention are further described and illustrated by the following examples. These examples are not intended to limit the scope of the invention.

(Example 1: SSH generation isolation of cDNA fragment of 98P4B6 gene)
In order to isolate genes that are overexpressed in prostate cancer, we have suppressed subtractive hybridization (SSH) using cDNA from prostate cancer tissue.
Procedure was used. This 98P4B6 SSH cDNA sequence was transferred from normal prostate to LAPC.
Derived from subtracted -4AD prostate xenografts. It was identified that 98P4B6 cDNA is highly expressed in prostate cancer.

(Materials and methods)
(Human tissue)
The patient's cancer and normal tissue are collected from separate sources (eg, NDRI (Philadelph).
purchased from ia, PA)). MRNA for some normal tissues
h, purchased from Palo Alto, CA.

(Isolation of RNA)
Tissue was treated with Trizol reagent (Life Technologies, Gibco BR).
L), total RNA was isolated by homogenization using 10 ml / g tissue. Poly A
RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total RNA and mRNA were analyzed spectrophotometrically (O.D.
D. 260/280 nm) and analyzed by gel electrophoresis.

(Oligonucleotide)
The following HPLC purified oligonucleotides were used.

（抑制サブトラクティブハイブリダイゼーション）
抑制サブトラクティブハイブリダイゼーション（ＳＳＨ）を使用して、前立腺癌におい
て差次的に発現し得る遺伝子に対応するｃＤＮＡを同定した。このＳＳＨ反応は、前立腺
癌異種移植片および正常組織由来のｃＤＮＡを使用した。

(Suppression subtractive hybridization)
Suppressive subtractive hybridization (SSH) was used to identify cDNAs corresponding to genes that could be differentially expressed in prostate cancer. This SSH reaction used prostate cancer xenografts and cDNA from normal tissues.

Gene 98P4B6 is derived from normal prostate tissue from prostate cancer xenograft LAPC-4AD
cDNA derived from the subtracted cDNA was used. The SSH DNA sequence (Figure 1) was identified.

Using the cDNA from LAPC-4AD as a source of “driver” cDNA,
On the other hand, cDNA from normal prostate was used as a source of “tester” cDNA. The double-stranded cDNA corresponding to the tester cDNA and the driver cDNA was prepared as described above using the CLONTECH PCR-Select cDNA Subtraction K.
It was synthesized from poly (A) ⁺ RNA (2 μg) isolated from the relevant xenograft tissue using it and 1 ng of oligonucleotide DPNCD as a primer. First and second strand synthesis was performed as described in the kit user manual protocol (CLONTECH protocol number PT1117-1, catalog number K1804-1).
The resulting cDNA was digested with Dpn II for 3 hours at 37 ° C. Digested cDNA was extracted with phenol / chloroform (1: 1) and precipitated with ethanol.

Driver cDNA was generated by mixing a DpnII-digested cDNA from a relevant tissue source (see above) in a 1: 1 ratio with a normal tissue-derived digested cDNA mixture.

Tester cDNA is derived from the relevant tissue source (see above) (400 ng),
DpnII digested cDNA (1 μl) was made by diluting in 5 μl of water. This diluted cDNA (2 μl, 160 ng) was then added to 400 u of T4 D
10 μl in a separate ligation reaction using NA ligase (CLONTECH)
Of 2 μl Adapter 1 and Adapter 2 (1
0 μM). Ligation was terminated by heating at 72 ° C. for 5 minutes with 1 μl of 0.2M EDTA.

The first hybridization was performed using driver cDNA (1.5 μl, 600 ng), 1.5 μl (20 ng) of Adapter 1-linked tester cDNA and Adapt.
or was performed by adding to each of the two tubes containing the 2-linked tester cDNA. In a final volume of 4 μl, these samples are covered with mineral oil and MJ Research
Denaturate at 98 ° C. for 1.5 minutes on an h thermal cycler and then hybridize at 68 ° C. for 8 hours. The two hybridization products were then mixed with additional fresh denatured driver cDNA (1 μl) and hybridized overnight at 68 ° C. This second hybridization product was then added to 20 mM Hepes (pH 8.3), 50 m
Dilute in M NaCl, 0.2 mM EDTA (200 μl), heat at 70 ° C. for 7 minutes, and store at −20 ° C.

(PCR amplification, cloning and sequencing of gene fragments generated by SSH)
Two PCR amplifications were performed to amplify the gene fragment obtained from the SSH reaction. In the first PCR reaction, the diluted final hybridization mixture (1 μl
) 1 μl PCR primer 1 (10 μM), 0.5 μl dNTP mix (10 μm
M), 2.5 μl of 10 × reaction buffer (CLONTECH) and 0.5 μl of 50 × A
In the dvantage cDNA polymerase mixture (CLONTECH), a final volume of 25
Added in μl. PCR1 was performed using the following conditions. 94 ° C for 5 minutes at 75 ° C
For 25 seconds, then 94 ° C for 10 seconds, 66 ° C for 30 seconds, and 75 ° C for 1.5 minutes for 27 cycles. Five separate first PCR reactions were performed for each experiment. Pool the product,
It was diluted 1:10 with water. For the second PCR reaction, 1 μl from this pooled diluted first PCR reaction was the same as that used for PCR 1 except that primers NP1 and NP2 (10 μM) were used instead of PCR primer 1. Added to the mixture. PCR2 was performed at 94 ° C for 10 seconds, 68 ° C for 30 seconds, and 72 ° C for 10 / 1.5
Performed using ~ 12 cycles. The PCR product was analyzed using 2% agarose gel electrophoresis.

This PCR product was inserted into pCR2.1 using the T / A vector cloning kit (Invitrogen). Transformed E. coli The E. coli was subjected to blue / white sorting and ampicillin sorting. White colonies were picked and placed in 96 well plates and grown overnight in liquid culture. To identify the insert, PCR amplification was performed on 1 μl of bacterial culture using PCR1 conditions and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.

Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid D
NA is prepared, sequenced, and GenBank, dBest and NCI-CGAP
The database was subjected to nucleic acid homology search.

(RT-PCR expression analysis)
First strand cDNA using priming of oligo (dT) 12-18 using Gibco-BRL Superscript Preamplification system
Can be made from 1 μg of mRNA. The manufacturer's protocol was used, which included incubation with reverse transcriptase at 42 ° C for 50 minutes, followed by RNAse H treatment at 37 ° C for 20 minutes. After the reaction was complete, the volume could be increased to 200 μl with water prior to normalization. First strand cDNA from 16 different normal human tissues was cloned into Clontec
available from h.

Normalization of first strand cDNA from multiple tissues was performed using the following primer: 5'atatcg
ccgcgctcgtcgtcgaca 3 '(SEQ ID NO: 109) and 5' aggca
cacgcagtctattgtagaag 3 ′ (SEQ ID NO: 110) is used to form β-
This was performed by amplifying actin. First strand cDNA (5 μl) was added in a total volume of 50 μl (0.4 μM primer, 0.2 μM dNTP each, 1 × PCR buffer (Clo
ntech, 10 mM Tris-HCl, 1.5 mM MgCl ₂ , 50 mM KCl
, PH 8.3) and 1 × Klentaq DNA polymerase (Clontech). 5 μl of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis. PCR, MJ Re
A search thermal cycler was used under the following conditions: the first denaturation step was 94 ° C for 15 seconds, followed by 94 ° C for 15 minutes, 65 ° C for 2 minutes, 72 ° C for 5 seconds. Cycle, 20 cycles and 22 cycles. The final extension step at 72 ° C. was performed for 2 minutes. After agarose gel electrophoresis, 283b. p. Β
The band intensity of the actin band was compared by visual inspection. The dilution factor of the first strand cDNA was calculated to obtain equal β-actin band intensity in all tissues after 22 cycles of PCR. In all tissues after 22 cycles of PCR, three rounds of normalization may be required to achieve equal band intensity.

To determine the expression level of the 98P4B6 gene, 5 μl of normalized first strand cD
NA was analyzed by PCR using 26 and 30 cycles of amplification. Semi-quantitative expression analysis can be accomplished by comparing PCR products in cycle numbers that give light band intensity. Primers used for RT-PCR were 98P4B6 SSH.
Designed using the sequence, this primer is shown below:

（実施例２：全長９８Ｐ４Ｂ６コードｃＤＮＡの単離）
９８Ｐ４Ｂ６ ＳＳＨ ｃＤＮＡ配列を、正常な前立腺から癌異種移植片を差し引いた
ものからなるサブトラクションから誘導した。このＳＳＨ ＤＮＡ配列（図１）を、９８
Ｐ４Ｂ６と呼んだ。

(Example 2: Isolation of full length 98P4B6-encoding cDNA)
The 98P4B6 SSH cDNA sequence was derived from a subtraction consisting of a normal prostate minus a cancer xenograft. This SSH DNA sequence (FIG. 1) was
I called it P4B6.

The 183 bp 98P4B6 SSH DNA sequence is shown in FIG. 2453 bp full length 98P4B6 v. 1 (clone GTD3) was cloned from a prostate cDNA library and revealed a 454 amino acid ORF (FIGS. 2 and 3). 98P4B6
v. 6 was also cloned from a normal prostate library. Other variants of 98P4B6 were also identified. These are listed in FIG. 2 and FIG.

98P4B6 v. 2, v. 3, v. 4, v. 5, v. 6, v. 7 and v. 8 is 9
8P4B6 v. 1 splice variant. 98P4B6 v. 9-v. 19 is S
An NP variant, v. It differs from 1 by one amino acid. 98P4B6 v. 20-v. 24
V. 7 SNP variants. 98P4B6 v. 25-v. 38 is v. 8 SN
P variant. These SNP variants have been shown separately, but they can be present in any transcript variant in any combination.

(Example 3: Chromosome mapping of 98P4B6)
Chromosomal localization can be associated with genes in the pathogenesis of the disease. Several chromosomal mapping approaches are available, including fluorescence in situ hybridization (FISH), human / hamster radiation hybrid (RH) panel (Walter et al., 1994; Nature Genetics 7:22; Research Gene
tics, Huntsville A1), human-rodent somatic cell hybrid panel (
For example, Cornell Institute (Camden, New Jersey)
And a genomic viewer using BLAST homology to sequenced and mapped genomic clones (NCBI, Bethesda,
Maryland).

98P4B6 contains the 98P4B6 sequence and the NCBI BLAST tool (World Wide Web (.ncbi.nlm.nih.gov / genome / seq / page.c
gi? F = HsBlast. html && ORG = Hs)), using chromosome 1
Maps to q22-q23.2.

Example 4: Expression analysis of 98P4B6 in normal tissues and patient specimens
Expression analysis by RT-PCR demonstrated that 98P4B6 is strongly expressed in prostate cancer patient specimens (FIG. 14). First strand cDNA is derived from normal stomach, normal brain, normal heart, normal liver, normal skeletal muscle, normal testis, normal prostate, normal bladder, normal kidney, normal colon, normal lung, normal pancreas, and cancer from prostate cancer patients. Specimen pool, Cancer specimen pool from bladder cancer patients, Cancer specimen pool from kidney cancer patients, Cancer specimen pool from colon cancer patients, Cancer specimen pool from lung cancer patients, Cancer specimen pool from prostate cancer patients, and lymph nodes Prepared from a pool of 2 patients with prostate metastases. Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 or / and v. Use primers for 14 (A) or splice variant 98P4B6 v. 6 and v. (B) Semi-quantitative PCR using primers specific for 8 was performed with 26 and 30 cycles of amplification. In (A), the sample was run on an agarose gel and PCR was performed.
Product was quantified using AlphaImager software. The results show that in normal prostate and prostate cancer, 98P4B6 and its splice variants v. 6 and v. A strong expression of 8 is shown. 98P4B6 expression was also detected in specimens of bladder cancer, kidney cancer, colon cancer, lung cancer, prostate cancer, breast cancer, cancer metastasis, and prostate cancer metastasis to lymph nodes compared to all normal tissues tested . As shown below (eg, Example 6), 9
8P4B6 v. Since 1 is expressed in cancer tissues as listed in Table 1, other protein code 98P4B6 variants are also expressed in these tissues. This principle is based on 98P4B6 v. 6 or v. The protein referred to herein as 8 is demonstrated by the data in FIG. 14 and is described in the prostate, lung, ovary, bladder, breast, colon, kidney, and pancreas, cancer, and literature (Porkka et al., Lab Invest, 2002 and Ko).
rkmaz et al., JBC, 2002) where the protein 98P4B
6 v. 8 is identified in normal prostate and prostate cancer.

When the genomic region to which a gene is mapped is regulated in a particular cancer, selective transcripts or splice variants of that gene are also regulated. Disclosed herein is that 98P4B6 has a specific expression profile associated with cancer. 98P
Selective transcripts and splice variants of 4B6 are also associated with cancer in the same or additional tissues, thereby serving as tumor associated markers / antigens.

98P4B6 v. 1, v. 13 and / or v. Expression of 14 was detected in prostate, bladder, cervix, uterus and pancreas cancer patient specimens (FIG. 15). First strand cDNA was prepared from a single patient cancer specimen. Normalization, P using primers for actin
Performed by CR. Semi-quantitative PCR using primers for 98P4B6
Cycle and 30 cycles of amplification. Samples were run on an agarose gel. PCR products were quantified using AlphaImager software. Expression was recorded as no, low, moderate or strong. The results show 98P4B6 expression in the majority of all patient cancer specimens tested.

FIG. 16 shows that 98P4B6 is expressed in gastric cancer patient specimens. (A) RNA
Were extracted from normal stomach (N) and from 10 different gastric cancer patient specimens (T). 1
Northern blots using 0 μg total RNA / lane were probed with 98P4B6 sequences. The results show 98P4B6 expression in gastric tumor tissue and lower expression in normal stomach. The figure below shows ethidium bromide staining of a blot showing the amount of RNA sample. (B) Expression of 98P4B6 is expressed in human gastric cancer (T) group and their respective matched normal tissues (
N) and assayed by RNA dot blot. 98P4B6 was detected in 7 out of 8 gastric tumors but not in matching normal tissue.

(Example 5: transcript of 98P4B6)
A transcript variant is a variant of the mature mRNA from the same gene by alternative transcription or alternative splicing. Selective transcripts are transcripts from the same gene but initiate transcription at different points. Splicing variants are mRNA variants that are differentially spliced from the same transcript. In eukaryotes, genes with multiple exons (
multi-exon gene) is transcribed from genomic DNA, the first RNA
Are spliced to produce a functional mRNA that has only exons and is used for translation into amino acid sequences. Thus, a given gene can have zero to many alternative transcripts, and each transcript can have zero to many splicing variants. Each transcript variant has a unique exon makeup and may have different coding and / or non-coding portions (5 ′ or 3 ′ end) from the original transcript. Transcript variants may encode similar or different proteins with the same or similar function, may encode proteins with different functions, and may be expressed in the same tissue at the same time point It may be expressed in different tissues at different times, in the same tissue at different times, or in different tissues at different times. Proteins encoded by transcript variants can have similar or different intracellular or extracellular locations (eg, secreted versus intracellular).

Transcript variants are identified by various methods accepted in the art. For example, selective transcripts and splicing variants can be obtained by full-length cloning experiments
Or identified by use of full-length transcripts and EST sequences. First, all human ESTs were grouped into clusters that showed direct or indirect identity with each other. Second
First, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to a consensus sequence or other full-length sequence. Each consensus sequence is a potential splicing variant for that gene. Even if a variant that is not a full-length clone is identified, that portion of the variant is very useful for antigen generation using techniques known in the art and for further cloning of full-length splicing variants.

In addition, computer programs that identify transcript variants based on genomic sequences are available in the art. Genome-based transcript variant identification programs include FgenesH (A. Salamov and V. Solovyev, “Abini”).
tio gene finding in Drosophila genomic D
NA, "Genome Research. 2000 April; 10 (4): 516
-22); Grail (URL compbio. Ornl. Gov / Grail-bi
n / EmptyGrailForm) and GenScan (URL genes.mi)
t. edu / GENSCAN. html). For a general discussion of splicing variant identification protocols see, for example, Southan, C .; , A
genomic perspective on human proteases,
FEBS Lett. 2001 Jun 8; 498 (2-3): 214-8; de S
ouza, S .; J. et al. , Identification of human chrom
osome 22 transcribed sequences with ORF
expressed sequence tags, Proc. Natl Acad S
ci USA. 2000 Nov 7; 97 (23): 12690-3.

Various techniques are available in the art to further confirm the parameters of the transcript variants (eg, full-length cloning, protein validation, PCR-based confirmation, and 5′RACE confirmation, etc.) ( For example, protein confirmation: Brennan, S.O. et al., Albumin banks pen.
insula: a new termination variant charact
erized by electrospray mass spectrometry
Biochem Biophys Acta. 1999 Aug 17; 1433 (1
-2): 321-6; Ferranti P et al., Differential splic
ing of pre-messenger RNA products multip
le forms of texture capsule alpha (sl) -cas
ein, Eur J Biochem. 1997 Oct 1; 249 (1): 1-7, for PCR-based confirmation: Wellmann S et al., Specific rev
erse transcription-PCR quantification of
basal endothelial growth factor (VEGF)
) Splice variants by LightCycler technology
ogy, Clin Chem. 2001 Apr; 47 (4): 654-60; Jia
, H .; P. , Discovery of new human beta-defen
sins using a genomics-based approach, Gen
e. 2001 Jan 24; 263 (1-2): 211-8 for PCR-based and 5'RACE confirmation: Brigle, K. et al. E. , Organizatio
n of the murine reduced fort carrier g
one and identification of variant splice
forms, Biochem Biophys Acta. 1997 Aug 7; 1
353 (2): 191-8).

It is known in the art that genomic regions are regulated in cancer. Recently, Po
rkka et al. (2002) reported that transcript variants of STEAP-2 were expressed and found in both normal and malignant prostate tissues (Porkka, K. P. et al.
Et al., Cloning and characterisation of a novel
l six-transmembrane protein STEAP2, expre
sed in normal and maligant prostate. La
laboratory Investigation 2002 Nov; 82 (11): 1
573-1582). Another group of scientists also reported that a transcriptional variant of STEAP2 (98P4B6 v.6 herein) was also expressed significantly higher in prostate cancer than in normal prostate (Korkmaz, KS). Et al., Molecular clone
ing and charactazonton of STAPM1, a high
ly prosthetic-specific sic transmembrane p
rotein ist overexpressed in prostate
cancer. The Journal of Biological Chemis
try. 2002 Sept. 277 (39): 36689-36696). When the genomic region to which a gene is mapped is regulated in a particular cancer, alternative transcripts or splicing variants of that gene are also regulated. It is disclosed herein that 98P4B6 has a specific expression profile associated with cancer. Alternative transcripts and splicing variants of 98P4B6 may also be involved in cancer in the same or different tissues and thus serve as tumor-related markers / antigens.

Using the full-length gene and EST sequence, seven additional transcript variants were identified and, as shown in Figure 12, 98P4B6 v. 2, 98P4B6 v. 3, 98P4B6 v.
4, 98P4B6 v. 5, 98P4B6 v. 6, 98P4B6 v. 7 and 98P
4B6 v. I named it 8. The exon boundary of the original transcript is 98P4B6 v. 1 is shown in Table LI. v. The first 22 bases of 1 in the current assembly of the human genome. 1
It was not in the vicinity of the 5 ′ region. 98P4B6 v. 1 compared to v. 2 is 37
The part is v. One exon transcript that was the same as the last exon of 1. v. The first two exons of 3 are v. In one intron. Variant v. 4, v. 5 and v. 6
V. 224-334 in the first exon of 1 was removed by splicing. Furthermore, v. 5 removes exon 5 by splicing; 6 removed exon 6 by splicing, but v. 1 extended to exon 5. Variant v. 7 used selective transcription initiation and a different 3 ′ exon. Variant v. 8 extends to the 5 ′ end, v. 1
Maintained the whole intron. In theory, each different combination of spatially ordered exons (eg, exons 2 and 3) is a potential splice variant.

Tables LII-LV are listed on a per variant basis. Tables LII (a)-(g) show the nucleotide sequences of transcript variants. Tables LIII (a)-(g) show transcript variants and 9
8P4B6 v. 1 shows alignment with one nucleic acid sequence. LIV (a)-(g) describes the amino acid translation of transcript variants for the identified reading frame orientation. LV
(A)-(g) are the amino acid sequence encoded by the splicing variant and the 98
P4B6 v. The alignment with the amino acid sequence of 1 is shown. Furthermore, single nucleotide polymorphism (SNP)
) Is noted in this alignment.

(Example 6: Single nucleotide polymorphism of 98P4B6)
A single nucleotide polymorphism (SNP) is a single base pair modification at a specific position in a nucleotide sequence. Four possible nucleotide base pairs (A / T, C / G, G /
C and T / A). A genotype refers to a base pair sequence at one or more positions in an individual genome. A haplotype often refers to the base pair organization of more than one altered position on the same DNA molecule (a chromosome in a higher organism) in the context of one gene or in the context of several closely linked genes. Say. SNPs that occur on cDNA are called cSNPs. These cSNPs can change the amino acids of the protein encoded by the gene and thus can change the function of the protein. Some SNPs cause genetic diseases, and others contribute to quantitative variations in phenotype and response to environmental factors (including diet and drugs) between individuals. Thus, SNP and / or allele combinations (called haplotypes) have many applications (diagnostic of genetic diseases, determination of drug response and dosage, identification of genes responsive to diseases, and between individuals Including genetic relationships)
(P. Nowotny, JM Kwon and AM Goate, “SNP
analysis to detect human traits "Curr. O
pin. Neurobiol. 2001 Oct; 11 (5): 637-641; P
irhamhamed and B.M. K. Park, “Generic suseptici
“Lite to Adverse Drug Reactions” Trends Ph
armacol. Sci. 2001 Jun; 22 (6): 298-305; H. R
iley, C.I. J. et al. Allan, E .; Lai and A.A. Roses, “The use
of single nucleotide polymorphisms in th
e isolation of common disease genes "Phar
macogenomics. 2000 Feb; 1 (1): 39-47; Judso
n, J. C. Stephens and A.M. Windemuth, “The predic.
live power of haplotypes in clinical res
ponse "Pharmacogenomics. 2000 feb; 1 (1): 15
-26).

SNPs are identified by various methods accepted in the art (P. Bean)
, "The proposing voice of SNP target dis
cover "Am. Clin. Lab. 2001 Oct-Nov; 20 (9): 18
-20; M.M. Weiss, “In search of human variat.
ion "Genome Res. 1998 Jul; 8 (7): 691-697: M. M
. She, “Enabling large-scale pharmacogene.
ic studies by high-throughput mutation d
detection and genetyping technologies "Cli
n. Chem. 2001 Feb; 47 (2): 164-172). For example, SNP is
It is identified by sequencing DNA fragments exhibiting the polymorphism by gel-based methods (eg, restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE)). These can also be found by direct sequencing of DNA samples pooled from different individuals or by comparing sequences from different DNA samples. Using the rapid accumulation of sequence data in public and private databases, computer programs (Z. Gu, L. Hillier and P. Y. Kwo
k, "Single nucleotide polymorphism huntin
g in cyberspace "Hum. Mutat. 1998; 12 (4): 221
SNPs can be found by comparing sequences using -225). SNPs can be identified and individual genotypes or haplotypes can be determined by various methods including direct sequencing and high-throughput microarrays (PY Kwok, “Met
hods for genotyping single nucleotide po
lymorphisms "Annu. Rev. Genomics Hum. Genet.
2001; 2: 235-258; Kokoris, K .; Dix, K.M. Moyniha
n, J. Mathis, B.M. Erwin, P.M. Grass, B.M. Hines and A.H. D
westerfoot, "High-throughput SNP genetyp"
ing with the Masscode system "Mol. Diagn. 2
000 Dec; 5 (4): 329-340).

Using the above method, 11 SNPs were transformed into the original transcript 98P4B6 v. 1, positions 46 (A / G), 179 (C / T), 180 (A / G), 269 (A / G), 40
4 (G / T), 985 (C / T), 1170 (T / C), 1497 (A / G), 1746
(T / G), 2046 (T / G) and 2103 (T / C). Transcripts or proteins with alternative alleles can be found in variant 98P4 as shown in FIG. 10a.
B6 v. 9v. 19 people are named. FIG. 11 shows a schematic alignment of protein variants, corresponding to nucleotide variants. v. Nucleotide sequence variants encoding the same amino acid sequence as 1 are not shown in FIG. Although shown here separately, these alleles of the SNP are in different combinations (haplotypes) and any one of the transcript variants (eg 98P4B6 v.5 (including the site of the SNP)) In addition, v.
There were SNPs in other transcript variants in regions that were not shared with 1. For example, v. There were 14 SNPs in one fifth intron. This intron is a variant v. 2,
v. 6 and v. 8 part. These SNPs are shown in FIG. 10c and are listed as follows (numbers for v.8): 1760 (G / A), 1818 (G /
T), 1870 (C / T), 2612 (T / C), 2926 (T / A), 4241 (T /
A), 4337 (A / G), 4338 (A / C), 4501 (A / G), 4506 (C /
T), 5434 (C / A), 5434 (C / G), 5434 (C / T) and 5589 (
G / T). FIG. 10b shows transcript variants v. Shows SNPs in 7 distinct regions: 195
6 (A / C), 1987 (T / A), 2010 (G / C), 2010 (G / T) and 2
059 (G / A) (numbers correspond to the nucleotide sequence of v.7). .

(Example 7: Production of recombinant 98P4B6 in prokaryotic systems)
To express recombinant 98P4B6 and 98P4B6 variants in prokaryotic cells, the full-length or partial length 98P4B6 and 98P4B6 variant cDNA sequences are cloned into any one of a variety of expression vectors known in the art. obtain. 98P
One or more of the following regions of 4B6 are expressed in these constructs: full-length sequences present in FIGS. 2 and 3, or any 8, 9, 10 from 98P4B6, variants or analogs thereof 11, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30 or more consecutive amino acids.

(A. In vitro transcription and translation constructs)
pCRII: To generate 98P4B6 sense and antisense RNA probes for RNA in situ studies, the pCRII construct (Invitrogen, Ca
rlsbad CA) (which encodes either the entire 98P4B6 cDNA or a fragment). The pCRII vector has an Sp6 promoter and a T7 promoter flanking the insert and drives transcription of 98P4B6 RNA for use as a probe in RNA in situ hybridization experiments. These probes are used to analyze cellular and tissue expression of 98P4B6 at the RNA level. A transcribed 98 representing the cDNA amino acid coding region of the 98P4B6 gene
P4B6 RNA, a TnT ^™ Coupler for synthesizing 98P4B6 protein
d Reticullyate System (Promega, Corp., Ma
used in in vitro translation systems such as dison, WI).

(B. Bacterial construct)
pGEX construct: This 9 to produce recombinant 98P4B6 protein, which is fused to glutathione S-transferase (GST) protein in bacteria.
All or part of the 8P4B6 cDNA protein coding sequence is obtained from the pGEX family of GST-fusion vectors (Amersham Pharmacia Biotech, Pis).
cataway, NJ). These constructs allow for controlled expression of recombinant 98P4B6 protein sequences with GST fused at the amino terminus and six histidine epitopes at the carboxyl terminus (6 × His). This GST and 6
The xHis tag allows for the purification of recombinant fusion proteins from bacteria derived using an appropriate affinity matrix and allows recognition of the fusion protein using anti-GST and anti-His antibodies. The 6 × His tag is created, for example, by adding six histidine codons to the cloning primer at the 3 ′ end of the open reading frame (ORF). Protein cleavage site (eg, PreSci in pGEX-6P-1
ssion ^TM recognition site) may be used to allow cleavage of the GST tag from 98P4B6-related proteins. The ampicillin resistance gene and the pBR322 origin are E. coli. Allows selection and maintenance of the pGEX plasmid in E. coli.

pMAL construct: In order to produce a recombinant 98P4B6 protein fused to maltose binding protein (MBP) in bacteria, all or part of this 98P4B6 cDNA protein coding sequence is expressed in pMAL-c2X and pMAL-p2X vectors (New England). Fusion to the MBP gene by cloning into Biolabs, Beverly, MA). These constructs were recombinant 98P4B with MBP fused at the amino terminus and a 6 × His epitope tag at the carboxyl terminus.
Allows controlled expression of 6 protein sequences. This MBP and 6xHis tag
It allows the purification of recombinant proteins from bacteria derived with an appropriate affinity matrix and allows the recognition of fusion proteins using anti-MBP and anti-His antibodies. The 6 × His epitope tag is created by the addition of 6 histidine codons to the 3 ′ cloning primer. The factor Xa recognition site is pMAL from 98P4B6
Allows tag disconnection. The pMAL-c2X and pMAL-p2X vectors are each optimized to express the recombinant protein in the cytoplasm or periplasm. Periplasmic expression increases the folding of proteins with disulfide bonds.

pET construct: To express 98P4B6 in bacterial cells, 98P4B6c
All or part of the DNA protein coding sequence is a vector of the pET family (Nov
agen, Madison, WI). These vectors provide fusion to proteins that increase solubility (eg, NusA and thioredoxin (Trx)), and epitope tags (eg, 6 × His and S-Tag ^™ ) to aid in purification and detection of recombinant proteins. Recombinant 98P4B in bacteria with and without
Allows tightly controlled expression of 6 proteins. For example, if the construct is pET Nus
A fusion system 43.1 was created, so that the region of 98P4B6 protein is N
Expressed as an amino terminal fusion to usA.

(C. Yeast construct)
pESC construct: Yeast species Sacc for the study of recombinant protein production and function
In order to express 98P4B6 in halomyces cerevisiae,
All or part of this 98P4B6 cDNA protein coding sequence is transferred to the pESC family of vectors, each of which contains one of four selectable markers, HIS3, TRP1, LEU2, and URA3 (Stratagene, La Jolla, CA).
) In. These vectors, Flag ^TM or M in the same yeast cells
Allows controlled expression of up to two different genes or cloned sequences from the same plasmid, including any of the yc epitope tags. This system is 98P4B6
It is useful for confirming the protein-protein interaction. Furthermore, expression in yeast results in post-translational modifications (eg, glycosylation and phosphorylation) similar to those found when expressed in eukaryotic cells.

pESP construct: 98P4B in the yeast species Saccharomyces pombe
In order to express 6, all or part of this 98P4B6 cDNA protein coding sequence is cloned into a vector of the pESP family. These vectors are either G-terminal or G-terminal to aid the purification of recombinant proteins.
Allows controlled high level expression of 98P4B6 protein sequences fused to ST. The Flag ^™ epitope tag allows detection of recombinant protein using anti-Flag ^™ antibody.

(Example 8: Production of recombinant 98P4B6 in higher eukaryotic systems)
(A. Mammalian construct)
This 98P4B6cD was used to express recombinant 98P4B6 in eukaryotic cells.
The full length or partial length of the NA sequence can be cloned into any one of a variety of expression vectors known in the art. One or more of the following regions of 98P4B6 are expressed in these constructs: amino acids 1-255; or 98P4B6 v. 1-v. 11, any 10, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 2 from 11
1, 2, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive amino acids;
Amino acids 1-1266 or 98P4B6 v. 12 and v. Arbitrary 8, 9 from 13
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30 or more consecutive amino acids.

These constructs were transfected into any one of a wide variety of mammalian cells such as 293T cells. Transfected 293T cell lysates were probed with the anti-98P4B6 polyclonal serum described herein.

pcDNA4 / HisMax construct: In order to express 98P4B6 in mammalian cells, this 98P4B6 ORF of 98P4B6, or a part thereof, was transformed into pcDNA4 / H
Cloned into isMax Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter and SP16 translational enhancer. This recombinant protein has Xpress ^™ and six histidine (6 × His) epitopes fused to the amino terminus. This pcDNA4 / HisMax vector also has an SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen,
Includes bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to increase RNA stability. The zeocin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColE1 origin are derived from E. coli. coli
Allows selection and maintenance of plasmids in

pcDNA3.1 / MycHis construct: This 98P of 98P4B6 with a consensus Kozak translation initiation site to express 98P4B6 in mammalian cells
4B6ORF or a part thereof was used as pcDNA3.1 / MycHis Version A
Cloned into (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. This recombinant protein has a myc epitope and a 6 × His epitope fused to its carboxyl terminus. The pcDNA3.1 / MycHis vector is also a bovine growth hormone (BGH) polyadenylation signal to increase mRNA stability along with SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen. And a transcription termination sequence. A neomycin resistance gene may be used. because,
The neomycin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. This is because it enables selection and maintenance of the plasmid in E. coli.

pcDNA3.1 / CT-GFP-TOPO construct: 98P4B in mammalian cells
To allow detection of recombinant protein using 6 and fluorescence, the 98P4B6 ORF with a consensus Kozak translation start site or a part thereof is pcDNA
3. Clone into 1 / CT-GFP-TOPO (Invitrogen, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant protein has a green fluorescent protein (GFP) fused to the carboxyl terminus that facilitates non-invasive in vivo detection and cell biology studies. pcDNA3.1
The / CT-GFP-TOPO vector is also a bovine growth hormone (BGH) polyadenylation to increase mRNA stability, along with SV40 origin for episomal replication and simple vector rescue in cell lines expressing large T antigen Contains signal and transcription termination sequences. The neomycin resistance gene allows selection of mammalian cells that express the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli. Allows selection and maintenance of plasmids in E. coli.

98P4B6 into 293T cells. GFP. Transfection of pcDNA3.1 was performed as shown in FIG. 17 and FIG. Results are from Western blot analysis (
FIG. 17) shows strong expression of the fusion protein by flow cytometry (FIG. 18A) and fluorescence microscopy (FIG. 18B).

Additional constructs containing amino terminal GFP fusions are made in pcDNA3.1 / NT-GP-TOPO spanning the full length of the 98P4B6 protein.

PAPtag: 98P4B6ORF, or a part thereof, pAPtag-5 (GenH
unter Corp. Nashville, TN). This construct produces a carboxyl-terminal alkaline phosphatase fusion of the 98P4B6 protein, which, on the other hand, fuses an IgG kappa signal sequence to the amino terminus. A construct is also made in which an alkaline phosphatase with an amino terminal IgG kappa signal sequence is fused to the amino terminus of the 98P4B6 protein. The resulting recombinant 98P4B6 protein is optimized for secretion into the medium of transfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with the 98P4B6 protein. Protein expression is driven from the CMV promoter and the recombinant protein also contains a myc and 6 × His epitope fused at the carboxyl terminus to facilitate detection and purification. The zeocin resistance gene present in the vector allows selection of mammalian cells expressing the recombinant protein, and the ampicillin resistance gene is E. coli. Allows selection of plasmids in E. coli.

pTag5: 98P4B6 v. One extracellular domain is cloned into pTag-5. This vector is similar to pAPtag but does not contain an alkaline phosphatase fusion. This construct produces a 98P4B6 protein with an amino-terminal IgGκ signal sequence and a carboxyl-terminal myc and 6 × His epitope tag that facilitates detection and affinity purification. The resulting recombinant 98P4B6 protein
Proteins such as ligands or receptors that were optimized for secretion into the medium of transfected mammalian cells and used as immunogens or ligands to interact with the 98P4B6 protein were identified. Protein expression is driven from the CMV promoter. The Zeocin resistance gene present in the vector allows selection of mammalian cells expressing the protein, and the ampicillin resistance gene is E. coli. coli
Allows selection of the plasmid in.

PsecFc: 98P4B6 ORF, or part thereof, is also cloned into psecFc. This psecFc vector was transformed into human immunoglobulin G1 (IgG) Fc (hinge region, CH2 region, CH3 region) and pSecTag2 (Invitrogen, Ca
assembly) by cloning into Lifonia). This construct is
An IgG1 Fc fusion is generated at the carboxy terminus of the 98P4B6 protein while an IgGK signal sequence is fused to the N-terminus. Utilizing mouse IgG1 Fc region 9
An 8P4B6 fusion is also used. The resulting recombinant 98P4B6 protein is optimized for secretion into the medium of transfected mammalian cells and used as an immunogen or to identify a protein such as a ligand or receptor that interacts with the 98P4B6 protein obtain. Protein expression is driven from the CMV promoter.
The hygromycin resistance gene present in the vector allows selection of mammalian cells expressing the recombinant protein, and the ampicillin resistance gene is E. coli. Allows selection of plasmids in E. coli.

pSRα construct: To constitutively create a mammalian cell line expressing 98P4B6, the 98P4B6 ORF of 98P4B6 or a portion thereof is cloned into the pSRα construct. Amphitrophic and ecotrophic retroviruses, respectively,
Transfection of pSRα construct into 293T-10A1 packaging strain, or 293 of pSRα and helper plasmids (including deleted packaging sequences)
Produced by co-transfection into cells. This retrovirus is used to infect various mammalian cell lines, resulting in the incorporation of the cloned gene 98P4B6 into the host cell line. Protein expression is driven from a long terminal repeat (LTR). The neomycin resistance gene present in the vector allows selection of mammalian cells expressing the protein, and the ampicillin resistance gene and the ColE1 origin are E. coli.
Allows selection and maintenance of the plasmid in E. coli. This retroviral vector was then used for infection and production of various cell lines using, for example, PC3 cells, NIH 3T3 cells, TsuPr1 cells, 293 cells or rat-1 cells.

Additional pSRa constructs were made. These fuse an epitope tag, such as the FLAG ^™ tag, to the carboxy terminus of the 98P4B6 sequence to allow detection using anti-Flag antibodies. For example, the FLAG ^TM sequence 5 'ga tac aag ga t gac
gac gata aag 3 ′ (SEQ ID NO: 60) is added to the cloning vector at the 3 ′ end of its ORF. Additional pSRα constructs are made to generate both the amino terminal GFP and carboxy terminal GFP of the full length 98P4B6 protein and the myc / 6 × His fusion protein.

Additional viral vectors: Additional constructs were constructed for virus-mediated delivery and expression of 98P4B6. High viral titers resulting in high level expression of 98P4B6 are achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors. The 98P4B6 coding sequence or fragment thereof is amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and viral packaging are performed according to the manufacturer's instructions to produce an adenoviral vector. Alternatively, the 98P4B6 coding sequence or fragment thereof is cloned into an HSV-1 vector (Imgenex) to generate a herpesvirus vector. Thereafter, the viral vector was transformed into PC3 cells, NIH 3T3 cells,
Used for infection of various cell lines such as 293 cells or rat-1 cells.

Regulated expression system: To control the expression of 98P4B6 in mammalian cells, 98
The coding sequence of P4B6 or a part thereof is designated as T-Rex System (Invitrolog
en), GeneSwitch System (Invitrogen), and tig
htly-regulated Ecdysone System (Stratagen
Cloning into a regulated mammalian expression system such as e). These systems are recombinant 9
Allows the study of time-dependent and concentration-dependent effects of 8P4B6. These vectors are then used to control the expression of 98P4B6 in various cell lines such as PC3 cells, NIH 3T3 cells, 293 cells, or rat-1 cells.

(B. Baculovirus expression system)
To produce recombinant 98P4B6 protein in a baculovirus expression system, 9
The 8P4B6 ORF, or a part thereof, is transferred to the baculovirus transfer vector pBlu
eBac 4.5 (Invitrogen) (this provides a His tag at the N-terminus)
Cloning into. Specifically, pBlueBac-98P4B6 is obtained using SF9 (Spodo) using the helper plasmid pBac-N-Blue (Invitrogen).
ptera frugiperda) are co-transfected into insect cells to produce recombinant baculovirus (see Invitrogen's instruction manual for details). The baculovirus is then collected from the cell supernatant and purified by plaque assay.

Recombinant 98P4B6 protein is then converted to high using purified baculovirus.
Produced by infection of hFive insect cells (Invitrogen). Recombinant 98P4
B6 protein can be detected using anti-98P4B6 or anti-His tag antibodies. 98P
Purify 4B6 protein and in various cell-based assays or 98P
It can be used as an immunogen to generate polyclonal and monoclonal antibodies specific for 4B6.

Example 9 Antigenic profile and secondary structure
5 (A to E), FIG. 6 (A to E), FIG. 7 (A to E), FIG. 8 (A to E), and FIG.
E) is the five amino acid profiles of 98P4B6 variants 1, 2, 5-7 (each assessment is
ExPassy molecular biology server world-wide website (.expasy.ch /
cgi-bin / protscale. pl) is available by accessing the Proscale website located at pl).

These profiles: FIG. 5, hydrophilicity, (Hopp TP, Woods KR
1981. Proc. Natl. Acad. Sci. U. S. A. 78: 3824-3
828); FIG. 6, Hydropathy, (Kyte J., Doolittle RF, 1
982. J. et al. Mol. Biol. 157: 105-132); FIG. 7, percent accessible residues, (Janin J., 1979 Nature 277: 491-492); FIG.
, Average flexibility, (Bhaskaran R., and Ponuswamy P.K.1
988. Int. J. et al. Pept. Protein Res. 32: FIG. 9, β-turn (Deleage, G., Roux B. 1987 Protein En
geneering 1: 289-294); and optionally, for example, Prot
Other profiles available in the art, such as those on the Scale website, were used to identify the antigenic region of the 98P4B6 variant protein. Each of the above amino acid profiles of 98P4B6 were generated for analysis using the following ProtScale parameters: 1) 9 window size; 2) 100% weight of window edge compared to window center; and 3) 0 Amino acid profile value normalized to be between 1.

The hydrophobic profile (FIG. 5), hydropathy profile (FIG. 6) and percent accessible residue profile (FIG. 7) can be used to generate hydrophilic amino acids (ie, hydropathy profile and percent accessible residue profile). The stretch with a value greater than 0.5 and a hydropathic profile with a value less than 0.5 was determined. Such regions can be exposed to an aqueous environment, can be present on the protein surface, and are therefore available for immune recognition (eg, by antibodies).

The average flexibility profile (Fig. 8) and β-turn profile (Fig. 9) are secondary structures (Fig.
For example, determine stretches of amino acids that are not constrained to β-sheets and α-helices (ie, values greater than 0.5 in β-turn profiles and average flexibility profiles). Such regions are also likely to be exposed parts on the protein,
Thus, it can be used for immune recognition (eg, by antibodies).

For example, shown by the profiles shown in FIGS. 5 (AE), 6 (AE), 7 (AE), 8 (AE), and / or 9 (AE). The antigenic sequence of the 98P4B6 variant protein is used to prepare an immunogen (either a peptide or a nucleic acid encoding the peptide) to produce therapeutic and diagnostic anti-98P4B6 antibodies. The immunogens are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1
5, 16, 17, 18, 19, 20, 21, 22, 23, 24, 2
2, 30, 35, 40, 45, 50, or more than 50 consecutive, FIG.
And any amino acid from the 98P4B6 protein variant listed in 3 or a corresponding nucleic acid encoding it. Among them, the amino acid profile is shown in FIG.
It is identical to the same variant sequence as the variant shown in FIG. In particular, the peptide immunogens of the present invention may comprise: any integer increment of peptides from at least 5 of FIG. 2, including amino acid positions having a value greater than 0.5 in the hydrophilic profile of FIG. Region; a peptide region of any integer increment of amino acids from at least five of FIGS. 2 and 3, including amino acid positions having a value of less than 0.5 in the hydropathic profile of FIG. 6; accessible residues of FIG. A peptide region of amino acids in any integer increment from at least 5 of FIGS. 2 and 3, including amino acid positions having a value greater than 0.5 in the percent profile; 0.5 in the average flexibility profile of FIG. A peptide region of amino acids in any integer increments from at least five of FIGS. 2 and 3, comprising amino acid positions having a value greater than In β- turn profile of beauty Figure 9 includes an amino acid position having a value greater than 0.5,
A peptide region of amino acids in any integer increment from at least 5 of FIG. The peptide immunogens of the invention can also include a nucleic acid encoding any of the above.

All of the immunogens, peptides or nucleic acids of the invention can be implemented in human unit dosage form or can be contained by a composition comprising pharmaceutical excipients compatible with human physiology.

The secondary structure of 98P4B6 protein variants 1, 2, 5-7 (ie, the presence and location of putative alpha helices, extended strands, and random coils) is HNN-Hierar.
The Chicural Neural Network method (Guermeur, 1997, http)
p: // pbil. ibcp. fr / cgi-bin / npsa_automat. pl
? page = npsa_nn. html) (estimated from the primary amino acid sequence using the ExPassy molecular biology server (accessed from the World Wide Web URL: expasy.ch/tools/)). This analysis shows that 98P4B6 variant 1 is 54.4
It is composed of 1% α-helix, 12.33% extended strand, and 33.26% random coil (FIG. 13A). Variant 2 is 17.78% alpha helix, 6.6
It is composed of 7% extended strands and 75.56% random coils (FIG. 13).
B). Variant 5 has 51.55% alpha helix, 13.13% extended strand, and 35.
It shows that it is composed of 52% random coils (FIG. 13C). Variant 6 is 54.4
It is shown to be composed of 9% α-helix, 11.84% extended strand, and 33.67% random coil (FIG. 13D). Variant 7 is 48.26% alpha helix, 15.
It is composed of 28% elongated strands and 36.46% random coils (FIG. 1).
3E).

Analysis for the potential presence of the transmembrane domain in the 98P4B6 variant protein
xPassy Molecular Biology Server (World Wide Web. expasy.ch/tools
This was performed using various transmembrane estimation algorithms accessed from (located at /).
Illustrated in FIGS. 13F and 13G are the results of analysis of variant 1 using the TMpred program, indicating the presence and location of six transmembrane domains (FIG. 13F)
Results of analysis using the MM program, showing the presence and location of five transmembrane domains (FIG. 13G). Illustrated in FIGS. 13H and 13I are results of analysis of variant 2 using the TMpred program, indicating the presence and location of one transmembrane domain (
FIG. 13H), results of analysis using the TMHMM program, showing the absence of a transmembrane domain (FIG. 13I). Illustrated in FIGS. 13J and 13K is TMpred
Results of analysis of variant 5 using the program, showing the presence and location of six transmembrane domains (FIG. 13J), results of analysis using the TMHMM program, presence and location of four transmembrane domains (FIG. 13K). Illustrated in FIGS. 13L and 13M are the results of analysis of variant 6 using the TMpred program, showing the presence and location of six transmembrane domains (FIG. 13L), and the results of the analysis using the TMHMM program. , Indicating the presence and location of six transmembrane domains (FIG. 13M). Illustrated in FIGS. 13N and 13O are the results of analysis of variant 7 using the TMpred program, showing the presence and location of six transmembrane domains (FIG. 13N), and the results of the analysis using the TMHMM program. Showing the presence and location of four transmembrane domains (FIG. 13O
). The results of each program, ie the amino acids encoding the transmembrane domain, are summarized in Table VI.

(Example 10: Production of 98P4B6 polyclonal antibody)
Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immune factor and (if desired) an adjuvant. Typically, the immune factor and / or adjuvant is injected into the mammal by multiple subcutaneous or intraperitoneal injections. In addition to immunizing with the full-length 98P4B6 protein variant, in the design of an immunogen with characteristics that are antigenic and available for recognition by the immune system of the immunized host based on amino acid sequence analysis, a computer algorithm Are used (see the example entitled “Antigenic profile and secondary structure”). Such areas are
It is presumed to be hydrophobic, flexible, β-turn conformation and exposed on the surface of the protein (eg amino acid profile showing such regions of 98P4B6 protein variants) 5 (AE), FIG. 6 (A and E), FIG.
(See (AE), FIG. 8 (AE), or FIG. 9 (AE)).

For example, a bacterial recombinant fusion protein or bacterial recombinant fusion peptide comprising the hydrophobic, flexible, β-turn region of a 98P4B6 protein variant can be expressed as a polyclonal antibody or monoclonal as described in Example 11 in New Zealand white rabbits. Used as an antigen to generate antibodies. For example, in 98P4B6 variant 1, such regions include amino acids 153-165, amino acids 240-260, and amino acid 3
45-358 may be mentioned, but not limited thereto. In a sequence unique to variant 2, such a region includes, but is not limited to, amino acids 26-38. In a sequence unique to variant 5, such a region includes, but is not limited to, amino acids 400-410. In a sequence unique to variant 6, such a region includes, but is not limited to, amino acids 455-490. In the sequence unique to variant 7, such regions include, but are not limited to, amino acids 451-465 and amino acids 472-498. It is useful to conjugate the immune factor to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. In one embodiment, a peptide encoding amino acids 153-165 of 98P4B6 protein variant 1 is conjugated to KLH and used to immunize rabbits. Alternatively, the immune factor can comprise all or part of a 98P4B6 variant protein, analog or fusion protein thereof. For example, 98P4B6 variant 1
The amino acid sequence is transferred to any one of a variety of fusion protein partners well known in the art (eg, glutathione-S-transferase (GST) tagged fusion protein and HIS tagged fusion protein) using recombinant DNA technology. Can be fused. In another embodiment, amino acids 2-204 of 98P4B6 variant 1 were fused, expressed, purified, and used to immunize rabbits using recombinant techniques and pGEX expression vectors. Such fusion proteins are purified from bacteria derived using an appropriate affinity matrix.

Other recombinant bacterial fusion proteins that can be used include maltose binding protein, La
cZ, thioredoxin, NusA, or immunoglobulin constant region (see section entitled “Production of 98P4B6 in Prokaryotic Systems”, and Current Proto
cols In Molecular Biology, Volume 2, Unit
16, Frederick M.M. Ausubul et al., 1995; Linsley, P. et al.
S. Brady, W .; Urnes, M .; Grosmaire, L .; , Damle,
N. , And Ledbetter, L .; (1991) J. MoI. Exp. Med. 174,56
1-566).

In addition to bacterial-derived fusion proteins, protein antigens expressed by mammals are also
use. These antigens are expressed from mammalian expression vectors (eg, Tag5 and Fc fusion vectors) (see section entitled “Production of Recombinant 98P4B6 in Eukaryotic Systems”). These antigens retain post-translational modifications (eg, glycosylation) found in native proteins. In one embodiment, amino acids 324-359 of variant 1 encoding the extracellular loop between the transmembrane domains are cloned into a Tag5 mammalian secretion vector. The recombinant protein is purified by metal chelate chromatography from tissue culture supernatants of 293T cells that stably express the recombinant vector. The purified Tag5 98P4B6 protein is then used as an immunogen.

During this immunization protocol, it is useful to mix or emulsify the antigen in an adjuvant that enhances the host animal's immune response. Examples of adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate).

In a typical protocol, rabbits are first immunized subcutaneously with up to 200 μg (typically 100-200 μg) of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Thereafter, rabbits can be up to 200 μg in incomplete Freund's adjuvant (IFA) (typically 100-200 μg).
Are injected subcutaneously every 2 weeks. Approximately 7-10 days after each immunization, test bleeds are collected and used to monitor antiserum titers by ELISA.

To test the reactivity and specificity of immune sera (eg, rabbit sera induced by immunization with Tag5 98P4B6 variant 1 protein), full length 98P4B6 variant 1 c
The DNA is cloned into the pCDNA3.1 myc-his expression vector (Invitrogen) (see the example entitled “Production of recombinant 98P4B6 in eukaryotic systems”). After transfection of the construct into 293T cells, the cell lysate was purified from anti-98P4B6 serum and anti-His antibody (Santa Cruz Biotech).
norogies, Santa Cruz, CA) and specific reactivity to denatured 98P4B6 protein is determined using Western blot techniques. 293T using polyclonal antibodies raised against GST-fusion proteins and peptides
Detection of 98P4B6 variant 1 protein expressed in is shown in FIGS. 17B and 17C, respectively. In addition, the immune serum was tested by fluorescence microscopy, flow cytometry, and immunoprecipitation of 293T cells and other recombinant 98P4B6 expressing cells,
Determine specific recognition of native protein. Western blots, immunoprecipitation, fluorescence microscopy, and flow cytometry techniques are also performed using cells that endogenously express 98P4B6 to test reactivity and specificity.

Fusion partner sequences by passing antisera from rabbits immunized with 98P4B6 fusion proteins (eg, GST and MBP fusion proteins) through an affinity column containing the fusion partner alone or in the context of an irrelevant fusion protein. Purify by removing antibodies that are reactive against. For example, antisera derived from GST-98P4B6 variant 1 fusion protein can be purified using an Affigel matrix (BioRad,
Hercules, Calif. The protein is first purified by passing it through a column of GST protein covalently bound to). The antiserum is then purified by passing through a column composed of MBP-98P4B6 fusion protein covalently linked to an Affigel matrix. The serum is then further purified by protein G affinity chromatography to isolate the IgG fraction. Column matrix composed of sera from other His-tagged antigen and peptide immunized rabbits, as well as fusion partner-removed sera, from the original protein immunogen or free peptide (eg, anti-peptide polyclonal antibody used in FIG. 17C) Affinity purification by passing through.

(Example 11: Production of 98P4B6 monoclonal antibody (mAb))
In one embodiment, therapeutic mAbs against 98P4B6 variants are variants that are specific for each variant protein or that disrupt or modulate the biological function of the 98P4B6 variant (eg, reciprocal interactions with ligands and binding partners). Including mAbs that react with epitopes specific for a common sequence (including those that disrupt action). Immunogens for the production of such mAbs include the entire 98P4B6 variant, the region of the 98P4B6 protein variant that is predicted to be antigenic by computer analysis of the amino acid sequence (eg, FIG.
E), FIG. 6 (AE), FIG. 7 (AE), FIG. 8 (AE), or FIG. 9 (AE), and the examples entitled “Antigenic Profile” Is an immunogen designed to encode or contain. Immunogens include peptides, recombinant bacterial proteins, and Tag5 proteins and mammalian proteins that expressed human and mouse IgG Fc fusion proteins. further. Cells engineered to express high levels of each 98P4B6 variant (eg, 293T-98P4B6 variant 1 or 30
0.19-98P4B6 variant 1 mouse PreB cells) is used to immunize mice.

To generate mAbs against 98P4B6 variants, mice were first injected intraperitoneally (IP) with 10-50 μg of protein immunogen or 10 ⁷ 98P4B6 expressing cells, typically mixed in complete Freund's adjuvant. did. Mice were then IP immunized every 2-4 weeks, typically with 10-50 μg of protein immunogen or 10 ⁷ cells mixed in incomplete Freund's adjuvant. Alternatively, MPL-TDM adjuvant is used for immunization. In addition to the protein and cell-based immunization strategies described above, DNA-based immunization protocols are used. In this protocol, a mammalian expression vector encoding a 98P4B6 variant sequence is used to immunize mice by direct injection of plasmid DNA. For example, amino acids 31-347 are cloned into a Tag5 mammalian secretion vector, and then the recombinant vector is used as an immunogen. In another example
The same amino acid was cloned into an Fc-fusion secretion vector,
The 98P4B6 variant 1 sequence is fused at the amino terminus to an IgK leader sequence and at the carboxy terminus to the coding sequence of a human or mouse IgG Fc region. The recombinant vector is then used as an immunogen. The plasmid immunization protocol is used in combination with purified protein expressed from the same vector and cells expressing the respective 98P4B6 variant.

During the immunization protocol, test bleeds are made 7-10 days after injection to monitor the titer and specificity of the immune response. Once the appropriate reactivity and specificity is obtained, as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytometry analysis, fusion and hybridomas are established by established procedures well known in the art. Generation (see, eg, Harlow and Lane, 1998).

In one embodiment for generating 98P4B6 monoclonal antibodies, amino acids 31
Tag5-98P4B6 variant 1 antigen encoding ~ 347 was expressed and then purified from stably transfected 293T cells. BalbC mice are first immunized intraperitoneally with 25 μg of 98P4B6 variant 1 protein mixed in complete Freund's adjuvant. Mice were then immunized 3 times every 2 weeks with 25 μg of antigen mixed in incomplete Freund's adjuvant. ELISA using Tag5 antigen determines the titer of serum from immunized mice. Serum reactivity and specificity for full length 98P4B6 variant 1 protein is monitored by Western blotting, immunoprecipitation and flow cytometry using 293 cells transfected with an expression vector encoding 98P4B6 variant 1 cDNA (eg, "Recombinant 98P in eukaryotic systems
See the section entitled “Generating 4B6” and FIG. 20). Other recombinant 98P4B6 variant 1 expressing cells or cells that endogenously express 98P4B6 variant 1 are also used. Mice that showed the strongest reactivity were rested and given a final injection of Tag5 antigen in PBS, then
Slaughtered 4 days later. Spleens from sacrificed mice are harvested and fused to SPO / 2 myeloma cells according to standard procedures (Harlow and Lane, 1998). Supernatants from HAT selected growth wells were analyzed by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy,
And screening by flow cytometry to identify 98P4B6-specific antibody purified clones.

In order to generate monoclonal antibodies specific for each 98P4B6 variant protein, the immunogen is designed to encode a sequence that is unique to each variant. In one embodiment, a GST fusion antigen encoding the full length sequence of 98P4B6 variant 2 (AA1-45) is generated, purified, and used as an immunogen to induce a monoclonal antibody specific for 98P4B6 variant 2. used. In another embodiment, an antigenic peptide composed of amino acids 400-410 of 98P4B6 variant 5 is bound to KLH and used as an immunogen. In another embodiment, an antigenic peptide composed of amino acids 455-490 of 98P4B6 variant 6 is used as an immunogen to induce variant 6 specific monoclonal antibodies. In another embodiment, an antigenic peptide composed of amino acids 472-498 of variant 7 is bound to KLH and used as an immunogen to generate variant 7-specific monoclonal antibodies. The hybridoma supernatant is then screened with the respective antigen, then further cells expressing specific variants are screened, and cells expressing other variants are cross-screened to produce variant-specific monoclonals. Induces antibodies.

The binding affinity of the 98P4B6 monoclonal antibody is determined using standard techniques. The affinity measurement quantifies the strength of the antibody to epitope binding, and using that affinity measurement, which 98P4B6 monoclonal antibody is preferred for diagnostic or therapeutic applications as recognized by one skilled in the art. Assist in prescribing. The BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity. This BIAcore system uses surface plasmon resonance (SPR, Welford).
K. 1991, Opt. Quant. Elect. 23: 1; Morton and Mys
zka, 1998, Methods in Enzymology 295: 268) to monitor biomolecular interactions in real time. BIAcore analysis conveniently generates association rate constants, dissociation rate constants, equilibrium dissociation constants, and affinity constants.

Example 12: HLA class I binding assay and HLA class II binding assay
HLA class I and HLA class II binding assays using purified HLA molecules can be performed using the disclosed protocols (eg, PCT Publication WO94 / 201527 and WO
94/03205; Sidney et al., Current Protocols in Im
munology 18.3.1 (1998); Sidney et al., J. MoI. Immunol.
154: 247 (1995); Sette et al., Mol. Immunol. 31: 813 (
1994)). Briefly, as described, purified MHC molecules (5-500 nM) were converted to various unlabeled peptide inhibitors and 1-10 nM ¹²⁵
Incubate with radiolabeled probe peptide. After incubation, MH
The C-peptide complex is separated from the free peptide by gel filtration and the fraction of bound peptide is measured. Typically, in preliminary experiments, each MHC preparation is titrated in the presence of a certain amount of radiolabeled peptide and the HLA molecules required to bind 10-20% of the total radioactivity. Determine the concentration of. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.

Under these conditions [label] <[HLA] and IC ₅₀ ≧ [HLA], the measured IC ₅₀ value is a reasonable approximation of the true _KD value. Peptide inhibitors are typically tested at concentrations ranging from 120 μg / ml to 1.2 ng / ml and are tested in 2 to 4 completely independent experiments. To allow comparison of data obtained in various experiments, the relative number of bonds is calculated for each peptide. This calculation, the IC ₅₀ of a positive control for inhibition, _(typically unlabeled versions of the radiolabeled probe peptide) IC 50 of each peptide was tested by dividing by. Relative binding values are tabulated for database purposes and for comparison between experiments. These values can then be converted back to IC ₅₀ nM values. This conversion is by dividing the positive control IC ₅₀ nM for inhibition by the relative binding of the peptide of interest. This data aggregation method is accurate and consistent for comparison of peptides tested on different days or peptides tested with different lots of purified MHC.

Binding assays as outlined above can be used to analyze HLA supermotif and / or HLA motif-bearing peptides (see Table IV).

(Example 13: Identification of CTL candidate epitope with HLA supermotif and CTL candidate epitope with HLA motif)
The HLA vaccine composition of the present invention may comprise multiple epitopes. The plurality of epitopes can include multiple HLA supermotifs or HLA motifs to achieve a broad population range. This example demonstrates the identification and confirmation of supermotif and motif-bearing epitopes for inclusion in such vaccine compositions. Population range calculations are performed using the following strategy.

(Computer search and algorithm for identification of supermotif and / or motif-bearing epitopes)
Examples entitled “Antigenic Profile” and Tables VIII-XXI and XXII-
The search performed to identify motif-bearing peptide sequences in XLIX uses the protein sequence data from the 98P4B6 gene product shown in FIGS. 2 and 3 and the specific search peptide used to generate the table Are listed in Table VII.

A computer search for epitopes carrying an HLA class I super motif or HLA class I motif or HLA class II super motif or HLA class II motif is performed as follows. All translated 98P4B6 protein sequences are analyzed using a string search software program to identify peptide sequences that may contain the appropriate HLA binding motif; Considering the supermotif disclosure, it is easily created according to information in the field. Furthermore, such calculations can be done in the head.

The identified A2, A3, and DR supermotif sequences are scored using a polynomial algorithm and these motifs bind to specific HLA-class I or HLA-class II molecules Guess the ability to do. These polynomial algorithms consider the effects of different amino acids at different positions. These polynomial algorithms show that the total affinity of peptide-HLA molecule interactions (ie ΔG) is
“ΔG” = a _1i × a _2i × a _3i . . . × a _ni
Based on the premise that can approximate as type linear polynomial function of the essentially where, a _ji is
A coefficient indicating the effect of the presence of a given amino acid (j) at a given position (i) along a peptide sequence of n amino acids. The critical assumption of this method is that the effects at each position are essentially independent of each other (ie, independent bonds of individual side chains). Residue j
Is present at position i in the peptide, regardless of the remaining sequence of the peptide,
Suppose that a certain amount j _i contributes to the free energy of binding of the peptide.

Specific algorithm coefficient derivation methods are described in Gulukota et al. Mol. Biol.
267: 1258-126, 1997 (Sidney et al., Human.
Immunol. 45: 79-93, 1996; and Southwood et al., J. MoI. Im
munol. 160: 3363-3373, 1998). Briefly, for all i positions, the anchor and non-anchor as well, calculate the geometric mean of the average relative binding (ARB) of all peptides carrying j, for the rest of the group, and j
Used as an estimate of _i . For multiple class II peptides, if multiple alignments are possible, only the highest scoring alignment is utilized according to an iterative procedure. To calculate the algorithm score for a given peptide in the test set, the ARB value corresponding to the sequence of that peptide is multiplied. If this product exceeds the selected threshold, the peptide is presumed to bind. Appropriate threshold values are selected as a function of the desired degree of stringency.

(Selection of HLA-A2 supertype cross-reactive peptide)
Protein sequences from 98P4B6 are scanned utilizing motif identification software to identify 8-mer, 9-mer, 10-mer, and 11-mer sequences that contain the HLA-A2 supermotif major anchor specificity. Typically, these sequences are then scored using the protocol described above, and peptides corresponding to sequences with positive scores are synthesized, and these in vitro purified HLA-A ^* 0201 molecules (HLA-A ^* 0201 is considered a prototype A2 supertype molecule).

These peptides are then combined with additional A2 supertype molecules (A ^* 0202, A ^*
0203, A ^* 0206, and A ^* 6802). Peptides that bind to at least three of the five A2 supertype alleles tested are typically considered A2 supertype cross-reactive conjugates. Preferred peptides are 3
Binds to one or more HLA-A2 supertype molecules with an affinity of 500 nM or less.

(Selection of epitope bearing HLA-A3 supermotif)
The 98P4B6 protein sequence scanned above is also tested for the presence of peptides with the HLA-A3 supermotif major anchor. A peptide corresponding to the HLA-A3 supermotif carrying sequence is then synthesized and into HLA-A ^* 0301 and HLA-A ^* 1101 molecules (molecules encoded by the two most prominent A3 supertype alleles) Test for binding. Then ≦ 500 nM, often ≦ 200 n
A peptide that binds to at least one of its two alleles with a binding affinity of M,
Five HLA-A tested, tested for binding cross-reactivity to other common A3 supertype alleles (eg, A ^* 3101, A ^* 3301 and A ^* 6801)
Molecules that can bind to at least three of the three supertype molecules are identified.

(Selection of epitope bearing HLA-B7 supermotif)
The 98P4B6 protein scanned above contains the HLA-B7 supermotif,
The presence of 8-mer, 9-mer, 10-mer, or 11-mer peptides is also analyzed. Corresponding peptides are synthesized and tested for binding to HLA-B ^* 0702 (the molecule encoded by the most common B7 supertype allele (ie, the prototype B7 supertype allele)). IC ₅₀ ≦ 500nM B
^* Peptides that bind 0702 are identified using standard methods. These peptides are then combined with other common B7 supertype molecules (eg, B ^* 3501, B ^* 5101).
, B ^* 5301 and B ^* 5401). Thereby, peptides that can bind to more than two of the five B7 supertype alleles to be tested are identified.

(Selection of A1 motif-bearing epitope and A24 motif-bearing epitope)
To further increase the population range, HLA-A1 and HLA-A24 epitopes can also be incorporated into the vaccine composition. Analysis of 98P4B6 protein can also be performed to identify HLA-A1 motif-containing sequences and HLA-A24 motif-containing sequences.

High affinity and / or cross-reactive binding epitopes carrying other motifs and / or supermotifs are identified using similar methodologies.

(Example 14: Confirmation of immunogenicity)
The cross-reactive candidate CTL A2 supermotif-bearing peptide identified as described herein is selected to confirm in vitro immunogenicity. Confirmation is performed using the following methodology.

(Target cell line for cell screening)
The HLA-A2.1 gene was generated by transfer to 721.221, an HLA-A, HLA-B, HLA-C null mutant human B lymphoblast cell line. 221A2.1
The cell line is used as a peptide loading target to measure the activity of HLA-A2.1 restricted CTL. This cell line is divided into antibiotics, sodium pyruvate, non-essential amino acids, and 1
Grow in RPMI-1640 medium supplemented with 0% (v / v) heat inactivated FCS. Cells expressing the antigen of interest, or transfectants containing a gene encoding the antigen of interest can be used as target cells to confirm the ability of peptide-specific CTL to recognize endogenous antigens.

(Primary CTL induction culture)
(Production of Dendritic Cells (DC)) PBMC is RPM containing 30 μg / ml of DNAse.
Thaw in I, complete medium (RPMI-1640 + 5% AB human serum, nonessential amino acids,
Wash twice with sodium pyruvate, L-glutamine and penicillin / streptomycin) and resuspend in this complete medium. The monocytes are placed in a 6 well plate at 10 × 10 ⁶
Purify by plating with PBMC / well. After 2 hours at 37 ° C., non-adherent cells are removed by gently shaking the plate and aspirating the supernatant. The wells are washed a total of 3 times with 3 ml RPMI to remove most of the non-adherent and loosely adherent cells. Then 50 ng / ml GM-CSF and 1,000 U / ml I
3 ml of complete medium containing L-4 is added to each well. On day 6, TNFα is added to DC at 75 ng / ml, and on day 7, the cells are used for CTL-induced culture.

Induction of CTL using DCs and peptides CD8 + T cells were isolated from Dynal magnetic beads (Dynabeads® M-450) and dechacha-be.
Isolate by positive selection using ad® reagent. Typically about 200
X10 ⁶ to 250 x 10 ⁶ PBMCs are processed to obtain 24 x 10 ⁶ CD8 ⁺ T cells (sufficient for 48-well plate culture). In short, PBM
C is thawed in RPMI containing 30 μg / ml DNAse and washed once with PBS containing 1% human AB serum and in PBS / 1% AB serum at a concentration of 20 × 10 ⁶ cells /
Resuspend in ml. The magnetic beads were washed 3 times with PBS / AB serum and the cells (140
μl beads / 20 × 10 ⁶ cells) and incubate for 1 hour at 4 ° C. with continuous mixing. The beads and cells are washed 4 times with PBS / AB serum,
Non-adherent cells were removed and 100 μl / ml detergent-bead®
Resuspend at 100 × 10 ⁶ cells / ml (based on original cell number) in PBS / AB serum containing reagents and 30 μg / ml DNAse. The mixture is incubated for 1 hour at room temperature with continued mixing. The beads are washed again with PBS / AB / DNAse and CD8 + T cells are collected. DCs were collected and centrifuged at 1300 rpm for 5-7 minutes, washed once with PBS containing 1% BSA, counted, and 3 μg / ml β ₂
In the presence of microglobulin at 20 ° C. for 4 hours, cell concentration of 1 × 10 ⁶ to 2 × 10 ⁶ / m
1 and pulse with 40 μg / ml peptide. Then, the DC is irradiated (4, 2
00 rad), washed once with medium and counted again.

(Induction culture setting) 0.25 ml of cytokine-producing DC (1 × 10 ⁵ cells / ml)
0.25 in each well of a 48-well plate in the presence of 10 ng / ml IL-7
Co-culture with ml CD8 + T cells (2 × 10 ⁶ cells / ml). The next day, recombinant human IL-10 was added at a final concentration of 10 ng / ml, and after 48 hours r human IL-2 was
Add at 0 IU / ml.

Restimulation of induced cultures using adherent cells pulsed with peptide After 7 and 14 days of primary induction, the cells are restimulated with adherent cells pulsed with peptide. Thaw the PBMC and wash twice with RPMI and DNAse. The cells are 5 × 10
Resuspend at ⁶ cells / ml and irradiate at approximately 4200 rad. PBMCs are plated at 2 × 10 ⁶ in 0.5 ml complete medium per well and incubated at 37 ° C. for 2 hours. The plate was washed twice with RPMI by gentle tapping to remove non-adherent cells and 10 μg / ml in the presence of 3 μg / ml β ₂ microglobulin in 0.25 ml RPMI / 5% AB / well. Adherent cells are pulsed with 2 peptides at 37 ° C. for 2 hours. Peptide solution is aspirated from each well and the wells are washed once with RPMI. Most of the medium is aspirated from the induction culture (CD8 + cells) and 0.5% with fresh medium.
Make ml. The cells are then transferred to a well containing adherent cells pulsed with the peptide. After 24 hours, recombinant human IL-10 is added at a final concentration of 10 ng / ml, and again the next day and 2-3 days later, recombinant human IL2 is added at 50 IU / ml (Tsai).
Et al., Critical Reviews in Immunology 18 (1-2)
: 65-75, 1998). After 7 days, the culture was treated with C in a ⁵¹ Cr release assay.
Assay for TL activity. In some experiments, the cultures are assayed for peptide specific recognition in an in situ IFNγ ELISA during the second re-stimulation, and after 7 days, an assay for endogenous recognition is performed. After growth, activity is measured in both assays for side-by-side comparison.

(Measurement of CTL dissolution activity by ⁵¹ Cr release)
Seven days after the second re-stimulation, cytotoxicity is determined in a standard (5 hour) ⁵¹ Cr release assay by assaying individual wells at a single E: T. 10μ of cells
Peptide pulsed targets are prepared by incubating overnight at 37 ° C. with g / ml peptide.

Adherent target cells are removed from the culture flask using trypsin-EDTA. Target cells were treated with 200 μCi of ⁵¹ Cr sodium chromate (Dupont, Wilmington).
, DE) for 1 hour at 37 ° C. Labeled target cells are resuspended at 10 ⁶ per ml and using K562 cells (NK sensitive erythroblastoma line used to reduce non-specific lysis) at a concentration of 3.3 × 10 ⁶ / ml. Dilute 1:10. Target cells (100 μl) and effectors (100 μl) are plated in 96 well round bottom plates and 3
Incubate for 5 hours at 7 ° C. At that time, 100 μl of supernatant is collected from each well and has the formula:
[(Test sample cpm−spontaneously generated ⁵¹ Cr release sample cpm) / (max ⁵¹ C
r release sample cpm-spontaneous ⁵¹ Cr release sample cpm)]] × 100
Determine the percent dissolution according to:

Maximum release and spontaneous release, respectively, labeled target 1% Triton X-10
Determine by incubating with 0 and medium alone. As a culture with specific lysis (sample-background)> 10% for individual wells and> 15% at the highest two E: T ratios when assaying grown cultures Define a positive culture.

(In situ measurement of human IFNγ production as an indicator of peptide-specific and endogenous recognition)
Immulon 2 plate was added to mouse anti-human IFNγ monoclonal antibody (4 μg / m
l Coat overnight at 4 ° C. using 0.1 M NaHCO ₃ , pH 8.2). The plate was washed with Ca ²⁺ , Mg ²⁺ free PBS / 0.05% Tween 20, blocked for 2 hours using PBS / 10% FCS, and then CTL (100
μl / well) and target (100 μl / well) are added to each well and the wells for standards and blanks are left empty (with medium only). Target cells (either peptide pulse or endogenous target) are used at a concentration of 1 × 10 ⁶ cells / ml. Plates are incubated for 48 hours at 37 ° C. with 5% CO ₂ .

Recombinant human IFN-γ at 400 pg / 100 μl / well or 1200 pg / 10
Add to standard wells starting at 0 μl / well and incubate the plate at 37 ° C. for 2 hours. The plate is washed and 100 μl of biotinylated mouse anti-human IFN-γ monoclonal antibody (2 μg / ml in PBS / 3% FCS / 0.05% Tween 20) is added and incubated for 2 hours at room temperature. After washing again, 100 μl HRP-streptavidin (1: 4000) is added and the plate is incubated at room temperature for 1 hour. The plate was then washed 6 times with wash buffer and 100 μl / well of color developing solution (
TMB 1: 1) is added and the plate is allowed to develop for 5-15 minutes. 50 μl / well
The reaction is stopped using 1M H ₃ PO ₄ and read at OD450. At least 50p
A culture is considered positive if g IFN-γ / well is measured above background and is twice the background level of expression.

(CTL proliferation)
Cultures exhibiting specific lytic activity against peptide pulsed targets and / or tumor targets are grown with anti-CD3 for 2 weeks. Briefly, 5 × 10 ⁴ CD8 ⁺ cells are added to a T25 flask containing: RPMI-1640 (10% (v / v) human AB serum, non-essential amino acids, sodium pyruvate, 25 μM 2-mercaptoethanol. 1 × in 1 ml), containing L-glutamine and penicillin / streptomycin
10 ⁶ irradiated (4,200 rad) PBMC (autologous or allogeneic) / ml, 2 × 10 ⁵ irradiated (8,000 rad) EBV transformed cells / ml, and 30 ng / ml OKT3 (
Anti-CD3). Recombinant human IL2 was added 24 hours later at a final concentration of 200 IU / ml,
Thereafter, every 3 days, fresh medium is added at 50 IU / ml. Cell concentration is 1 × 10 ⁶ / m
If the cell is exceeded, the cells are split and the culture is divided into 30: 1, 10: 1, 3 in ⁵¹ Cr release assay.
Assay at E: T ratios of 1: 1 and 1: 1 for 13-15 days or assay at 1 × 10 ⁶ / ml in an in situ IFNγ assay using the same target as before growth.

Cultures are grown in the absence of anti-CD3 ⁺ as follows. Cultures exhibiting specific lytic activity against peptides and endogenous targets are selected and 5 × 10 ⁴ CD8 ⁺ cells are added to a T25 flask containing: RPMI-1640 (10% (v / v) human AB serum ,
Peptide pulsed for 2 hours at 37 ° C. with 1 × 10 ⁶ autologous PBMC / ml (10 μg / ml peptide in 1 ml of non-essential AA, containing sodium pyruvate, 25 mM 2-ME, L-glutamine and gentamicin) And irradiated (4,200 rad)); 2 × 10 ⁵ irradiated (8,000 rad) EBV transformed cells / ml.

(Immunogenicity of peptides with A2 supermotif)
The A2 supermotif cross-reactive binding peptide is converted to peptide-specific C in normal individuals.
Test in cell assay for ability to induce TL. In this analysis, a peptide is typically considered an epitope if it induces peptide-specific CTL in at least an individual, and preferably also recognizes an endogenously expressed peptide.

Immunogenicity can also be confirmed using PBMCs isolated from patients bearing tumors that express 98P4B6. Briefly, PBMCs are isolated from patients and restimulated with peptide-pulsed monocytes and assayed for their ability to recognize peptide-pulsed target cells and transfected cells that endogenously express the antigen.

(Evaluation of A ^* 03 / A11 immunogenicity)
HLA-A3 supermotif carrying cross-reactive binding peptides are also evaluated for immunogenicity using methods similar to those used to assess the immunogenicity of HLA-A2 supermotif peptides.

(Evaluation of B7 immunogenicity)
Immunogenicity screening of B7 supertype cross-reactive binding peptides identified as shown herein is confirmed in a manner similar to the confirmation of peptides carrying A2 and A3 supermotifs.

Peptides carrying other supermotifs / motifs (eg, HLA-A1, HLA-A24, etc.) are also confirmed using similar methodology.

Example 15: Implementation of extended supermotif to improve native epitope binding ability by making analogs
HLA motifs and supermotifs (including primary and / or secondary residues) are useful in the identification and preparation of highly cross-reactive native peptides, as demonstrated herein. In addition, the definition of HLA motifs and supermotifs also allows manipulation of highly cross-reactive epitopes by identifying residues within the native peptide sequence. This native peptide sequence is unique to the peptide (
For example, it can be analogized to confer greater cross-reactivity within a group of HLA molecules including supertypes and / or greater binding affinity for some or all of those HLA molecules. Examples of analogized peptides that exhibit modulated binding affinity are shown in this example.

(Analogization at the primary anchor residue)
Peptide manipulation strategies are performed to further increase epitope cross-reactivity. For example, the major anchor of the A2 supermotif-bearing peptide is modified, for example, to introduce a preferred L, I, V or M at position 2 and a preferred I or V at the C-terminus.

In order to analyze the cross-reactivity of the analog peptides, each engineered analog is first bound for binding to the prototype A2 supertype allele A ^* 0201, then A ^*.
If 0201 binding ability is maintained, test for A2 supertype cross-reactivity.

Alternatively, the peptide is confirmed to bind one or all supertype members, and then analogized to modulate the binding affinity for any one (or more) of the supertype members, and the population range Append.

Analog selection for immunogenicity in cell screening analysis typically involves parental wild-type (WT) peptides binding at least weakly to 3 or more A2 supertype alleles (ie, with an IC _{50 of} 5000 nM or less). Further limited by ability to join. The principle for this requirement is that the WT peptide must be endogenously present in an amount sufficient to be biologically relevant. Analogized peptides have been shown to have increased immunogenicity and cross-reactivity with T cells specific for the parent epitope (
See, for example, Parkhurst et al. Immunol. 157: 2539, 1996; and Pogue et al., Proc. Natl. Acad. Sci. USA 92: 8166
1995).

In cell screening of these peptide analogs, confirm that analog-specific CTLs can also recognize wild-type peptides and, if possible, target cells that endogenously express this epitope. is important.

(Analogization of peptides carrying HLA-A3 and B7 supermotifs)
Analogs of HLA-A3 supermotif carrying epitopes are generated using a strategy similar to that used in the analogization of HLA-A2 supermotif carrying peptides. For example, a peptide that binds to 3/5 of the A3 supertype molecule is engineered with a primary anchor residue to carry a preferred residue (V, S, M or A) at position 2.

This analog peptide is then tested for the ability to bind A ^* 03 and A ^* 11 (prototype A3 supertype allele). Peptides exhibiting ≦ 500 nM binding ability are then confirmed to have A3 supertype cross-reactivity.

Similar to A2 motif-bearing peptide and A3 motif-bearing peptide, 3 or more B7
Peptides that bind supertype alleles can be improved to achieve increased cross-reactivity binding or greater binding affinity or binding half-life if possible. Peptides carrying the B7 supermotif are described by Sidney et al. (J. Immunol. 157: 3480).
-3490, 1996), for example, engineered to have a preferred residue (V, I, L or F) at the C-terminal primary anchor position.

Analogization at the primary anchor residue of other motif-bearing epitopes and / or supermotif-bearing epitopes is performed in a similar manner.

The analog peptide is then typically confirmed for immunogenicity in a cell screening assay. Again, analog-specific CTLs are also wild-type peptides,
And where possible, it is generally important to demonstrate that it is possible to recognize targets that endogenously express this epitope.

(Analogization at secondary anchor residues)
Furthermore, the HLA supermotif identifies highly cross-reactive peptides and / or peptides that bind HLA molecules with increased affinity to specific residues at secondary anchor positions associated with such properties. It is valuable to operate. For example,
The binding ability of the B7 supermotif-containing peptide having an F residue at position 1 is analyzed. The peptide is then analogized, eg, to replace F at position 1 with L. The analogized peptide is evaluated for increased binding affinity, binding half-life and / or increased cross-reactivity. Such a procedure identifies analogized peptides with enhanced properties.

Engineered analogs with sufficiently improved binding capacity or cross-reactivity, for example
Following IFA immunization or lipopeptide immunization, immunogenicity can also be tested in HLA-B7 transgenic mice. Analogized peptides are further tested for the ability to stimulate a recall response using PBMC from patients with 98P4B6-expressing tumors.

(Other analog strategies)
Another form of peptide analogization involves replacing cysteine with α-aminobutyric acid, regardless of anchor position. Due to its chemical nature, cysteine has the property of structurally altering peptides enough to form disulfide bridges and reduce binding capacity. Substitution with α-aminobutyric acid instead of cysteine not only reduces this problem, but in some cases has also been shown to improve binding and cross-linking capabilities (eg, Sette et al., Persistent Viral). Infecti
ons, R.M. Ahmed and I.M. Chen, John Wiley & Sons,
See the review by England, 1999).

Thus, the use of single amino acid substitutions can modulate the binding properties and / or cross-reactivity of peptide ligands to HLA supertype molecules.

(Example 16: Identification and confirmation of 98P4B6-derived sequence having HLA-DR binding motif)
Peptide epitopes having HLA class II supermotifs or HLA class II motifs are identified and confirmed as outlined below using methodologies similar to those described for HLA class I peptides.

(Selection of epitope bearing HLA-DR supermotif)
To identify the HLA class II HTL epitope from 98P4B6, 98P4
The B6 antigen is analyzed for the presence of sequences carrying the HLA-DR motif or HLA-DR supermotif. Specifically, a 15-mer sequence containing the DR supermotif (including a 9-mer core and a 3-residue N-terminus and a 3-residue C-terminal flanking region (15 amino acids in total)) is selected.

Protocols have been developed to estimate peptides that bind to DR molecules (Sout
hwood et al. Immunol. 160: 3363-3373, 1998). These protocols specific for individual DR molecules allow for scoring and ranking of 9-mer core regions. Each protocol not only scores the peptide sequence for the presence of the DR supermotif primary anchor (ie, positions 1 and 6) within the 9-mer core, but also evaluates the sequence for the presence of the secondary anchor. Using an allele-specific selection table (see, eg, Southwood et al., Ibid), these protocols
We have found efficient selection of peptide sequences with a high probability of binding specific DR molecules. Furthermore, performing these protocols in tandem specifically found that performing on DR1, DR4w4, and DR7 can efficiently select DR cross-reactive peptides.

The 98P4B6-derived peptides identified above are tested for their binding ability for various common HLA-DR molecules. All peptides are primary panels: DR1, D
First tested for binding to DR molecules in R4w4 and DR7. Peptides that bind at least two of these three DR molecules are then tested for binding to DR2w2β1, DR2w2β2, DR6w19, and DR9 molecules in a secondary assay. Finally, a peptide that binds at least two of the four secondary panel DR molecules, and thus a peptide that cumulatively binds at least four of the seven different DR molecules, is DR4w15, DR5w11, And DR8w2
Screened in a tertiary assay for binding to the molecule. Including primary screening assays, secondary screening assays and tertiary screening assays,
Peptides that bind at least 7 of the 10 DR molecules are considered cross-reactive DR binders. Of particular interest are peptides derived from 98P4B6 that have been found to bind common HLA-DR alleles.

(Selection of DR3 motif peptide)
Since HLA-DR3 is an allele that predominates in the white, black and Latin American populations, DR3 binding ability is an appropriate criterion in the selection of HTL epitopes. Thus, peptides that have been shown to be candidates can also be assayed for their DR3 binding ability. However, considering the binding specificity of the DR3 motif,
Peptides that bind only to DR3 can also be considered candidates for inclusion in vaccine formulations.

In order to efficiently identify peptides that bind DR3, the target 98P4B6 antigen was
Sequences with one of the two DR3-specific binding motifs reported by luk et al. (J. Immunol. 152: 5742-5748, 1994) are analyzed. The corresponding peptide is then synthesized and confirmed to have the ability to bind DR3 with an affinity of 1 μM or better (ie, less than 1 μM). Peptides that meet this binding criteria and qualify as HLA class II high affinity binding agents are found.

The DR3 binding epitope thus identified is included in the vaccine composition along with the DR supermotif-bearing peptide epitope.

As with HLA class I motif-bearing peptides, class II motif-bearing peptides are analogized to improve affinity or cross-reactivity. For example, aspartic acid at position 4 of the 9-mer core sequence is the optimal residue for DR3 binding, and substitution on that residue often improves DR3 binding.

Example 17: Immunogenicity of 98P4B6-derived HTL epitope
This example determines the immunogenic DR supermotif and DR3 motif-bearing epitopes from those identified using the methodology described herein.

Confirm the immunogenicity of the HTL epitope in a manner similar to the determination of the immunogenicity of the CTL epitope by assessing its ability to stimulate an HTL response and / or by using an appropriate transgenic mouse model To do. Immunogenicity is determined by screening for the following: 1.) In vitro primary induction using normal PBMC or ) Recall response from patients with 98P4B6 expressing tumors.

Example 18: Calculation of phenotypic frequencies of HLA supertypes in various racial backgrounds to determine the breadth of population range
This example shows an assessment of the breadth of the population range of vaccine compositions composed of multiple supermotifs and / or multiple epitopes containing motifs.

To analyze population range, determine the gene frequency of the HLA allele. The gene frequency of each HLA allele is calculated from the antigen or allele frequency using the binomial distribution gf = 1- (SQRT (1-af)) (eg, Sidney et al., Human Immun).
ol. 45: 79-93, 1996). To obtain the overall phenotypic frequency, the cumulative gene frequency is calculated, and the cumulative antigen frequency is calculated as the inverse formula (inverse formula).
a) Derived by using [af = 1- (1-Cgf) ² ].

If frequency data is not available at the level of DNA typing, a response to serologically defined antigen frequencies is assumed. In order to obtain the entire potential supertype population range, no linkage disequilibrium is assumed, and only alleles identified as belonging to each of the supertypes are included (minimum estimate). An assessment of the overall potential range achieved by the combination between loci is made by adding to the A range the proportion of populations not included in A that can be predicted to be covered by the considered B allele (eg, Total = A + B ^* (1-A)). The confirmed members of A3-like supertype are A3, A1
1, A31, A ^* 3301, and A ^* 6801. A3 super type is A3
4, A66, and A ^* 7401 could also be included, but these alleles were not included in the overall frequency calculation. Similarly, identified members of the A2-like supertype family are A ^* 0201, A ^* 0202, A ^* 0203, A ^* 0204, A ^* 0205, A ^*.
0206, A ^* 0207, A ^* 6802 and A ^* 6901. Finally, confirmed alleles of the B7-like supertype are B7, B ^* 3501-03, B51, B ^* 53
01, B ^* 5401, B ^* 5501-2, B ^* 5601, B ^* 6701, and B ^* 78
01 (B ^* 1401, B ^* 3504-06, B ^* 4201, and B ^* 5602 are also potentially members).

The population range achieved by combining the A2, A3 and B7 supertypes is approximately 86% in the five major racial groups. The range is
It can be expanded by including peptides carrying the A1 and A24 motifs. On average, A1 is present in 12% of the population spanning five different major ethnic groups (white, North American black, Chinese, Japanese, and Latino), and A24 is 29%
Exists. In summary, these alleles are 39% in these same ethnic populations
It corresponds to the average frequency. When A1 and A24 are combined with a range of A2 supertype alleles, A3 supertype alleles and B7 supertype alleles, the total range across major races exceeds 95% (see Table IV (G) ) A similar approach can be used to assess the population range achieved by a combination of class II motif-bearing epitopes.

Immunogenicity studies in humans (eg Bertoni et al., J. Clin. Invest
. 100: 503, 1997; Doolan et al., Immunity 7:97, 1997.
And Threlkeld et al., J .; Immunol. 159: 1648, 1997) showed that highly cross-reactive binding peptides are almost always recognized as epitopes. The use of highly cross-reactive binding peptides is an important selection criterion in identifying candidate epitopes for inclusion in vaccines that are immunogenic in diverse populations.

By using a sufficient number of epitopes (as disclosed herein and according to the art), the average population range is estimated to be greater than 95% in each of the five major racial populations. Monte Carlo simulation analysis, which is game theory (this is well known in the art (eg, Osborne, MJ and Rubinstein, A.
“A course in game theory” MIT Press, 1994)) is the percentage of the population comprised of white, North American black, Japanese, Chinese, and Latino racial groups. It can be used to infer whether an individual recognizes the vaccine epitopes described herein. A preferred percentage is 90%. A more preferred percentage is 95%.

Example 19: CTL recognition of endogenously processed antigen after priming
In this example, a CTL induced by an epitope of a native or analog peptide identified and selected as described herein recognizes an endogenously synthesized antigen (ie, a native antigen). Make sure you do.

Effector cells isolated from transgenic mice immunized with peptide epitopes (eg, epitopes bearing the HLA-A2 supermotif) are restimulated in vitro using peptide-coated stimulator cells. After 6 days, effector cells are assayed for cytotoxicity and cell lines containing peptide-specific cytotoxic activity are further restimulated. After an additional 6 days, these cell lines were tested for cytotoxic activity against ⁵¹ Cr-labeled Jurkat-A2.1 / ^Kb target cells in the presence or absence of peptides and have endogenously synthesized antigens. It is also tested against ⁵¹ Cr labeled target cells (ie cells stably transfected with 98P4B6 expression vector).

The results demonstrate that CTL lines obtained from animals primed with peptide epitopes recognize the endogenously synthesized 98P4B6 antigen. The selection of the transgenic mouse model used for such analysis depends on the epitope being evaluated. HL
In addition to A-A ^* 0201 / ^Kb transgenic mice, human A11 (which is also
Several other transgenic mouse models have been characterized, including mice that can be used to evaluate A3 epitopes) and B7 alleles, others (eg, HL
Transgenic mice for A-A1 and HLA-A24) have been developed. Mouse models of HLA-DR1 and HLA-DR3 have also been developed and are
Can be used to assess L epitopes.

Example 20: Activity of CTL-HTL conjugated epitopes in transgenic mice
This example demonstrates the induction of CTL and HTL in transgenic mice by use of 98P4B6-derived CTL and HTL peptide vaccine compositions. The vaccine composition used herein comprises a peptide to be administered to a patient having a 98P4B6-expressing tumor. The peptide composition comprises a plurality of CTL epitopes and / or HT
L epitopes can be included. These epitopes are identified using the methodology described herein. This example also demonstrates that enhanced immunogenicity is present in CTL vaccine compositions.
It shows that it can be achieved by including the above HTL epitopes; such a peptide composition may comprise an HTL epitope conjugated to a CTL epitope. This CT
An L epitope can be an epitope that binds to multiple HLA family members or an analog of that epitope with an affinity of 500 nM or less. These peptides can be lipidated if desired.

Immunization procedure: Immunization of transgenic mice has been described (Alexander et al., J. I.
mmunol. 159: 4753-4761, 1997). For example, A2 /
^Kb mice (which are transgenic for the human HLA A2.1 allele and are used to confirm the immunogenicity of epitopes carrying the HLA-A ^* 0201 motif or the HLA-A2 supermotif) DMSO in Freund's incomplete adjuvant or when the peptide composition is a lipidated CTL / HTL conjugate.
/ In saline or subcutaneously with 0.1 ml peptide (base of tail) in PBS or Freund's incomplete adjuvant if the peptide composition is a polypeptide
Prime. Seven days after priming, splenocytes from these animals are restimulated with syngeneic irradiated LPS activated lymphoblasts coated with peptide.

Cell lines: Target cells for peptide-specific cytotoxicity assays are HLA-A2.1 /
^Kb chimeric genes (eg, Vitiello et al., J. Exp. Med. 173: 100
7, 1991) transfected Jurkat cells.

In vitro CTL activation: One week after priming, spleen cells (30 × 10 ⁶ cells / flask) in 10 ml culture medium / T25 flask were irradiated at 37 ° C. with syngeneic irradiation (30
00 rad) co-cultured with peptide-coated lymphoblasts (10 × 10 ⁶ cells / flask). After 6 days, effector cells are harvested and assayed for cytotoxic activity.

Assay for cytotoxic activity: target cells (1.0-1.5 × 10 ⁶ )
Incubate at 37 ° C. in the presence of μl ⁵¹ Cr. After 60 minutes, the cells are washed three times and resuspended in R10 medium. Peptides are added at a concentration of 1 μg / ml if necessary. For the assay, 10 ^{4 51} Cr labeled target cells are added to different concentrations of effector cells (final volume 200 μl) in U-bottom 96-well plates. After 6 hours incubation at 37 ° C., a 0.1 ml aliquot of the supernatant is removed from each well and the radioactivity is measured with a Micromedic automatic gamma counter. The% specific lysis is determined by the following formula:% specific release = 100 × (experimental release−spontaneous release) / (maximum release−
Spontaneous release). To facilitate comparison between separate CTL assays performed under the same conditions,% ⁵¹ Cr release data is expressed as lytic units / 10 ⁶ cells. 1 dissolution unit is 6 hours
Arbitrarily defined as the number of effector cells required to achieve 30% lysis of 10,000 target cells in a ⁵¹ Cr release assay. To obtain the specific lytic unit / 10 ⁶ , the lytic unit / 10 ⁶ obtained in the absence of peptide is subtracted from the lytic unit / 10 ⁶ obtained in the presence of peptide. For example, 30% ⁵¹ Cr release is 5% in the absence of peptide.
Effector (E): target (T) ratio of 0: 1 (ie 5 × 10 ⁵ effector cells for 10,000 targets) and 5: 1 in the presence of peptide ( That is, when obtained with 5 × 10 ⁴ effector cells for 10,000 targets), the specific lysis unit is: [(1 / 50,000) − (1 / 500,
000)] × 10 ⁶ = 18 LU.

Analyzing the results, CT of animals injected with immunogenic CTL / HTL conjugate vaccine preparations
The magnitude of the L response is assessed and compared to the magnitude of the CTL response achieved, for example, using CTL epitopes as outlined above in the example title “Verification of immunogenicity”. A similar analysis can be performed to confirm the immunogenicity of peptide conjugates containing multiple CTL epitopes and / or multiple HTL epitopes. According to these procedures, it is found that a CTL response is induced and at the same time an HTL response is induced upon administration of such a composition.

Example 21: Selection of CTL and HTL epitopes for inclusion in 98P4B6 specific vaccines
This example shows the procedure for selecting peptide epitopes for the vaccine composition of the invention. The peptides in this composition can be in the form of a nucleic acid sequence, either a single sequence encoding the peptide or one or more sequences (ie, a minigene), or of a single epitope and / or polyepitope. It can be a peptide.

The following principles are utilized when selecting multiple epitopes for inclusion in a vaccine composition. Each of the following principles are balanced to make a selection.

Upon administration, an epitope that mimics the immune response that correlates with 98P4B6 clearance is selected. The number of epitopes used depends on patient observations that spontaneously clear 98P4B6. For example, if a patient who spontaneously clears 98P4B6 expressing cells is observed to produce an immune response against at least three epitopes derived from the 98P4B6 antigen, HL
At least three epitopes for A class I should be included. A similar principle is used to determine HLA class II epitopes.

Often, an epitope with a binding affinity of HLA class I The following _{IC 50} 500 nM for molecules or _{IC 50} of less 1000nM for class II,; high from or BIMAS web site (URL bimas.dcrt.nih.gov/) HLA class I peptides with binding scores are selected.

In order to achieve a wide range of vaccines across diverse populations, a sufficient population of supermotifs or sufficient arrays of allele-specific motif-bearing peptides can be selected to provide a broad population range. In one embodiment, the epitope is at least 8
Selected to provide 0% population coverage. Monte Carlo analysis (statistical evaluation methods known in the art) can be used to assess the breadth of the population range, ie redundancy.

When making a polyepitope composition, or minigene encoding it, it is typically desirable to produce the smallest possible peptide containing the epitope of interest. The principle used is similar if not the same as that used when selecting peptides containing a nested epitope. For example, the protein sequence for a vaccine composition is selected because this sequence has the maximum number of epitopes contained within the sequence (ie, has a high concentration of epitopes). Epitopes may be nested or overlapping (ie, frame shifted from each other).
For example, if overlapping epitopes are used, two 9-mer epitopes and one 10
A mer epitope can be present in a 10 amino acid peptide. Each epitope can be exposed,
They are bound by HLA molecules upon administration of such peptides. Multi-epitope peptides can be produced synthetically, recombinantly, or by cleavage from native sources. Alternatively, analogs can be generated from the native sequence, whereby one or more epitopes contain substitutions that alter the cross-reactivity and / or binding affinity properties of the polyepitope peptide. Such vaccine compositions are administered for therapeutic or prophylactic purposes. This embodiment, as an undiscovered aspect of the immune system, allows processing to be applied to native nested sequences, thereby facilitating the generation of therapeutic or prophylactic immune response inducing vaccine compositions Provide sex. Furthermore, such embodiments provide the possibility of motif-bearing epitopes for currently unknown HLA structures. Furthermore, this embodiment (which does not make analogs) directs the immune response to multiple peptide sequences that are actually present in 98P4B6, thus avoiding the need to evaluate any linked epitopes. Finally, this embodiment provides economies of scale in producing nucleic acid vaccine compositions. In connection with this embodiment, a computer program can be derived according to the principles of the art, which identifies the maximum number of epitopes per sequence length in the target sequence.

Vaccine compositions composed of selected peptides are safe and effective when administered and have a magnitude similar to an immune response that controls or eliminates cells that have or overexpress 98P4B6 Elicits an immune response.

Example 22: Construction of “minigene” multi-epitope DNA plasmid
This example discusses the construction of a minigene expression plasmid. The minigene plasmid is
Of course, various configurations of B cell epitopes, CTL epitopes and / or HTL epitopes or B cell epitope analogs, CTL epitope analogs and / or HTL epitope analogs described herein may be included.

Minigene expression plasmids typically have multiple CTL peptide epitopes and HT
Contains the L peptide epitope. In this example, HLA-A2 supermotif-containing peptide epitope, HLA-A3 supermotif-containing peptide epitope, HLA-B
7 supermotif carrying peptide epitopes and HLA-A1 motif carrying peptide epitopes and HLA-A24 motif carrying peptide epitopes are used in combination with DR supermotif carrying epitopes and / or DR3 epitopes. 98P4
HLA class I supermotifs derived from B6 or peptide epitopes carrying HLA class I motifs are selected such that multiple supermotifs / motifs are presented to ensure a broad population range. Similarly, HLA class II epitopes are selected from 98P4B6 to provide a broad population range. That is, HLA DR-1-4
Both the 7 supermotif-bearing epitope and the HLA DR-3 motif-bearing epitope are selected for inclusion in the minigene construct. Selected CTL and HTL epitopes are then incorporated into a minigene for expression in an expression vector.

Such a construct may further comprise a sequence that directs the HTL epitope to the endoplasmic reticulum.
For example, an Ii protein (Ii protein) can be fused to one or more HTL epitopes as described in the art, where the CLIP sequence of the Ii protein is removed and replaced with an HLA class II epitope sequence As a result, an HLA class II epitope is directed to the endoplasmic reticulum and this epitope binds to an HLA class II molecule.

This example illustrates the method used for the construction of a minigene-bearing expression plasmid. Other expression vectors that can be used for minigene compositions are available and known to those of skill in the art.

The minigene DNA plasmid of this example comprises a consensus Kozak sequence and a consensus mouse κIg light chain signal sequence, followed by a CTL epitope and / or an HTL epitope selected according to the principles disclosed herein. This sequence is pc
It encodes the open reading frame fused to the Myc and His antibody epitope tags encoded by the DNA3.1Myc-His vector.

For example, overlapping oligonucleotides that can be on average about 70 nucleotides long, with 15 nucleotides overlapping, are synthesized and HPLC purified. These oligonucleotides encode selected peptide epitopes as well as appropriate linker nucleotides, Kozak sequences, and signal sequences. The final multi-epitope minigene is assembled by extending overlapping oligonucleotides in three sets of reactions using PCR. Perkin / Elmer 9600 PCR
And a total of 30 cycles are carried out using the following conditions: 15 seconds at 95 ° C.
30 seconds at annealing temperature (5 ° C. below the lowest calculated Tm of each primer pair),
And at 72 ° C for 1 minute.

For example, a minigene is prepared as follows. 5 μg each in the first PCR reaction
The two oligonucleotides are annealed and extended. In an example using 8 oligonucleotides (ie 4 pairs of primers), oligonucleotide 1
And oligonucleotide 2, oligonucleotide 3 and oligonucleotide 4, oligonucleotide 5 and oligonucleotide 6, and oligonucleotide 7 and oligonucleotide 8
And Pfu polymerase buffer (1 × = 10 mM KCL, 10 mM (NH 4) ₂ SO
₄ , 20 mM Tris-chloride (pH 8.75), 2 mM MgSO ₄ , 0.1%
Triton X-100, 100 μg / ml BSA), each with 0.25 mM dN
Combine in a 100 μl reaction containing TP and 2.5 U Pfu polymerase. The full-length dimer product is gel purified and the two reactions including the 1 and 2 and 3 and 4 products and the 5 and 6 and 7 and 8 products are mixed, annealed, and 10 cycles Elongate. The halves of the two reactions are then mixed and adjacent primers are added to perform 5 cycles of annealing and extension before amplifying the full length product. This full length product is gel purified, cloned into pCR-blunt (Invitrogen), and individual clones are screened by sequencing.

(Example 23: Plasmid construct and extent to which the plasmid construct induces immunogenicity)
To the extent that a plasmid construct (eg, a plasmid constructed according to the previous examples) can induce immunogenicity, transducing or transfecting APC with the epitope-expressing nucleic acid construct, followed by epitope presentation by this APC. Confirm in vitro by determining. Such studies determine “antigenicity” and allow the use of human APC. By quantifying the density of epitope-HLA class I complexes on the cell surface by this assay, the ability of the epitope presented by APC in a state recognized by T cells is determined. Quantification can be performed by directly measuring the amount of peptide eluted from the APC (eg, Sijts et al., J. Immunol. 156: 683-6).
92, 1996; Demotz et al., Nature 342: 682-684, 1989); or the number of peptide-HLA class I complexes is determined by lysis induced by affected or transfected target cells or It can be assessed by measuring the amount of release of lymphokine and then determining the concentration of peptide required to obtain an equal level of lysis or release of lymphokine (see, eg, Kageyama et al., J. Immun
ol. 154: 567-576, 1995).

Alternatively, immunogenicity can be determined by in vivo injection into mice followed by CTL activity and HT.
L activity (these activities are determined by cytotoxicity and cell proliferation assays (e.g.,
Confirmed through in vitro assessment of Alexander) et al., Immunity 1: 751-761, detailed in 1994).

For example, to confirm the ability of a DNA minigene construct having at least one HLA-A2 supermotif peptide to induce CTL in vivo, for example, HLA-A
2.1 / ^Kb transgenic mice are immunized intramuscularly with 100 μg naked cDNA. As a means of comparing the level of CTL induced by cDNA immunization, a control group of animals also contains an actual epitope containing multiple epitopes synthesized as a single polypeptide, since multiple epitopes are encoded by minigenes. Immunization is performed using the peptide composition itself.

Spleen cells from the immunized animal are stimulated twice with each composition (peptide epitope or polyepitope peptide encoded in the minigene), respectively, and then ⁵
Assay for peptide-specific cytotoxic activity in a ¹ Cr release assay. These results indicate the magnitude of the CTL response to the A2-restricted epitope, thus indicating the in vivo immunogenicity of the minigene and polyepitope vaccines.

Therefore, the minigene is HLA-, as induced by the polyepitope peptide vaccine.
It is found to elicit an immune response against the A2 supermotif peptide epitope. Similar analyzes were also performed using other HLA-A3 and HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 and HLA-B7 motif or supermotif epitopes, Thereby, it is also found that this minigene elicits an appropriate immune response directed against the provided epitope.

To confirm the ability of minigenes encoding class II epitopes to induce HTL in vivo, for epitopes that cross-react with DR transgenic mice or with appropriate mouse MHC molecules, see, for example, IA ^b Restrained mice are immunized intramuscularly with 100 μg of plasmid DNA. As a means of comparing the level of HTL induced by DNA immunization, a group of control animals is also immunized with the actual peptide composition emulsified in Freund's complete adjuvant. CD4 + T cells (ie HTL) are purified from spleen cells of immunized animals and stimulated with each of the respective compositions (peptides encoded in the minigene). The HTL response is measured using a ³ H-thymidine incorporation proliferation assay (eg, Alexander et al., Immunity 1: 751-761, 199
4). This result indicates the magnitude of the HTL response and thus demonstrates the in vivo immunogenicity of this minigene.

A DNA minigene constructed as described in the previous example can also be identified as a vaccine in combination with a boost agent using a prime boost protocol. This boosting agent is a recombinant protein (eg, Barnett et al., Aids Res. And Human Retrovirus).
ses 14, Supplement 3: S299-S309, 1998) or, for example, a recombinant vaccine expressing a minigene or DNA encoding the complete protein of interest (eg, Hanke et al., Vaccine 16: 439-445, 1998;
Seedegah et al., Proc. Natl. Acad. Sci USA 95: 7648-
53, 1998; Hanke and McMichael, Immunol. Letter
66: 177-181, 1999; and Robinson et al., Nature M.
ed. 5: 526-34, 1999).

For example, the effectiveness of the DNA minigene used in the prime boost protocol is first evaluated in transgenic mice. In this example, A2.1 / K ^b
Transgenic mice are IM immunized with 100 μg of a DNA minigene encoding an immunogenic peptide (including at least one HLA-A2 supermotif-bearing peptide). After an incubation period (ranging from 3 to 9 weeks), the mice are
Boost with IP using 10 ⁷ pfu / mouse recombinant vaccinia virus expressing the same sequence encoded by the minigene. Control mice are immunized with 100 μg of DNA or recombinant vaccinia without the minigene sequence, or with DNA encoding this minigene, but without vaccinia boost. 2
After a further incubation period of weeks, spleen cells from this mouse were
Immediately assay for peptide specific activity in the OT assay. In addition, spleen cells were stimulated in vitro with the A2 restricted peptide epitope encoded in the minigene and recombinant vaccinia, followed by αIFN ELISA, βIFN ELISA
And / or assay for peptide specific activity in a γIFN ELISA.

It is found that the minigene utilized in the prime boost protocol elicits a higher immune response than the DNA alone against the HLA-A2 supermotif peptide. Such analysis is also performed using HLA-A11 or HLA-B7 transgenic mouse models to assess CTL induction by HLA-A3 or HLA-B7 motif or supermotif epitopes. obtain. The use of the prime boost protocol in humans is described in the following example entitled “Induction of CTL Response Using Prime Boost Protocol”.

Example 24: Peptide composition for prophylactic use
The vaccine composition of the present invention may be used to prevent 98P4B6 expression in humans at risk for tumors carrying this antigen. For example, a polyepitope peptide epitope composition (or a nucleic acid comprising a polyepitope peptide epitope) comprising a plurality of CTL epitopes and HTL epitopes, such as those selected in the above examples (
These are also selected to target more than 80% of the population) 98P4B6
Administer to individuals at risk for related tumors.

For example, a peptide-based composition is provided as a single polypeptide comprising multiple epitopes. Typically, the vaccine is administered in a physiological solution containing an adjuvant (eg, Freund's incomplete adjuvant). The peptide dose for the first immunization is 70k
g patients, about 1 μg to about 50,000 μg, generally 100 μg to 5,000 μg
00 μg. Following the first dose of vaccine, booster was given at 4 weeks,
Further, the magnitude of the immune response in the patient is subsequently evaluated by a technique that determines the presence of an epitope-specific CTL population in the PBMC sample. Additional booster doses are administered as necessary. This composition is found to be safe and effective as a prophylactic against 98P4B6-related diseases.

Alternatively, a composition that typically includes a transfected agent is used for the administration of nucleic acid based vaccines according to methodologies known in the art and disclosed herein.

Example 25: Polyepitope vaccine composition derived from native 98P4B6 sequence
Computers preferably defined for each class I and / or class II supermotif or motif to identify the native 98P4B6 polyprotein sequence as a “relatively short” region of a polyprotein containing multiple epitopes Analyze using algorithm. Preferably, this “relatively short” region is shorter than the full length native antigen. Multiple separate or overlapping “nested (n
This relatively short region containing the “ested)” epitope can be used to create a minigene construct. This construct is engineered to express a peptide corresponding to the native protein sequence. This “relatively short” peptide is generally less than 250 amino acids long, often less than 100 amino acids long, preferably less than 75 amino acids long, and more preferably less than 50 amino acids long. Since the protein sequence of the vaccine composition has the maximum number of epitopes contained in the sequence (ie, it has a high concentration of epitopes), the protein sequence of the vaccine composition is selected. As shown herein, epitope motifs may be nested or overlap (ie, may be frame shifted relative to each other). For example, using overlapping epitopes, two 9-mer epitopes and one 10-mer epitope can be present in a 10 amino acid peptide. Such vaccine compositions are administered for therapeutic or prophylactic purposes.

Examples of the vaccine composition include a plurality of CTL epitopes derived from 98P4B6 antigen and at least one HTL epitope. The polyepitope native sequence is administered either as a peptide or as a nucleic acid sequence encoding the peptide. Alternatively, an analog can be made from its native sequence, whereby 1
One or more epitopes include substitutions that alter the cross-reactivity and / or binding affinity properties of the polyepitope peptide.

The embodiment of this example applies the undiscovered aspects of immune system processing to native nested sequences, thereby producing a vaccine composition that induces a therapeutic or prophylactic immune response. Provides the possibility to make it easier. Further, such an embodiment is
It provides the possibility of motif-bearing epitopes for currently unknown HLA structures. further,
This embodiment (except similar embodiments) directs the immune response to multiple peptide sequences that are actually present in native 98P4B6, thus eliminating the need to evaluate any linking epitopes. Finally, this embodiment provides economies of scale when producing peptide vaccine compositions or nucleic acid vaccine compositions.

For this embodiment, computer programs are available in the art that can be used to identify the largest number of epitopes per sequence length in the target sequence.

Example 26: Polyepitope vaccine composition derived from multiple antigens
The 98P4B6 peptide epitopes of the present invention are used in combination with epitopes derived from other target tumor associated antigens to create vaccine compositions useful for the prevention and treatment of cancers expressing 98P4B6 and such other antigens. For example, the vaccine composition may be 98P4B6
A composition comprising a plurality of epitopes derived from and a tumor-associated antigen often expressed in a target cancer associated with 98P4B6 expression, which may be provided as a single polypeptide or comprising a cocktail of one or more distinct epitopes Can be administered as Alternatively, the vaccine can be administered as a minigene construct or as a dendritic cell loaded with peptide epitopes in vitro.

Example 27: Use of peptides to assess immune response
The peptides of the present invention may be used to analyze immune responses for the presence of specific antibodies, CTL or HTL against 98P4B6. Such an analysis was performed by Ogg et al., Scie.
nce 279: 2103-2106, 1998. In this example, the peptide according to the invention is used as a reagent (not as an immunogen) for diagnostic or prophylactic purposes.

In this example, a highly sensitive human leukocyte antigen tetramer complex (“tetramer”), eg, a post-immunization HLA A ^* containing a different stage of disease or a 98P4B6 peptide containing the A ^* 0201 motif ^. Used for cross-sectional analysis of 98P4B6 HLA-A ^* 0201-specific CTL frequencies from 0201 positive individuals Tetrameric complexes are described (Musey et al., N. Engl. J. Med. 337: 1267, 1997) Briefly, purified HLA heavy chain (A ^* 0201 in this example) and β2-microglobulin are synthesized by a prokaryotic expression system, which is transmembrane-cytosolic tail Of the sequence containing the BirA enzyme biotinylation site and addition of COOH termini.
β2-microglobulin and peptide are refolded by dilution. This 45k
The refolded product of D is isolated using high performance protein liquid chromatography and then biotinylated with BirA in the presence of biotin (Sigma, St. Louis, Missouri), adenosine 5 ′ triphosphate and magnesium. Streptavidin
Phycoerythrin conjugate is added at a molar ratio of 1: 4 and the tetramer product is concentrated to 1 mg / ml. The resulting product is referred to as tetramer-fecoerythrin.

For analysis of patient blood samples, approximately 1 million PBMCs are centrifuged at 300 g for 5 minutes and resuspended in 50 μl of cold phosphate buffered saline. Three-color analysis for anti-CD8-
Perform with tetramer-phycoerythrin with Tricolor and anti-CD38. PBMC are incubated with tetramer and antibody on ice for 30-60 minutes and then washed twice prior to formaldehyde fixation. Apply a gate that contains more than 99.98% control samples. Control for tetramer is A
^* Includes both 0201 negative individuals and A ^* 0201 positive unaffected donors. The percentage of cells stained with this tetramer is then determined using flow cytometry. This result shows the number of epitope-restricted CTL-containing cells in the PBMC sample,
This readily indicates the extent of the immune response to the 98P4B6 epitope, and thus the state of exposure to 98P4B6, or the state of exposure to a vaccine that elicits a prophylactic or therapeutic response.

Example 28: Use of peptide epitopes to assess recall responses
The peptide epitopes of the invention are used as reagents for assessing T cell responses (eg, acute or recall responses) in patients. Such an analysis may be performed in patients who have recovered from 98P4B6-related disease or who have been vaccinated with 98P4B6 vaccine.

For example, vaccinated human class I restricted CTL responses can be analyzed. This vaccine may be any 98P4B6 vaccine. PBMC are collected from the vaccinated individuals and HLA typed. Then, for analysis of samples from individuals carrying that HLA type, the appropriate peptide epitope of the present invention optionally carrying a supermotif to provide cross-reactivity to complex HLA supertype family members. Used for.

PBMCs from vaccinated individuals are separated on a Ficoll-Histopaque density gradient (Sigma Chemical Co., St. Louis, Mo.)
Washed 3 times in BSS (GIBCO Laboratories) and heat inactivated 1
L-glutamine (2 mM), penicillin (50 U / ml), containing 0% human AB serum,
RPMI supplemented with streptomycin (50 μg / ml) and Hepes (10 mM)
Resuspend in I-1640 (GIBCO Laboratories) (complete RPMI) and plate using microculture format. A synthetic peptide comprising an epitope of the present invention,
10 μg / ml is added to each well and the HBV core 128-140 epitope is added to each well at 1 μg / ml as a source of T cell help during the first week of stimulation.

In a microculture format, 4 × 10 ⁵ PBMC were added at 100 μl / well complete RPM.
Stimulate with peptide in 8 replicate cultures in I 96 well round bottom plates. On days 3 and 10, 100 μl of complete RPMI and 20 U / ml final concentration of rIL
-2 is added to each well. On day 7, the culture was transferred to a flat bottom 96-well plates and peptide are restimulated with self feeder cells of radioactive (3,000 rad) of rIL-2 and 10 ^5. The culture is tested for cytotoxicity on day 14. A positive CTL response is as described previously (Rehermann et al., Nature.
e Med. 2: 1104, 1108, 1996; Rehermann et al. Clin
. Invest. 97: 1655-1665, 1996; and Rehermann et al.,
J. et al. Clin. Invest. 98: 1432-1440, 1996) Based on a comparison with unaffected control subjects, two or more of the eight replicate cultures require more than 10% specific ⁵¹ Cr release.

The target cell line is autologous and allogeneic EBV transformed B-LCL, both of which are American Society for Histocompatibility
purchased from or written as it and Immunogenetics (ASHI, Boston, Mass.) (Guihot et al., J. Virol. 66: 2).
670-2678, 1992) either established from a pool of patients.

Cytotoxicity assays are performed in the following manner. Target cells consist of either allogeneic HLA-compatible B lymphoblast cell lines or autologous EBV transformed B lymphoblast cell lines, which are overnight with 10 μM of the synthetic peptide epitope of the present invention. Incubate and 100 μCi ⁵¹ Cr (Amersham Corp., Arlingto)
n Heights, IL) for 1 hour, after which these are labeled with HBSS
Wash 4 times with.

Cytotoxic activity is determined in a standard 4-hour, separate well ⁵¹ Cr release assay using a U-bottom 96-well plate containing 3,000 targets / well. Stimulated P
BMC are tested on day 14 at an effector / target (E / T) ratio of 20-50: 1. The% cytotoxicity is determined from the formula: 100 × [(experimental release−spontaneous release) / (maximum release−spontaneous release)]. Maximum release was determined by surfactant (2% Triton X-100; Sig
ma Chemical Co. , St. Determined by lysis of the target by Louis, MO). Spontaneous release is less than 25% of maximum release for all experiments.

The results of such analysis indicate that the HLA-restricted CTL population is 98P4B6 or 98P4B6
Shows the degree stimulated by previous exposure to the vaccine.

Similarly, class II constrained HTL responses can also be analyzed. Purified PBMC is
Culture in 96 well flat bottom plates at a density of 10 ⁵ cells / well and stimulate with 10 μg / ml of the synthetic peptide of the invention, whole 98P4B6 antigen, or PHA. Cells are routinely plated as 4-6 well replicas for each condition. After 7 days of culture, the medium is removed and replaced with fresh medium containing 10 U / ml IL-2. 2
After one day, 1 μCi of ³ H thymidine is added to each well and incubation is continued for an additional 18 hours. Cellular DNA is then collected on a glass fiber mat and analyzed for ³ H thymidine incorporation. Antigen-specific T cell proliferation, to calculate the ^{3 H-thymidine} incorporation in the presence of an antigen as divided by the ratio with ^{3 H-thymidine} incorporation in the absence of antigen.

Example 29: Induction of specific CTL responses in humans
Human clinical trials for immunogenic compositions comprising CTL and HTL epitopes of the invention are set up as an IND phase I, dose escalation study and conducted as a randomized, double-blind placebo controlled trial. Such a test is designed, for example, as follows:
A total of about 27 individuals are enrolled and divided into three groups;
Group I: 3 subjects are injected with placebo and 6 subjects are injected with 5 μg of the peptide composition;
Group II: 3 subjects are injected with placebo and 6 subjects are injected with 50 μg of the peptide composition;
Group III: 3 subjects are injected with placebo and 6 subjects are injected with 500 μg of the peptide composition.

  Four weeks after the first injection, all subjects were boosted at the same dose.

The endpoint measured in this study is related to the safety and tolerability of the peptide composition and its immunogenicity. The cellular immune response to the peptide composition is an indicator of the intrinsic activity of the peptide composition and can therefore be seen as a measure of biological effectiveness.
The following summarizes clinical and laboratory data regarding safety and efficacy endpoints.

Safety: The incidence of adverse events is monitored in the placebo and drug treatment groups and evaluated with their extent and reversibility.

Assessment of vaccine efficacy: Blood is drawn from the subject before and after injection for assessment of vaccine efficacy. Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted into freezing media and stored frozen. Samples are assayed for CTL activity and HTL activity.

  Vaccines are found to be safe and effective.

Example 30: Phase II study in patients expressing 98P4B6
A phase II study is conducted to study the effect of administration of the CTL-HTL peptide composition to patients with cancer that express 98P4B6. The primary purpose of this study is 98P4B6
To determine the effective dose and regimen to induce CTL in cancer patients that express C, establish the safety of inducing CTL and HTL responses in these patients, and how much CTL To see if activation improves the clinical picture of these patients as evidenced (eg, by lesion reduction and / or atrophy).
Such a study is designed as follows, for example.

This study will be conducted at multiple facilities. The study design is an open-label, uncontrolled dose escalation protocol where the peptide composition is administered as a single volume,
This is followed by a single booster injection of the same dose after 6 weeks. This dose is 50 μg, 500 μg, and 5,000 μg per injection. Record adverse drug effects (severity and reversibility).

There are three patient groups. The first group is injected with 50 μg of this peptide composition, and the second and third groups are injected with 500 μg and 5,000 μg of peptide composition, respectively. Patients within each group range from 21 years to 65 years and show different racial population backgrounds. All of them have tumors that express 98P4B6.

Clinical expression or antigen-specific T cell responses are monitored to evaluate the effects of administering this peptide composition. This vaccine composition is found to be safe and effective in the treatment of 98P4B6-related diseases.

Example 31 Induction of CTL Response Using Prime Boost Protocol
Underlying protocols and protocols used to confirm the effectiveness of DNA vaccines in transgenic mice, as described in the examples entitled "Plasmid constructs and the extent to which the plasmid constructs induce immunogenicity" Prime boost protocols with similar principles can also be used to administer vaccines to humans. Such vaccine regimens include, for example, initial boosting of naked DNA and subsequent boosting with the administration of a recombinant virus encoding the vaccine, or a recombinant protein / polypeptide or peptide mixture administered in an adjuvant. obtain.

For example, the initial immunization can be performed using an expression vector (eg, “minigene” multi-epitope DN
The example entitled “A plasmid construction” was prepared in a quantity of 0.5 mg to 5 mg IM (
Or SC or ID) expression vectors as constructed in the form of naked nucleic acids to be administered. This nucleic acid (0.1 μg to 1000 μg) can also be administered using a gene cancer. After a 3-4 week incubation period, a booster dose is then administered. The booster can be a recombinant fowlpox virus administered at a dose of 5 × 10 ⁷ pfu to 5 × 10 ⁹ pfu. Alternative recombinant viruses (eg, MVA virus, canarypox virus, adenovirus, or adeno-associated virus) can also be used for boosters, or polyepitope proteins or mixtures of these peptides can be administered. For assessment of vaccine efficacy, patient blood samples are obtained at intervals prior to immunization and after administration of the initial vaccine and vaccine booster dose. Peripheral blood mononuclear cells are isolated from fresh heparinized blood by Ficoll-Hypaque density gradient centrifugation, aliquoted into frozen media and stored frozen. The sample,
Assay for CTL activity and HTL activity.

Analysis of these results indicates that a response is generated that is strong enough to achieve therapeutic or protective immunity to 98P4B6.

(Example 32: Administration of vaccine composition using dendritic cells (DC))
Vaccines containing the peptide epitopes of the present invention are designated as APC or “professional”
Administration can be with APC (eg, DC). In this example, peptide-pulsed DC is administered to a patient to stimulate a CTL response in vivo. In this method, dendritic cells are isolated, expanded, and the peptide CTL epitopes and peptides HT of the present invention
Pulse with vaccine containing L epitope. These dendritic cells are injected back into the patient to elicit CTL and HLT responses in vivo. The induced CTL and H
TL destroys or promotes the destruction of each target cell carrying the 98P4B6 protein from which the epitope in this vaccine is derived.

For example, administering a cocktail of epitope-containing peptides to PBMCs ex vivo,
Alternatively, DC isolated from it is administered. Drugs that facilitate the recovery of DC (eg,
Progenipoietin ^™ (Monsanto, St. Louis, MO) or GM-CSF / IL-4) may be used. After pulsing the DC with the peptide and prior to reinfusion into the patient, the DC is washed to remove unbound peptide.

The number of DCs reinfused into the patient can vary as is clinically understood and easily determined by one of ordinary skill in the art based on clinical results (eg, Nature Med. 4:32).
8, 1998; Nature Med. 2:52, 1996 and Prostate 3
2: 272, 1997). Typically 2-50 × 10 ⁶ DCs are administered per patient, although higher numbers of DCs (eg, 10 ⁷ or 10 ⁸ ) may also be provided. Such cell populations typically contain between 50% and 90% DC.

In some embodiments, peptide-loaded PBMC are injected into a patient without purifying DC. For example, PBMC produced after treatment with a drug (eg, Progenipoietin ^™ ) is injected into a patient without purifying the DC. PB administered
The total number of MCs often ranges from 10 ⁸ to 10 ¹⁰ . In general, the cell dose injected into a patient is based on the percentage of DC in the blood of each patient, as determined, for example, by immunofluorescence analysis using specific anti-DC antibodies. Thus, for example, Progen
If ipoietin ^™ mobilizes 2% DC in the peripheral blood of a given patient and that patient is receiving 5 × 10 ⁶ DC, this patient will receive a total of 2.5 × 10 ⁸ peptide loaded PBMC Inject. The DC% mobilized by an agent (eg, Progenipoietin ^™ ) is typically estimated to be between 2-10%, but can vary as will be appreciated by those skilled in the art.

(Activation of CTL / HTL response ex vivo)
Alternatively, the ex vivo CTL or HTL response to the 98P4B6 antigen is
Patient or genetically compatible CTL precursor cells or HTL precursor cells can be derived by incubating in tissue culture with a source of APC such as DC and an immunogenic peptide. After an appropriate incubation time (typically about 7-28 days), the progenitor cells are activated and expanded into effector cells. The effector cells are injected into the patient and destroy (CTL) or promote destruction (HTL) of specific target cells (ie, tumor cells).

(Example 33: Alternative method for identification and confirmation of motif-bearing peptide)
Another way to identify and confirm a motif-bearing peptide is to elute the peptide from cells that carry a defined MHC molecule. For example, EB used for tissue type determination
B cell lines transformed with V have been extensively characterized to determine which HLA molecules they express. In certain cases, these cells express only a single type of HLA molecule. These cells can be transfected with a nucleic acid that expresses the antigen of interest (eg, 98P4B6). The peptide produced by endogenous antigen processing of the peptide produced as a result of transfection then binds to intracellular HLA molecules and is transported and presented on the cell surface. The peptides are then eluted from the HLA molecule by exposure to mild acid conditions, and these amino acid sequences are analyzed using, for example, mass spectrometry (eg, Kubo et al., J. Immunol. 152: 3913, 1994). decide. Since most of the peptides that bind to a particular HLA molecule carry a motif, this is an alternative way to obtain a motif-bearing peptide associated with a particular HLA molecule expressed on a cell.

Alternatively, cell lines that do not express endogenous HLA molecules can be transfected with an expression construct that encodes a single HLA allele. These cells can then be used as described (ie, these cells are transfected with a nucleic acid encoding 98P4B6 to isolate the peptide corresponding to 98P4B6 displayed on the cell surface. Can be). Peptides obtained from such analyzes possess a motif that corresponds to binding to a single HLA allele expressed in cells.

As will be appreciated by those skilled in the art, a similar analysis in cells carrying more than one HLA allele, followed by determination of specific peptides for each expressed HLA allele. Furthermore, those skilled in the art will also recognize that means other than transfection, such as loading with protein antigens, can be used to provide a source of antigen to the cells.

(Example 34: Complementary polynucleotide)
A sequence complementary to the 98P4B6 coding sequence or any portion thereof is used to detect, reduce or inhibit the expression of naturally occurring 98P4B6. Although the use of oligonucleotides comprising about 15-30 base pairs is described, substantially the same means are used with smaller or larger sequence fragments. Suitable oligonucleotides are described, for example, in OLIGO 4.06 software (National Biosc
ienses) and 98P4B6 coding sequences. In order to inhibit transcription, a complementary oligonucleotide is designed from the most unique 5 'sequence and the complementary oligonucleotide is used to prevent promoter binding to the coding sequence. To inhibit translation, complementary oligonucleotides are designed to prevent ribosome binding to the transcript encoding 98P4B6.

Example 35: Purification of naturally occurring 98P4B6 or recombinant 98P4B6 using 98P4B6 specific antibodies
Naturally occurring 98P4B6 or recombinant 98P4B6 is substantially purified by immunoaffinity chromatography using an antibody specific for 98P4B6. An immunoaffinity column can be prepared using an activated chromatography resin (eg CNBr-activated SEPHAR
OSE (Amersham Pharmacia Biotech)) anti-98P4B6
Constructed by covalently linking antibodies. After this bonding, the resin is blocked and washed according to the manufacturer's instructions.

The medium containing 98P4B6 is passed through an immunoaffinity column and the column is 98P
Wash under conditions that preferentially adsorb 4B6 (eg, high ionic strength buffer in the presence of surfactant). The column is eluted under conditions that interfere with antibody / 98P4B6 binding (eg, pH 2 to pH 3 buffers, or high concentrations of chaotropes (eg, urea or thiocyanate ions)) and GCR. Collect P.

Example 36: Identification of molecules that interact with 98P4B6
98P4B6 or a biologically active fragment thereof, 121 1 Bolton
-Label with Hunter reagent. (For example, Bolton et al. (1973) Biochem.
. J. et al. 133: 529. checking ... ) Candidate molecules pre-ordered in the wells of a multi-well plate are incubated with labeled 98P4B6, washed, and any well containing labeled 98P4B6 complex is assayed. 98P4 with different concentrations
Using the data obtained using B6, the number, affinity, and 98P4 of 98P4B6
The value of association between B6 and the candidate molecule is calculated.

Example 37: In vivo assay for promoting 98P4B6 tumor growth
The effect of 98P4B6 protein on tumor cell proliferation is assessed in vivo by gene overexpression in tumor-bearing mice. For example, in a SCID mouse, 1 × 10 ⁶ 3
T3 cells, prostate cancer cell lines (eg PC3 cells), bladder cancer cell lines (eg UM-UC)
3 cells), kidney cancer cell lines (eg CaKi cells), or lung cancer cell lines (eg A42)
7 cells) (tkNeo empty vector or 98P)
4B6) is injected subcutaneously into each flank. At least two strategies may be used: (1) Polyoma virus, fowlpox virus (UK2, 211, 504 (198
Such as adenovirus (eg adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40)). Under the control of a promoter, such as a constructed promoter obtained from the genome of or a heterologous mammalian promoter (eg, an actin promoter or an immunoglobulin promoter) (as long as these promoters are compatible with the host cell system) Constitutive 98P4B6 in
And (2) regulated expression under the control of an inducible vector system (eg, ecdysone, tet, etc.) (as long as these promoters are compatible with the host cell system). Tumor volume is then monitored for the appearance of obvious tumors and followed over time. Then 9
Confirm that 8P4B6-expressing cells proliferate at a faster rate and that tumors produced by 98P4B6-expressing cells are characterized by altered aggressiveness (eg, enhanced metastasis, angiogenesis, decreased response to chemotherapeutic drugs) To do.

In addition, mice can be orthotopically transplanted with 1 × 10 ⁵ identical cells, and 98P4B6 has an effect on local proliferation in the prostate and / or its cells specifically metastasize to, for example, lung, lymph nodes, and bone marrow It can be determined whether it has an effect on the ability to do.

This assay also includes 98 of candidate therapeutic compositions (eg, small molecule drugs, 98P4B6 intracellularly expressed antibodies, 98P4B6 antisense molecules and ribozymes).
Useful for determining P4B6 inhibitory effects.

Example 38: 98P4B6 monoclonal antibody-mediated inhibition of prostate tumors in vivo
Significant expression of 98P4B6 in cancer tissue, along with its restricted expression in normal tissue with cell surface expression, makes 98P4B6 an excellent target for antibody therapy. Similarly 98
P4B6 is a target for T cell-based immunotherapy. Accordingly, the therapeutic efficacy of anti-98P4B6 mAb in a human cancer xenograft mouse model is shown in prostate cancer, listed in Table 1,
Recombinant cell lines (eg, PC3, including lung cancer, bladder cancer, kidney cancer and other 98P4B6 cancers)
-98P4B6, UM-UC3-98P4B6, CaKi-98P4B6, A427-9
8P4B6 and 3T3-98P4B6) (eg, Kaihn, ME et al., Inv
est Urol, 1979.17 (1): 16-23), and human prostate xenograft models, human kidney xenograft models, and human bladder xenograft models (eg, LAPC 9AD, AGS- K3 and AGS-B1) (Saffran, D
. Et al., PNAS 1999, 10: 1073-1078).

Antibody effects on tumor growth and metastasis formation are studied, for example, in mouse orthotopic prostate cancer xenograft model, kidney xenograft model, bladder xenograft model and lung xenograft model. This antibody may be unbound as discussed in this example or may be combined in a therapeutic modality as is understood in the art. Anti-98P4B6 m
Ab inhibits tumor formation in prostate xenografts, kidney xenografts, bladder xenografts and lung xenografts. Anti-98P4B6 mAb also delayed the growth of established orthotopic tumors in tumor-bearing mice and prolonged survival of tumor-bearing mice. These results show that these results show anti-98P in the treatment of the localized and advanced stages of some solid tumors.
Show the utility of 4B6 mAb (eg, Saffran, D. et al., PNAS 10: 1
073-1078 or World Wide Web URL pnas. org / cgi / do
i / 10.1073 / pnas. 051624698).

Administration of anti-98P4B6 mAb slows established orthotopic tumor growth and inhibits metastasis to distant sites, resulting in a significant increase in survival of tumor-bearing mice. These studies
We show that 98P4B6 is an attractive target for immunotherapy and show the therapeutic use of anti-98P4B6 mAb for the treatment of local and metastatic prostate cancer. This example is non-binding to inhibit the growth of human prostate tumor xenografts, human kidney tumor xenografts, human bladder tumor xenografts, and human lung tumor xenografts grown in SCID mice. It shows that the embodied 98P4B6 monoclonal antibody is effective.

(Tumor inhibition using multiple unconjugated 98P4B6 mAbs)
(Materials and methods)
(98P4B6 monoclonal antibody):
Monoclonal antibodies are raised against 98P4B6 as described in the example under the heading “Generation of 98P4B6 Monoclonal Antibody (mAb)”. This antibody is 98P4B
Their ability to bind to 6 is characterized by ELISA, Western blot, FACS, and immunoprecipitation. The epitope mapping data for anti-98P4B6 mAb as measured by ELISA and Western analysis is 98P4
Recognizes an epitope on the B6 protein. Immunohistochemical analysis of prostate cancer tissue, kidney cancer tissue, bladder cancer tissue, and lung cancer tissue, and cells is performed using these antibodies.

Monoclonal antibodies are purified from ascites fluid or hybridoma tissue culture supernatant by protein G sepharose chromatography, dialyzed against PBS, filter sterilized, and stored at -20 ° C. Protein measurement is performed using the Bradford assay (Bio-R
ad, Hercules, CA). A cocktail containing a therapeutic monoclonal antibody or a mixture of individual monoclonal antibodies is prepared and a PC3 tumor xenograft, UM-
Used for treatment of mice receiving subcutaneous or orthotopic injections of UC3 tumor xenografts, CaKi tumor xenografts and A427 tumor xenografts.

(Cancer xenografts and cell lines)
LAPC-9 xenografts, which express wild type androgen receptor and produce prostate specific antigen (PSA), were isolated from 6-8 week old male ICR severe combined immunodeficiency (S
(CID) In mice (Taconic Farms), subcutaneous trocar implantation (Cra)
ft, N.M. Et al., Above). Prostate cancer cell line (PC3), lung cancer cell line (AA)
27), ovarian cancer cell line (PA1) (American Type Culture Co)
detection) RPMI or D supplemented with L-glutamine and 10% FBS
Maintain in MEM.

PC3-98P4B6 cell population, A427-98P4B6 cell population, PA1-98P4
The B6 cell population, and the 3T3-98P4B6 cell population were obtained from Hubert, R .; S. Et al., S
TEAP: A Prostate-specific Cell-surface An
tigen Highly Expressed in Human Prostate
Tumors (Proc Natl Acad Sci USA, 1999.96
(25): 14523-8)). LAPC-9 xenografts (expressing wild type androgen receptor and producing prostate specific antigen (PSA)) were obtained by subcutaneous trocar transplantation in 6-8 week old male ICR severe combined immunodeficiency (SCID) mice. (Taconic Farms) (Craft, N. et al., Nat Med. 1999: 5: 280). LAPC-
A single cell suspension of 9 tumor cells is prepared as described in Craft et al. Similarly, xenografts from kidney (AGS-K3) and bladder (AGS-B1) patients are passaged in 6-8 week old male ICR-SCID mice.

(Xenograft mouse model)
Subcutaneous (sc) tumors were placed on the right flank of male SCID mice with Matrigel (Col.
2 × 10 ⁶ L mixed at 1: 1 dilution with abortive Research)
APC-9 cells, PC3 cells, PC3-98P4B6 cells, A427 cells, A427-9
8P4B6 cells, PA1 cells, PA1-98P4B6 cells, 3T3 cells or 3T3-9
Produced by injecting 8P4B6 cells. To test the antibody effect on tumorigenesis, i. p. Antibody injection begins on the same day as tumor cell injection. As a control,
Mice are injected with either purified mouse IgG (ICN) or PBS; or a purified monoclonal antibody that recognizes an irrelevant antigen that is not expressed in human cells. In preliminary studies, there is no difference between mouse IgG or PBS for tumor growth. Tumor size is determined by caliper measurements, and tumor volume is calculated as length x width x height. S. Of diameter greater than 1.5 cm. c. Mice with tumors are sacrificed. PSA levels were measured using the PSA ELISA kit (Anogen, Mississauga, Ontario)
Determine by using o). Calculation of anti-98P4B6 mAb level is based on capture EL
ISA kit (Bethyl Laboratories, Montgomery, TX
) (E.g., Saffran, D. et al., PNAS 10: 1073-10).
78 or World Wide Web pnas. org / cgi / doi / 10.1073 /
pnas. See the URL located at 051624698).

Orthotopic injection is performed under anesthesia by using ketamine / xylazine. For prostate orthotopic studies, an abdominal incision is made to expose the prostate, LAPC tumor cells or PC3
Tumor cells (5 × 10 ⁵ ) are mixed with Matrigel and prostatic sac (pr
injected into the state capsule). To monitor tumor growth, the mice are palpated and blood is drawn on a weekly basis to measure PSA levels. For the renal orthotopic model, an abdominal incision is made to expose the kidney. A mixed with Matrigel
GS-K3 cells are injected under the kidney capsule. Mice were grouped for appropriate treatment and anti-98P4B6 mAb or control mAb was
. p. Inject.

(Anti-98P4B6 mAb inhibits the growth of 98P4B6-expressing xenograft cancer tumors)
The effect of anti-98P4B6 mAb on tumor formation is tested by using the LAPC-9-98P4B6 and PC3-98P4B6 orthotopic models. s. c. When compared to tumor models, orthotopic models require direct tumor injection in mouse organs (eg, prostate, bladder, kidney or lung), local tumor growth, metastasis at distant sites Occurrence, loss of mouse health, and subsequent death (Saffran, D. et al., PNAS supra) occur. Its features allow the orthotopic model to better represent human disease progression and allow us to follow the therapeutic effect of mAb on clinically relevant endpoints.

Therefore, tumor cells were injected into mouse prostate, lung, or ovary and after 2 days, divided into two groups and treated with either: a) 200 to 3 times per week for 2-5 weeks
500 μg anti-98P4B6 Ab, or b) PBS.

A major advantage of orthotopic cancer models is the ability to study metastatic development. The formation of metastases in mice with established orthotopic tumors is an antibody against the prostate-specific cell surface protein STEAP expressed at high levels in LAPC-9 xenografts (Hubert, R. et al.
S. Et al., Proc. Natl Acad. Sci USA, 1999, 96 (25): 1
4523-8) is studied by IHC analysis on lung sections.

Mice with established orthotopic LAPC-9-98P4B6 or PC3-98P4B6 tumors were treated with 10 of either anti-98P4B6 mAb or PBS for 4 weeks.
A 00 μg injection is administered. Both groups of mice establish a high tumor burden and ensure a high frequency of metastasis formation in the mouse lung. The mice are then sacrificed and their prostate and lungs are analyzed for the presence of tumor cells by ICH analysis.

These studies show the broad anti-tumor efficacy of anti-98P4B6 antibodies against prostate cancer initiation and progression in a xenograft mouse model. Anti-98P4B6 antibody inhibits tumor formation, delays the growth of previously established tumors and prolongs the survival of treated mice. Furthermore, the anti-98P4B6 mAb shows whether it is after dramatic relapse for local prostate tumor distal spread, even with large tumor burden. Therefore, anti-98P4B6 mAb is effective against major clinically relevant endpoints (tumor growth), prolonged survival, and health.

Example 39: Curative and diagnostic use of anti-98P4B6 antibodies in humans
Anti-98P4B6 monoclonal antibodies are safe and are effectively used for diagnostic, prophylactic, prognostic and / or therapeutic purposes in humans. Western blot and immunohistochemical analysis of cancer tissues and cancer xenografts using anti-98P4B6 mAb showed a strong and extensive coloration in cancer but at significantly lower or undetectable levels in normal tissues is there. Detection of 98P4B6 in cancer and metastatic disease indicates the usefulness of the mAb as a diagnostic and / or prognostic indicator. Anti-98P4B6 antibodies are therefore used in diagnostic applications (eg, immunohistology of renal biological specimens to detect cancer from suspect patients).

Anti-98P4B6 mAb specifically binds to cancer cells as measured by flow cytometry. Accordingly, anti-98P4B6 antibodies are used in diagnostic whole body imaging applications (eg, radioimmunoscintigraphy and radioimmunotherapy) for the detection of local and metastatic cancers that exhibit 98P4B6 expression (eg, Potamianos). S et al, Anti
cancer Res 20 (2A): 925-948 (2000)). 9
Divergence or release of the extracellular domain of 8P4B6 into the extracellular environment (eg found in alkaline phosphatase B10 (Meerson, N, R, Hepatology 27: 5
63-568 (1998))) allows diagnostic detection of 98P4B6 with anti-98P4B6 antibodies in serum and / or urine samples from suspected patients.

Anti-98P4B6 antibodies that specifically bind 98P4B6 are used in therapeutic applications for the treatment of cancers that express 98P4B6. Anti-98P4B6 antibodies are used as non-binding modalities and binding modalities (eg, prodrugs, enzymes or radioisotopes) in which the antibody is conjugated to one of various therapeutic modalities or imaging modalities well known in the art. The In preclinical studies, unbound and bound anti-antibodies are
Tested for efficacy of tumor prevention and growth inhibition in D mouse cancer xenograft models (eg, renal cancer models AGS-K3 and AGS-K6) (eg, “98P4B6 monoclonal antibody-mediated in vivo bladder and lung tumors See the example entitled “Inhibition”). Either conjugated anti-98P4B6 antibody or unconjugated anti-98P4B6 antibody is used either as a therapeutic modality in human clinical trials alone or in combination with other therapies as described in the examples below.

Example 40: Human clinical trial for the treatment and diagnosis of human carcinomas through the use of human anti-98P4B6 antibodies in vivo
An antibody that recognizes an epitope on 98P4B6 is used in accordance with the present invention and this antibody is used in the treatment of specific tumors as listed in Table 1. Many factors (98P
Based on 4B6 expression levels) tumors as listed in Table 1 are currently preferred indicators. In connection with each of these indicators, three clinical approaches are successfully implemented.

I. ) Adjunct therapy: In adjunct therapy, patients are treated with anti-98P4B6 antibody in combination with chemotherapeutic or anti-neoplastic agents and / or radiation therapy. Primary cancer targets as listed in Table I are treated under standard protocols by adding anti-98P4B6 antibody to the standard therapy of the first and second systems. The protocol design is
Addresses efficacy as assessed by tumor mass reduction and the ability to reduce normal doses of standard chemotherapy. These dosage reductions allow for further and / or prolonged treatment by reducing the dose-related toxicity of the chemotherapeutic agent. Anti-98P4B6 antibodies are used to treat chemotherapeutic or anti-neoplastic agents adriamycin (advanced prostate carcinoma), cisplatin (advanced head and neck carcinoma, and lung carcinoma), taxol (breast cancer) and doxorubicin (preclinical). In combination, it is utilized in several ancillary clinical trials.

II. ) Monotherapy: Anti-98P4B in tumor monotherapy
In connection with the use of 6 antibodies, these antibodies are administered to the patient without chemotherapeutic or anti-neoplastic agents. In one embodiment, monotherapy is performed clinically in end-stage cancer patients with a wide range of metastatic disease. Patients show some disease stabilization. The study demonstrates efficacy in treatment resistant patients with cancerous tumors.

III. ) Contrast agent: Radionuclide (eg iodine or yttrium (I ¹³¹ , Y ^9
By binding ⁰ )) to an anti-98P4B6 antibody, the radiolabeled antibody is utilized as a diagnostic and / or contrast agent. In such a role, the labeled antibody localizes to both solid tumors and metastatic lesions of 98P4B6-expressing cells. In connection with the use of anti-98P4B6 antibodies as contrast agents, these antibodies are useful for solid tumor surgical as both pre-operative screening and post-operative follow-up to determine which tumors remain and / or revert. Used as a treatment aid. In one ^embodiment, (111 In) 98P4
The B6 antibody is used as a contrast agent in phase I human clinical trials in patients with carcinomas expressing 98P4B6 (by analogy, for example, Divgi et al., J. Natl. Ca
ncer Inst. 83: 97-104 (1991)). The patient is tracked with a standard front and rear gamma camera. These results indicate that primary and metastatic lesions are identified.

(Dose and route of administration)
As will be appreciated by those skilled in the art, dosing considerations can be determined relative to similar products present in the clinic. Accordingly, anti-98P4B6 antibody can be administered at dosages ranging from 5 to 400 mg / m ² , eg, used at lower dosages for safety testing. The affinity of an anti-98P4B6 antibody compared to the affinity of a known antibody for its target is one parameter used by those skilled in the art to determine a similar dosage regimen. Furthermore, anti-98P4B6 antibodies that are fully human antibodies have a slower clearance when compared to chimeric antibodies; thus, such anti-98P4 antibodies that are fully human antibodies.
Dosing in patients with the B6 antibody may be lower and still remain effective, perhaps in the range of 50-300 mg / m ² . Contrary to conventional volume measurements in mg / kg, dosing in mg / m ² is a surface area based measurement and convenient dosing designed to include patients of all sizes from infants to adults It is a measurement.

Three separate delivery approaches are useful for the delivery of anti-98P4B6 antibodies. Conventional intravenous delivery is one standard delivery technique for many tumors. However, for intraperitoneal tumors (eg, tumors of the ovary, bile duct, other ducts, etc.) intraperitoneal administration is advantageous to obtain high doses of antibody in the tumor and also to minimize antibody clearance You can prove that. In a similar manner, certain solid tumors have vasculature that is appropriate for local perfusion. Local perfusion allows high doses of antibody at the tumor site and minimizes short term clearance of the antibody.

(Clinical Development Plan (CDP))
Overview: CDP is anti-98P4B for adjuvant treatment, monotherapy and as a contrast agent
Follow and develop 6 antibody treatments. The study will first demonstrate safety and then confirm efficacy with repeated dosing. The study is open label comparing standard chemotherapy with standard therapy plus anti-98P4B6 antibody. As will be appreciated, one criterion that can be utilized for patient enrollment is the expression level of 98P4B6 in the patient's tumor, as determined by biopsy.

As with any protein or antibody injection-based therapy, safety considerations are primarily related to: (i) cytokine release syndrome (ie, hypotension, fever, shakings, chills) (Ii) generation of an immune response to the substance (ie, the patient eliciting a human antibody to antibody therapy or a HAHA response); and (iii)
Toxicity to normal cells expressing 98P4B6. Standard tests and tracking are utilized to monitor each of these safety considerations. Anti-98P4B6 antibodies are found to be safe upon human administration.

Example 41 Human Clinical Trial Adjuvant Treatment Using Human Anti-98P4B6 Antibody and Chemotherapeutic Agent
A Phase I human clinical trial is initiated to evaluate the safety of six intravenous doses of human anti-98P4B6 antibody for the treatment of solid tumors (eg, cancer of tissues listed in Table I).
In this study, antineoplastic or chemotherapeutic agents as defined herein (eg cisplatin, topotecan, doxorubicin, adriamycin, taxol, etc.
The safety of a single dose of anti-98P4B6 antibody is evaluated when used as an adjunct therapy to (but not limited to). The study design involves the delivery of six single doses of anti-98P4B6 antibody, where the antibody dosage is approximately about 2 over the course of treatment according to the following schedule:
Increase from 5 mg / m ² to about 275 mg / m ² :

抗体および化学治療剤のそれぞれの投与後、患者を１週間密接に追跡する。特に、上記
の安全性の問題：（ｉ）サイトカイン放出症候群（すなわち、低血圧、発熱、振せん（ｓ
ｈａｋｉｎｇ）、悪寒）；（ｉｉ）その物質に対する免疫原性応答の発生（すなわち、ヒ
ト抗体治療剤に対する、患者によるヒト抗体の発生、またはＨＡＨＡ応答）；ならびに（
ｉｉｉ）９８Ｐ４Ｂ６を発現する正常細胞に対する毒性について、患者を評価する。標準
的な試験および追跡試験を利用して、これらの安全性の問題のそれぞれをモニターする。
患者はまた、臨床結果について、そして特に、ＭＲＩまたは他の画像化によって証明され
るような腫瘍塊の低減について、評価される。

Patients are followed closely for one week after each administration of antibody and chemotherapeutic agent. In particular, the above safety issues: (i) cytokine release syndrome (ie, hypotension, fever, tremor (s
(ii) generation of an immunogenic response to the substance (ie generation of a human antibody by a patient, or HAHA response to a human antibody therapeutic);
iii) Patients will be evaluated for toxicity to normal cells expressing 98P4B6. Standard and follow-up tests are utilized to monitor each of these safety issues.
Patients are also evaluated for clinical outcome and in particular for tumor mass reduction as evidenced by MRI or other imaging.

This anti-98P4B6 antibody has proven to be safe and effective, and Phase II of the clinical trial confirms this efficacy and refines optimal dosing.

Example 42: Human clinical trial: Monotherapy with human anti-98P4B6 antibody (mono
therapy))
Anti-98P4B6 antibodies are safe with respect to the adjunct studies discussed above, and Phase II human clinical trials confirm efficacy and optimal dosing for monotherapy. Such a test is achieved and includes the same safety and results analysis as the adjunct test described above, except that the patient receives multiple doses of anti-98P4B6 antibody and does not receive chemotherapy at the same time.

Example 43 Human Clinical Trial: Diagnostic Imaging Using Anti-98P4B6 Antibody
Again, if the adjuvant therapy discussed above is safe within the safety criteria discussed above, human clinical trials will be conducted regarding the use of anti-98P4B6 antibodies as diagnostic contrast agents. This protocol is designed in a manner that is substantially similar to that described in the art (
For example, Divgi et al. Natl. Cancer Inst. 83: 97-104 (
1991)). This antibody is found to be safe and effective when used as a diagnostic modality.

Example 44: Comparison of 98P4B6 homology with known sequences
98P4B6 protein is a known human protein (ie, human STAMP1 (g
i 15418732) (Korkmarz, KS et al., J. Biol. Chem. 2
002, 277: 36689), showing 99% identity and 99% homology to this gene (FIG. 4). This 98P4B6 protein is also linked to another human prostate 2 6-transmembrane epithelial antigen (gi23308593) (Walker, MG, et al., Ge
name Res. 1999, 9: 1198; Porka, K .; P. , Heleniu
s, M.M. A. And Visakorpi, T .; Lab. Invest. 2002, 82:
1573) shows 99% identity and 99% homology. The closest mouse homologue to 98P4B6 is prostate 2 6 transmembrane epithelial antigen (gi28501136) with 97% identity and 99% homology. We have identified several variants of 98P4B6, including 4 splice variants and 3 SNPs (FIG. 11). 98
P4B6 v. 1 consists of 454 amino acids and has a calculated molecular weight of 52 Da and pI 8
. 7 This is a six-transmembrane protein that can localize to the cell surface or possibly to the endoplasmic reticulum (Table VI). Several 98P4B6 variants (v.1, v.5-8, v
. 13, v. 14, v. 21, v. 25) share similar characteristics (functionally important proteins are also chief, and share structural commonality (eg, multiple transmembrane domains).
P4B6 v. 2 is a short protein containing no known motif.

Motif analysis revealed the presence of several known motifs, including oxidoreductase, cysteine hydrolase, and dudulin motifs. Variant v. 7 and this variant SNP also often carry an Ets motif that is implicated in transcriptional activity.

Several oxidoreductases (NADH / quinone oxidoreductases) have been identified in mammalian cells. This protein binds to the cell membrane and is proton / Na
+ Functions as a pump. This regulates the proteolysis of the tumor suppressor p53,
Protect mammalian cells from oxidative stress, cytotoxicity, and mutagens (Asher
G. Et al., Proc Natl Acad Sci USA 2002, 99: 13125.
Jaiswal Ak, Arch Biochem Biophys 2000, 37;
5:62, Yano T, Mol Aspects Med 2002, 23: 345)
. Homocysteine hydrolase is known to catalyze the degradation of S-adenosylhomocysteine to homocysteine and adenine and ultimately regulate transmethylation, thereby regulating protein expression, cell cycle and proliferation. An enzyme (Tumer
MA et al., Cell Biochem Biophys 2000; 33: 101; Zha.
ng et al., J Biol Chem. 2001; 276: 35867).

This information indicates that 98P4B6 plays a role in cell growth in mammalian cells and regulates gene transcription and electronic and small molecule transport. Thus, if 98P4B6 functions as a regulator of cell proliferation, tumorigenesis, or a transcriptional regulator involved in activating genes involved in inflammation, tumorigenesis, or proliferation,
4B6 is useful for therapeutic, diagnostic, prognostic and / or prophylactic purposes. Furthermore, when a 98P4B6 molecule (eg, a variant or polymorphism) is expressed in cancerous tissue, it is used for therapeutic, diagnostic, prognostic, and / or prophylactic purposes.

(Example 45: Phenotypic effect of STEAP-2 expression)
It has the amino acid sequence shown in FIG. 2 and American Type on July 2, 1999.
e Deposited with Culture Collection and ATCC deposit number PTA-31
STEAP- encoded by a cDNA insert in a plasmid assigned 1
Experiments on the expression of two proteins. As deduced from the coding sequence, the open reading frame encodes 454 amino acids with six transmembrane domains. ST
A summary of features associated with EAP-2 protein is shown in FIG.

The data presented in this patent application provides a STEAP-2 protein expression profile that is preferentially specific to the prostate among normal tissues for certain types of prostate tumors as well as other tumors. This evidence is based on detecting messenger RNA using Northern blotting. In maintaining standard practice in this industry, Northern blots are routinely used to assess gene expression. This is because it does not require time-consuming processes of synthesizing related proteins, raising antibodies, confirming antibody specificity, requiring protein Western blotting, and histological examination of tissues. It is. Northern blotting provides a reliable and efficient method for assessing RNA expression and expression levels.

This example shows that STEAP-2 protein is actually produced. In summary, these experiments showed that PC-3 cells and 3T3 cells modified to include an expression system for STEAP-2 generally showed increased levels of tyrosine phosphorylation, particularly phosphorylation of the ERK protein. It shows that. This data also shows that PC-3 cells containing an expression system for STEAP-2 showed altered calcium efflux, altered response to paclitaxel, and global inhibition of drug-induced apoptosis. These are effects shown at the protein level, but with these data alone, STEAP-2 protein may show.

Furthermore, although such phenotypic effects are protein mediated, further evidence is ST
It shows that the EAP-2 protein itself is a mediator of these effects. This evidence
It is obtained by utilizing a modified STEAP-2 protein. The expression system is stably introduced into PC3 and 3T3 cells, which allows modified passage of STEAP-2 (STE
Expression of AP-2CFl (referred to as “Fl” for flag)) is allowed. STEA
P-2CF1 is a STEAP-2 protein with a peptide extension (ie, a Flag epitope) that changes the physical conformation of the protein. This Flag epitope is a sequence of 8 amino acids and is often introduced at the amino or carboxy terminus of the protein as a means of identifying and tracking recombinant proteins in engineered cells (Slotstra JW et al., Mol Divers 1997, 2: 156). In most cases, introduction of a Flag epitope at either end of the protein has little effect on the natural function and location of the protein (Molloy SS et al.,
EMBO J 1994, 13:18). However, this depends on the characteristics of the protein that is Flag-tagged. Recent studies have shown that Flag tags affect the function and conformation of selected proteins (eg, CLN3 protein) (eg, H
askell RE et al., Mol Genet Metab 1999, 66: 253).
With CLN3, introduction of a Flag epitope at the C-terminus of STEAP-2 changes the physical conformation and properties of this protein. Changes in STEAP-2 protein using the C-Flag epitope resulted in a significant reduction in the effects otherwise observed (phosphorylation of ERK and resistance to drug derivative cell death). This data indicates that it is STEAP-2 protein that mediates these phenotypic effects. Finally, in vitro translation using rabbit reticulocyte lysate showed that STEAP-2 protein
It has been translated to show the expected molecular weight.

FIGS. 20 and 21 show the results obtained when PC-3 and 3T3 cells were modified to include the indicated proteins (including STEAP-1, STEAP-2 and STEAP-2CF1), respectively. Indicates. Gene-specific expression is expressed by long terminal repeats (LTR).
) Was driven from. Mammalian cells that stably expressed the protein were selected using a neomycin resistance gene. PC-3 and 3T3 cells were transduced with retrovirus, selected in the presence of G418, and cultured under conditions that allowed expression of the STEAP-2 coding sequence. The cells were grown overnight in low concentrations of FBS (0.5-1% FBS) and then planted with 10% FBS. The cells were lysed in EIPA buffer and quantified for protein concentration. Whole cell monsters were separated by SDS-PAGE and anti-phospho-ER
Analysis was by Western blotting using K (Cell Signaling Inc.) or anti-phosphotyrosine (UBI) antibodies (FIGS. 20, 21, and 22). As shown in FIG. 20, cells modified to contain STEAP-2 contain an increased amount of phosphorylated tyrosine compared to non-transformed PC-3 cells. Similar results from similar experiments on 3T3 cells are shown on page 3. In this latter experiment, the STEAP-2CF1 expression system was also transfected into 3T3 cells. This cell was used as a control. As shown in FIG. 21, the enhanced phosphorylation found in the presence of native STEAP-2 was significantly reduced when the conformation of this protein was altered.
Therefore, these results conclude that STEAP-2 protein was produced and mediated the phenotypic effect.

FIG. 22 shows similar results in both PC-3 and 3T3 cells where ERK phosphorylation is specifically detected. This protocol is similar to that shown in paragraph 5 above, except that instead of probing the gel with a phosphotyrosine specific antibody,
The gel is probed with both anti-ERK and anti-phospho ERK antibodies. FIG.
As shown in FIG. 2, both PC-3 cells and 3T3 cells modified to express STEAP-2 are detected in cells transformed to contain STEAP-2CF1 in the presence of 10% FBS. It showed phosphorylation of ERK that was not possible. Background E
In contrast to control PC-3 cells that do not show RK phosphorylation, control 3T3-
neo cells show low levels of endogenous ERK phosphorylation. Processing with 10% FBS is S
ERK protein phosphorylation in cells expressing TEAP-2 was increased compared to 3T3-neo cells, but in 3T3 cells expressing modified STEAP-2 (ie, STEAP-2 CF1), ERK phosphorylation An increase was not observed.

Other effects on cellular metabolism in cells modified to include a STEAP-2 expression system are also shown in our data. FIG. 23 shows enhanced calcium efflux in STEAP-2-containing cells when cells with and without the expression system for STEAP-2 were measured for calcium efflux in the presence of LPA. Using FACS analysis and commercially available indicators (Molecular Probes), parental cells and STEAP
-2 expressing cells were compared for their ability to transport calcium. PC3-
Flu, a calcium-responsive indicator, in neo and PC3-STEAP-2 cells
o4 and Fura red were loaded, incubated in the presence or absence of calcium and LPA, and analyzed by flow cytometry. PC3 cells expressing a known calcium transport factor (PC3-83P3H3 pCatT) were used as a positive control (Biochem Biohys Res Commun.
2001, 282: 729). The table in FIG. 23 shows that STEAP-2 mediates calcium efflux in response to LPA and that the magnitude of calcium efflux is comparable to that produced by known calcium channels.

Furthermore, STEAP-2 expressing PC3 cells showed increased sensitivity to agatoxin (calcium channel blocker) compared to PC3-neo cells. These results indicate that STEAP-2 expression sensitizes PC3 cells to treatment with Ca2 + channel inhibitors. Information derived from the above experiments provides a mechanism by which cancer cells are regulated. This is particularly relevant in the case of calcium. This is because calcium channel inhibitors have been reported to induce death of certain cancer cells (including prostate cancer cell lines) (eg, Batra S., Popper LD, Hartley-
Asp B. Prostate 1991, 19: 299).

FIG. 24 shows that cells transfected with the STEAP-2 expression system have an increased ability to survive exposure to paclitaxel. PC3 lacking STEAP-2 or PC3 expressing STEAP-2 to determine the effect of STEAP-2 on survival
Cells were treated with paclitaxel for 60 hours and assayed for apoptosis using Annexin V and propidium iodide staining conjugated to FITC. In apoptotic cells, the membrane phospholipid phosphatidylserine (PS) translocates from the inner leaflet to the outer leaflet of the membrane, thereby exposing the PS to the external cellular environment. PS is recognized and bound by annexin V, thereby providing scientists with a reliable means of identifying cells that experience programmed cell death. Propidium iodide staining identifies dead cells. FIG. 25 shows that STEAP-2 expression loves paclitaxel-mediated apoptosis 45% compared to paclitaxel-treated PC3-neo cells. The protective effect of STEAP-2 is inhibited when STEAP-2 is modified by the presence of a Flag at its C-terminus as shown in FIG.

Publicly available literature includes several examples of prostate cancer and other cancers that exhibit phenotypic characteristics similar to those observed in PC3 cells expressing STEAP-2. In particular, clinical studies have reported transient tumor regression and / or only partial response in patients treated with paclitaxel. For example, when only about 50% of prostate cancer patients entering paclitaxel single-drug clinical trials were treated with a dose of paclitaxel that induced grade 3 and grade 4 cytotoxicity, a decrease in PSA levels was observed. Not shown, a fairly high level of response was expected based on this dose level. Thus, this data indicates the development of paclitaxel resistance in prostate cancer patients (Beer TM et al., Ann Oncol 2
001, 12: 1273). Similar phenomena such as reduced responsiveness and progressive tumor recurrence have been observed in other studies (eg, Obasajy C. and Hudes).
GR. Hematol Oncol Clin North Am 2001, 15: 5
25). Furthermore, inhibition of calcium efflux in cells that endogenously express STEAP-2 (eg, LNC or P cells) induces their cell death (Sktyma R et al., J Phy.
siol. 2000, 527: 71).

Thus, not only does STEAP-2 protein be produced in the cells tested,
It is also produced in unmodified tumor cells or unmodified prostate cells where the presence of mRNA has been shown. Northern blot data in this application clearly indicates that messenger RNA encoding STEAP-2 is produced in certain prostate and tumor cells. 3T3 cells and PC3 cells, which are themselves tumor cells, are able to translate messenger RNA into proteins. Considering the fact that mRNA is produced because it has been shown that there is no obstacle to translating this messenger in cells similar to tumor cells and prostate cells that have been shown to produce mRNA. It can be concluded appropriately that the protein itself can be detected in unmodified tumor cells or prostate cells. This conclusion is also supported by the pattern of phenotypic changes observed in cells specifically modified to express STEAP-2, which are consistent with the changes observed in cancer cells. Based on the above data, it can be chemically concluded that cells and tissues that produce mRNA encoding STEAP-2 also produce the protein itself.

Example 46: Identification and confirmation of potential signaling pathways
Many mammalian proteins have been reported to interact with signaling molecules and participate in the regulation of signaling pathways (J Neurochem. 2001; 76).
: 217-223). Using immunoprecipitation and Western blotting techniques, 98P
Proteins that bind 4B6 and mediate signaling events are identified. Phospholipid pathway (eg, PI3K, AKT, etc.), adhesion pathway and migration pathway (FAK, Rho, Rac)
Several pathways known to play a role in cancer biology, including mitotic / survival cascades such as ERK, p38, etc.
Can be regulated by P4B6 (Cell Growth Differ. 2000, 1
1: 279; J Biol Chem. 1999, 274: 801; Oncogene.
2000, 19: 3003; Cell Biol. 1997, 138: 913).

To confirm whether 98P4B6 directly or indirectly activates a known signaling pathway in cells, a luciferase (luc) -based transcription reporter assay in cells expressing individual genes I do. These transcription reporters contain consensus binding sites for known transcription factors located downstream of well-characterized signaling pathways. These related transcription factors, signal transduction pathways and reporters of activation stimuli and examples are listed below.

1. NFκB-luc, NFκB / Rel; Iκ-kinase / SAPK; proliferation / apoptosis / stress 2. SRE-luc, SRF / TCF / ELK1; MAPK / SAPK; proliferation / differentiation AP-1-luc, FOS / JUN; MAPK / SAPK / PKC; proliferation / apoptosis / stress ARE-luc, androgen receptor; steroid / MAPK; proliferation / differentiation /
Apoptosis 5. p53-luc, p53; SAPK; proliferation / differentiation / apoptosis CRE-luc, CREB / ATF2; PKA / p38; proliferation / apoptosis / stress.

Gene-mediated effects can be assayed in cells exhibiting mRNA expression. The luciferase reporter plasmid was transformed into lipid-mediated transfection (TFX-50, Pro
mega)). By incubating the cell extract with a luciferin substrate, luciferase activity, which is an indicator of relative transcriptional activity, is measured, and the luminescence of the reaction is monitored with a luminometer.

The signaling pathway activated by 98P4B6 is mapped and used for therapeutic target identification and confirmation. When 98P4B6 is involved in cell signaling,
This is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 47: 98P4B6 functions as a proton or small molecule transport factor)
Analysis of the sequence and homology of 98P4B6 indicates that 98P4B6 can function as a transport factor. To confirm that STEAP-1 functions as an iron channel,
CS analysis and fluorescence microscopy techniques are used (Gergely L. et al., Clin Di).
agn Lab Immunol. 1997; 4:70; Skryma R et al., J Ph.
ysiol. 2000.527: 71). FACS analysis and commercial support (Molec
(Ulary Probs) is used to compare parental cells and cells expressing 98P4B6 for their ability to transport calcium. For example, PC3 cells and PC3-9
8P4B6 cells are loaded with calcium responsive indicators Fluo4 and Fura red, incubated in the presence or absence of calcium and LPA, and analyzed by flow cytometry. Ion flux is an important mechanism by which cancer cells are regulated. This is especially true in the case of calcium. This is because calcium channel inhibitors have been reported to induce death of certain cancer cells (including prostate cancer cells) (Batra S, Popper LD, Hartley-Asp).
B. Prostate 1991, 19: 299). Similar results can be concluded using indicators such as sodium, potassium and pH.

Due to its homology to oxidoreductase, 98P4B6 may be involved in conferring drug resistance by immobilizing and transporting small molecules. The effect of 98P4B6 on small molecule transport is investigated using a modified MDR assay. Control cells and 98P4B6-expressing cells are loaded with a small fluorescent molecule (eg, calcein AM). Calcein efflux from the cells is measured by testing the supernatant for fluorescent compounds. MDR-like activity is confirmed using MDR inhibitors.

When 98P4B6 functions as a transport factor, it is used for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 48: Improvement of tumor progression)
The 98P4B6 gene can contribute to the growth of cancer cells. The role of 98P4B6 in tumor growth is confirmed in various primary and transfected cell lines, including prostate cells and NIH 3T3 cells engineered to stably express 98P4B6. Parental cells lacking 98P4B6 and 98P4B6 expressing cells were analyzed using well-described proliferation assays (Fraser SP, Grimes JA, Dkamgoz MB, Prosta
te 2000; 44: 61, Johnson DE, Ochieng J, Evans
SL, Anticancer Drugs. 1996, 7: 288) is used to evaluate for cell proliferation.

To confirm the role of 98P4B6 in transformation purposes, its effect in a colony formation assay is investigated. Parental NIH-3T3 cells lacking 98P4B6 were treated with 98P4B
Comparison of NIH-3T3 cells expressing 6 with stringent and more permissive conditions using a soft agar assay (Song Z et al., Cancer Res. 20
00; 60: 6730).

To confirm the role of 98P4B6 in cancer cell invasion and metastasis, a well-established assay (eg, transient insert system assay (Becton Dicki)
nson) (Cancer Res. 1999; 59: 6010). Control cells (including prostate cells and fibroblasts lacking 98P4B6) were treated with 98P4B6.
Compare with expressing cells. Cells are loaded with the fluorescent dye calcein and placed in the upper well of a transient insert coated with a basement membrane analog. Invasion is determined by the fluorescence of the cells in the lower chamber compared to the fluorescence of the entire cell population.

98P4B6 may also play a role in the cell cycle and apoptosis. Parental cells and 98P4B6 expressing cells were analyzed using the well-established BrdU assay (Abdel-M
alek ZA. J Cell Physiol. 1988, 136: 247) to compare for differences in cell cycle regulation. Briefly, cells are grown in both optimal (complete serum) and limited (low serum) conditions, labeled with BrdU, and anti-BrdU Ab.
And stained with propidium iodide. Cells are designated as G1 phase, S phase, and G2M of the cell cycle.
Analyze about entering the period. Alternatively, the effect of stress on apoptosis is assessed in control parental cells and 98P4B6 expressing cells (including normal cells and tumor prostate cells). Engineered and parental cells are treated with various chemotherapeutic agents (eg, etoposide, flutamide, etc.) and protein synthesis inhibitors (eg, cycloheximide). Cells are stained with Annexin V-FITC and cell death is measured by FACS analysis. Regulation of cell death by 98P4B6 may play an important role in regulating tumor progression and tumor load.

When 98P4B6 plays a role in cell proliferation, cell transformation, cell invasion or apoptosis, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 49: Improvement of angiogenesis)
Angiogenesis or new capillary formation is required for tumor growth (Hanaha
n D, Folkman J. et al. Cell. 1996, 86: 353; Folkman J
. Endocrinology. 1998 139: 441). Based on its effects on phosphoesterase inhibitors on endothelial cells, 98P4B6 plays a role in parent angiogenesis (DeFouw L et al., Microvasc. Res. 2001, 62:26).
3). Several assays have been developed to measure parent angiogenesis in vitro and in vivo, such as tissue culture assays, endothelial cell tube formation and endothelial cell proliferation. Using these assays, and in vitro angiogenesis, 98P4 in parent angiogenesis
The role of B6 (enhancement or inhibition) is confirmed.

For example, endothelial cells engineered to express 98P4B6 are evaluated using tube formation and proliferation assays. The effect of 98P4B6 is also confirmed in animal models in vivo. For example, either cells expressing 98P4B6 or cells lacking 98P4B6,
Subcutaneously transplanted in immunocompromised mice. Endothelial cell migration and parent angiogenesis are assessed after 5-15 days using immunohistochemical techniques. 98P4B6 affects parent angiogenesis. This is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 50: Regulation of transcription)
The localization of 98P4B6 and its similarity to hydrolase and its Ets motif (v.7) indicate that 98P4B6 is effectively used as a regulator of transcriptional regulation of eukaryotic genes. Modulation of gene expression is, for example, 98P4B6 expressing cells or 9
Confirm by studying gene expression in cells lacking 8P4B6. For this, two types of experiments are carried out.

In the first set of experiments, RNA from parental cells and 98P4B6 expressing cells is extracted and hybridized to a commercially available gene array (Clontech) (Smit
-Koopman E et al., Br J Cancer. 2000.83: 246). Resting cells and FBS treated cells or androgen treated cells are compared. Differentially expressed genes are identified according to procedures known in the art. Subsequently, differentially expressed genes are mapped to biological pathways (Chen K et al., Thyroid. 2001).
. 11:41).

In a second set of experiments, specific transcriptional pathway activation was performed using commercially available (Stratagene) luciferase reporter constructs (NFκB-luc, SRE-luc, ELK1-luc).
ARE, ARE-luc and CRE-luc). These transcriptional reporters contain consensus binding sites for known transcription factors that exist downstream of well-characterized signaling pathways, to confirm pathway activation, and positive regulators of pathway activation and A good tool is shown to screen for negative regulators.

Thus, 98P4B6 plays a role in gene regulation. When 98P4B6 is involved in gene regulation, it is used as a target for diagnostic, prognostic, prophylactic and / or therapeutic purposes.

(Example 51: Protein-protein binding)
Several 6-transmembrane (TM) proteins have been shown to interact with other proteins, thereby regulating signal transduction, gene transcription, transformation, and cell adhesion. Using immunoprecipitation techniques and the yeast two-hybrid system, proteins that bind to 98P4B6 are identified. Immunoprecipitates from 98P4B6 expressing cells and cells lacking 98P4B6 are compared for specific protein-protein binding.

Studies are conducted to confirm the extent of binding between 98P4B6 and effector molecules (eg, nuclear proteins, transcription factors, kinases, phosphates, etc.). Studies comparing 98P4B6-positive and 98P4B6-negative cells, and studies comparing unstimulated / resting cells with cells treated with epithelial cell activators (eg, cysteine, growth factors, androgens, and anti-integrin Abs) Uniquely reveals the interaction.

Furthermore, protein-protein interactions can be determined using the yeast two-hybrid method (Curr
Opin Chem Biol. 1999, 3:64). A vector carrying a protein library fused to the activation domain of a transcription factor is designated 98P4B6.
-Introducing into the yeast expressing the DNA binding domain fusion protein and the reporter construct. Protein-protein interactions are detected by colorimetric reporter activity. Specific binding with effector molecules and transcription factors directs those skilled in the art to the mode of action of 98P4B6, thus identifying cancer therapeutic, prognostic, prophylactic and / or diagnostic targets. This assay and similar assays are also used to identify and screen for small molecules that interact with 98P4B6.

Thus, 98P4B6 is found to bind to proteins and small molecules. Thus, 98P4B6 and these proteins and small molecules are used for diagnostic purposes, prognostic purposes, prophylactic purposes, and / or therapeutic purposes.

Throughout this application, various website data content, publications, patent applications, and patents are referenced (a website is referenced by its URL (address on the World Wide Web)). The disclosure of each of these references is hereby incorporated by reference in its entirety.

The present invention should not be limited in scope by the embodiments disclosed herein. These embodiments are intended as merely illustrative of individual aspects of the invention, and any that are functionally equivalent are within the scope of the invention. Various modifications to the models and methods of the invention will become apparent to those skilled in the art from the foregoing description and teachings, in addition to the models and methods described herein. These are likewise intended to be within the scope of the present invention. Such modifications or other embodiments can be practiced without departing from the true scope and spirit of the invention.

183 nucleotide 98P4B6 SSH sequence. The cDNA and amino acid sequence of 98P4B6 variant 1 (also referred to as “98P4B6 v.1” or “98P4B6 variant 1”) is shown in FIG. 2A. The starting methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 1 (also referred to as “98P4B6 v.1” or “98P4B6 variant 1”) is shown in FIG. 2A. The starting methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 2 (also referred to as “98P4B6 v.2”) is shown in FIG. 2B. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 4-138, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 2 (also referred to as “98P4B6 v.2”) is shown in FIG. 2B. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 4-138, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 2 (also referred to as “98P4B6 v.2”) is shown in FIG. 2B. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 4-138, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 3 (also referred to as “98P4B6 v.3”) is shown in FIG. 2C. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 188-1552, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 3 (also referred to as “98P4B6 v.3”) is shown in FIG. 2C. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 188-1552, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 4 (also referred to as “98P4B6 v.4”) is shown in FIG. 2D. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318 to 1682, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 4 (also referred to as “98P4B6 v.4”) is shown in FIG. 2D. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318 to 1682, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 4 (also referred to as “98P4B6 v.4”) is shown in FIG. 2D. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318 to 1682, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 5 (also referred to as “98P4B6 v.5”) is shown in FIG. 2E. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318-1577, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 5 (also referred to as “98P4B6 v.5”) is shown in FIG. 2E. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318-1577, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 6 (also referred to as “98P4B6 v.6”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318-1790, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 6 (also referred to as “98P4B6 v.6”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318-1790, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 6 (also referred to as “98P4B6 v.6”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 318-1790, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 7 (also referred to as “98P4B6 v.7”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 7 (also referred to as “98P4B6 v.7”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 7 (also referred to as “98P4B6 v.7”) is shown in FIG. 2F. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) is shown in FIG. 2H. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) is shown in FIG. 2H. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) is shown in FIG. 2H. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) is shown in FIG. 2H. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 8 (also referred to as “98P4B6 v.8”) is shown in FIG. 2H. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 9 (also referred to as “98P4B6 v.9”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 9 (also referred to as “98P4B6 v.9”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 10 (also referred to as “98P4B6 v.10”) is shown in FIG. 2J. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 10 (also referred to as “98P4B6 v.10”) is shown in FIG. 2J. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 10 (also referred to as “98P4B6 v.10”) is shown in FIG. 2J. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 11 (also referred to as “98P4B6 v.11”) is shown in FIG. 2K. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 11 (also referred to as “98P4B6 v.11”) is shown in FIG. 2K. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 12 (also referred to as “98P4B6 v.12”) is shown in FIG. 2L. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 12 (also referred to as “98P4B6 v.12”) is shown in FIG. 2L. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 12 (also referred to as “98P4B6 v.12”) is shown in FIG. 2L. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 13 (also referred to as “98P4B6 v.13”) is shown in FIG. 2M. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 13 (also referred to as “98P4B6 v.13”) is shown in FIG. 2M. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 13 (also referred to as “98P4B6 v.13”) is shown in FIG. 2M. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 14 (also referred to as “98P4B6 v.14”) is shown in FIG. 2N. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 14 (also referred to as “98P4B6 v.14”) is shown in FIG. 2N. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 15 (also referred to as “98P4B6 v.15”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 15 (also referred to as “98P4B6 v.15”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 15 (also referred to as “98P4B6 v.15”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 16 (also referred to as “98P4B6 v.16”) is shown in FIG. 2P. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 16 (also referred to as “98P4B6 v.16”) is shown in FIG. 2P. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 16 (also referred to as “98P4B6 v.16”) is shown in FIG. 2P. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 17 (also referred to as “98P4B6 v.17”) is shown in FIG. 2Q. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 17 (also referred to as “98P4B6 v.17”) is shown in FIG. 2Q. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 18 (also referred to as “98P4B6 v.18”) is shown in FIG. 2R. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 18 (also referred to as “98P4B6 v.18”) is shown in FIG. 2R. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 18 (also referred to as “98P4B6 v.18”) is shown in FIG. 2R. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 19 (also referred to as “98P4B6 v.19”) is shown in FIG. 2S. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 19 (also referred to as “98P4B6 v.19”) is shown in FIG. 2S. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 19 (also referred to as “98P4B6 v.19”) is shown in FIG. 2S. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 355-1719, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 20 (also referred to as “98P4B6 v.20”) is shown in FIG. 2T. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 20 (also referred to as “98P4B6 v.20”) is shown in FIG. 2T. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 21 (also referred to as “98P4B6 v.21”) is shown in FIG. 2U. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 21 (also referred to as “98P4B6 v.21”) is shown in FIG. 2U. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 21 (also referred to as “98P4B6 v.21”) is shown in FIG. 2U. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 22 (also referred to as “98P4B6 v.22”) is shown in FIG. 2V. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 22 (also referred to as “98P4B6 v.22”) is shown in FIG. 2V. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 22 (also referred to as “98P4B6 v.22”) is shown in FIG. 2V. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 23 (also referred to as “98P4B6 v.23”) is shown in FIG. 2W. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 23 (also referred to as “98P4B6 v.23”) is shown in FIG. 2W. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 24 (also referred to as “98P4B6 v.24”) is shown in FIG. 2X. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 24 (also referred to as “98P4B6 v.24”) is shown in FIG. 2X. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 24 (also referred to as “98P4B6 v.24”) is shown in FIG. 2X. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 295-2025, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 25 (also referred to as “98P4B6 v.25”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 25 (also referred to as “98P4B6 v.25”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 25 (also referred to as “98P4B6 v.25”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 25 (also referred to as “98P4B6 v.25”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 26 (also referred to as “98P4B6 v.26”) is shown in FIG. 2Z. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 26 (also referred to as “98P4B6 v.26”) is shown in FIG. 2Z. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 26 (also referred to as “98P4B6 v.26”) is shown in FIG. 2Z. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 26 (also referred to as “98P4B6 v.26”) is shown in FIG. 2Z. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 27 (also referred to as “98P4B6 v.27”) is shown in FIG. 2AA. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 27 (also referred to as “98P4B6 v.27”) is shown in FIG. 2AA. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 27 (also referred to as “98P4B6 v.27”) is shown in FIG. 2AA. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 27 (also referred to as “98P4B6 v.27”) is shown in FIG. 2AA. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as “98P4B6 v.28”) is shown in FIG. 2AB. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as “98P4B6 v.28”) is shown in FIG. 2AB. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as “98P4B6 v.28”) is shown in FIG. 2AB. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as “98P4B6 v.28”) is shown in FIG. 2AB. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 28 (also referred to as “98P4B6 v.28”) is shown in FIG. 2AB. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 29 (also referred to as “98P4B6 v.29”) is shown in FIG. 2AC. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 29 (also referred to as “98P4B6 v.29”) is shown in FIG. 2AC. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 29 (also referred to as “98P4B6 v.29”) is shown in FIG. 2AC. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 29 (also referred to as “98P4B6 v.29”) is shown in FIG. 2AC. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) is shown in FIG. 2AD. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) is shown in FIG. 2AD. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) is shown in FIG. 2AD. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) is shown in FIG. 2AD. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 30 (also referred to as “98P4B6 v.30”) is shown in FIG. 2AD. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 31 (also referred to as “98P4B6 v.31”) is shown in FIG. 2AE. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 31 (also referred to as “98P4B6 v.31”) is shown in FIG. 2AE. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 31 (also referred to as “98P4B6 v.31”) is shown in FIG. 2AE. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 31 (also referred to as “98P4B6 v.31”) is shown in FIG. 2AE. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 32 (also referred to as “98P4B6 v.32”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 33 (also referred to as “98P4B6 v.33”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 33 (also referred to as “98P4B6 v.33”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 33 (also referred to as “98P4B6 v.33”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 33 (also referred to as “98P4B6 v.33”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) is shown in FIG. 2AH. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) is shown in FIG. 2AH. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) is shown in FIG. 2AH. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) is shown in FIG. 2AH. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 34 (also referred to as “98P4B6 v.34”) is shown in FIG. 2AH. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 35 (also referred to as “98P4B6 v.35”) is shown in FIG. 2AI. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 35 (also referred to as “98P4B6 v.35”) is shown in FIG. 2AI. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 35 (also referred to as “98P4B6 v.35”) is shown in FIG. 2AI. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 35 (also referred to as “98P4B6 v.35”) is shown in FIG. 2AI. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 36 (also referred to as “98P4B6 v.36”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 36 (also referred to as “98P4B6 v.36”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 36 (also referred to as “98P4B6 v.36”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 36 (also referred to as “98P4B6 v.36”) is shown in FIG. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 37 (also referred to as “98P4B6 v.37”) is shown in FIG. 2AK. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 37 (also referred to as “98P4B6 v.37”) is shown in FIG. 2AK. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 37 (also referred to as “98P4B6 v.37”) is shown in FIG. 2AK. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of 98P4B6 variant 37 (also referred to as “98P4B6 v.37”) is shown in FIG. 2AK. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of the 98P4B6 variant (also referred to as 38 “98P4B6 v.38”) is shown in FIG. 2AL. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of the 98P4B6 variant (also referred to as 38 “98P4B6 v.38”) is shown in FIG. 2AL. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of the 98P4B6 variant (also referred to as 38 “98P4B6 v.38”) is shown in FIG. 2AL. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. The cDNA and amino acid sequence of the 98P4B6 variant (also referred to as 38 “98P4B6 v.38”) is shown in FIG. 2AL. The codon for the initiating methionine is underlined. This open reading frame spans nucleic acids 394-1866, including the stop codon. 98P4B6 V.P. One amino acid sequence is shown in FIG. 3A; it has 454 amino acids. 98P4B6 V.P. Two amino acid sequences are shown in FIG. 3B; it has 45 amino acids. 98P4B6 V.P. The amino acid sequence of 5 is shown in FIG. 3C; it has 419 amino acids. 98P4B6 V.P. A six amino acid sequence is shown in FIG. 3D; it has 490 amino acids. 98P4B6 V.P. The amino acid sequence of 7 is shown in Figure 3E; it has 576 amino acids. 98P4B6 V.P. The amino acid sequence of 8 is shown in Figure 3F; it has 490 amino acids. 98P4B6 V.P. The 13 amino acid sequence is shown in FIG. 3G; it has 454 amino acids. 98P4B6 V.P. The 14 amino acid sequence is shown in FIG. 3H; it has 454 amino acids. 98P4B6 V.P. The 14 amino acid sequence is shown in FIG. 3H; it has 454 amino acids. 98P4B6 V.P. The 21 amino acid sequence is shown in Figure 3I; it has 576 amino acids. 98P4B6 V.P. The 25 amino acid sequence is shown in Figure 3E; it has 490 amino acids.

As used herein, reference to 98P4B6 includes all variants thereof, unless this context clearly indicates otherwise, FIG. 2, FIG. 3, FIG. 10, and FIG. The modification shown in is included.
Alignment of 98P4B6 with known genes. Human STAMP1, human prostate 2 6 transmembrane epithelial antigen, and mouse prostate 2 6 transmembrane epithelial antigen. FIG. 4A: Alignment of 98P4B6 variant 1 to human STAMP1 (gi15418732). Alignment of 98P4B6 with known genes. Human STAMP1, human prostate 2 6 transmembrane epithelial antigen, and mouse prostate 2 6 transmembrane epithelial antigen. FIG. 4B: Alignment of 98P4B6 variant 1 to human STAMP2 (gi: 23308593). Alignment of 98P4B6 with known genes. Human STAMP1, human prostate 2 6 transmembrane epithelial antigen, and mouse prostate 2 6 transmembrane epithelial antigen. FIG. 4B: Alignment of 98P4B6 variant 1 to human STAMP2 (gi: 23308593). Alignment of 98P4B6 with known genes. Human STAMP1, human prostate 2 6 transmembrane epithelial antigen, and mouse prostate 2 6 transmembrane epithelial antigen. FIG. 4C: Alignment of 98P4B6 variant 1 and mouse STEAP2 (gi28501136). Alignment of 98P4B6 with known genes. Human STAMP1, human prostate 2 6 transmembrane epithelial antigen, and mouse prostate 2 6 transmembrane epithelial antigen. FIG. 4D: Cluster alignment of the three 98P4B6 variants. This indicates that 98P4B6 V1B contains an additional 62 amino acids for V1 at its N-terminus and that 98P4B6 V2 carries an I → T point mutation at amino acid 225 for V1. Hopp and Woods methods (Hopp T.P., Woods K., Ltd.) accessed on the ProtScale website located on the world wide web (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server. R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. Hopp and Woods methods (Hopp T.P., Woods K., Ltd.) accessed on the ProtScale website located on the world wide web (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server. R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. Hopp and Woods methods (Hopp T.P., Woods K., Ltd.) accessed on the ProtScale website located on the world wide web (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server. R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. Hopp and Woods methods (Hopp T.P., Woods K., Ltd.) accessed on the ProtScale website located on the world wide web (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server. R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. Hopp and Woods methods (Hopp T.P., Woods K., Ltd.) accessed on the ProtScale website located on the world wide web (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server. R., 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 hydrophilic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doolittle R.F., accessed on the ProtScale website located on the world wide web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1982. J. Mol.Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doolittle R.F., accessed on the ProtScale website located on the world wide web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1982. J. Mol.Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doolittle R.F., accessed on the ProtScale website located on the world wide web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1982. J. Mol.Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doolittle R.F., accessed on the ProtScale website located on the world wide web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1982. J. Mol.Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. The Kyte and Doolittle method (Kyte J., Doolittle R.F., accessed on the ProtScale website located on the world wide web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1982. J. Mol.Biol.157: 105-132), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 Hydropathic amino acid profiles. Janin's method (Janin J., 1979 Nature 277: 491-492) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 98P4B6 v. Determined by computer algorithm sequence analysis using 1, v. 2, v. 5, v. 6 and v. 7 accessible residue percent amino acid profile. Janin's method (Janin J., 1979 Nature 277: 491-492) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 98P4B6 v. Determined by computer algorithm sequence analysis using 1, v. 2, v. 5, v. 6 and v. 7 accessible residue percent amino acid profile. Janin's method (Janin J., 1979 Nature 277: 491-492) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 98P4B6 v. Determined by computer algorithm sequence analysis using 1, v. 2, v. 5, v. 6 and v. 7 accessible residue percent amino acid profile. Janin's method (Janin J., 1979 Nature 277: 491-492) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 98P4B6 v. Determined by computer algorithm sequence analysis using 1, v. 2, v. 5, v. 6 and v. 7 accessible residue percent amino acid profile. Janin's method (Janin J., 1979 Nature 277: 491-492) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 98P4B6 v. Determined by computer algorithm sequence analysis using 1, v. 2, v. 5, v. 6 and v. 7 accessible residue percent amino acid profile. Bhaskaran and Ponwaswamy's method (Bhaskaran R., and Ponwaswamy P.K.) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1988. Int. J. Pept. Protein Res. 32: 242-255), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. Average mean amino acid profile of 7. Bhaskaran and Ponwaswamy's method (Bhaskaran R., and Ponwaswamy P.K.) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1988. Int. J. Pept. Protein Res. 32: 242-255), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. Average mean amino acid profile of 7. Bhaskaran and Ponwaswamy's method (Bhaskaran R., and Ponwaswamy P.K.) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1988. Int. J. Pept. Protein Res. 32: 242-255), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. Average mean amino acid profile of 7. Bhaskaran and Ponwaswamy's method (Bhaskaran R., and Ponwaswamy P.K.) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1988. Int. J. Pept. Protein Res. 32: 242-255), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. Average mean amino acid profile of 7. Bhaskaran and Ponwaswamy's method (Bhaskaran R., and Ponwaswamy P.K.) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPasy molecular biology server. 1988. Int. J. Pept. Protein Res. 32: 242-255), 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. Average mean amino acid profile of 7. The Delage and Roux methods (Deleage, G., Roux B. 1987 Protein Engineering) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPassy molecular biology server. 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 β-turn amino acid profiles. The Delage and Roux methods (Deleage, G., Roux B. 1987 Protein Engineering) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPassy molecular biology server. 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 β-turn amino acid profiles. The Delage and Roux methods (Deleage, G., Roux B. 1987 Protein Engineering) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPassy molecular biology server. 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 β-turn amino acid profiles. The Delage and Roux methods (Deleage, G., Roux B. 1987 Protein Engineering) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPassy molecular biology server. 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 β-turn amino acid profiles. The Delage and Roux methods (Deleage, G., Roux B. 1987 Protein Engineering) accessed on the ProtScale website located on the World Wide Web (.expasy.ch / cgi-bin / protscale.pl) through the ExPassy molecular biology server. 1: 289-294), determined by computer algorithm sequence analysis, 98P4B6 v. 1, v. 2, v. 5, v. 6 and v. 7 β-turn amino acid profiles. 98P4B6 v. Schematic alignment of one SNP variant. Variant 98P4B6 v. 9-modified 98P4B6 v. 19 is v. From 1 to a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. Other transcript variants (eg, v.2, v.6, and v.8) are described in v. Not in common with 1 and not shown here. The black square is 98P4B6 v. 1 shows the same sequence as 1. The SNP is indicated above with a square. 98P4B6 v. Schematic alignment of one SNP variant. Variant 98P4B6 v. 9-modified 98P4B6 v. 19 is v. From 1 to a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. Other transcript variants (eg, v.2, v.6, and v.8) are described in v. Not in common with 1 and not shown here. The black square is 98P4B6 v. 1 shows the same sequence as 1. The SNP is indicated above with a square. 98P4B6 v. Schematic alignment of 7 SNP variants. Variant 98P4B6 v. 20-modified 98P4B6 v. 24, v. From 7 it was a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. v. SNPs in regions not in common with 1 were not shown here. The number is 98P4B6 v. Corresponds to 7. The black square is 98P4B6 v. The same sequence as 7 is shown. The SNP is indicated above with a square. 98P4B6 v. Schematic alignment of 8 SNP variants. Variant 98P4B6 v. 25-modified 98P4B6 v. 38 is v. From 8 it was a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. v. SNPs in regions not in common with 1 were not shown here. The number is 98P4B6 v. Corresponds to 8. The black square is 98P4B6 v. 8 shows the same sequence. The SNP is indicated above with a square. 98P4B6 v. Schematic alignment of 8 SNP variants. Variant 98P4B6 v. 25-modified 98P4B6 v. 38 is v. From 8 it was a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. v. SNPs in regions not in common with 1 were not shown here. The number is 98P4B6 v. Corresponds to 8. The black square is 98P4B6 v. 8 shows the same sequence. The SNP is indicated above with a square. 98P4B6 v. Schematic alignment of 8 SNP variants. Variant 98P4B6 v. 25-modified 98P4B6 v. 38 is v. From 8 it was a variant with a single nucleotide difference. Although these variants are shown separately, they can also be present in any combination and in any transcript variant containing the above bases, as shown in FIG. v. SNPs in regions not in common with 1 were not shown here. The number is 98P4B6 v. Corresponds to 8. The black square is 98P4B6 v. 8 shows the same sequence. The SNP is indicated above with a square. Schematic alignment of 98P4B6 protein variants. A protein variant corresponds to a nucleotide variant. Nucleotide variant 98P4B6 v. 3, v. 4, v. 9-v. 12 and v. 15-v. 19 is 98P4B6 v. Coded the same protein as 1. Nucleotide variant 98P4B6 v. 6 and v. 8 is v. 8 encoded the same protein except for the single amino acid at position 475 which was “M”. Variant v. 25 is v. 8 SNP variants with one amino acid difference per 565 v. Translated from 25. Similarly, v. 21 is only one amino acid at position 565 v. It was different from 7. Single amino acid differences are indicated above with squares. The black square is 98P4B6 v. 1 shows the same sequence as 1. The numbers below the squares are 98P4B6 v. Corresponding to 1. Schematic alignment of 98P4B6 protein variants. A protein variant corresponds to a nucleotide variant. Nucleotide variant 98P4B6 v. 3, v. 4, v. 9-v. 12 and v. 15-v. 19 is 98P4B6 v. Coded the same protein as 1. Nucleotide variant 98P4B6 v. 6 and v. 8 is v. 8 encoded the same protein except for the single amino acid at position 475 which was “M”. Variant v. 25 is v. 8 SNP variants with one amino acid difference per 565 v. Translated from 25. Similarly, v. 21 is only one amino acid at position 565 v. It was different from 7. Single amino acid differences are indicated above with squares. The black square is 98P4B6 v. 1 shows the same sequence as 1. The numbers below the squares are 98P4B6 v. Corresponding to 1. Structure of 98P4B6 transcript variant. Variant 98P4B6 v. 2 to v. 8 is v. 1 transcript variant. Variant v. 2, the 3 ′ portion is v. It was a single exon transcript that was the same as the last exon of 1. v. The first two exons of 3 are v. 1 in Intron 1 Variant v. 4, v. 5 and v. 6 is v. 224-334 in the first exon of 1 was spliced out. Furthermore, v. 5 removes exon 5 by splicing; 6 removed exon 6 by splicing, but v. It extended to 1 exon 5. Variant v. 7 used selective transcription initiation and a different 3 ′ exon. Variant v. 8 extends to the 5 ′ end, v. One entire intron 5 was maintained. v. The first 35 bases of 1 in the current assembly of the human genome 1 was not present in the vicinity of the 5 ′ region. The ends of exons in the transcript are shown above the squares. Potential exons of this gene are shown in turn on the human genome. Poly A tails and single nucleotide differences are not shown in this figure. The number in “()” below the square is 98P4B6 v. Corresponds to the number 1. Intron and exon lengths are not proportional. Structure of 98P4B6 transcript variant. Variant 98P4B6 v. 2 to v. 8 is v. 1 transcript variant. Variant v. 2, the 3 ′ portion is v. It was a single exon transcript that was the same as the last exon of 1. v. The first two exons of 3 are v. 1 in Intron 1 Variant v. 4, v. 5 and v. 6 is v. 224-334 in the first exon of 1 was spliced out. Furthermore, v. 5 removes exon 5 by splicing; 6 removed exon 6 by splicing, but v. It extended to 1 exon 5. Variant v. 7 used selective transcription initiation and a different 3 ′ exon. Variant v. 8 extends to the 5 ′ end, v. One entire intron 5 was maintained. v. The first 35 bases of 1 in the current assembly of the human genome 1 was not present in the vicinity of the 5 ′ region. The ends of exons in the transcript are shown above the squares. Potential exons of this gene are shown in turn on the human genome. Poly A tails and single nucleotide differences are not shown in this figure. The number in “()” below the square is 98P4B6 v. Corresponds to the number 1. Intron and exon lengths are not proportional. FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E: Presumption of secondary structure and transmembrane domain of 98P4B6 protein variant. Secondary structure of 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), variant 6 (SEQ ID NO: 196) and variant 7 (SEQ ID NO: 197) Of the World Wide Web. expasy. HNN-Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pln_page.pl?_page?pl? This method estimates the position and presence of alpha helices, extended strands, and coils from the primary amino acid sequence, and the percentage of the protein in a given secondary structure is also listed. FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E: Presumption of secondary structure and transmembrane domain of 98P4B6 protein variant. Secondary structure of 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), variant 6 (SEQ ID NO: 196) and variant 7 (SEQ ID NO: 197) Of the World Wide Web. expasy. HNN-Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pln_page.pl?_page?pl? This method estimates the position and presence of alpha helices, extended strands, and coils from the primary amino acid sequence, and the percentage of the protein in a given secondary structure is also listed. FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E: Presumption of secondary structure and transmembrane domain of 98P4B6 protein variant. Secondary structure of 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), variant 6 (SEQ ID NO: 196) and variant 7 (SEQ ID NO: 197) Of the World Wide Web. expasy. HNN-Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pln_page.pl?_page?pl? This method estimates the position and presence of alpha helices, extended strands, and coils from the primary amino acid sequence, and the percentage of the protein in a given secondary structure is also listed. FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E: Presumption of secondary structure and transmembrane domain of 98P4B6 protein variant. Secondary structure of 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), variant 6 (SEQ ID NO: 196) and variant 7 (SEQ ID NO: 197) Of the World Wide Web. expasy. HNN-Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pln_page.pl?_page?pl? This method estimates the position and presence of alpha helices, extended strands, and coils from the primary amino acid sequence, and the percentage of the protein in a given secondary structure is also listed. FIG. 13A, FIG. 13B, FIG. 13C, FIG. 13D, FIG. 13E: Presumption of secondary structure and transmembrane domain of 98P4B6 protein variant. Secondary structure of 98P4B6 protein variant 1 (SEQ ID NO: 193), variant 2 (SEQ ID NO: 194), variant 5 (SEQ ID NO: 195), variant 6 (SEQ ID NO: 196) and variant 7 (SEQ ID NO: 197) Of the World Wide Web. expasy. HNN-Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pln_page.pl?_page?pl? This method estimates the position and presence of alpha helices, extended strands, and coils from the primary amino acid sequence, and the percentage of the protein in a given secondary structure is also listed. 13F, 13H, 13J, 13L, 13N: TMBASE (utilizing K. Hofmann, W. Stofell. TMBASE-A database of membrane spanning protein segments Biol. Chem. Hope-Seyler 374: 1637) Schematic representation of the probability and orientation of the transmembrane regions of each of 98P4B6 variants 1, 2, 5-7 based on the algorithm. 13G, 13I, 13K, 13M, 13O: Sonnhammer, von Heijne and Krough of TMHMM algorithm (Erik L.L.Sonnhammer, Gunnar von Heijne, and Anders Krough: A hidden Markov model for prdicting transmembrane herices in protein sequences, Proc of Sixth Int Conf.on Intelligent Systems for Molecular Biology, p175-182 Ed.J.Glasgow, T.Littlejohn, F.Major, R.Lathrop, D.Sankoff, and C.Sensen Menkoff. A: AAAI Press, based on 1998), variant 1 of 98P4B6, variants 2, possibility of each of the transmembrane region variant 5-7 is present, as well as schematic representation of the extracellular orientation and intracellular orientation. The TMpred algorithm and the TMHMM algorithm are accessed from an Expasy molecular biology server located on the world wide web (.expasy.ch / tools /). 13F, 13H, 13J, 13L, 13N: TMBASE (utilizing K. Hofmann, W. Stofell. TMBASE-A database of membrane spanning protein segments Biol. Chem. Hope-Seyler 374: 1637) Schematic representation of the probability and orientation of the transmembrane regions of each of 98P4B6 variants 1, 2, 5-7 based on the algorithm. 13G, 13I, 13K, 13M, 13O: Sonnhammer, von Heijne and Krough of TMHMM algorithm (Erik L.L.Sonnhammer, Gunnar von Heijne, and Anders Krough: A hidden Markov model for prdicting transmembrane herices in protein sequences, Proc of Sixth Int Conf.on Intelligent Systems for Molecular Biology, p175-182 Ed.J.Glasgow, T.Littlejohn, F.Major, R.Lathrop, D.Sankoff, and C.Sensen Menkoff. A: AAAI Press, based on 1998), variant 1 of 98P4B6, variants 2, possibility of each of the transmembrane region variant 5-7 is present, as well as schematic representation of the extracellular orientation and intracellular orientation. The TMpred algorithm and the TMHMM algorithm are accessed from an Expasy molecular biology server located on the world wide web (.expasy.ch / tools /). 13F, 13H, 13J, 13L, 13N: TMBASE (utilizing K. Hofmann, W. Stofell. TMBASE-A database of membrane spanning protein segments Biol. Chem. Hope-Seyler 374: 1637) Schematic representation of the probability and orientation of the transmembrane regions of each of 98P4B6 variants 1, 2, 5-7 based on the algorithm. 13G, 13I, 13K, 13M, 13O: Sonnhammer, von Heijne and Krough of TMHMM algorithm (Erik L.L.Sonnhammer, Gunnar von Heijne, and Anders Krough: A hidden Markov model for prdicting transmembrane herices in protein sequences, Proc of Sixth Int Conf.on Intelligent Systems for Molecular Biology, p175-182 Ed.J.Glasgow, T.Littlejohn, F.Major, R.Lathrop, D.Sankoff, and C.Sensen Menkoff. A: AAAI Press, based on 1998), variant 1 of 98P4B6, variants 2, possibility of each of the transmembrane region variant 5-7 is present, as well as schematic representation of the extracellular orientation and intracellular orientation. The TMpred algorithm and the TMHMM algorithm are accessed from an Expasy molecular biology server located on the world wide web (.expasy.ch / tools /). 13F, 13H, 13J, 13L, 13N: TMBASE (utilizing K. Hofmann, W. Stofell. TMBASE-A database of membrane spanning protein segments Biol. Chem. Hope-Seyler 374: 1637) Schematic representation of the probability and orientation of the transmembrane regions of each of 98P4B6 variants 1, 2, 5-7 based on the algorithm. 13G, 13I, 13K, 13M, 13O: Sonnhammer, von Heijne and Krough of TMHMM algorithm (Erik L.L.Sonnhammer, Gunnar von Heijne, and Anders Krough: A hidden Markov model for prdicting transmembrane herices in protein sequences, Proc of Sixth Int Conf.on Intelligent Systems for Molecular Biology, p175-182 Ed.J.Glasgow, T.Littlejohn, F.Major, R.Lathrop, D.Sankoff, and C.Sensen Menkoff. A: AAAI Press, based on 1998), variant 1 of 98P4B6, variants 2, possibility of each of the transmembrane region variant 5-7 is present, as well as schematic representation of the extracellular orientation and intracellular orientation. The TMpred algorithm and the TMHMM algorithm are accessed from an Expasy molecular biology server located on the world wide web (.expasy.ch / tools /). 13F, 13H, 13J, 13L, 13N: TMBASE (utilizing K. Hofmann, W. Stofell. TMBASE-A database of membrane spanning protein segments Biol. Chem. Hope-Seyler 374: 1637) Schematic representation of the probability and orientation of the transmembrane regions of each of 98P4B6 variants 1, 2, 5-7 based on the algorithm. 13G, 13I, 13K, 13M, 13O: Sonnhammer, von Heijne and Krough of TMHMM algorithm (Erik L.L.Sonnhammer, Gunnar von Heijne, and Anders Krough: A hidden Markov model for prdicting transmembrane herices in protein sequences, Proc of Sixth Int Conf.on Intelligent Systems for Molecular Biology, p175-182 Ed.J.Glasgow, T.Littlejohn, F.Major, R.Lathrop, D.Sankoff, and C.Sensen Menkoff. A: AAAI Press, based on 1998), variant 1 of 98P4B6, variants 2, possibility of each of the transmembrane region variant 5-7 is present, as well as schematic representation of the extracellular orientation and intracellular orientation. The TMpred algorithm and the TMHMM algorithm are accessed from an Expasy molecular biology server located on the world wide web (.expasy.ch / tools /). 98P4B6 expression in human normal and patient cancer tissues. First strand cDNA is derived from normal stomach, normal brain, normal heart, normal liver, normal skeletal muscle, normal testis, normal prostate, normal bladder, normal kidney, normal colon, normal lung, normal pancreas, and cancer from prostate cancer patients Specimen pools, cancer specimen pools from bladder cancer patients, cancer specimen pools from kidney cancer patients, cancer specimen pools from colon cancer patients, cancer specimen pools from lung cancer patients, cancer specimen pools from pancreatic cancer patients, and lymph nodes Generated from a pool of 2 patients with prostate metastases to Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 and v. Primer (A) to 14 or splice variant 98P4B6 v. 6 and v. Semi-quantitative PCR using primers specific for 8 (B) was performed with 26 and 30 cycles of amplification. Samples were run on an agarose gel and PCR products were reduced using AlphaImager software. The results show that in normal prostate and prostate cancer, 98P4B6 v. 1, v. 13 and v. 14, and its splice variants v. 6 and v. 8 shows strong expression. Expression was also detected in bladder cancer, kidney cancer, colon cancer, lung cancer, pancreatic cancer, breast cancer, cancer metastasis, and prostate cancer metastasis to lymph node specimens compared to all normal tissues tested. 98P4B6 expression in human normal and patient cancer tissues. First strand cDNA is derived from normal stomach, normal brain, normal heart, normal liver, normal skeletal muscle, normal testis, normal prostate, normal bladder, normal kidney, normal colon, normal lung, normal pancreas, and cancer from prostate cancer patients Specimen pools, cancer specimen pools from bladder cancer patients, cancer specimen pools from kidney cancer patients, cancer specimen pools from colon cancer patients, cancer specimen pools from lung cancer patients, cancer specimen pools from pancreatic cancer patients, and lymph nodes Generated from a pool of 2 patients with prostate metastases to Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 and v. Primer (A) to 14 or splice variant 98P4B6 v. 6 and v. Semi-quantitative PCR using primers specific for 8 (B) was performed with 26 and 30 cycles of amplification. Samples were run on an agarose gel and PCR products were reduced using AlphaImager software. The results show that in normal prostate and prostate cancer, 98P4B6 v. 1, v. 13 and v. 14, and its splice variants v. 6 and v. 8 shows strong expression. Expression was also detected in bladder cancer, kidney cancer, colon cancer, lung cancer, pancreatic cancer, breast cancer, cancer metastasis, and prostate cancer metastasis to lymph node specimens compared to all normal tissues tested. Expression in patient cancer specimens of lung, ovary, prostate, bladder, cervix, uterus, and pancreas. First strand cDNA was prepared from a group of patient cancer specimens. Normalization was performed by PCR using primers for actin. 98P4B6 v. 1, v. 13 and v. Semi-quantitative PCR using primers for 14 was performed with 26 and 30 cycles of amplification. Samples were run on an agarose gel and PCR products were reduced using AlphaImager software. Expression was recorded as none, low, moderate or strong. The results show 98P4B6 expression in the majority of all patient cancer specimens tested. Expression of 98P4B6 in gastric cancer patient specimens. (A) RNA was extracted from normal stomach (N) and 10 different cancer patient specimens (T). Northern blots with 10 μg total RNA / lane were probed with the 98P4B6 sequence. The results show strong expression of 98P4B6 in gastric tumor tissue and weaker expression in normal stomach. (B) Expression of 98P4B6 was assayed by RNA dot blot in the human gastric cancer (T) group and its individual matched normal tissues (N). 98P4B6 was detected in 7 out of 8 gastric tumors but not in matching normal tissue. Detection of 98P4B6 expression using a polyclonal antibody. 293 cells were transformed into 98P4B6. GFP. pcDNA3.1 / mycys constructs were transfected with clone A12 or clone B12. STEAP1. GFP vector was used as a positive control. An empty vector was used as a negative control. After 40 hours, cell lysates were collected. Samples were run on an SDS-PAGE acrylamide gel, blotted, and anti-GFP antibody (A), anti-98P4B6 antibody generated against amino acids 198-389 (B) or anti-antibody generated against amino acids 153-165. Stained with either 98P4B6. The blot was developed using an ECL chemiluminescence kit and visualized by autoradiography. The results show that the expected 98P4B6. The expression of GFP fusion protein is shown. In addition, we have 98P4B6. Two different polyclonal antibodies that recognize the GFP fusion protein could be raised. Detection of 98P4B6 expression using a polyclonal antibody. 293 cells were transformed into 98P4B6. GFP. pcDNA3.1 / mycys constructs were transfected with clone A12 or clone B12. 98P4B6. GFP fusion protein expression was detected by flow cytometry (A) and fluorescence microscopy (B). The result shows strong green fluorescence in the majority of cells. The fusion protein was localized in the perinuclear region and cell membrane. Detection of 98P4B6 expression using a polyclonal antibody. 293 cells were transformed into 98P4B6. GFP. pcDNA3.1 / mycys constructs were transfected with clone A12 or clone B12. 98P4B6. GFP fusion protein expression was detected by flow cytometry (A) and fluorescence microscopy (B). The result shows strong green fluorescence in the majority of cells. The fusion protein was localized in the perinuclear region and cell membrane. STEAP-2 features. STEAP-2 expression in normal tissues was preferentially restricted to the prostate. STEAP-2 is expressed in several cancerous tissues. In patient-derived prostate cancer specimens, colon cancer specimens, and lung cancer specimens, and multiple cancer cell lines, including prostate, colon, Ewing sarcoma, lung, kidney, pancreas, and testis. By ISH, STEAP-2 expression appears to be mainly restricted to ductal epithelial cells. STEAP-2 induces tyrosine phosphorylation in PC3 cells. STEAP-2 induces tyrosine phosphorylation of proteins at 140-150, 120, 75-80, 62 and 40 kDa. STEAP-2 enhances tyrosine phosphorylation in NIH 3T3 cells. STEAP-2 enhances phosphorylation of p135-140, p78-75 by STEAP-2 in NIH 3T3 cells. STEAP-2 C-Flag enhances phosphorylation of p180 and induces dephosphorylation of p132, p82 and p75. STEAP-2 induces EPK phosphorylation. STEAP-2 induces ERK phosphorylation in PC3 and 3T3 cells in 0.5% FBS and 10% FBS. STEAP-2 enhances calcium efflux in PC3 cells. PC-STEAP-1 and PC3-STEAP-2 showed enhanced calcium efflux in response to LPA. PC3-STEAP-1 exhibits sensitivity to conotoxin, an L-type calcium channel inhibitor. PC3-STEAP-2 is a PQ-type calcium channel inhibitor Agatoxin Susceptibility to. PDGA and TEA had no effect on PC3-STEAP-2 cell proliferation. STEAP-2 alters the effect of paclitaxel on PC3 cells. Other tested chemotherapeutic agents that did not produce a differential response between STEAP expressing cells and control cells were flutamide, genistein, rapamycin. STEAP-2 confers partial resistance to paclitaxel in PCR cells. More than 8-fold increase in percent survival of PC3-STEAP-2 over PC3-Neo cells. Inhibition of apoptosis by STEAP-2. PC3 cells were treated with paclitaxel for 60 hours and analyzed for apoptosis by Annexin-PI staining. STEAP-2 expression partially inhibits apoptosis by paclitaxel. STEAP-2 attenuates paclitaxel-mediated apoptosis. PC3 cells were treated with paclitaxel for 68 hours and analyzed for apoptosis. STEAP-2 expression partially inhibits paclitaxel-induced apoptosis, whereas STEAP-2 CFlag expression is not.

Claims (7)

SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 43, and SEQ ID NO: 51 A composition for delivering a calcium channel inhibitor to paclitaxel resistant cancer cells expressing a protein selected from the group consisting of:
SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 43, and SEQ ID NO: 51 A composition comprising a calcium channel inhibitor bound to an antibody or fragment thereof that specifically binds to a protein selected from the group consisting of:   The composition according to claim 1, wherein the calcium channel inhibitor is agatoxin. SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 43, and SEQ ID NO: 51 A composition for inhibiting the growth of paclitaxel resistant prostate cancer cells expressing a protein selected from the group consisting of:
SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 43, and SEQ ID NO: 51 A composition comprising a cytotoxic or therapeutic agent bound to an antibody or fragment thereof that specifically binds to a protein selected from the group consisting of: 4. The composition of claim 3, wherein the antibody or fragment is conjugated to a cytotoxic agent.   The composition according to claim 4, wherein the cytotoxic drug is auristatin or maytansinoid.   The composition of claim 4, wherein the cytotoxic agent is a calcium channel inhibitor.   The composition according to claim 6, wherein the calcium channel inhibitor is agatoxin.

Images