JP5263729B2 - Preventive and therapeutic agent for feline infectious peritonitis virus (FIPV) - Google Patents

Description

  The present invention relates to a double-stranded RNA (dsRNA) molecule that targets the mRNA of a matrix gene (M gene) of feline infectious peritonitis virus (FIPV). The present invention also relates to a composition for inhibiting FIPV replication comprising the dsRNA molecule.

  Feline Infectious Peritonitis (FIP) is a disease caused by feline infectious peritonitis virus (FIPV) in which coronavirus has been mutated in the cat. It is a high and terrible disease.

There are two types of symptoms of FIP: “wet type” and “dry type”. The “wet type”, which has many cases, causes severe vasculitis in the abdomen and chest along with fever, diarrhea, anemia, etc., ascites and pleural effusion accumulate, abdomen swells, and difficulty breathing. The “dry type” has a large lump like lymphoma in the abdomen. In addition, this type may cause inflammation in the brain, causing neurological symptoms such as paralysis and convulsions.

  At present, there is no radical cure for FIP, and once FIP develops, there is only symptomatic treatment to relieve symptoms by administering interferon or steroids, and in most cases it does not help. Moreover, since there is no effective vaccine, it is difficult to obtain a sufficient therapeutic effect (Non-patent Document 1).

Journal of Virological Methods, 124 (2005), p.111-116.

  In the conventional method, since FIP could not be sufficiently prevented and / or treated, a new method capable of effectively treating FIP has been desired. Therefore, the present invention provides a dsRNA molecule that targets the M gene mRNA of FIPV that inhibits the growth of FIPV. Also provided is a composition for inhibiting FIPV replication comprising the dsRNA molecule.

FIPV is a positive-sense single-stranded RNA virus having the structure shown in FIG. The M gene encodes the M protein. The M protein is a protein essential for the formation of the viral envelope together with the E protein. In addition, the M protein has a function of binding to the N protein and allowing the virus nucleocapsid to be incorporated into the virus particle (J. Virology, 75: 1312-1324, 2001, J. Virology, 75: 9059-9067, 2001). , J. Virology, 76: 4987-4999, 2002).

Therefore, the present inventors considered that by suppressing the expression of M protein, virus release from infected cells can be suppressed and pathogenicity can be suppressed. As a result of diligent investigations to solve the above-mentioned problems, a sense strand having the same base sequence as the M gene sequence of FIPV or a part thereof and an antisense strand having a base sequence complementary to the base sequence of the sense strand And dsRNA molecules specifically found to suppress the expression of the M gene, thereby completing the present invention.

That is, the present invention is as follows.
[1] A double-stranded RNA (dsRNA) molecule that targets the mRNA of a feline infectious peritonitis virus (FIPV) matrix gene (M gene), one strand of which is represented by SEQ ID NO: 1 A dsRNA molecule, wherein the dsRNA molecule is a sense strand identical to a sequence having at least 19 consecutive bases therein, and the other strand is an antisense strand having a base sequence complementary to the base sequence of the sense strand.

[2] The dsRNA molecule is 695 to 717 of the M gene sequence whose one strand is represented by SEQ ID NO: 1.
A sense strand that is identical to any one of the base sequences selected from the group consisting of a sequence having the base 527th, a sequence having the 527th to 549th base, and a sequence having the 400th to 422nd base, and the other strand The dsRNA molecule according to [1], wherein is an antisense strand having a base sequence complementary to the base sequence of the sense strand.

[3] The dsRNA molecule comprises a sense strand represented by SEQ ID NO: 2 and an antisense strand represented by SEQ ID NO: 3, a sense strand represented by SEQ ID NO: 4 and an antisense strand represented by SEQ ID NO: 5, and The dsRNA molecule of [2], comprising any base pair selected from the group consisting of a sense strand represented by SEQ ID NO: 8 and an antisense strand represented by SEQ ID NO: 9.
[4] The dsRNA molecule according to any one of [1] to [3], wherein the sense strand and the antisense strand are linked via a linker molecule.

[5] A vector comprising the template DNA of the dsRNA molecule of [4] and expressing the dsRNA molecule.
[6] A composition comprising one or more dsRNA molecules according to any one of [1] to [4] for inhibiting FIPV replication.
[7] A composition comprising the vector of [5] for inhibiting FIPV replication.

The dsRNA molecule according to the present invention can be used to specifically suppress the expression of the FIPV M gene, thereby inhibiting FIPV replication. The dsRNA of the present invention can be used as a prophylactic or therapeutic agent for cat FIP.

In one embodiment, the present invention relates to a dsRNA molecule that targets mRNA of FIPV M gene, wherein one strand of the dsRNA molecule has a sense strand having a base sequence identical to the M gene sequence of FIPV or a part thereof. And the other strand is related to the above dsRNA molecule, which is an antisense strand having a base sequence complementary to the base sequence of the sense strand.

The dsRNA molecule of the present invention can cause RNA interference (RNAi) that cleaves the M gene mRNA of FIPV in a sequence-specific manner and consequently suppresses the expression of the M gene.

When the dsRNA molecule of the present invention is provided with a length of 30 bases or more, it is processed by the action of an RNase III-like enzyme called Dicer and has 21 to 27 bases having a 2 base overhang at the 3 ′ end. Can generate siRNA (small interfering RNA) molecules. This siRNA
Molecules are incorporated into a protein complex called RISC (RNA-induced silencing complex), and the M gene mRNA is recognized and decomposed by homology with siRNA molecules to suppress expression.

In the present invention, the dsRNA molecule includes an siRNA molecule.
The number of bases of the dsRNA molecule of the present invention is not particularly limited, but is 15 to 50 bases, preferably 19 bases or more, more preferably 19 to 35 bases, and particularly preferably 21 bases.

In the present invention, the sense strand identical to the gene sequence of the M gene means an RNA strand having a base sequence in which thymine in the M gene sequence represented by SEQ ID NO: 1 is replaced with uracil. The sense strand constituting the dsRNA molecule of the present invention is preferably the same as the gene sequence of the M gene, but may be a substantially identical sequence, that is, a homologous sequence. That is, as long as the sense strand of the dsRNA molecule and the mRNA sequence of the actually targeted M gene hybridize, one or more, that is, 1 to 10, preferably 1 to 5, more preferably 1 to 3, There may be two or one mismatch. Therefore, the sense strand sequence of the dsRNA molecule of the present invention and the gene sequence of the M gene have a sequence homology of 90% or more, preferably 95% or more, more preferably 95, 96, 97, 98 or 99% or more.

  In the present invention, the sense strand preferably has a sequence having the 695th to 717th bases of the M gene sequence represented by SEQ ID NO: 1, a sequence having the 527th to 549th bases, and a sequence having the 400th to 422th bases Preferably, it is the same as the base sequence selected from the group consisting of: The sequence having the 695th-717th base and the sequence having the 400th-422th base are particularly preferred.

The sense strand and antisense strand constituting the dsRNA molecule can be synthesized in vitro by chemical synthesis or a transcription system using a promoter and RNA polymerase based on a known method. It is also possible to synthesize in vivo by introducing the antisense strand and the template DNA of the sense strand into an appropriate expression vector and administering the vector into an appropriate host cell. Annealing of the synthesized sense strand and antisense strand can be performed by a general method known to those skilled in the art. Dissolve the synthesized sense strand and antisense strand in dsRNA annealing buffer, mix the same amount (equal number of moles), heat the temperature until the double strands dissociate, and then gradually cool and incubate. Do by. Annealing conditions are performed, for example, by leaving still at 90 ° C. for 1 minute and then at 37 ° C. for 1 hour. Then, dsRNA molecules can be obtained by phenol / chloroform extraction / ethanol precipitation.

In one embodiment, the dsRNA molecule of the present invention is represented by the sense strand represented by SEQ ID NO: 2 and the antisense strand represented by SEQ ID NO: 3, the sense strand represented by SEQ ID NO: 4 and SEQ ID NO: 5. An antisense strand and any one of the base pairs selected from the group consisting of the sense strand represented by SEQ ID NO: 8 and the antisense strand represented by SEQ ID NO: 9, in particular, the sense strand represented by SEQ ID NO: 2 And a dsRNA molecule comprising an antisense strand represented by SEQ ID NO: 3, a sense strand represented by SEQ ID NO: 8, and an antisense strand represented by SEQ ID NO: 9.

In addition, the dsRNA molecule of the present invention is provided as a folded shRNA (short hairpin RNA) molecule in which the sense strand and the antisense strand defined above are linked via a linker molecule and a loop structure is formed at the linker portion. Can be done. shRNA molecules can also be processed by Dicer to produce siRNA molecules.

The linker molecule contained in the shRNA molecule may be a polynucleotide linker or a non-polynucleotide linker as long as it can link the sense strand and the antisense strand to form a stem loop structure, and is not particularly limited. Polynucleotide linkers known to those skilled in the art are preferred.

  shRNA molecules can also be synthesized in vitro or in vivo based on known methods as described above. When synthesizing, a single RNA strand containing the sense strand and antisense strand as reverse sequences is synthesized, and then a single strand of RNA is formed by self-complementary binding to obtain an shRNA molecule. Can do.

The sense strand or antisense strand constituting the dsRNA molecule may optionally have an overhang at the 3 ′ end, and the type and number of bases of the overhang are not limited. For example, 1-5 , Preferably 1 to 3, more preferably 1 or 2 base sequences, for example, TTT, UU and TT. In the present invention, the term “overhang” refers to a base that is added to the end of one strand of a dsRNA molecule and does not have a base that can complementarily bind to the corresponding position of the other strand. The overhang may be a base constituting DNA. Furthermore, the sense strand or the antisense strand constituting the dsRNA molecule has 1 to 3 bases as necessary within a range not affecting siRNA activity in order to smoothly perform various experimental operations such as gene sequencing. More preferably, it may further include substitution, addition or deletion of 1 or 2 bases.

Further, the sense strand or the antisense strand may be phosphorylated at the 5 ′ end as necessary, and for the shRNA molecule, triphosphate (ppp) may be bound to the 5 ′ end.
In one embodiment, the present invention also relates to a vector that expresses the shRNA molecule.

  As vectors that can be used in the present invention, plasmid vectors, viral vectors, non-viral vectors, and the like can be used. As a plasmid vector, a pBAsi vector, a pSUPER vector, or the like can be used. As a viral vector, an adenovirus vector, a retrovirus vector, a lentivirus vector, or the like can be used. As the non-viral vector, a liposome vector or the like can be used, and a Sendai virus-liposome vector is particularly preferable.

The vector may be inserted with a promoter and / or other regulatory sequences linked in a functional manner. “Functionally linked and inserted” means that the shRNA molecule is expressed and targeted in the M gene mRNA under the control of a promoter and / or other control sequences in the cell into which the vector is introduced. Means that the promoter and / or other regulatory sequences are linked and incorporated into the vector so that is degraded. Promoters and / or other regulatory sequences that can be incorporated into the vector are not particularly limited, but promoters and / or other known in the art such as constitutive promoters, tissue-specific promoters, time-specific promoters, other regulatory elements, etc. These control sequences can be appropriately selected.

  The thus-produced vector expressing the shRNA molecule expresses the shRNA molecule in the introduced cell and specifically degrades the M gene mRNA.

In one embodiment, the present invention also provides a dsRNA of the present invention for inhibiting FIPV replication.
It relates to a composition comprising a molecule and a composition comprising a vector of the invention. The composition of the present invention may contain one or a combination of the dsRNA molecules or vectors of the present invention. For example, the sense strand represented by SEQ ID NO: 2 and the antisense strand represented by SEQ ID NO: 3, the sense strand represented by SEQ ID NO: 4 and the antisense strand represented by SEQ ID NO: 5, or the sequence represented by SEQ ID NO: 8 1 type, 2 types, or 3 types of dsRNA molecules consisting of the sense strand and the antisense strand represented by SEQ ID NO: 9 may be included. The compositions of the present invention may also contain suitable carriers, diluents, emulsions and the like with the dsRNA molecules or vectors of the present invention. For example, physiological saline, phosphate buffered saline, phosphate buffered saline glucose solution, buffered saline, and the like can be included in the composition. When the composition of the present invention is used as a pharmaceutical composition, the composition is suitable for administration by the oral route, as well as intravenous, intramuscular, subcutaneous and intraperitoneal injection or parenteral route. Can be prepared in different forms.

The present invention can provide a prophylactic or therapeutic agent for FIP comprising the above dsRNA molecule or expression vector as an active ingredient. The prophylactic or therapeutic agent is a normal cat, a cat infected with FIPV, or FIP
Is administered to cats that are developing FIPV to prevent infection of FIPV, inhibit the growth of infected FIPV, prevent the development of FIPV, or treat FIPV infection. The dose of the prophylactic or therapeutic agent is not limited. For example, in the case of intestinal epithelial cells, macrophages, etc., it can be administered such that at least one copy of dsRNA molecule is introduced per cell, for example, per dosage unit. The molecular weight of dsRNA is 1 nM to 100 μM, preferably 10 nM to 50 μM, more preferably 100 nM to 20 μM. The dose can be changed according to the condition, age, sex, severity, etc. of the patient cat, and is determined by the judgment of a specialist veterinarian. Furthermore, the present invention provides the above dsRNA.
A molecule or expression vector can be administered to a cat to provide a method for preventing or treating feline FIPV.

  The composition of the present invention can suppress the expression of the M gene of FIPV and, as a result, inhibit the replication of FIPV by the action of the dsRNA molecule or vector contained as a component thereof.

  Moreover, this invention can provide the replication inhibition method of FIPV using the said composition. In this method, the composition is administered to a cell, tissue or individual infected with FIPV to deliver the dsRNA molecules and expression vectors of the invention contained in the composition. The delivered dsRNA molecules and expression vectors can suppress the expression of the FIPV M gene and consequently inhibit FIPV replication.

dsRNA molecules and expression vectors include nucleic acid introduction methods known to those skilled in the art, such as, but not limited to, Hydrodynamic method, method using calcium ions, electroporation method, spheroplast method, lithium acetate method, calcium phosphate method It can be introduced into cells and tissues using a lipofection method, a microinjection method, a method using a gene gun, and the like. If the subject is an animal individual, the dsRNA molecule and expression vector are in the form of a composition comprising appropriate carriers, diluents, emulsions, and the like in the oral route, as well as intravenous, intramuscular, subcutaneous and intraperitoneal. It can be administered by injection or parenteral route.

The effect of the dsRNA molecule of the present invention is that cells and tissues into which the dsRNA molecule has been introduced, and cells or tissues in which the expression level of mRNA or protein of the M gene in the individual does not introduce the dsRNA molecule (or before introduction). , And the expression level of the M gene mRNA or protein in the individual is decreased. The M gene measured here may be expressed from an expression vector that expresses the M gene introduced in advance and / or simultaneously, or may be detected by FIPV infection. The expression level is reduced not only when the expression level is reduced by 90% or more compared to the control, but also when the expression level is reduced by 50% or more or 10% or more. When the measurement target is mRNA,
It can be measured by Northern hybridization, RT-PCR, in situ hybridization and the like. When the measurement target is a protein, it can be measured by Western blotting, ELISA, measurement using a protein chip to which an antibody is bound, measurement of protein activity, or the like. When the M gene to be detected is derived from a vector introduced in advance and / or at the same time, a detectable label gene (for example, EGFP) is incorporated into the vector together with the M gene, and the M gene and the label are incorporated. The expressed fusion protein consisting of can be detected and compared by suitable means.

  The present invention will be specifically described by the following examples, but the present invention is not limited to these examples.

Example 1. Preparation of M gene-EGFP expression vector
FIPV is a mutant strain of intestinal coronavirus, many of which are known. Of these, the FIP 79-1146 strain is highly infectious, and is considered to have the same serotype as the causative virus of FIP that has developed most in Japan. Therefore, in this example, an experiment was conducted using a gene of FIP79-1146 strain having the same serotype as the causative virus of FIP which is highly infectious and occurs frequently in Japan. Based on the sequence of the M gene of FIP79-1146 strain (SEQ ID NO: 1 AY994055), the following primers containing the FLAG tag sequence and restriction enzyme (NheI and BamHI) recognition sequences were prepared:
[Nhe-FLAG FW] 5'-CCCGCTAGCATGGTGGACTACAAGGACGACGATGACAAGAAGTACATTTTGCTAATAC
-3 '(SEQ ID NO: 10)
[FIP79-1146M-Bam RV] 5'-GCGGGATCCCACCATATGTAATAATTTTT-3 '(SEQ ID NO: 11)
PCR was performed using pBRDI-1 (provided by Dr. Peter JM Rottier (Utrecht University, Netherlands) (J. Virol. 77 (8), 4528-4538 (2003))) as the primer and template DNA. The M gene was cloned. The cloned M gene was treated with restriction enzymes with NheI and BamHI, the fragment was purified, and then cloned into the NheI-BamHI site of pACGFP1-N1 (Takara Bio Inc.). Since the M gene protein expressed from the vector is a fusion with EGFP, it can be visualized under a fluorescence microscope.

Example 2 siRNA selection and synthesis
M gene sequence of FIP79-1146 strain (SEQ ID NO: 1 AY994055)
Based on the above, four types of siRNA consisting of the following sense strands and antisense strands specifically targeting the M gene were selected by a computer program (consigned to RNAi) and synthesized respectively (consigned to PROLIGO).
siRNA1: Target gene region 695 to 717 bases Sense strand: GCUUACUACGUAAAAUCUAAA (SEQ ID NO: 2)
Antisense strand: UAGAUUUUACGUAGUAAGCCC (SEQ ID NO: 3)
siRNA2: Target gene region 527 to 549 bases Sense strand: GUUACCCUUACUCUACUUUCA (SEQ ID NO: 4)
Antisense strand: AAAGUAGAGUAAGGGUAACAC (SEQ ID NO: 5)
siRNA3: Target gene region 253-275 bases Sense strand: GCUGAUCAUGUGGCUAUUAUG (SEQ ID NO: 6)
Antisense strand: UAAUAGCCACAUGAUCAGCAU (SEQ ID NO: 7)
siRNA4: target gene region 400 to 422 bases sense strand: GAGAUCUGUUCAGCUAUAUAG (SEQ ID NO: 8)
Antisense strand: AUAUAGCUGAACAGAUCUCAC (SEQ ID NO: 9)
Negative control (non-target siRNA): no corresponding site Sense strand: CACACAGGUUGAGAUGAUUGA (SEQ ID NO: 12)
Antisense strand: AAUCAUCUCAACCUGUGUGUC (SEQ ID NO: 13)

Example 3 Analysis of M gene expression inhibitory effect by siRNA molecules The above four types of siRNA molecules were transfected into cultured cells together with M gene-EGFP expression vector, and the M gene expression inhibitory effect by each siRNA molecule was analyzed using the following analysis system. Examined.

(I) Confirmation of decrease in expression level of M gene protein by confocal laser microscope and FACS (i) Introduction of M gene-EGFP expression vector and each siRNA molecule
AD293 cell line containing 10% fetal bovine serum (FCS) and Dulbecco's modified Eagle's medium
The cells were cultured and maintained in (D-MEM) at 37 ° C. in a 5% CO ₂ environment. The cell line is seeded at a density of 4 × 10 ⁵ / well in a 6-well plate. After 20 hours, when the cells are 80-90% confluent, the medium is placed in 1 ml of D-MEM containing 5% FCS. The M gene-EGFP expression vector and various siRNAs were transfected. Transfection was performed as follows: 1.0 μg of M gene-EGFP expression vector, 1.0 μl of various siRNAs (final concentration 50 nM) and 0.5 μg of DsRed expression vector (pDsRed2-N1 vector, Clontech) in 50 μl of 0 pti-MEM On the other hand, 4 μl of Lipofectamine 2000 (Invitrogen) and 50 μl of Opti-MEM medium were mixed, allowed to stand at room temperature for 5 minutes, and then both were mixed and incubated at room temperature for 20 minutes. This mixed solution was added to each well and cultured at 37 ° C.

  Cells in each well were harvested 48 hours after transfection. After removing the culture supernatant, the cells were detached with EDTA trypsin. Thereafter, the plate was washed with PBS (−) and fixed with PBS (−) containing 10% formalin. After removing the supernatant by centrifugation, 1 ml of 0.1% BSA-PBS (-) was added and stored in the dark.

  The FIP79-1146 strain M gene expression level of the collected cells was analyzed as the fluorescence intensity of EGFP. DsRed was used to compare transfection efficiency in each siRNA transfected cell.

(ii) Analysis results a. Confirmation of decrease in expression level of M gene protein by confocal laser microscope FIG. 2 shows the result of examining the expression level of M gene-EGFP fusion protein by analyzing the fluorescence intensity of EGFP with a confocal laser microscope. It was observed that the fluorescence intensity decreased in the system in which various siRNA molecules were introduced, compared to the fluorescence intensity in the system in which no siRNA molecules were introduced. In particular, the fluorescence intensity decreased significantly in the system into which siRNA1 molecule or siRNA4 molecule was introduced.

b. Confirmation of decrease in expression level of M gene protein by FACS FIG. 3 shows the result of quantitative analysis of the expression level of the M gene-EGFP fusion protein by the fluorescence intensity of EGFP by FACS. From this quantitative analysis, it was shown that the amount of M gene-EGFP fusion protein detected in the system into which various siRNA molecules were introduced was reduced as compared with the system into which no siRNA molecules were introduced. In particular, it was shown that the expression level of the M gene-EGFP fusion protein was suppressed by about 70% in the system in which siRNA1 and siRNA4 were introduced, compared to the system in which no siRNA molecule was introduced.

(II) Confirmation of decreased expression of M gene-EGFP mRNA by real-time PCR
AD293 cells were seeded in a 12-well plate at a density of 4 × 10 ⁵ / well, and after 16 hours, 1.0 μg of M gene-EGFP expression vector and 1.0 μl (final concentration 50 nM) of various siRNAs were added to each well (see above). I) Cells were transfected by the same method as (i).

(I) Cell recovery and RNA extraction 20 hours after gene introduction, the expression of the 79-1146 strain M gene was confirmed with a confocal laser microscope (Leica), and then the cells were recovered. The culture supernatant was discarded, 1 ml of ISOGEN (Nippon Gene) was added to each well, and the cells in the well were thoroughly dissolved using a syringe and an 18 G needle. Thereafter, the sample was collected in a 1.5 ml tube, and the cells were thoroughly dissolved again and allowed to stand at room temperature for 5 minutes. 200 μl of chloroform (Wako) was added to the tube, stirred and allowed to stand at room temperature for 2 minutes, then centrifuged at 14000 rpm, 4 ° C. for 15 minutes, and the aqueous layer was transferred to another 1.5 ml tube. To this, 500 μl of isopropanol (Wako) was added, gently mixed by inversion, and allowed to stand at room temperature for 5 to 10 minutes. The supernatant was removed by centrifugation at 14000 rpm, 4 ° C. for 10 minutes. The remaining pellet was washed twice with 1000 μl of 70% ethanol, and finally centrifuged at 4 ° C. for 5 minutes at 14000 rpm, the supernatant was removed, and the pellet was naturally dried. Add 16 μl of DEPC-treated water, 1 μl of DNaseI Enzyme (Wako), 2 μl of 10 × DNase buffer (Wako), and 1 μl of RNase out (Wako) to this pellet. 1 μl of STOP solution (Wako) was added and placed on ice. After adding 80 μl of DEPC-treated water and 50 μl of phenol (Wako) to this, the mixture was stirred for 1 minute, centrifuged at 12000 rpm, 23 ° C. for 1 minute, and the aqueous layer was collected in another 1.5 ml tube. Thereafter, 20 μl of DEPC-treated water was added to the pellet obtained by ethanol precipitation, and RNA concentration was measured.

(ii) cDNA synthesis
CDNA synthesis was performed using PrimeScript ^™ cDNA synthesis kit (Takara Bio). First 1μg
The RNA was diluted with DEPC-treated water so as to contain the minute RNA. The diluted solution was reacted at 65 ° C. for 3 minutes, and then immediately cooled on ice for 2 minutes. Then add 2 μl of 2 × RT Reaction Mix, 0.5 μl of RT Enzyme Mix, 0.5 μl of Oligo (dT) primer and 0.5 μl of Random primer, mix at 25 ° C for 10 minutes, and 30 at 50 ° C. The mixture was allowed to react at 85 ° C. for 5 seconds, and then immediately left on ice.

(Iii) Reaction and analysis The synthesized cDNA, 2 × Premix EXTaq (Takara Bio), Forward primer (10 pmol / μl), Reverse primer (10 pmol / μl), probe (5 pmol / μl), Rox dye II ( Stock solution), RNase
Free water was mixed in the following volume.

The primer and probe sequences used are as follows.
Forward primer: AATGCTGATCATGTGGCTATTATGG (SEQ ID NO: 14)
Reverse primer: AAATACATCATCCAAAGTGCAAACG (SEQ ID NO: 15)
Probe: GTGCACCTGCAACACTAAAGCCGAACA (SEQ ID NO: 16)

The prepared sample was placed in a 96-well plate and reacted using Real Time PCR 7500 System. As reaction conditions, initial denaturation at 95 ° C for 10 seconds, then 95 ° C for 5 seconds, 60 ° C
At 34 seconds, 40 cycles were performed.
The analysis was performed using the SDS system software of Real Time PCR System.

(Iv) Analysis Results FIG. 4 shows the results of quantitative analysis of the expression level of M gene-EGFP mRNA by the real-time PCR method. From this quantitative analysis, it was shown that the amount of M gene-EGFP fusion protein detected in the system into which various siRNA molecules were introduced was reduced as compared with the system into which no siRNA molecules were introduced. In particular, it was shown that the expression level of M gene-EGFP mRNA was significantly suppressed in the system in which siRNA1, siRNA2, and siRNA4 were introduced, compared to the system in which no siRNA molecule was introduced.

The dsRNA molecule targeting the M gene mRNA of FIPV of the present invention can effectively suppress the expression level of the M gene protein, thereby inhibiting FIPV replication. Moreover, feline infectious peritonitis can be effectively prevented and / or treated by inhibiting FIPV replication using the dsRNA molecule of the present invention.

It is a schematic diagram which shows single-stranded RNA of FIPV. It is a figure which shows the analysis result of M gene-EGFP fusion protein by a confocal laser microscope. In the figure, ag represents the following expression systems: a: MOCK, b: M gene-EGFP + DsRed only, c: M gene-EGFP + DsRed + siRNA1, d: M gene-EGFP + DsRed + siRNA2, e: M gene-EGFP + DsRed + siRNA3, f: M gene- EGFP + DsRed + siRNA4, g: M gene-EGFP + DsRed + non-target siRNA. Each photo on the left shows a fluorescent image of EGFP, and the photo on the right shows a fluorescent image of DsRed. It is a figure which shows the expression analysis result of the M gene-EGFP fusion protein by FACS method. The expression level of the M gene-EGFP fusion protein when the M gene-EGFP expression vector is introduced alone is defined as 100%, and the expression level of the M gene-EGFP fusion protein in each system is relatively shown. The horizontal axis represents the following expression systems from the left: MOCK; M gene-EGFP + DsRed only; M gene-EGFP + DsRed + siRNA1; M gene-EGFP + DsRed + siRNA2; M gene-EGFP + DsRed + siRNA3; M gene-EGFP + DsRed + siRNA4; It is a figure which shows the expression analysis result of M gene-EGFP mRNA by real-time PCR method. The analysis is performed with the SDS system software of Real Time PCR System, and the M gene-EGFP mRNA amount is shown on the vertical axis. The horizontal axis represents the following expression systems from the left: MOCK; M gene-EGFP only; M gene-EGFP + siRNA1; M gene-EGFP + siRNA2; M gene-EGFP + siRNA3; M gene-EGFP + siRNA4; M gene-EGFP + non-target siRNA.

  SEQ ID NOs: 2-16 show synthetic oligonucleotide sequences.

Claims (3)

A double-stranded RNA (dsRNA) molecule targeting the mRNA of a matrix gene (M gene) of feline infectious peritonitis virus (FIPV), which is represented by a sense strand represented by SEQ ID NO: 2 and SEQ ID NO: 3 From the group consisting of an antisense strand, a sense strand represented by SEQ ID NO: 4 and an antisense strand represented by SEQ ID NO: 5, and a sense strand represented by SEQ ID NO: 8 and an antisense strand represented by SEQ ID NO: 9 A dsRNA molecule consisting of any selected base pair . The dsRNA molecule according to claim 1, wherein the sense strand and the antisense strand are linked via a linker molecule. A vector comprising the template DNA of the dsRNA molecule according to claim 2 and expressing the dsRNA molecule.

Images