JP2007074960A - Method for amplifying gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for amplifying a gene, which has less working procedures, less articles of consumption and contaminated waste materials, is useful even for an examination of a small number of specimens and has an extremely small risk of contamination, and is inexpensive and simple by using conventional tools and instruments. <P>SOLUTION: This method for amplifying a nucleic acid comprises a step of preparing a pipette chip as a reaction container, a step of preparing a layer of mixed liquid of a specimen containing the nucleic acid and amplification reaction liquid, and an oil layer covering the upper surface of the mixed liquid layer in the pipette chip and a step of performing the amplification of the target gene in the pipette chip. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to gene amplification from DNA / RNA, inspection of infectious diseases, detection of genetically modified plants, confirmation of the presence or absence of specific microorganisms, and gene polymorphism analysis.

  Known gene amplification methods include PCR, ligase chain reaction (LCR method), NASBA method, LAMP method, and ICAN method. The most commonly known PCR method is a method of amplifying DNA by frequently raising and lowering the temperature. The PCR method requires a dedicated device, and usually takes about 1.5 to 2.5 hours for amplification. As a method for shortening the amplification time, a PCR method using a capillary is known.

  The amplified DNA is usually confirmed by agarose gel electrophoresis. In order to confirm the amplified DNA in real time, a real-time PCR apparatus for detecting a fluorescent substance while performing an amplification operation has been developed.

  PCR technology has been widely used outside the research field. For example, in the field of infectious disease testing, it can be determined by PCR whether or not a causative bacterium of the infectious disease exists. JP Forum, Vol. 12, No. 1, p.21-22 (2003) describes the use of PCR to identify microorganisms that are detected in pharmaceutical production process control tests and shipment judgment tests genetically as species or genus. A technique for identifying or estimating by level is shown. In addition, determination using PCR has been widely performed in the field of genetically modified foods and the field of food traceability. Furthermore, in recent years, environmental purification using microorganisms has also been performed, and it is also useful here to determine the presence or absence of useful bacteria by PCR.

  PCR often takes about 1.5 to 2.5 hours, and in order to shorten the reaction time, a PCR apparatus using a capillary or a special plate has been developed. However, such a device is expensive. In general, a reaction vessel of a PCR apparatus used in a laboratory has a smaller capacity and outer shape from a 0.5 ml tube to a 0.2 ml tube. At present, smaller 384 well plates are sometimes used, and the capacity and outer shape of the PCR reaction vessel are becoming smaller.

  For example, Japanese Patent Application Laid-Open No. 2004-154008 describes a method in which a nucleic acid amplification reaction is performed on a microchip under isothermal conditions, and the obtained amplification product is subsequently analyzed on the microchip. In this method, electrophoretic analysis or visual analysis in which an excess intercalator is added to the nucleic acid amplification product and the presence or absence of the target nucleic acid is visually detected by the resulting color change is performed.

  On the other hand, in Japanese Patent Application Laid-Open No. 8-196923, a pipette having a piston, a cylinder in which the piston reciprocates in the bore, a nozzle provided at the tip of the cylinder and fitted with a tip, A liquid dispensing reaction device configured with a temperature cycle device that heats and cools a reaction sample sucked into a chip is disclosed, and a method of performing nucleic acid amplification with the liquid dispensing reaction device is described.

JP 2004-154008 A JP-A-8-196923 Edited by the Japanese Official Association, Japanese Pharmacopoeial Forum, 2003, Vol. 12, No. 1, p. 21-22

  Conventionally, when performing gene amplification such as PCR, pretreatment such as DNA extraction and purification has been required, and this pretreatment has taken time and labor. Although a method of performing a PCR reaction directly from blood or the like is also known, considering procedures up to the PCR reaction, it still requires time and effort such as mixing of reagents and dispensing operation.

  The downsizing of the reaction vessel disclosed in Japanese Patent Application Laid-Open No. 2004-154008 and the like is intended to save time and the amount of reagents in order to advance research efficiently and to process a large amount of samples. is there. On the other hand, when the number of specimens to be examined is small, the reaction container is preferably a tube. However, in this case, the reaction tube may be too small to make it difficult to determine the sample name. If a larger tube is used so that it can be easily discriminated, a larger amount of liquid is required and a reaction time is also required.

  In addition, as disclosed in JP Forum, Vol. 12, No. 1, p.21-22 (2003), PCR is carried out by genetic testing, etc. Operation is required. However, for the following reasons, PCR is still a difficult technique depending on the environment in which the operation is performed and the experience of the person performing the operation.

  For example, a chip and a reaction tube are required for each sample. Furthermore, for confirmation after PCR, it is necessary to use another chip, mix the reaction solution and the loading die, and apply the mixture to the agarose gel. For this reason, the cost of consumables is high, the operation is complicated, and it can be said that it is too much work to perform work outside a laboratory with good environment.

  For example, when the reaction is carried out in a tube, it is necessary to pay close attention, for example, not to touch the back of the lid in order to prevent DNase contamination.

  On the other hand, in the method of performing nucleic acid amplification by the liquid dispensing reaction apparatus disclosed in JP-A-8-196923, the amplification reaction is performed with a syringe attached. That is, existing equipment cannot be used, and a specific liquid dispensing reaction apparatus must be prepared.

  Therefore, an object of the present invention is to provide a gene amplification method that has few work procedures and few consumables and contaminated waste. In particular, the object of the present invention is to provide a gene amplification method that is also useful for tests with a small number of specimens, a gene amplification method that has a very low risk of contamination, and inexpensive and simple gene amplification by using existing instruments and equipment. To provide a law.

The present invention includes the following inventions.
(1) preparing a pipette tip as a reaction vessel;
Preparing a layer of a mixed solution of a sample containing a target nucleic acid and an amplification reaction solution in the pipette chip, and an oil layer covering an upper surface of the layer of the mixed solution;
And a step of amplifying the target nucleic acid in the pipette chip.

Said (2)-(4) describes about operation for preparing the layer of a liquid mixture and the layer of oil in a pipette tip.
(2) The step of preparing the mixed solution layer and the oil layer in the pipette tip includes:
Preparing the amplification reaction solution layer and the oil layer covering the upper surface of the amplification reaction solution layer in a container separate from the pipette tip;
Sucking up the oil from the layer of oil into the pipette tip;
Sucking up the amplification reaction solution from the layer of the amplification reaction solution into the pipette tip;
The nucleic acid amplification method according to (1), further comprising a step of sucking up the sample into the pipette tip.

(3) The step of preparing the mixed solution layer and the oil layer in the pipette tip includes:
Preparing a dispersion obtained by mixing and dispersing the amplification reaction solution with the oil in a container different from the pipette tip;
Sucking up the dispersion into the pipette tip;
Sucking the sample into the pipette tip;
And a step of obtaining the oil layer to be separated from the dispersion sucked up in the pipette tip.

(4) The nucleic acid amplification method according to any one of (1) to (3), further comprising a step of preparing an oil layer that covers a lower surface of the mixed solution layer.

  In (2) to (4), sucking into the pipette tip includes both sucking into the pipette tip by a pipette button operation and drawing into the pipette tip by a capillary phenomenon regardless of the button operation. .

  The nucleic acid amplification method according to any one of (1) to (4), wherein the pipette tip is disposable.

The following describes the sample.
The nucleic acid amplification method according to any one of (1) to (4), wherein the target nucleic acid is DNA or RNA.
The nucleic acid amplification method according to any one of (1) to (4), wherein the sample has not undergone the operation of extracting the target nucleic acid.
The target nucleic acid may be a gene for drug responsiveness, a gene related to a genetic disease, a gene related to disease susceptibility, a bacterial or viral gene, a marker gene of a genetically modified plant, a marker gene for identifying a variety, a plasmid or The nucleic acid amplification method according to any one of (1) to (4), which comprises a gene selected from genes cloned into a phage vector.

The following describes the amplification reaction solution.
The nucleic acid amplification method according to any one of (1) to (4), wherein the amplification reaction solution contains one or more sets of primers.
The nucleic acid amplification method according to any one of (1) to (4), wherein the amplification reaction solution contains a reagent for confirming amplification of the target nucleic acid.
The nucleic acid amplification method described above, wherein the reagent for confirming the amplification is a reagent for electrophoresis.
The nucleic acid amplification method described above, wherein the reagent for confirming the amplification is a fluorescent substance.

  The nucleic acid amplification method described above, wherein the amplification is performed by a PCR method, an LCR method, a NASBA method, a LAMP method, or an ICAN method.

The following (5) describes a pipette tip useful as a reaction vessel for nucleic acid amplification.
(5) A pipette chip containing a nucleic acid amplification reaction solution whose upper surface is covered with an oil layer.

  In the present invention, the use of a pipette tip as a reaction container enables gene amplification with very few work procedures and few consumables and contaminated waste. Further, in the present invention, by using a pipette chip as a reaction vessel, even when the number of samples is small, it is possible to construct a minimal scale reaction system in one reaction vessel. Can be shortened. Moreover, in the present invention, identification and handling of individual reaction vessels are simple. Therefore, according to the present invention, gene amplification useful for a test with a small number of specimens becomes possible. Furthermore, the present invention enables gene amplification with very little risk of contamination. Furthermore, the present invention enables inexpensive and simple gene amplification by using existing instruments and equipment.

  The present invention is a method for performing a nucleic acid amplification reaction using a pipette tip as a reaction vessel and covering the surface of a reaction mixture for nucleic acid amplification with oil in the pipette tip. That is, the present invention includes a step of preparing a pipette tip; a step of preparing a reaction mixture layer for nucleic acid amplification and an oil layer on the upper surface in the pipette tip; and a nucleic acid amplification reaction in the pipette tip. The process of performing is included.

  In the present specification, a reaction mixture for nucleic acid amplification refers to a mixture of a sample containing a target nucleic acid to be amplified and an amplification reaction, and may be referred to as an amplification reaction mixture. The amplification reaction solution refers to an amplification reaction reagent or a solution containing an amplification reaction reagent.

  In order to carry out the present invention, a sample containing a target nucleic acid, an amplification reaction reagent, a pipette chip (sometimes referred to simply as a chip in this specification), an oil, and a PCR apparatus are prepared. In the case of a targeted examination, a single reagent set is often used for amplification. In particular, in this case, a primer for performing amplification is determined, and a common amplification reaction solution containing the primer can be prepared for each specimen.

  One pipette tip is preferably prepared for each specimen. A commercially available pipette tip can be used without particular limitation regardless of its material. The volume of the pipette tip can be 10 to 250 μl, for example. The length of the pipette tip can be, for example, about 12 to 35 mm. As a pipette, a commercially available pipette can be used without any particular limitation regardless of its performance and accuracy.

  The target nucleic acid may be DNA or RNA. In the present invention, all types of nucleic acids can be used as target nucleic acids to be amplified, depending on the type of gene to be finally detected. For example, genes for drug responsiveness, genes related to genetic diseases, genes related to disease susceptibility, bacterial or viral genes, genetically modified plant marker genes, marker genes for distinguishing varieties, plasmids or phage vectors A nucleic acid containing a gene selected from cloned genes and the like can be mentioned.

  A sample containing nucleic acid is appropriately prepared by those skilled in the art. Therefore, the sample may be prepared in any form. For example, when the collected specimen is contained in an appropriate liquid such as a buffer, or when the collected specimen itself is liquid, it can be prepared as a liquid. On the other hand, when a colony is formed from the collected specimen, or when the collected specimen itself is solid, it can be prepared as a solid. The sample may be in a state where the target nucleic acid is not extracted.

  These samples can be prepared in a suitable container such as a tube or on a suitable plate such as a colony plate according to the form. In addition, when a liquid sample (hereinafter sometimes referred to simply as a sample solution) is prepared and the sample solution may be used for purposes other than nucleic acid amplification, an appropriate amount of sample solution to be used for amplification is prepared. Move it to another location. For example, drop an appropriate amount of sample solution to be used for amplification in a suitable container separate from the pipette tip, on parafilm, or in the lid of a tube prepared with amplification reaction solution. I can leave.

  On the other hand, the composition of the amplification reaction solution can be appropriately determined by those skilled in the art according to the type of amplification reaction. In the present invention, one or more sets of primers can be included in the amplification reaction solution. When two or more sets of primers are included, primers designed for multiplex amplification are prepared. Further, the amplification reaction solution may contain a reagent for confirming the amplification of the target nucleic acid. Such a reagent will be described later. Further, the amplification reaction solution may contain an additive having an action of promoting nucleic acid amplification. Examples of such additives include Ampdirect manufactured by Shimadzu Corporation.

  In the present invention, when described as an amplification reaction solution, it is not always necessary to include all of the necessary amplification reaction reagents in the middle of the preparation, and all of the necessary amplification reaction reagents in the stage immediately before performing the amplification reaction. Should be included. For example, primers, nucleic acid polymerases, and reagents common to all amplification reaction systems such as buffers, salts, and dNTPs may be mixed immediately before the amplification reaction. Prepare them in separate containers and separate them. It may be accommodated in the chip at this stage. Of course, an amplification reaction solution containing all necessary amplification reagents may be prepared in one container.

  When all the reagents necessary for amplification immediately before the amplification reaction are contained in the pipette chip, the final pH of the amplification reaction solution can be set to 8.5 to 9.5 at 25 ° C., for example. .

  As the oil, a non-volatile liquid having a specific gravity lower than that of the amplification reaction mixture can be used without particular limitation. In the present specification, the term “nonvolatile” means a property that does not volatilize under the conditions of nucleic acid amplification reaction. Examples of such liquids include mineral oil (mineral oil), vegetable oil, animal oil, silicone oil, diphenyl ether, and the like. Mineral oil is a liquid hydrocarbon compound obtained by distillation from petrolatum, and is also called liquid paraffin, liquid petrolatum, white oil, etc., and also includes low specific gravity light oil. Animal oils include cod liver oil, halibut oil, herring oil, orange luffy oil or shark liver oil. Examples of vegetable oils include canola oil, tonsil oil, cottonseed oil, corn oil, olive oil, peanut oil, safflower oil, sesame oil, and soybean oil.

  In the present invention, since a pipette tip is used as a reaction vessel, when preparing a reaction vessel containing a sample, an amplification reaction solution, and oil, the tip is attached to the pipette, and the sample, amplification reaction solution, and oil are added. It is convenient and preferable to perform the operation of sucking into the chip. The pipette volume setting can be 5-50 μl, for example about 15 μl. The sucking operation in the present invention may be performed by raising the pipette button up depending on the amount of liquid to be sucked up, or by drawing the liquid into the chip using capillary action regardless of the button operation. May be.

  In the process of preparing the reaction mixture layer for nucleic acid amplification and the oil layer on the upper surface in the pipette tip, the amplification reaction mixture layer and the oil layer on the upper surface are accommodated in the pipette tip. Any procedure may be performed as long as the prepared state is prepared. In the present invention, an oil layer may also be provided on the lower surface of the amplification reaction mixture layer in some cases. By providing the oil layer, it is possible to prevent contamination of the mixed solution and evaporation of water from the mixed solution, which may occur during work or amplification reaction.

  In order to cover the upper surface of the amplification reaction mixture layer in the pipette tip with the oil layer, for example, the operation of sucking up the oil first and then sucking up the amplification reaction solution and the sample as described above is performed. be able to. When the lower surface of the amplification reaction mixture layer is also covered with an oil layer, a phenomenon in which oil remains attached to the inner wall of the tip portion of the pipette tip having a small inner diameter can be used. For this reason, a lower layer can be formed with the oil of the same component as the upper layer oil.

  The oil and the amplification reaction solution may be prepared in the same container in a separate container from the pipette tip. In this case, both may be prepared in a layered state, or may be prepared in a state where both are mixed and dispersed. Such a method is effective when the amplification reaction solution is commonly used for a sample for nucleic acid amplification, or when the number of samples is small.

  When the sample is prepared as a liquid sample, for example, when the sample solution prepared in an appropriate place and the amplification reaction solution prepared in an appropriate container are sucked into one pipette tip, An amplification reaction mixture can be prepared. Since the sample solution and the amplification reaction solution may be finally mixed with each other in the chip to form an amplification reaction mixture solution, the order of sucking up each solution is not limited. For example, when amplification is performed on multiple samples using the same amplification reaction solution, it is preferable to suck up the amplification reaction solution first in order to prevent mixing of other samples into the amplification reaction solution in the container.

When the oil and the amplification reaction liquid are prepared in a layered state in a container different from the pipette tip, a tube or the like may be used as such a container. Specifically, the following operations can be performed. First, insert the tip (2) into the layer of oil (3) in the tube A (1) to suck up the oil (Fig.1- <1>), and then insert the tip into the layer of amplification reaction solution (4). (Fig. 1- <2>), sucking up the amplification reaction solution (Fig. 1- <3>), and preparing the sample solution (6) in another tube B (5) (Fig. 1- <4>) By inserting a chip into the solution and sucking up the sample (FIG. 1- <5>), the upper surface of the amplification reaction mixture (7) can be covered with a layer of oil (3) (FIG. 1- <6>). In FIG. 1- <5>, for the sake of convenience, the amplification reaction solution and the sample solution are depicted as being layered. However, these solutions naturally mix uniformly in the chip, and the amplification reaction mixture. Become a liquid. In FIG. 1, the pipette body is omitted from the drawing.
Further, after the amplification reaction solution and the sample are accommodated in the chip, the lower oil layer may be formed by finally sucking up the oil again.

  In addition, when the oil and the amplification reaction liquid are prepared in a state of being mixed and dispersed in a container different from the pipette tip, specifically, the following operation can be performed. The amplification reaction solution and oil are placed in a container such as a tube and shaken to mix and disperse both. The amplification reaction solution and the oil can both be accommodated in the pipette by a simple operation of sucking up the prepared dispersion liquid at a time. The sample is then drawn up into the pipette tip. From the dispersion liquid stored in the pipette tip, it is allowed to stand naturally after the liquid dispersion is sucked or after the sample is sucked, as shown in I of FIG. 1 or <6> of FIG. The oil layer separates.

  Even in the case where the sample is prepared as a solid material, an operation similar to the above can be performed. In this case, the sample can be collected by bringing the tip of the chip into contact with the surface of the solid sample and sucking it up. In some cases, a part of the collected solid sample does not completely enter the chip and adheres to the tip of the chip.Therefore, an operation for further sucking up the liquid is performed so that the adhered sample is efficiently contained in the chip. It can be carried out. Specifically, for example, a tube A (2) containing the oil (3) and the amplification reaction solution (4) is prepared, and the oil is sucked into the chip (1) (FIG. 2- <1>), Subsequently, the amplification reaction solution is sucked up (FIGS. 1- <2> and <3>), and then the tip of the chip is brought into contact with the surface of the colony (9) on the colony plate (8) (FIGS. 2- <4). >) Further, the operation of sucking up the oil in the tube A (2) (FIG. 2- <5>) can be performed. In FIG. 2, the pipette body is omitted from the drawing.

  The amount of liquid to be sucked up can be determined appropriately by those skilled in the art in consideration of the capacity of the pipette tip. The amount of suction of the amplification reaction liquid can be about 3 to 10 μl, for example. The amount of sample liquid sucked up can be, for example, about 0.5 to 1 μl. Furthermore, the amount of oil sucked up can be, for example, about 0.5 to 2 μl. The sucking operation may be performed by placing the tip of the tip slightly on the liquid surface.

  After all necessary samples selected from the sample, the amplification reaction solution, and the oil are contained in the pipette tip, the pipette button may be raised and an air layer may be formed at the tip of the tip. Considering the case where all the necessary samples selected from the sample, amplification reaction solution and oil are accommodated in the pipette tip, a part of the sample does not enter the tip and adheres to the tip of the tip. This operation is arbitrarily performed for the purpose of efficiently accommodating in the chip.

  Further, an operation of physically closing the tip of the chip may be performed. For example, the tip of the chip is sandwiched with hot tweezers (10) (Fig. 3- <1>), and the sandwiched portion is melted to form a plug (11) to be sealed (Fig. 3- <2>) Alternatively, a solid material such as rubber can be used as a stopper for sealing. On the other hand, even if the closing operation is not performed in this way and the tip of the chip is open, the contents will not spill until the amplification reaction is completed. For this reason, the operation of physically closing the tip of the chip can be arbitrarily performed.

  Moreover, it is preferable to attach an ID tag to the pipette tip. For example, a sticker or tape describing the sample name or sample number can be affixed to the top of the pipette tip (FIG. 3- <3>). In the present invention, a pipette tip used as a reaction vessel has an external shape of a certain size while having a small capacity. For this reason, the present invention has an advantage that an ID tag having a sufficiently large size that allows easy identification of the sample name can be attached while the reaction system is small in scale, and the handling of the reaction vessel is simple. Have

  As described above, the amplification reaction mixture can be prepared in a pipette tip. In the process until the amplification reaction mixture is prepared in the pipette tip, the pipette tip containing the amplification reaction solution whose upper surface is covered with oil (for example, I in the examples shown in FIGS. 2 and 3). Corresponding) is useful for a variety of samples. For example, an amplification reaction solution containing reagents common to all amplification reaction systems, such as buffers, salts, and dNTPs, and a pipette tip containing oil can be prepared and stored. Then, when it is desired to amplify the nucleic acid in the sample, the sample can be accommodated and subjected to an amplification reaction after further containing a suitably selected primer or nucleic acid polymerase in a stored pipette chip.

  In the present invention, it is possible to construct a very small scale reaction system in one reaction container while using one reaction container for each specimen. Then, by directly attaching the pipette tip to the amplification reaction apparatus as it is, the amplification reaction mixture can be subjected to the amplification reaction. When attaching to the amplification reaction apparatus, the pipette tip is attached in a state where it is removed from the pipette body. Note that the tip can be removed from the pipette body in the operation of closing the tip of the tip or the operation of attaching the ID tag after the operation of sucking up with the pipette is completed.

  In the present invention, since the amplification reaction is performed in the pipette tip, it is not necessary to prepare a reaction tube. Therefore, it is possible to ease the utmost attention to contamination that has been conventionally required in the step of transferring a sample or the like to a reaction tube using a pipette. In addition, there are the advantages that the work procedure is very small and there are very few consumables and contaminated waste.

  The nucleic acid amplification method is not particularly limited, and any method can be adopted. For example, PCR (polymerase chain reaction) method, LCR (ligase chain reaction) method, NASBA (Nucleic Acid Sequence-Based Amplification) method, LAMP (Loop-mediated Isothermal Amplification) method, ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic) acids) method. As the most general method, the PCR method is preferably performed.

  In the present invention, since one reaction container is used for each specimen and a minimal scale reaction system is constructed in one reaction container, the reaction time can be shortened. For example, when the method of the present invention is used, the amplification reaction time can be about 0.5 to 3 hours.

  If the chip after the reaction has been physically closed, the closed portion can be cut off and used for the detection of the amplified product. If the detection reagent is contained in the amplification reaction solution before the amplification reaction, the detection can be performed directly. If the detection reagent is not contained in the amplification reaction solution before the amplification reaction, the detection can be performed by mixing the chip contents and the above-described detection reagent after the amplification reaction.

  As a method for detecting an amplified product, any method can be used as long as it is a method usually used for detecting a nucleic acid. Therefore, as the detection reagent, those usually used for detection of nucleic acids can be used without any particular limitation.

  For example, when confirming by an electrophoresis method, an electrophoresis die or the like can be used. If the amplification reaction solution contains a die for electrophoresis in advance, if the chip is attached to the pipette after the amplification reaction is completed, the amplified product can be electrophoresed by using the chip used as a reaction vessel as it is. Can be applied to gel wells. As described above, when the method of the present invention is used, the number of consumables is minimized and the operation becomes very simple even in the detection after the amplification reaction.

  For example, when confirming by detecting fluorescence, a suitable fluorescent substance is mentioned. Specific examples include reagents used in the invader method. In this case, the amplification reaction can be followed by an invader reaction. According to the present invention, gene polymorphism typing can be performed very easily.

  Thus, when the method of the present invention is used, various tests using gene amplification can be performed very easily. If there are a tube and a pipette tip that contain a reagent for amplification reaction or a reagent for detection as a test solution, the reaction mixture can be prepared at any location. For example, the work of environmental inspection can be greatly simplified by bringing the tube containing the test liquid and the pipette tip to the site and collecting the microorganisms in the environment. Moreover, the present invention can be used effectively even when the number of specimens to be examined is small because of the fact that a reaction system on a micro scale can be constructed for each reaction container and the handling of individual reaction containers is easy. it can. In addition, since the work procedure is very small and there are few consumables and contaminated waste, it goes without saying that the present invention is useful even when the number of samples to be examined is large.

<Example 1>
[Multiplex PCR reaction using 1.20 sets of primers]
Using purified human genomic DNA as a template, 24 μl of a PCR reaction mixture containing 35 ng / μl template DNA was prepared. The following components are mixed in the PCR reaction mixture.
Template DNA 35ng / μl
20 pairs (40 types) of primers 12.5 mmol each
Ex-Taq DNA polymerase (Takara Shuzo) 10 units TaqStart (Clontech Laboratories) 0.55 μg
TaqStart is an antibody against EX-Taq DNA polymerase and can be hot-started by adding it to the reaction solution.

  Specifically, primers of SEQ ID NOs: 1 to 40 that can amplify the region containing SNP shown in Table 1 were used. These primers were commissioned to Proligo Japan.

  3 μl of the above mixture was dispensed into a pipette tip and then 2 μl of mineral oil was overlaid. The pipette tip was placed in a 1.5 ml assist tube and lightly centrifuged, followed by PCR reaction.

  For the PCR reaction, a PCR reaction device Quick Thermo Personal QTP-1 (manufactured by Nippon Genetics) was used. The PCR reaction was first performed at 98 ° C. for 2 minutes, and the cycle of 98 ° C. for 1 second-55 ° C. for 30 seconds-65 ° C. for 1 minute was repeated 35 times. At this time, the PCR reaction time was about 2 hours.

[2. Confirmation by invader reaction]
After the PCR reaction, 0.2 μl of the reacted mixture was used for the invader reaction. As an invader reagent, an invader assay kit (manufactured by Third Wave Technology) was used.
The invader reaction was performed by first heating at 96 ° C. for 5 minutes, followed by incubation at 63 ° C. for 40 minutes, and detecting fluorescent signals VIC and FAM every other minute in real time. For detection of the fluorescent signal, Mx3000P (manufactured by Stratagene) was used. When a VIC signal was plotted on the X axis and a FAM signal was plotted on the Y axis, and typing was attempted, 14 SNPs were typed at an appropriate expected position.

[3. Evaluation]
It was confirmed that the pipette tip was useful as a reaction vessel. It was also confirmed that the pipette tip was useful as a pretreatment container for performing gene polymorphism typing in an invader reaction.

<Example 2>
[1. PCR reaction]
Using purified human genomic DNA as a template, 24 μl of a PCR reaction mixture containing 5 ng / μl template DNA was prepared. The PCR reaction mixture contains:
Template DNA 3ng
One pair of primers 4 μmol each
Ex-Taq DNA polymerase (Takara Shuzo) 5 units dNTP Mix (each 2.5 mM) 1.2 μl
Ampdirect (manufactured by Shimadzu Corporation) 4.8 μl
As the primer, specifically, primers of SEQ ID NOS: 33 and 34 described in Table 1 were used.

  3 μl of the above mixture was dispensed into a pipette tip whose tip was sealed with heat, and then 2 μl of mineral oil was overlaid. The pipette tip was placed in a 1.5 ml assist tube and spun down to perform a PCR reaction. The PCR reaction was carried out under the condition that QTP-1 was first heated at 98 ° C. for 2 minutes and a cycle of 98 ° C. for 1 second-55 ° C. for 10 seconds-65 ° C. for 40 seconds was repeated 30 times. At this time, the PCR reaction time was about 1 hour.

[2. Confirmation by agarose electrophoresis]
After the PCR reaction, the pipette tip was attached to the pipette, the tip of the sealed pipette tip was cut with scissors, and the mineral oil and the reacted mixed solution were discharged onto the parafilm. After the reacted mixture was mixed with an electrophoresis die, 2 μl of the reacted mixture was subjected to agarose electrophoresis. As a result, a band of about 550 bp could be confirmed.

[3. Confirmation by invader reaction]
Separately, after PCR reaction, 0.2 μl of the reacted mixture was subjected to invader reaction. As an invader reagent, an invader assay kit (manufactured by Third Wave Technology) was used.
The invader reaction was performed by first heating at 96 ° C. for 5 minutes and then incubating at 63 ° C. for 30 minutes, and detecting fluorescent signals VIC and FAM every other minute in real time. For detection of the fluorescent signal, Mx3000P (manufactured by Stratagene) was used. As a result, since both fluorescence signals were detected, it was revealed that the template DNA has both wild type and mutant bases.

[4. Evaluation]
It was confirmed that the pipette tip was useful as a reaction vessel. It was also confirmed that the pipette tip was useful as a pretreatment container for performing gene polymorphism typing in an invader reaction.

<Example 3>
[1. PCR reaction]
In order to confirm the insertion of E. coli cloned in the plasmid and amplify the 16S rRNA gene of E. coli, PCR was performed in the following steps.
1) A PCR reaction solution (lower layer) and mineral oil (upper layer) were placed in a tube in advance.
2) First, 2 μl of mineral oil was sucked from the upper layer into the pipette tip attached to the pipette.
3) Next, the chip was inserted deeply, and 3 μl of the PCR reaction solution was sucked up from the lower layer.
4) The chip was removed from the tube, and the tip of the chip was brought into contact with the E. coli colonies on the plate.
5) Again, 2 μl of mineral oil was sucked up from the upper layer in the tube, and the PCR reaction solution was sandwiched with mineral oil.
6) The tip of the pipette tip was sealed with hot tweezers and sealed with heat, and then PCR reaction was performed.

The PCR reaction solution contains the following.
Ex-Taq (5 units / μl) 1.0 μl
ExTaq buffer 1.2 μl
dNTP Mix (2.5 mM each) 1.2 μl
4 μl of each primer
Distilled water (total amount of reaction solution was 12 μl)

Specifically, the following were used as primers.
As a primer for amplification of a gene derived from M13 plasmid DNA;
M13-F (forward primer; CGACGTTGTAAAACGACGGCCAGT: SEQ ID NO: 41) and
M13-R (reverse primer; GGAAACAGCTATGACCATGATTAC: SEQ ID NO: 42), each at 20 pmol / μl, 0.5 μl (both manufactured by Takara Shuzo),
As a primer for amplification of the E. coli 16S rRNA gene;
10F (forward primer; GTTTGATCCTGGCTCA: SEQ ID NO: 43) and
800R (reverse primer; TACCAGGGTATCTAATCC: SEQ ID NO: 44), 10 μM each and 0.5 μl (both synthesis was contracted to Proligo Japan) were used.

  The PCR reaction was carried out under the condition that QTP-1 (manufactured by Nippon Genetics) was first heated at 98 ° C. for 2 minutes and the cycle of 98 ° C. 1 second-55 ° C. 10 seconds-65 ° C. 40 seconds was repeated 30 times. It was. At this time, the PCR reaction time was about 1 hour.

[2. Confirmation by agarose gel electrophoresis]
After the PCR reaction, the pipette tip was attached to the pipette, the tip of the sealed pipette tip was cut with scissors, and the mineral oil and the reacted mixed solution were discharged onto the parafilm. After the reacted mixture was mixed with an electrophoresis die, 2 μl of the reacted mixture was subjected to agarose electrophoresis. The results are shown in FIG. 4 (M indicates a marker lane). As shown in FIG. 4, the PCR amplification product of the DNA cloned into the plasmid (band indicated by M13 in the figure) and the PCR amplification product of the E. coli 16S rRNA gene (band indicated by 16S in the figure) were confirmed.

  In this example, JP Forum Vol.12 No.1 (2003) p.21-22 14th revised Japanese Pharmacopoeia Second Supplement was referred to. This document describes a technique for rapidly identifying or estimating a bacterium as a microorganism by automatically analyzing a partial gene sequence of a highly variable region of 16S rRNA and collating it with a database.

[3. Evaluation]
It was shown that the amount of consumables can be reduced since the electrophoresis operation can be performed with a pipette tip directly in contact with the colony. Moreover, since it was possible to amplify not only plasmid DNA but 16S rRNA gene, it was shown that it is effective for a microorganism test.

<Example 4>
[1. PCR reaction]
Using the genomic DNA prepared in Example 1 as a template, a 3 ng / μl template DNA aqueous solution was prepared in a tube. In addition, 10 μl of the PCR reaction solution was prepared in another tube (0.2 ml). The PCR reaction solution contains the following.
One pair of primers 4 μmol each
Z-Taq DNA polymerase (Takara Shuzo) 1 unit dNTP Mix (2.5 mM each) 1.0 μl
Ampdirect (manufactured by Shimadzu Corporation) 2.5μl
In addition, as a primer, the primer of sequence number 33 and 34 of Table 1 was used.

A tube containing 10 μl of the PCR reaction solution was overlaid with 10 μl of mineral oil.
The pipette memory for 10 μl was set to 10 μl and a pipette tip was attached.
About 2 μl of the template DNA solution was sucked up from the tube containing the template DNA, and transferred to the lid of the tube containing the PCR reaction solution and mineral oil.

  The pipette tip was put into the upper mineral oil layer in the tube, and about 2 μl of mineral oil was sucked. Then, the pipette tip was inserted into the lower reaction solution layer, and 3 μl of the reaction solution was sucked. Further, 0.5 μl of the template DNA solution that had been transferred to the tube lid was aspirated. Once again, 2 μl of mineral oil was sucked up from the upper layer in the tube, and finally the tip was taken out to suck up the air.

  Remove the pipette tip from the pipette, sandwich the tip with aluminum foil to prevent contamination, and perform PCR reaction with a cycler (DNA Engine Tetrad 2 PTC-240, Flat Block Alpha Unit, manufactured by MJ Research) using an in situ PCR block. Went. The PCR reaction was first performed at 98 ° C. for 2 minutes, and the cycle of 98 ° C. for 1 second-55 ° C. for 10 seconds-65 ° C. for 40 seconds was repeated 30 times. At this time, the PCR reaction time was about 1 hour.

[2. Confirmation by agarose electrophoresis]
After the PCR reaction, the pipette tip was attached to the pipette, and the mineral oil and the reacted mixed solution were discharged on the parafilm. The reacted mixture was mixed with an electrophoresis die and then subjected to agarose electrophoresis. The results are shown in FIG. 5 (M indicates a marker lane). As shown in FIG. 5, a band of about 550 bp could be confirmed.

[3. Evaluation]
It was shown that amplification can be performed in a manner that does not crush the tip of the pipette tip. Since it is not necessary to cleave the tip during electrophoresis, for example, if an electrophoresis die is added to the PCR reaction solution in advance, it is possible to perform electrophoresis as it is by attaching a pipette tip to the pipette after the PCR reaction. Sex was shown.

The process for preparing an amplification reaction mixture when the sample containing the nucleic acid to be amplified is a liquid sample is schematically shown. The process for preparing an amplification reaction mixture when the sample containing the nucleic acid to be amplified is a solid sample is schematically shown. The process of sealing the tip of a pipette tip and attaching an ID tag is schematically shown. 4 is a result of electrophoresis obtained in Example 3. 4 is a result of electrophoresis obtained in Example 4.

Explanation of symbols

1: Pipette tip
2: Tube A
3: Oil
4: Amplification reaction solution
5: Tube B
6: Sample solution
7: Amplification reaction mixture
8: Colony plate
9: Colony
10: Tweezer tip
11: stopper
12: ID tag I: Pipette tip containing an amplification reaction solution whose upper surface is covered with oil

  SEQ ID NOs: 1-44 are primers.

Claims (5)

Preparing a pipette tip as a reaction vessel;
Preparing a layer of a mixed solution of a sample containing a target nucleic acid and an amplification reaction solution in the pipette chip, and an oil layer covering an upper surface of the layer of the mixed solution;
And a step of amplifying the target nucleic acid in the pipette chip. The step of preparing the mixed solution layer and the oil layer in the pipette tip,
Preparing the amplification reaction solution layer and the oil layer covering the upper surface of the amplification reaction solution layer in a container separate from the pipette tip;
Sucking up the oil from the layer of oil into the pipette tip;
Sucking up the amplification reaction solution from the layer of the amplification reaction solution into the pipette tip;
The nucleic acid amplification method according to claim 1, further comprising a step of sucking up the sample into the pipette tip. The step of preparing the mixed solution layer and the oil layer in the pipette tip,
Preparing a dispersion obtained by mixing and dispersing the amplification reaction solution with the oil in a container different from the pipette tip;
Sucking up the dispersion into the pipette tip;
Sucking the sample into the pipette tip;
The method for nucleic acid amplification according to claim 1, further comprising the step of obtaining the oil layer separated from the dispersion liquid sucked into the pipette tip. The nucleic acid amplification method according to any one of claims 1 to 3, further comprising a step of preparing an oil layer covering a lower surface of the mixed solution layer. A pipette chip containing a nucleic acid amplification reaction solution whose upper surface is covered with an oil layer.