ES2355142T3 - PROCEDURE FOR THE IN-SITU PRODUCTION OF AN EMULSIONANT IN A FOOD. - Google Patents

Abstract

Process for the production in situ of an emulsifier in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that exhibits acyltransferase activity and comprising the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

Description

FIELD OF THE INVENTION

The present invention relates to a process for the in situ production of an emulsifier in a food by using a lipid acyltransferase.

The present invention further relates to a process for the on-site production of an emulsifier in a food by using a lipid acyltransferase, in which the process is such that the emulsifier is produced without increasing or substantially increasing free fatty acids. in the food

The present invention still further relates to a process for the in situ production of at least two emulsifiers in a food by using a lipid acyltransferase.

The present invention further relates to a process for the in situ production of a carbohydrate ester and / or a sterol ester and / or a stanol ester and / or a protein ester and / or a glycerol ester and / or a hydroxy acid ester in a food by using a lipid acyltransferase.

The present invention relates to the use of a food enzyme composition and / or an enzyme feed composition, which contains a lipid acyltransferase, in the methods of the present invention.

A method of identifying suitable lipid acyltransferases according to the present invention, lipid acyltransferases identified and an immobilized lipid acyltransferase is disclosed.

BACKGROUND OF THE TECHNIQUE

The beneficial use of phospholipases and lipases (called lipolytic enzymes, (EC.3.1.1.x) used in industrial applications in food and / or feed is known for many years.

For example, in EP 0 585 988 it is claimed that the addition of lipase to the dough produced an improvement in the anti-hardening effect. It is suggested that a lipase obtained from Rhizopus arrhizus when added to the dough may improve the quality of the resulting bread when used in combination with lard / fat. WO 94/04035 discloses that improved softness can be obtained by adding a lipase to the dough without adding fat / oil to the dough. Castello, P.ESEGP 89-10 Dec. 1999. Helsinki, demonstrates that exogenous lipases can modify the volume of bread.

Lipolytic enzymes hydrolyze one or more of the fatty acids from the lipids present in the food which can produce the formation of potent emulsifying molecules in food which provides commercially valuable functionality. The molecules that contribute to the most significant emulsifying characteristics are the products of partial hydrolysis, such as the lysophospholipid, lysoglucolipid and monoglyceride molecules. Polar products of lipid hydrolysis, such as lyso phospholipids and lyso glycolipids have particular advantages. In bread making, said in situ modified emulsifiers can provide equivalent functionality as emulsifiers, such as DATEM.

However, the activity of lipolytic enzymes can cause the accumulation of free fatty acids that can lead to harmful functionality in the food. This activity of lipolytic enzymes limits its functionality.

Numerous solutions to this problem have been tried in the art. However, these produce a significant increase in free fatty acids in the food, particularly foods with a high water content, including, but not limited to, bread dough and egg yolk.

Phospholipases, particularly phospholipase A2 (E.C.3.1.1.4), have been used for many years for the treatment of egg or egg-based products (see for example US document no.

4,034,124 and Dutihl & Groger 1981 J. Sci. Food Agric. 32, 451-458). The activity of phospholipase during the treatment of egg or egg-based products produces the accumulation of polar lysolecitin, which can act as an emulsifier. The treatment of egg phospholipase or egg-based products can improve stability, thermal stability under heat treatment such as pasteurization and results in substantial thickening. Egg-based products may include, but are not limited to cakes, mayonnaise, salad dressings, sauces, ice cream and the like. The use of phospholipases causes the accumulation of free fatty acids. The accumulation of free fatty acids can cause a significant lack of flavor. In addition, the accumulation of free fatty acids can produce an increase in oxidation sensitivity, and therefore produce poor storage stability, discoloration of the product and alteration of other critical characteristics of the food such as taste and texture. Recently, lipolytic enzymes with broader substrate specificity have been commercialized for the treatment of food products such as egg yolk and related. These have the advantage that, unlike most A2 phospholipases, they do not come from any mammal. However, they produce a significant accumulation of free fatty acids not only due to the hydrolysis of phospholipids but also of triglycerides.

As mentioned earlier, another area where lipases have been widely used is the bakery industry. The use of phospholipases in baking dates from the beginning of 1980.

The substrate for lipases in wheat flour is 1.5 to 3% of endogenous wheat lipids, which are a complex mixture of polar and apolar lipids. Polar lipids can be divided into glycolipids and phospholipids. These lipids are constituted by glycerol esterified with two fatty acids and a polar group. The polar group contributes to the surface activity of these lipids. Enzymatic cleavage of one of the fatty acids in these lipids leads to lipids with much greater surface activity. It is well known that emulsifiers, such as DATEM, with great surface activity are very functional when added to the dough.

However, the use of lipases (E.C. 3.1.1.X) in dough products can have a detrimental impact on the activity of the yeast and / or a negative effect on the volume of the bread. A negative effect on bread volume is often explained by overdose. Overdose can lead to a decrease in the elasticity of gluten that produces a dough that is too stiff and therefore produces reduced bread volumes. In addition, or alternatively, lipases can degrade the butter, oil or milk fat added to the dough, causing a lack of flavor in the dough and the baked product. Overdose and lack of flavor have been attributed to the accumulation of free fatty acids in the dough.

In EP 1 193 314, EP 0 977 869 and also in WO 01/39602, it was published that the use of active lipolytic enzymes in glycolipids was particularly beneficial in the application of bread making since the products of partial hydrolysis lysoglucolipids were found to have a very high emulsifier functionality, which apparently produces a higher proportion of positive emulsifier functionality as opposed to the harmful accumulation of free fatty acids. However, it was also discovered that enzymes have significant non-selective activity on triglycerides, which unnecessarily produces many free fatty acids.

The same discovery was published in WO 00/32758, which disclosed variants of the lipolytic enzyme with enhanced activity on phospholipids and / or glycolipids, in addition variants that had a preference for long chain fatty acids over short ones. This last property, also disclosed in WO 01/39602, was considered of particular importance to prevent the lack of flavors associated with the accumulation of short-chain free fatty acids. However, significant free fatty acids are produced.

The problem of high triglyceride activity was studied in WO 02/094123, which discloses the use of active lipolytic enzymes in polar lipids (i.e., glycolipids and phospholipids) in a mass, but substantially inactive on triglycerides or 1-monoglycerides. However, significant free fatty acids are produced.

Some lipolytic enzymes have little or no activity on the smooth form of polar lipids (eg, glycolipids / phospholipids). The use of said enzymes has been deemed preferable, since they guarantee the accumulation of polar lysolipids, producing optimum functionality. However, free fatty acids accumulate. This selective functionality is characteristic of the phospholipase A2 enzymes and the glycolipases disclosed in EP 0 977 869, EP 1 193 314 and WO 01/39602. Variant enzymes of less selective lipolytic enzymes have been produced which have a lower enzymatic activity on polar lysolipids compared to the original enzyme (WO 03/060112). However, significant free fatty acids are produced.

WO 00/05396 discloses a process for the preparation of a food comprising an emulsifier, in which the food material is in contact with an enzyme such that the enzyme generates an emulsifier from a fatty acid ester and A second constituent generates a second functional ingredient. WO 00/05396 discloses the use of in particular a lipase or esterase enzyme. Nowhere in WO 00/05396 is the specific use of a lipid acyltransferase disclosed. In addition, in foods with high water content, the use of esterases and lipases as disclosed in WO 00/05396 would produce significant accumulation of free fatty acids.

A drawback associated with the use of lipases, including phospholipases and glycolipases, can be caused by the construction of free fatty acids released from lipids. During the past two decades the use of lipolytic enzymes in foods has been limited because the balance between the harmful accumulation of free fatty acids and the production of lysolipids provides positive functionality. Although numerous strategies have been tried in the field, some of which provided significant improvements in functionality, the fundamental problem in the art has not been fully studied, that is, the significant accumulation of free fatty acids in foods prepared using enzymes. lipolytic in situ.

The presence of large amounts of free fatty acids (FFA) in raw materials or food products is generally recognized as a quality defect and food processors and customers usually include a maximum amount of FFA in food specifications. The effects resulting from excess amounts of FFA may be organoleptic and / or functional defects.

A result of lipolysis is hydrolytic thickening, with the formation of the characteristic "soap" flavor. This "soap" flavor is especially acute with fatty acids of intermediate chain length (C8C12), which, although not present in high concentrations, can be important constituents, for example, of dairy products or vegetable oils. A more frequent organoleptic defect is due to the combined effect of lipolytic enzymes and oxidation processes. Unsaturated fatty acids are more sensitive to enzymatic oxidation when they are not esterified than when they are esterified in acyl lipids.

Functional defects in food due to large concentrations of FFA are recognized but are less easy to explain. Without wishing to be bound by theory, hydrolysis of unchanged lipids to carboxylic acids will increase [H +] and produce carbonyl groups that can be combined with other metal compounds or ions. Free fatty acids are also combined with proteins by hydrophobic interactions and can be complexed with starch during cooking. FFAs can also interfere with the action of surface active agents, such as polar lipids and emulsifiers (Lipid in Cereal Technology, P. J. Barnes, Academic Press 1983).

WO 03/100044 discloses a class of acyltransferases known as PDAT (or ATWAX). These enzymes use a monoglyceride or diglyceride as the acceptor molecule, and phosphatidylcholine (PC) as the donor molecule to produce the following products: lyso-phosphatidylcholine and triacylglycerol and / or diacylglycerol.

In one embodiment, the present invention relates to improvements in the incorporation of whey proteins into food products, providing better yields without altering the qualities (such as texture) of food compositions and products.

Cheese compositions are generally prepared from dairy liquids by processes that include treating the liquid with a coagulating or curdling agent. The coagulating agent can be a coagulating enzyme, an acid or a suitable bacterial culture or it can include said culture. The resulting clot usually incorporates transformed casein, fats that include natural shortening fat and dressings that increase especially when a bacterial culture is used. The clot can be separated from the liquid serum, which contains soluble proteins not affected by coagulation and which are therefore not incorporated into the coagulate.

Whey is therefore a byproduct of preparation in commercial processes that produce food products such as cheeses. Traditionally, whey is disposed of an unused residue or used as fertilizer or animal feed or processed into a food ingredient.

The inability of whey proteins to remain substantially in the clot is an important factor contributing to a lack of efficacy in the conventional production of dairy products (such as cheese clots) and a reduction in overall yield in relation to the incorporation of all protein solids that are present in the starting milk liquids in the resulting cheese clots.

Numerous attempts have been made to include whey proteins in cheese for example, by heat treatment of milk, heat treatment of cheese or by filtration, such as by ultrafiltration.

There are also several descriptions of the use of specific proteases to cause the accumulation of whey proteins. A serine protease from Bacillus licheniformis has been shown to have the ability to cause the accumulation of whey proteins (US 5,523,237).

However, there are still many difficulties associated with the addition of whey proteins in processes such as taste and mouthfeel of the product, and also tend to interfere with coagulation and subsequent treatment of the product. The proteases described above that can be added to cheese milk for the hydrolysis of whey proteins produce significant hydrolysis of caseins as described by Madsen, JS & Qvist, KB (1997) Hydrolysis of milk protein by Bacillus licheniformis protease specific for acidic amino acid residues. J. Food Sci. 62, 579-582.

Therefore, there is a need in this matter for processes and compositions that provide improved incorporation of whey protein into food products while maintaining organoleptic and other desirable properties. Such optimization would result in increased efficiency, higher yields of food products and reduced total material costs.

Lipase: cholesterol acyltransferases have long been known (see for example Buckley-Biochemistry 1983, 22, 5490-5493). In particular, it has been found that glycerophospholipid: cholesterol acyltransferases (GCAT), such as lecithin: vegetable and / or mammalian cholesterol acyltransferases (LCAT), will catalyze the transfer of fatty acids between phostatidylcholine and cholesterol.

Upton and Buckley (TIBS 20, May 1995, pp. 178-179) and Brumlik and Buckley (J. of Bacteriology, April 1996, pp. 2060-2064) disclose an Aeromonas hydrophila lipase / acyltransferase that has the ability to carry out the transfer of acyl to alcohol receptors in aqueous medium.

ASPECTS OF THE SUMMARY OF THIS INVENTION

According to a first aspect of the present invention there is provided an in situ production process of an emulsifier in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that has acyltransferase activity comprising the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T , N, M or S.

In a further aspect, the present invention provides the use of a lipid acyltransferase to prepare from a food material a food containing water comprising an emulsifier, in which the emulsifier is produced without increasing or substantially increasing free fatty acids. in the food and in which the emulsifier is generated from the constituents of the food material by the lipid acyltransferase, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and which comprises the GDSX motif of the sequence of amino acids, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

In a further aspect, the present invention provides an in situ production process of an emulsifier in a food containing water, wherein the process is such that the emulsifier is produced without increasing or substantially increasing the free fatty acids in the food , and in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X it is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% activity of acyltransferase.

In another aspect, the present invention provides an in situ production process of an emulsifier and either a sterol ester and / or a stanol ester in a food containing water, in which the process is such that the emulsifier is produced without increasing or without substantially increasing the free fatty acids in the food, and in which the process comprises the step of adding the lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and which comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S, and in which The lipid acyltransferase has at least 5% acyltransferase activity.

In another aspect, the present invention provides an in situ production process of an emulsifier and either a sterol ester and / or a stanol ester in a food containing water, in which the process comprises the step of adding the lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V , I, F, Y, H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity.

According to another aspect of the present invention there is provided a process for the production in situ of at least two emulsifiers in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid Acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H , Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity.

According to a further aspect of the present invention there is provided an in situ production process of at least two emulsifiers and either a sterol ester and / or a stanol ester in a food containing water, in which the process is such that The emulsifiers are produced without increasing or substantially increasing the free fatty acids in the food, and in which the process comprises the step of adding the lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses activity of acyltransferase and comprising the GDSX motif of the amino acid sequence, in which X is one

or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity .

According to a further aspect of the present invention there is provided an in situ production process of at least two emulsifiers and either a sterol ester and / or a stanol ester in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity.

In a further aspect the present invention provides a process for the in situ production of an emulsifier in which the emulsifier is a carbohydrate ester in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food. , in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I , F, Y, H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity.

In another aspect, the present invention provides a process for the production in situ of a carbohydrate ester together with an emulsifier in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which The lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y , H, Q, T, N, M or S, and in which the lipid acyltransferase has at least 5% acyltransferase activity.

In another aspect, the present invention provides a process for the in situ production of an emulsifier, and one or more of a carbohydrate ester; a sterol ester; a stanol ester; a protein ester; a monoglyceride or diglyceride in a food containing water, and in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and which comprises the motif GDSX of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S, and in which the Lipid acyltransferase has at least 5% acyltransferase activity.

A process for producing a food comprising an emulsifier is disclosed, in which the process comprises the step of adding a lipid acyltransferase to the food as defined herein.

A process for producing a food comprising an emulsifier is disclosed, in which the process is such that the emulsifier is produced without increasing or substantially increasing the free fatty acids in the food; and wherein the process comprises the step of adding a lipid acyltransferase to the food, a process for producing a food comprising an emulsifier and a sterol ester and / or a stanol ester, wherein the process is such that the Emulsifier is produced without increasing or substantially increasing the free fatty acids in the food; and wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising an emulsifier and a sterol ester and / or a stanol ester, wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising at least two emulsifiers, in which the process comprises the step of adding a lipid acyltransferase to the food; a process for producing a food comprising at least two emulsifiers and either a sterol ester and / or a stanol ester, in which the process is such that the emulsifier is produced without increasing or substantially increasing free fatty acids in the food; and wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising at least two emulsifiers and either a sterol ester and / or a stanol ester, wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising a carbohydrate ester, wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising a carbohydrate ester and an emulsifier, wherein the process comprises the step of adding a lipid acyltransferase to the food; a method of producing a food comprising an emulsifier and one or more of a carbohydrate ester; a sterol ester; a stanol ester; a protein ester; a monoglyceride or diglyceride, and wherein the process comprises the step of adding a lipid acyltransferase to the food; and the use of a lipid acyltransferase to prepare from a food material a food comprising an emulsifier, in which the emulsifier is generated by the lipid acyltransferase from constituents of the food material.

In another aspect, the present invention provides the use of a lipid acyltransferase to prepare from a food material a food containing water comprising an emulsifier and a sterol ester and / or a stanol ester, in which the emulsifier is produces without increasing or substantially increasing the free fatty acids in the food, and in which the emulsifier and the sterol ester and / or the stanol ester is / are generated by the lipid acyltransferase from the constituents of the food material, in which the lipid acyltransferase is characterized as an enzyme that has GDSX with acyltransferase activity, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

The use of a lipid acyltransferase for preparing a food from a food material comprising an emulsifier and a sterol ester and / or a stanol ester, wherein the emulsifier and the sterol ester and / or ester is disclosed The stanol ester is / are generated by the lipid acyltransferase from the constituents of the food material.

In another aspect, the present invention provides the use of a lipid acyltransferase to prepare from a food material a food containing water comprising at least two emulsifiers, in which emulsifiers are produced without substantially increasing or substantially increasing acids. free fatty acids in the food, and in which the lipid acyltransferase generates the two emulsifiers from the constituents of the food material, in which the lipid acyltransferase is characterized as an enzyme that possesses GDSX with acyltransferase activity, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

According to another aspect of the present invention, the use of a lipid acyltransferase is provided to prepare from a food material a food containing water comprising at least two emulsifiers and one of a sterol ester and / or a stanol ester , in which the emulsifiers are produced without increasing or substantially increasing the free fatty acids in the food, and in which the one or both emulsifiers and / or the sterol ester and / or a stanol ester is / are generated ( s) by the lipid acyltransferase from the constituents of the food material, in which the lipid acyltransferase is characterized as an enzyme possessing GDSX with acyltransferase activity, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

The use of a lipid acyltransferase to prepare a food from a food material comprising at least two emulsifiers and one of a sterol ester and / or a stanol ester, wherein one or both emulsifiers is disclosed and / or the sterol ester and / or the stanol ester is / are generated by the lipid acyltransferase from the constituents of the food material.

The use of a lipid acyltransferase to prepare from a food material a food comprising a carbohydrate ester, wherein the lipid acyltransferase generates the carbohydrate ester from the constituents of the food material is disclosed.

In another aspect, the present invention provides the use of a lipid acyltransferase to prepare from a food material a food containing water comprising at least one carbohydrate ester and an additional emulsifier, in which the emulsifier is produced without increasing or without substantially increasing the free fatty acids in the food, and in which the carbohydrate ester and the emulsifier are generated by the lipid acyltransferase from the constituents of the food material, in which the lipid acyltransferase is characterized as an enzyme that it possesses acyltransferase activity and which comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

In another aspect, the present invention provides the use of a lipid acyltransferase to prepare from a food material a food containing water comprising an emulsifier and one or more of a carbohydrate ester; a sterol ester; a stanol ester; an ester protein; a monoglyceride or diglyceride, and in which the emulsifier is produced without increasing or substantially increasing the free fatty acids in the food, and in which the emulsifier and / or the carbohydrate ester and / or sterol ester and / or the stanol ester and / or the ester protein and / or the monoglyceride and / or the diglyceride is / are generated by the lipid acyltransferase from the constituents of the food material, in which the lipid acyltransferase is characterized as a enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, wherein X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

According to a further aspect of the present invention there is provided a process of the in situ production of an emulsifier, preferably a lisolecitin and a sterol ester in an egg-based food product, in which the process is such that the emulsifier is produced without increasing or substantially increasing the free fatty acids in the food, and in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and which comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S and in which The lipid acyltransferase has at least 5% acyltransferase activity.

According to a further aspect of the present invention there is provided a process of the in situ production of an emulsifier, preferably a lysolecitin and a sterol ester in an egg-based food product, in which the process comprises the step of adding a lipid food acyltransferase, in which the lipid acyltransferase is characterized as an enzyme that has acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S and in which the lipid acyltransferase has at least 5% acyltransferase activity.

In another aspect, the present invention provides a method of producing an egg-based food comprising an emulsifier, preferably a lysolecitin and a sterol ester in an egg-based food, in which the emulsifier is produced without increasing or without substantially increasing the free fatty acids in the food, and in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and which comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S and in which the lipid acyltransferase It has at least 5% acyltransferase activity.

In another aspect, the present invention provides a method of producing an egg-based food comprising an emulsifier, preferably a lysolecitin and a sterol ester in an egg-based food, in which the process comprises the step of adding a food lipid acyltransferase, in which the lipid acyltransferase is characterized as an enzyme that possesses acyltransferase activity and that comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S and in which the lipid acyltransferase has at least 5% acyltransferase activity.

In a further aspect, the present invention also provides a food containing water that can be obtained, preferably obtained, by a process according to the present invention in which the food comprises a lipid acyltransferase according to the present invention and an emulsifier.

An enzymatic food composition and / or an enzymatic feed composition, containing a lipid acyltransferase, and the use of said composition in the methods of the present invention is disclosed.

A method of identifying a suitable lipid acyltransferase, comprising the steps of determining an enzyme of interest using one or more of "Transferase assay in a medium with little water", the "Transferase assay in egg yolk with a lot of water "or" Transferase assay in buffered substrate "and selecting a lipid acyltransferase if it has one or more of the following characteristics:

a) when tested using the "Transferase assay in a medium with little water", measured after a selected period of between 30, 20 or 120 minutes, it has a relative transferase activity of at least 1%; b) when determined using the "Transferase assay in egg yolk with a lot of water" in an egg yolk with 54% water, it has up to 100% relative transferase activity; or c) when the "Transferase Assay in Buffered Substrate" is determined to have at least 2% acyltransferase activity and an acyltransferase lipid identified using a method according to the present invention is disclosed herein.

An immobilized lipid acyltransferase enzyme is disclosed.

DETAILED ASPECTS OF THE PRESENT INVENTION

The term "lipid acyltransferase" as used herein means an enzyme that also has lipase activity (generally classified as EC3.1.1.x according to the Recommendations for Enzyme Nomenclature (1992) of the Nomenclature Committee of the Union International Biochemistry and Molecular Biology) also has acyltransferase activity (generally classified as EC2.3.1.x) so the enzyme can transfer an acyl group from a lipid to one or more receptor substrates, such as one or more of the following: a sterol; a stanol; a carbohydrate; a protein; a protein subunit; glycerol.

Preferably, the lipid acyltransferase for use in the methods and / or uses of the present invention can transfer an acyl group from a lipid (defined herein) to one or more of the following acyl receptor substrates: a sterol, a stanol; a carbohydrate; a protein or subunits thereof, or a glycerol.

For some aspects the "acyl receptor" according to the present invention can be any compound comprising a hydroxy group (-OH), such as, for example, polyhydric alcohols, including glycerol; sterol stanols; carbohydrates; hydroxy acids including fruit acids, citric acid, tartaric acid, lactic acid and ascorbic acid; proteins or a subunit thereof, such as amino acids, protein hydrolysates and peptides (partially hydrolyzed proteins) for example; and mixtures and derivatives thereof. Preferably, the "acyl receptor" according to the present invention is not water.

In one embodiment, the acyl receptor is preferably not a monoglyceride or a diglyceride.

In another aspect, preferably the enzyme can transfer an acyl group from a lipid to a sterol and / or stanol.

In one aspect, preferably the enzyme can transfer an acyl group from a lipid to a carbohydrate.

In one aspect, preferably the enzyme can transfer an acyl group from a lipid to a protein or a subunit thereof. Suitably the protein subunit may be one or more of the following: an amino acid, a protein hydrolyzate, a peptide, a dipeptide, an oligopeptide and a polypeptide.

Suitably in the protein or protein subunit the acyl receptor may be one or more of the following constituents of the protein or protein subunit: a serine, a threonine, a tyrosine or a cysteine.

When the protein subunit is an amino acid, properly the amino acid can be any suitable amino acid. Suitably the amino acid can be for example one or more of a serine, a threonine, a tyrosine or a cysteine.

In one aspect, preferably, the enzyme can transfer an acyl group from a lipid to a glycerol.

In one aspect, preferably, the enzyme can transfer an acyl group from a lipid to a hydroxy acid.

In one aspect, preferably, the enzyme can transfer an acyl group from a lipid to a polyvalent alcohol.

In one aspect, the lipid acyltransferase may also be able to transfer an acyl group from a lipid to a sterol and / or a stanol, in addition it may be able to transfer an acyl group from a lipid to one or more of the following: carbohydrate, a protein; a protein subunit, glycerol.

Preferably, the lipid substrate on which the lipid acyltransferase acts according to the present invention is one or more of the following lipids: a phospholipid, such as a lecithin, for example, phosphatidylcholine, a triacylglyceride, a cardiolipin, a diglyceride or a glycolipid , such as digalactosyldiglyceride (DGDG). The lipid substrate may be referred to herein as "acyl lipid donor." The term lecithin as used herein comprises phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, phosphatidylserine and phosphatidylglycerol.

For some aspects, preferably the lipid substrate on which the lipid acyltransferase acts is a phospholipid, such as lecithin, for example phosphatidylcholine.

For some aspects, preferably the lipid substrate is a glycolipid, such as for example DGDG.

Preferably the lipid substrate is a food lipid, that is to say a lipid component of a food.

For some aspects, preferably the lipid acyltransferase according to the present invention, is incapable,

or substantially unable, to act on a triglyceride and / or a 1-monoglyceride and / or 2-monoglyceride.

Suitably, the lipid substrate or acyl lipid donor may be one or more lipids present in one or more of the following substrates: fats, including butter, bait and butter fat; oils including oils extracted or preceded from palm oil, sunflower oil, soybean oil, safflower oil, cottonseed oil, walnut oil, corn oil, olive oil, peanut oil, coconut oil and linseed oil. Soy lecithin, flaxseed or egg yolk is also a suitable lipid substrate. Lipid substrate may be an oatmeal lipid or other plant material that contains galactolipids.

In one aspect, the lipid acyl donor is preferably lecithin (such as phosphatidylcholine) in egg yolk.

For some aspects of the present invention, the lipid can be selected from among the lipids that have a fatty acid chain length of 8 to 22 carbons.

For some aspects of the present invention, the lipid can be selected from among the lipids that have a fatty acid chain length of 16 to 22 carbons, more preferably 16 to 20 carbons.

For some aspects of the present invention, the lipid may be selected from among the lipids having a chain length of the fatty acid not exceeding approximately 14 carbons of lipids having a chain length of fatty acids of 4 to 14 carbons, appropriately of 4 to 10 carbons, appropriately 4 to 8 carbons.

Suitably, the lipid acyltransferase according to the present invention may have one or more of the following lipase activities: glucolipase activity (EC 3.1.1.26), triacylglycerol lipase activity (EC 3.1.1.3), phospholipase A2 activity (EC3.1 .1.4) or phospholipase A1 activity (EC3.1.1.32). The term "glucolipase activity" as used herein comprises the "galactolipase activity".

Suitably, the lipid acyltransferase according to the present invention may have at least one or more of the following activities: glucolipase activity (E.C. 3.1.1.26) and / or phospholipase A1 activity

(E.C.3.1.1.32) and / or phospholipase A2 activity (E.C.3.1.1.4).

For some aspects, the lipid acyltransferase according to the present invention may have at least glucolipase activity (E.C.3.1.1.26).

Suitably, for some aspects the lipid acyltransferase according to the present invention, may be able to transfer an acyl group from a glycolipid and / or a phospholipid to one or more of the following receptor substrates: a sterol, a stanol, a carbohydrate, a protein and a glycerol.

For some aspects, preferably the lipid acyltransferase according to the present invention, can transfer an acyl group from a glycolipid and / or a phospholipid to a sterol and / or a stanol to form at least one sterol ester and / or a stanol ester .

For some aspects, preferably the lipid acyltransferase according to the present invention, can transfer an acyl group from a glycolipid and / or a phospholipid to a carbohydrate to form at least one carbohydrate ester.

For some aspects, preferably the lipid acyltransferase according to the present invention, can transfer an acyl group from a glycolipid and / or a phospholipid to a protein to form at least one ester protein (or a condensed fatty acid protein).

For some aspects, preferably the lipid acyltransferase according to the present invention, an acyl group can be transferred from a glycolipid and / or a phospholipid to a glycerol to form at least one diglyceride and / or a monoglyceride.

For some aspects, preferably the lipid acyltransferase according to the present invention has no activity of triacylglycerol lipase (E.C. 3.1.1.3).

In some aspects, the lipid acyltransferase may be able to transfer an acyl group from a lipid to a sterol or to a stanol or to a combination of a sterol and a stanol. Therefore, in a way of

embodiment the "acyl receptor" according to the present invention can be a sterol or a stanol or a combination

of a sterol and a stanol.

In one embodiment, suitably the sterol and / or stanol may comprise one or more of the following structural properties:

i) a 3-beta hydroxy group or a 3-alpha hydroxy group, and / or

ii) A: B rings in cis position or A: B rings in trans or C5-C6 position is unsaturated.

Suitable sterol acyl receptors include cholesterol and phytosterols, for example alpha-sitosterol, beta-sitosterol, stigmasterol, ergosterol, campesterol, 5,6-di-hydrosterol, brasicasterol, alpha-spinasterol, betaespinasterol, gamma-spinasterol, delta-spinasterol , fucosterol, dimosterol, ascosterol, serebisterol, episterol, anasterol, hyposterol, condrilasterol, desmosterol, chalinosterol, poriferasterol, clionasterol, sterol glycosides and other forms and natural or synthetic isomeric derivatives.

In one aspect of the present invention appropriately more than one sterol and / or stanol may act as an acyl receptor, appropriately more than two sterols and / or stanols may act as an acyl receptor. In other words, in one aspect of the present invention, more than one sterol ester and / or a stanol ester may be suitably produced. Appropriately when the cholesterol is the acyl receptor, one or more additional sterols or one or more stanols may act as the acyl receptor. Thus, in one aspect, the present invention provides a method for in situ production of both the cholesterol ester and at least one sterol or a stanol ester in combination. In other words, the lipid acyltransferase for some aspects of the present invention can transfer an acyl group from a lipid to both a cholesterol and at least one additional sterol and / or at least a stanol.

In one aspect, preferably the sterol acyl receptor is one of the following: alpha-sitosterol, beta-sitosterol, stigamasterol, ergosterol and campesterol.

In one aspect, preferably the acyl sterol receptor is cholesterol. When the case is that cholesterol is the acyl receptor for lipid acyltransferase, the amount of free cholesterol in the food is reduced compared to the food before exposure to lipid acyltransferase compared to an equivalent food that has not been treated with lipid acyltransferase.

Suitable receptors for stanol acyl include phytostanols, for example beta-sitostanol or sssitostanol.

In one aspect, preferably the sterol and / or stanol acyl receptor is a sterol and / or a stanol other than cholesterol.

In some aspects, the food prepared according to the present invention can be used to reduce blood serum cholesterol and / or to reduce low density lipoprotein. Blood serum cholesterol and low density lipoproteins have both been associated with certain diseases in humans, such as, for example, atherosclerosis and / or heart disease. Therefore, it is envisioned that foods prepared according to the present invention can be used to reduce the risk of such diseases.

Therefore, in one aspect the present invention provides the use of a food according to the present invention for use in the treatment and / or prevention of atherosclerosis and / or heart disease.

In a further aspect, the present invention provides a medicament comprising a food according to the present invention.

In a further aspect, the present invention provides a method of treating and / or presenting a disease in a human or animal patient whose method comprises administering to the patient an effective amount of a food according to the present invention.

Appropriately, the sterol and / or the "acyl receptor" stanol can be found naturally in the food. Alternatively, sterol and / or stanol can be added to the food. When it is the case that a sterol and / or a stanol is added to the food, the sterol and / or the stanol can be added before, simultaneously and / or after the addition of the lipid acyltransferase according to the present invention. Suitably, the present invention may comprise the addition of exogenous sterols / stanols, particularly sitosterols / phytostanols to the food before

or simultaneously that the addition of the enzyme according to the present invention.

For some aspects, one or more sterols present in the food can be transformed into one or more stanols before or at the same time that the lipid acyltransferase according to the present invention is added. Any suitable procedure can be used to convert sterols to stanols. For example, the conversion can be carried out by chemical hydrogenation. The conversion can be carried out before the addition of the lipid acyltransferase according to the present invention or at the same time as the addition of the lipid acyltransferase according to the present invention. Appropriately the enzymes for the conversion of sterol into stanols are disclosed in WO 00/061771.

Suitably the present invention can be used to produce phytostanol esters in situ in a food. Phytostanol esters have increased solubility through lipid membranes, bioavailability and increased sanitary utility (see for example WO 92/99640).

In some embodiments of the present invention the stanol ester and / or the sterol ester may be a flavoring and / or a texture-giving product. In which cases, the present invention comprises the production in situ of flavorings and / or products that give texture.

For some aspects of the present invention, the lipid acyltransferase according to the present invention can use a carbohydrate as an acyl receptor. The acyl receptor carbohydrate may be one or more of the following: a monosaccharide, a disaccharide, an oligosaccharide or a polysaccharide. Preferably, the carbohydrate is one or more of the following: glucose, fructose, anhydrofructose, maltose, lactose, sucrose, galactose, xylose, xylooligosaccharides, arabinose, maltooligosaccharides, tagatose, microtecin, ascopirone P, ascopirone T or cortalcerone.

Appropriately, the "acyl receptor" carbohydrate can be found naturally in the food. Alternatively, the carbohydrate can be added to the food. When it is the case that the carbohydrate is added to the food, the carbohydrate can be added before, at the same time and / or after the addition of the lipid acyltransferase according to the present invention.

Carbohydrate esters can function as valuable emulsifiers in foods. Therefore, when it is the case that the enzyme works to transfer the acyl group to a sugar, the invention comprises the production of a second emulsion in situ in the food.

In some embodiments, the lipid acyltransferase can use both a sterol and a stanol and a carbohydrate as an acyl receptor.

The use of the lipid acyltransferase which can then transfer an acyl group to a carbohydrate as well as a sterol and / or a stanol is particularly advantageous for egg-containing foods. In particular, the presence of sugars, in particular glucose, in eggs and in egg products is often seen as disadvantageous. Egg yolk can comprise up to 1% glucose. Usually, the egg or egg-based products can be treated with glucose oxidase to remove some or all of the glucose. However, according to the present invention this unwanted sugar can be easily removed by "esterifying" the sugar to form a sugar ester.

For some aspects of the present invention, the lipid acyltransferase according to the present invention can use an acyl receptor component protein. Suitably, the protein may be one or more of the proteins found in a food product, for example in a dairy product and / or a meat product. By way of example only, suitable proteins can be those found in curd or in whey, such as lactoglobulin. Other suitable proteins include egg ovalbumin, gliadin, glutenin, puroindoline, lipid transfer grain proteins and meat myosin.

Therefore, according to the present invention, one or more of the following advantageous properties can be achieved: in situ production of an emulsifier without increase of free fatty acids; a reduction in the accumulation of free fatty acids in the food, a reduction in the concentrations of free cholesterol in the food; an increase in sterol esters and / or stanol esters; a reduction in blood serum cholesterol and / or low density lipoproteins; an increase in carbohydrate esters; a reduction in unwanted free carbohydrates.

An advantage of the present invention is that the emulsifier (s) is prepared in situ in the food with no increase, or substantial increase, in the free fatty acid content in the food. The production of free fatty acids can be harmful to food. In particular, free fatty acids have been linked to lack of smell and / or lack of aromas in foods, as well as other harmful effects, including, for example, a soapy taste in cheese. Preferably, the method according to the present invention results in the in situ preparation of an emulsifier (s) in which the accumulation of free fatty acids is reduced and / or eliminated. Without wishing to be bound by theory, according to the present invention the fatty acid that is removed from the lipid is transferred by the lipid acyltransferase to an acyl receptor, for example a sterol and / or a stanol. Thus, the total concentration of free fatty acids in the food does not increase or increase only to an insignificant degree. This is in sharp contrast to the situation when lipases (E.C.3.1.1.x) are used to produce emulsifiers in situ. In particular, the use of lipases can cause an increase in the amount of free fatty acid in the food, which can be harmful. According to the present invention, the accumulation of free fatty acids is reduced and / or eliminated compared to the amount of free fatty acids that would have been accumulated if there would be a lipase enzyme, in particular, a phospholipase A enzyme has been used, instead of the lipid acyltransferase according to the present invention.

The use of a lipid acyltransferase that can transfer the acyl group to a sterol and / or stanol can be particularly advantageous for foods containing eggs. In particular, it has been found that an egg-based product with significantly better properties can be obtained by following treatment with a lipid acyltransferase as defined herein in comparison to egg-based products treated with conventional phospholipase, such such as Lipopan F® (Novozymes A / S, Denmark)), Lecitase Ultra® (Novozymes A / S, Denmark) or Lipomod 22 L from Biocatalysts.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized using the following criteria:

(i)

the enzyme possesses acyltransferase activity that can be defined as ester transfer activity whereby the acyl part of an original ester bond of an acyl lipid donor is transferred to an acyl receptor to form a new ester; Y

(ii)

The enzyme comprises the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

Preferably, X of the GDSX motif is L. Thus, preferably, the enzyme according to the present invention comprises the GSDL motif of the amino acid sequence.

The GDSX motif is composed of four conserved amino acids. Preferably, the serine within the motif is a catalytic serine of the lipid acyltransferase enzyme. Appropriately, the serine of the GDSX motif may be in a position corresponding to Ser-16 in the Aeromonas hydrophila lipolytic enzyme disclosed in Brumlik & Buckley (Journal of Bacteriology, April 1966, Vol. 178, No. 7, pp. 2060- 2064).

To determine if a protein has the GDSX motif according to the present invention, the sequence is preferably compared to the hidden profiles of the Marcov model (HMM profiles) of the pfam database.

Pfam is a database of protein domain families. Pfam contains multiple curated sequence alignments for each family as well as hidden Marcov profile models (HMM profiles) to identify these domains in new sequences. An introduction of Pfam can be found in Bateman A. et al. (2002) Nucleic Acids Res. 30, 276-280. Hidden Markov models are used in numerous databases that help classify proteins, for studies see Bateman A. and Haft DH (2002), Brief Bioinform. 3; 236-245.

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids = 12230032 & dopt = Abstract

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids = 11752314 & dopt = Abstract

For a detailed explanation of Marcov's hidden models and how they are applied in the Pfam database see Durbin R., Eddy S. and Krogh A., (1998) Biological sequence analysis; probabilistics models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4. The Hammer software package can be purchased at the University of Washington St. Louis, USA.

Alternatively, the GDSX motif can be identified using the Hammer software package, instructions are provided in Durbin R., Eddy S. and Krogh A., (1998) Biological sequence analysis; probabilistics models of proteins and nucleic acids. Cambridge University Press, ISBN 0-521-62041-4 and references therein, and the HMMER2 profile provided herein.

The PFAM database can be accessed, for example, by several servers that are currently located on the following web pages.

http://www.sanger.ac.uk/Software/Pfam/index.shtml

http://Pfam.wustl.edu/

http://pfam.jouy.inra.fr/

http://pfam.cgb.ki.se/

The database offers a search facility where you can enter a protein sequence. Using the default parameters of the database in the protein sequence, the presence of Pfam domains will then be analyzed. The GDSX domain is a domain created in the database and as such its presence will be recognized in any sequence sought. The database will return the alignment of the consensus sequence Pfam00657 to the query sequence.

A multiple alignment, which includes Aeromonas salmonicida or Aeromonas hydrophila can be obtained:

a) in manual

an alignment of the protein of interest is obtained with the consensus sequence Pfam00657 and an alignment of P10480 is obtained with the consensus sequence Pfam00657 following the procedure described above; or

b) through the database

Upon identification of the consensus sequence Pfam00657 the database offers the option of displaying an alignment of the query sequence for the seeded alignment of the consensus sequence Pfam00657. P10480 is a part of this budding alignment and is indicated by GCAT_AERHY. Both the query sequence and P10480 will be presented in the same interval.

Aeromonas hydrophila reference sequence

The remains of the GDSX lipase of Aeromonas hydrophila are numbered in the NCBI file P10480, the figures in this text refer to the numbers given in this file that is used in the present invention to determine the specific amino acid residues that, in a Preferred embodiment are present in the lipid acyltransferase enzymes of the invention.

Pfam alignment was carried out (figures 33 and 34):

The following conserved moieties can be recognized and in a preferred embodiment they can

be present in enzymes for use in the compositions and methods of the invention;

image 1

Block 2 -GANDY block

Block 3 - HPT Block

image2

image2

In which "hid" means a hydrophobic moiety selected from Met, Ile, Leu, Val, Ala, Gly, Cys, His, Lys, Trp, Tyr, Phe.

Preferably, the lipid acyltransferase enzyme for use in the compositions or methods of the invention can be aligned using the consensus sequence Pfam00657.

Preferably, a positive pairing with the hidden profile (HMM profile) of the Marcov model of the pfam00657 domain family indicates the presence of the GDSL or GDSX domain according to the present invention.

Preferably when the Pfam00657 consensus sequence is aligned with the lipid acyltransferase for use in the compositions or methods of the invention it has at least one, preferably more than one, preferably more than two, of the following blocks, a GDSx block, a GANDY block, an HPT block. Suitably, the lipid acyltransferase may have a GDSx block and a GANDY block. Alternatively, the enzyme may have a GDSx block and an HPT block. Preferably the enzyme comprises at least one GDSx block.

Preferably, when aligned with the consensus sequence of Pfam00657 the enzymes for use in the compositions or methods of the invention have at least one, preferably more than one, preferably more than two, preferably more than three, preferably more than four, preferably more than six, preferably more than seven, preferably more than eight, preferably more than nine, preferably more than ten, preferably more than eleven, preferably more than twelve, preferably more than thirteen, preferably more than fourteen, of the following residues of amino acid compared to the reference A. hydrophila polypeptide sequence, ie the SEC. ID. No. 32: 28hid, 29hid, 30hid, 31hid, 32gly, 33Asp, 34Ser, 35hid, 130hid, 131Gly, 132Hid, 133Asn, 134Asp, 135hid, 309His.

The GDSX domain of pfam00657 is a unique identifier that distinguishes the proteins that this domain possesses from other enzymes.

The consensus sequence of Pfam00657 is presented in Figure 1 as SEC. ID. No. 1. This comes from the identification of family 00657 of pfam, database version 6, which can also be referred to as pfam00657.6 herein.

The consensus sequence can be updated using more editions of the pfam database.

For example, Figures 33 and 34 present the pfam alignment of family 00657 of the database version 11, which may also be referred to as pfam 00657.11 herein.

The presence of the GDSx, GANDY and HPT blocks were discovered in the pfam family 00657 from both editions of the database. Future editions of the pfam database can be used to identify the 00657 family of pfam.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized using the following criteria:

(i)

the enzyme possesses acyltransferase activity that can be defined as an activity for ester transfer whereby the acyl part of the original ester bond of an acyl lipid donor is transferred to the acyl receptor to form a new ester;

(ii)

the enzyme comprises the GDSX motif of the amino acid sequence, wherein X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, M, M or S;

(iii) the enzyme comprises His-309 or comprises a histidine residue at a position corresponding to His309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme shown in Figure 2 (SEQ. ID. No. 2 or SEQ. ID. No. 32).

Preferably, the rest of the amino acids of the GDSX motif is L.

In SEC. ID. . 2nd or SEC. ID. . 32, the first 18 amino acid residues form a signal sequence. His-309 of the complete sequence, which is the protein that includes the signal sequence, is equal to His-291 of the mature part of the protein, ie the sequence without signal sequence.

Preferably, the lipid acyltransferase enzyme according to the present invention comprises the following catalytic triad: Ser-34, Asp-134 and His-309 or comprises a serine residue, an aspartic acid residue and a histidine residue, respectively, at positions corresponding to Ser-34, Asp-134 and His-309 in the Aeromonas hydrophila lipolytic enzyme shown in Figure 2 (SEQ. ID. No. 2) or in Figure 28 (SEQ. ID. No. 32). As indicated above, in the sequence shown in SEC. ID. . 2nd or SEC. ID. . 32 the first 18 amino acid residues form a signal sequence. Ser-34, Asp-134 and His-309 of the complete sequence, which is the protein that includes the final sequence, is equal to Ser-16, Asp-116 and His-291 of the mature part of the protein, i.e. sequence without the signal sequence. In the consensus sequence Pfam00657, as provided in Figure 1 (SEQ. ID. No. 1) the remains of the active zone correspond to Ser-7, Asp-157 and His-348.

Preferably, the lipid acyltransferase enzyme according to the present invention can be characterized using the following criteria:

(i)

the enzyme possesses acyltransferase activity that can be defined as an activity for ester transfer whereby the acyl part of the original ester bond of a first acyl lipid donor is transferred to the acyl receptor to form a new ester;

(ii)

the enzyme comprises at least Gly-32, Asp-33, Ser-34, Asp-134 and His-309 or comprises glycine, aspartic acid, serine, aspartic acid and histidine residues in the positions corresponding to Gly-32, Asp -33, Ser-34, Asp-134 and His-309, respectively, in the Aeromonas hydrophila lipolytic enzyme shown in Figure 2 (SEQ. ID. No. 2) or Fig. 28 (SEQ. ID. No. 32 ).

Appropriately, the lipid acyltransferase enzyme according to the present invention can be obtained, preferably obtained, from organisms of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Camplobacterium, Bacillus, Camplobacterium Vibrionaceae, Xylella, Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.

Appropriately, the lipid acyltransferase enzyme according to the present invention can be obtained, preferably it is obtained from one or more of the following organisms: Aeromonas hydrophila, Aeromonas salmonicida, Streptomyces coelicolor, Streptomyces rimosus, Mycobacterium, Streptococcus pyogenes, Lactococcus lactis stcgenesus streptococcus, Streptococcus streptococcus , Lactobacillus helveticus, Desulfitobacterium dehalogenans, Bacillus sp., Campylobacter jejuni, Vibrionaceae, Xylella fastidiosa, Sulfolobus solfataricus, Saccharomyces cerevisiae, Aspergillus terreus, Schizosaccharomyces pombe, Listeria innocua, Listeria monocytogenes, Neisseria meningitidis, Mesorhizobium loti, Ralstonia solanacearum, Xanthomonas campestris, Xanthomonas axonopodis and Candida parapsilosis.

In one aspect, preferably the lipid acyltransferase enzyme according to the present invention can be obtained, preferably obtained, from one or more of Aeromonas hydrophila or Aeromonas salmonicida.

Suitably, the lipid acyltransferase enzyme according to the present invention comprises one or more of the following amino acid sequences:

(i)

the amino acid sequence shown as SEC. ID. No. 2 (see figure 2)

(ii)

the amino acid sequence shown as SEC. ID. No. 3 (see figure 3)

(iii) the amino acid sequence shown as SEC. ID. No. 4 (see figure 4)

(iv)

the amino acid sequence shown as SEC. ID. No. 5 (see figure 5)

(v)

the amino acid sequence shown as SEC. ID. No. 6 (see figure 6)

(saw)

the amino acid sequence shown as SEC. ID. No. 12 (see figure 14)

(vii) the amino acid sequence shown as SEC. ID. No. 20 (see figure 16)

(viii) the amino acid sequence shown as SEC. ID. No. 22 (see figure 18)

(ix)

the amino acid sequence shown as SEC. ID. No. 24 (see figure 20)

(x)

the amino acid sequence shown as SEC. ID. No. 26 (see figure 22)

(xi)

the amino acid sequence shown as SEC. ID. No. 28 (see figure 24)

(xii) the amino acid sequence shown as SEC. ID. No. 30 (see figure 26)

(xiii) the amino acid sequence shown as SEC. ID. No. 32 (see figure 28)

(xiv) the amino acid sequence shown as SEC. ID. No. 34 (see Figure 30) or an amino acid sequence that has 75% or more identity with any of the sequences shown as SEC. ID. No. 2, SEC. ID. No. 3, SEC. ID. No. 4, SEC. ID. No. 5, SEC. ID. No. 6, SEC. ID. No. 12, SEC. ID. No. 20, SEC. ID. No. 22, SEC. ID. No. 24, SEC. ID. No. 26, SEC. ID. No. 28, SEC. ID. No. 30, SEC. ID. No. 32 or SEC. ID. No. 34.

Suitably, the lipid acyltransferase enzyme according to the present invention comprises either the amino acid sequence shown as SEC. ID. No. 2 or as SEC. ID. No. 3, or SEC. ID. No. 32 or SEC. ID. No. 34 or comprises an amino acid sequence having 75% or more, preferably 80% or more, preferably 85% or more, preferably 90% or more, preferably 95% or more, of identity with the amino acid sequence shown as SEC. ID. No. 2 or the amino acid sequence shown as SEC. ID. No. 3 or the amino acid sequence shown as SEC. ID. No. 32 or the amino acid sequence shown as SEC. ID. No. 34.

For the sake of the present invention, the degree of identity is based on the number of sequence elements that are the same. The degree of identity according to the present invention can be suitably determined by computer programs known in the art such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, version 8, August 1994, Genetics Computer Group, 575 Science Drive , Madison, Wisconsin, US53711) (Needleman & Wunsch (1970), J. of Molecular Biology 48, 433-45) using the following sets for comparison of the polypeptide sequence: penalty for creation of GAP of 3.0 and penalty for GAP expansion of 0.1.

Suitably, the lipid acyltransferase enzyme according to the present invention comprises an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity than any of the sequences shown as SEC. ID. No. 2, SEC. ID. No. 3, SEC. ID. No. 4, SEC. ID. No. 5, SEC. ID. No. 6, SEC. ID. No. 12, SEC. ID. No. 20, SEC. ID. No. 22, SEC. ID. No. 24, SEC. ID. No. 26, SEC. ID. No. 28, SEC. ID. No. 30, SEC. ID. No. 32 or SEC. ID. No. 34.

Suitably, the lipid acyltransferase enzyme according to the present invention comprises one or more of the following amino acid sequences:

(to)

an amino acid sequence shown as the 1 to 100 amino acid residues of the SEC. ID. No. 2 or SEC. ID. No. 32;

(b)

an amino acid sequence shown as residues 101 to 200 amino acids of the SEC. ID. No. 2 or SEC. ID. No. 32;

(C)

an amino acid sequence shown as amino acid residues 201 to 300 of the SEC. ID. No. 2 or SEC. ID. No. 32; or

(d)

an amino acid sequence having 75% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity than any of the amino acid sequences defined in sections (a) to (c ) previously.

Suitably, the lipid acyltransferase enzyme according to the present invention comprises one or more of the following amino acid sequences:

(to)

an amino acid sequence shown as amino acid residues 28 to 39 of the SEC. ID. No. 2 or SEC. ID. No. 32;

(b)

an amino acid sequence shown as amino acid residues 77 to 78 of the SEC. ID. No. 2 or SEC. ID. No. 32;

(C)

an amino acid sequence shown as amino acid residues 126 to 136 of the SEC. ID. No. 2 or SEC. ID. No. 32;

(d)

an amino acid sequence shown as amino acid residues 163 to 175 of the SEC. ID. No. 2 or SEC. ID. No. 32;

(and)

an amino acid sequence shown as amino acid residues 304 to 311 of the SEC. ID. No. 2 or SEC. ID. No. 32; or

(F)

an amino acid sequence having 75% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity than any of the amino acid sequences defined in sections (a) to (e ) previously.

Suitably, the lipid acyltransferase enzyme according to the present invention may comprise an amino acid sequence produced by the expression of one or more of the following nucleotide sequences:

(to)

the nucleotide sequence shown as SEC. ID. No. 7 (see Figure 9);

(b)

the nucleotide sequence shown as SEC. ID. No. 8 (see Figure 10);

(C)

the nucleotide sequence shown as SEC. ID. No. 9 (see Figure 11);

(d)

the nucleotide sequence shown as SEC. ID. No. 10 (see Figure 12);

(and)

the nucleotide sequence shown as SEC. ID. No. 11 (see Figure 13);

(F)

the nucleotide sequence shown as SEC. ID. No. 13 (see Figure 15);

(g)

the nucleotide sequence shown as SEC. ID. No. 21 (see Figure 17);

(h)

the nucleotide sequence shown as SEC. ID. No. 23 (see Figure 19);

(i)

the nucleotide sequence shown as SEC. ID. No. 25 (see Figure 21);

(j)

the nucleotide sequence shown as SEC. ID. No. 27 (see Figure 23);

(k)

the nucleotide sequence shown as SEC. ID. No. 29 (see Figure 25);

(l)

the nucleotide sequence shown as SEC. ID. No. 31 (see Figure 27);

(m)

the nucleotide sequence shown as SEC. ID. No. 33 (see Figure 29);

(n)

the nucleotide sequence shown as SEC. ID. No. 35 (see Figure 31);

(or)

or

a nucleotide sequence that has 75% or more identity with any of the sequences shown as SEC. ID. No. 7, SEC. ID. No. 8, SEC. ID. No. 9, SEC. ID. No. 10, SEC. ID. No. 11, SEC. ID. No. 13, SEC. ID. No. 21, SEC. ID. No. 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. No. 29, SEC. ID. No. 31, SEC. ID. No. 33 or SEC. ID. No. 35.

Suitably, the nucleotide sequence may have 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more identity than any of the sequences shown as SEC. ID. No. 7, SEC. ID. No. 8, SEC. ID. No. 9, SEC. ID. No. 10, SEC. ID. No. 11, SEC. ID. No. 13, SEC. ID. No. 21, SEC. ID. No. 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. No. 29, SEC. ID. No. 31, SEC. ID. No. 33 or SEC. ID. No. 35.

In one aspect, the lipid acyltransferase according to the present invention can be a lecithin: cholesterol acyltransferase (LCAT) or a variant thereof (for example a variant constructed by molecular evolution).

Suitable LCATs are known in the art and can be obtained from one or more of the following organisms, for example: mammals, rats, mice, chickens, Drosophila melanogaster, plants, including Arabidopsis and Oryza sativa, nematodes, fungi and yeasts.

In one embodiment of the invention, the lipid acyltransferase enzyme according to the present invention may be the lipid acyltransferase that can be obtained, preferably obtained, from E. coli TOP 10 strains that house pPet12aAhydro and pPet12aASalmo deposited by Danisco A / S of Langebrogade 1, DK1001, Copenhagen, K, Denmark under the Budapest Treaty on International Recognition of the Deposit of Microorganisms for the Patent Procedure in the National Collection of Industrial, Marine and Food Bacteria (NCIMB) 23 St. Machar Street, Aberdeen , Scotland, GB; on December 22, 2003 with registration numbers NICMB 41204 and NCIMB 41205, respectively.

Preferably, when performing a process according to the present invention, the product is produced without substantially increasing or increasing the free fatty acids in the food product.

The term "transferase" as used herein is interchangeable with the term "lipid acyltransferase."

Suitably, the lipid acyltransferase defined herein catalyzes one or more of the following reactions: interesterification, transesterification, alcoholysis and hydrolysis.

The term "interesterification" refers to the catalytic enzymatic transfer of acyl groups between a lipid donor and a lipid receptor, in which the lipid donor is not a free acyl group.

The term "transesterification" as used herein means the catalyzed enzymatic transfer of an acyl group between a lipid donor (other than a free fatty acid) to an acyl receptor (other than water).

As used herein the term "alcohololysis" refers to the enzymatic cleavage of a covalent bond of an acid derivative by reaction with an alcohol ROH so that one of the products is combined with the H of the alcohol and the other product is combined with the OR group of alcohol.

As used herein, the term "alcohol" refers to an alkyl compound that contains a hydroxyl group.

As used herein, the term "hydrolysis" refers to the catalyzed enzymatic transfer of an acyl group from a lipid to the OH group of a water molecule. Acyl transfer from hydrolysis requires separation of the water molecule.

The expression "without increasing or substantially increasing free fatty acids" as used herein, means that preferably the lipid acyltransferase according to the present invention has 100% transferase activity (ie transfers 100% of the acyl groups from an acyl donor to the acyl receptor, without hydrolytic activity); however, the enzyme can transfer less than 100% of the acyl groups present in the donor acyl lipid to the acyl receptor. In which case, preferably the acyltransferase activity accounts for at least 5%, more preferably at least 10%, more preferably at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90% and more preferably at least 98% of the total enzyme activity. The% transferase activity (i.e. the transferase activity in% of the total enzyme activity) can be determined by the following protocol:

Protocol for the determination of% acyltransferase activity:

A food to which a lipid acyltransferase has been added according to the present invention can be extracted following the enzymatic reaction with CHCl3: CH3OH 2: 1 and the organic phase containing the lipid material is isolated and analyzed by GLC and HPLC according to the described procedure. in this report below. From the GLC and HPLC analyzes, the amount of free fatty acids and one or more sterol / stanol esters is determined; carbohydrate esters, protein esters; diglycerides; or monoglycerides. A reference food to which no enzyme has been added according to the present invention is analyzed in the same manner.

Calculation

From the results of the GLC and HPLC analyzes, the increase of free fatty acids and sterol / stanol esters and / or carbohydrate esters and / or esters of proteins and / or diglycerides and / or monoglycerides can be calculated:

Δ% of fatty acids =% of fatty acid (enzyme) -% of fatty acid (reference); Mv fatty acid = average molecular weight of fatty acids;

A = Δ% sterol ester / Mv sterol ester (in which Δ% sterol ester =% ester of

sterol / stanol (enzyme) -% sterol / stanol ester (reference) and Mv sterol ester = average molecular weight of the sterol / stanol esters) -applicable when the acyl receptor is a sterol and / or stanol;

B = Δ% carbohydrate ester / Mv of the carbohydrate ester (in which Δ% carbohydrate ester =% carbohydrate ester (enzyme) -% carbohydrate ester (reference) and Mv carbohydrate ester = average molecular weight of carbohydrate ester -applicable when the acyl receptor is a carbohydrate;

C = Δ% protein ester / Mv of the protein ester (in which Δ% protein ester =% protein ester (enzyme) -% protein ester (reference) and Mv protein ester = average molecular weight of the ester of applicable protein when the acyl receptor is a protein; and

D = absolute value of glyceride and / or monoglyceride / Mv di / monoglyceride (when Δ% diglyceride and / or monoglyceride =% diglyceride and / or monoglyceride (enzyme) -% diglyceride and / or monoglyceride (reference) and Mv di / monoglyceride = average molecular weight of the diglyceride and / or monoglyceride) applicable when the lipid receptor is glycerol.

Transferase activity is calculated as a percentage of total enzyme activity:

A * + B * + C * + D * x 100

% transferase activity =

A * + B * + C * + D * + Δ% fatty acid / (Mv fatty acid)

* -Delete as appropriate.

If the free fatty acids increase in the food, they preferably do not increase substantially, that is to say to a significant degree. The authors mean by this, that the increase in free fatty acid does not adversely affect the quality of the food.

In some aspects of the present invention, the expression "without substantially increasing free fatty acids" as used in the present invention means that the amount of free fatty acid in the food or in the composition treated with a lipid acyltransferase according to the present The invention is less than the amount of free fatty acid produced in the food or in a composition when an enzyme other than a lipid acyltransferase according to the present invention has been used, such as for example compared to the amount of free fatty acid produced when has used a conventional phospholipase enzyme, for example LipopanF® (Novozymes A / S, Denmark).

The term "in situ" as used herein means that the emulsifier (s) and / or the sterol / stanol esters and / or the carbohydrate esters and / or the mono or diglycerides are produced in the food or a food fraction This contrasts with the situation in which, the emulsifiers and / or the sterol / stanol esters and / or the carbohydrate esters and / or the protein esters and / or the mono or diglycerides are produced independently of the food and are they add as products formed to the food during its preparation. In other words, "in situ" as used herein means that by adding the lipid acyltransferase enzyme according to the present invention to a food, or to the food ingredients or materials constituting the food, an emulsifier and / or a sterol ester and / or a stanol ester and / or a carbohydrate ester and / or a protein ester and / or a mono- or diglyceride can be produced from the food compounds. Appropriately, the food components may be the substrate (s) for the enzyme. If necessary, the food components can be enriched by the addition of one or more additional components whose additional components may be the same as those present in the food or may be additional to these components already present in the food. For the avoidance of doubt, in one embodiment the process according to the present invention may be a process for the production of an emulsifier and / or a sterol ester and / or a stanol ester and / or a carbohydrate ester and / or a protein ester and / or a mono- or diglyceride in situ in a food and is not a process for preparing an emulsifier and / or a sterol ester and / or a stanol ester (for example it is an isolated form and / or purified) for subsequent addition to a food.

In another embodiment the lipase acyl transferase can be used during the treatment of the food, but it is not left in the food. For example, lipase acyltransferase can be immobilized, allowing it to be reused.

Preferably, the lipid acyltransferase according to the present invention can transfer an acyl group of a lipid to a sterol and / or stanol and / or a carbohydrate and / or a protein and / or glycerol when present in a polar medium, preferably in a medium aqueous, preferably a food that contains water. Suitably, the aqueous medium may be an aqueous buffer or it may be the aqueous phase in a food. The term "aqueous medium" as used herein preferably means a medium that is absent from organic solvent, preferably absent from polar organic solvent, more preferably absent from inedible organic solvent. In particular, the term "aqueous medium" may refer to a medium to which no exogenous organic solvent, preferably no polar organic solvent, has been added. The term "organic solvent" as used herein does not comprise food oils, preferably does not comprise food oils that are high in apolar lipids. In one embodiment, the term "organic solvent" may exclude edible organic solvents, such as ethanol, propylene glycol and / or glycerol. Suitably, the aqueous medium according to the present invention may comprise less than 80% by volume of organic solvents, less than 70% by volume of organic solvents, less than 50% by volume of organic solvents, less than 30% by volume of organic solvents , more preferably less than 15% by volume of organic solvents, more preferably less than 5%. Suitably the food may comprise between 1 and 5% organic solvent, for example ethanol. However, when the food comprises said organic solvent, it is preferably produced endogenously in the food. That is, when the food comprises said organic solvent, preferably the organic solvent is not an exogenous organic solvent.

The term "food" as used herein means a substance that is suitable for human and / or animal consumption.

Appropriately, the term "food" as used herein may mean a food in a form that is ready for consumption. Alternatively, or in addition, however, the term "food" as used herein may mean one or more food materials that are used in the preparation of a food. By way of example, only, the term "food" comprises both baked goods produced from the dough and the dough used in the preparation of said baked goods.

In a preferred aspect the present invention provides a food as defined above in which the food is selected from one or more of the following: eggs, egg-based products, including but not limited to mayonnaise, salad dressings, sauces, ice cream, egg powder, modified egg yolk and producer prepared from them; baked goods, including breads, cakes, sweet dough products, rolled doughs, liquid butters, sweet breads, donuts, cookies, crackers and sweets; cakes, including chocolate, chocolates, candies, nougat, chewing gum, including sugar-free gum and sweetened with sugar, chewing gum, soft chewing gum, chewing gum and puddings; frozen products, including sorbets, preferably frozen dairy products, including ice cream and ice milk; dairy products, including cheese, butter, milk, coffee cream, whipped cream, custard, dairy drinks and yogurts; creams, whipped vegetable creams; edible oils and fats, aerated and non-aerated milkshakes, oil-in-water emulsions, water-in-oil emulsions, margarine, butter and including low-fat and very low-fat spreads; dressings, mayonnaise, dipping sauces, cream-based sauces, cream-based soups, drinks, spice emulsions and sauces.

Suitably the food according to the present invention may be "refined foods", including cakes, pastries, confectionery, chocolates, soft candies and the like.

In one aspect, the food according to the present invention can be a dough product or a baked product, such as a bread, a fried product, a snack, cakes, cakes, chocolate and nut cakes (brownies), tea pastes, Pasta, snack items such as crackers, whole wheat flour cookies (graham crackers), eight-shaped crackers (pretzels) and chips and pastas.

In a further aspect, the food according to the present invention can be a food product from plants such as flours, premixes, oils, fats, cocoa butter, non-dairy coffee cream, salad dressings, margarine, spreads, butter of peanut, butter, ice cream and cooking oils.

In another aspect, the food according to the present invention can be a dairy product, including butter, milk, cream, cheese such as natural, processed and imitation cheeses in various forms (including crumbled, block, sliced or grated cheese), Cream cheese, ice cream, frozen desserts, yogurt, liquid yogurts, powdered milk fat and other dairy products. The enzyme according to the present invention can improve the stability of the fat in dairy products.

It is particularly advantageous to use the present invention in cheese since the production of free fatty acids in cheese is associated with a "soap" flavor. Thus, the use of a lipid acyltransferase according to the present invention advantageously produces "soap-free" cheese.

In another aspect, the food according to the present invention can be a food product containing ingredients derived from animals, such as processed meat products, cooking oils and butter.

In a further aspect, the food according to the present invention can be a beverage, a fruit, a mixture of fruits, a vegetable or wine. In some cases the drink may contain up to 20 g / l of added phytosterols.

In another aspect, the food according to the present invention can be an animal feed. Animal feed may be enriched with phytosterol and / or phytostanols, preferably with beta-sitosterol / stanol. Appropriately, animal feed can be a poultry feed. When the feed is a poultry feed, the present invention can be used to reduce the cholesterol content of the eggs produced by the poultry fed with the feed according to the present invention.

In one aspect preferably the food is selected from one or more of the following: eggs, egg-based products, including mayonnaise, salad dressings, sauces, ice cream, powdered egg, modified egg yolk and products prepared from the same.

The food according to the present invention is a food containing water. Appropriately the article may be composed of 10 to 98% water, appropriately 14 to 98%, appropriately 18 to 98% water, appropriately 20 to 98%, appropriately 40 to 98%, appropriately 50 to 98% , appropriately from 70 to 98% and appropriately from 75 to 98%.

For some aspects, preferably the food according to the present invention is not a pure vegetable derived oil, such as, for example, olive oil, sunflower oil, peanut oil, rapeseed oil. For the avoidance of doubt, in some aspects of the present invention the food according to the present invention may comprise an oil, but preferably the food is not primarily composed of oil or oil mixtures. For some aspects, preferably the food comprises less than 95% lipids, preferably less than 90% lipids, preferably less than 85%, preferably less than 80% lipids. Thus, for some aspects of the present invention the oil may be a component of the food, but preferably the food is not an oil by itself.

The claims of the present invention should be considered to include each of the foods listed above.

When it is the case that a carbohydrate ester according to the present invention is produced, the carbohydrate ester is preferably an oligosaccharide ester, a monosaccharide ester or a disaccharide ester.

Suitably the carbohydrate ester when produced according to the present invention may be one or more of the following: glucose ester, fructose ester, anhydrofructose ester, maltose ester, lactose ester, galactose ester, xylose ester, ester of xylooligosaccharide, ester of maltooligosaccharide, ester of arabinose, ester of maltooligosaccharide, ester of tagatose, ester of sucrose, ester of microtecina, ester of ascopirone P, ester of ascopirone T or ester of cortalcerone.

Preferably, the carbohydrate ester when produced according to the present invention is one of the following: a carbohydrate monoester, a sugar monoester, an oligosaccharide monoester, a trisaccharide monoester, a disaccharide monoester, a monosaccharide monoester, a glucose monoester, a fructose monoester, anhydrofructose monoester, maltose monoester, lactose monoester, galactose monoesters, xylose monoesters, xylooligosaccharide monoesters, arabinose monoesters, maltooligosaccharide monoesters, maltooligosaccharides monoesters, tagatose monoesters of sucrose, microtecin ester, ascopirone P ester, ascopirone T ester or cortalcerone ester.

In one embodiment, the microtecin ester, the ascopirone P ester, the ascopirone T ester and / or the cortalcerone ester can function as antimicrobial agents. Alternatively, or in addition to this, the microtecin ester, the ascopirone P ester, the ascopirone T ester and / or the cortalcerone ester can function as one or both antioxidants and / or emulsifiers.

Preferably, the formation of the carbohydrate ester (if any) according to the present invention is independent of UDP-glucose.

Preferably, the food according to the present invention does not comprise UDP-glucose, or only comprises UDP-glucose in insignificant amounts.

Suitably, the emulsifier according to the present invention may be, for example, one or more of the following: a diglyceride, a monoglyceride, such as 1-monoglyceride or a lysolecitin, such as lysophosphatidylcholine for example, a digalactosyl monoglyceride (DGMG). The emulsifier is preferably produced from the acyl lipid donor after the removal of one or more acyl groups from said acyl lipid donor. The term lysolecithin as used herein comprises lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine and lysophosphatidylglycerol.

When one of the emulsifiers is a carbohydrate ester, the second emulsifier may be, for example, one or more of the following: a diglyceride, a monoglyceride, such as 1-monoglyceride, lysophosphatidylcholine

or digalactosyl monoglyceride (DGMG). The second emulsifier is preferably produced from the acyl lipid donor after the removal of one or more acyl groups from said lipid acyl donor. The term lysophosphatidylcholine as used herein is synonymous with the term lysolecithin and these terms may be used interchangeably herein.

Preferably the second emulsifier is the DGMG. Appropriately, the DGMG is produced in situ by removal of an acyl group from DGDG with the transfer of the removed acyl group into a carbohydrate to form a carbohydrate ester.

When one of the emulsifiers is a protein ester and / or a diglyceride and / or a monoglyceride, the second emulsifier may be, for example, one of the following: a diglyceride, a monoglyceride, such as 1-monoglyceride, lysophosphatidylcholine or digalactosyl monoglyceride (DGMG). The second emulsifier is preferably produced from the acyl lipid donor after the removal of one or more acyl groups from said lipid acyl donor. The term lysophosphatidylcholine as used herein is synonymous with the term lysolecithin and these terms may be used interchangeably herein.

In one embodiment, the lipid acyltransferase of the invention can be used in a process for the preparation of a food such as a cooking oil, margarine or spreadable cream, whereby the food naturally contains or has been enriched with glycerol. , at least one phospholipid (for example lecithin) and / or a glycolipid (for example digalactosyl diglyceride), and optionally a phytosterol or phytostanol.

When used as cooking oil or margarine, the food may have improved antifouling properties. In addition or alternatively the food may have one or more useful technical properties, for example improved oxidative stability, improved emulsification properties or sanitary utilities.

In one embodiment, the lipid acyltransferase of the invention may be in the preparation of low-fat foods, such as low-fat spread creams, low-fat salad dressings, low-fat mayonnaise, etc. In such low fat food products, the fat content is generally reduced by the addition of emulsifiers and additional water compared to the equivalent with more fat.

It has been found that the lipid acyltransferases used in the compositions and methods of the invention have exclusive properties when compared with lipolytic enzymes in which they have a marked preference for the transfer of acyl groups from lipids to other receptors other than water, including in the presence of water in significant quantity. In a comparison with the enzymes of the prior art, the lipid acyltransferase used in the invention was found to have a relatively high transferase activity in the presence of 6% water, 54% water, 73% water, 89% water and about 95% water. The lipolytic enzymes tested had virtually no significant activity related to transferase at these water concentrations.

The lipase and acyltransferase activity of an enzyme can be evaluated using the following assays: In this way a lipid acyltransferase having the enzymatic characteristics defined herein can be obtained and identified.

Transferase assay in buffered substrate (see Example 12)

Enzymes, which function as lipid acyltransferases for use in the compositions and methods of the invention can be routinely identified using the analysis disclosed herein in Example 12. This assay will hereinafter be referred to herein. as "Transferase assay in buffered substrate". In Example 12 the Aeromonas salmonicide lipid acyltransferase enzyme according to the present invention was analyzed and compared with a range of lipolytic enzymes not covered by the present invention. As can be seen, it was discovered that of the lipolytic enzymes only LIPOPAN® F (Novozymes, Denmark) exhibits some transferase activity and then only a very low concentration (1.3%).

Enzymes suitable for use in the compositions and methods of the invention can be routinely identified using the transferase assay in buffered substrate. Using this test, in which there is a very high water content, approximately 95%, the lipid acyltransferases according to the present invention are those that have at least 2% acyltransferase activity (relative transferase activity), preferably at least 5% relative transferase activity, preferably at least 10% relative transferase activity, at least 15%, 20%, 25%, 26%, 28%, 30%, 40%, 50%, 60% or 75% relative activity of transferase. Suitably, the lipid acyltransferase according to the present invention may have less than 28%, less than 30%, preferably less than 40%, 50%, 60%, 70%, 80%, 90% or 100% acyltransferase activity.

Transferase assay in egg yolk with plenty of water (see Example 11)

As an alternative to (or in addition to) using the "Transferase Assay in Buffered Substrate" (see above), a lipid acyltransferase for use according to the present invention can be identified using the "Test with transferase in egg yolk with a lot of water" given to be known in Example 11.

In one embodiment, the lipid acyltransferase suitable for use in the methods and / or compositions according to the present invention is what is tested using the water-rich egg yolk transferase assay in an egg yolk with 54 % water, has up to 100% relative transferase activity. In fact, experiments in egg yolk with high water content have shown that at the beginning of the experiment it was calculated that the initial amount of transferase was 100% transferase activity, that is, no hydrolytic activity was observed. On the other hand, the lipolytic enzymes used as a reference, that is to say LIPOPAN® F and phospholipase A2, showed undetectable transferase activity in the egg yolk with 54% water, or the egg yolk with water-enriched content (i.e. egg with 73% water or 89% water). Preferably, the increase in the water content does not significantly decrease the percentage of acyltransferase activity of a lipid acyltransferase for use in the processes or compositions according to the present invention.

In a preferred embodiment, with reference to the transferase assay in water-rich egg yolk, with a water content of 54%, a lipid acyltransferase for use in the present invention will have an initial percentage of acyltransferase activity (activity initial relative transferase) measured after 10% of donor molecule consumption (i.e. phospholipids) of at least 0.1% relative transferase activity, preferably at least 1% relative transferase activity, preferably by at least 5% relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% relative transferase activity, preferably at least 50% relative transferase activity, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 99%, preferably about 100% relative transferase activity.

In a preferred embodiment, referring to the transferase assay in water-rich egg yolk, with a water content of 54%, and measured after 10% consumption of the donor molecule (i.e. phospholipid), the lipid Acyltransferase for use in the compositions and methods of the invention has detectable transferase activity, ie relative transferase activity between 0.1% and 100%, preferably at least 1% relative transferase activity, preferably at least 5 % relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% relative transferase activity, preferably at least 45%, 50%, 60%, 70%, 80% or 90% relative transferase activity. Suitably, the lipid acyltransferase according to the present invention may have, when using the water-rich egg yolk transferase assay, with a water content of 54%, and measured after 10% consumption of the donor molecule (it is say phospholipid), a percentage of acyltransferase activity (relative transferase activity) less than 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, referring to the test with transferase in water-rich egg yolk, with a water content of 73%, and measured after 10% consumption of donor molecule (i.e. phospholipid), the lipid acyltransferase for use in the compositions and methods of the invention it has detectable transferase activity, i.e. relative transferase activity between 0.1% and 100%, preferably at least 1% relative transferase activity, preferably at least 5% of relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% activity of relative transferase, preferably at least 45%, 50%, 58%, 60%, 70%, 80% or 90% relative transferase activity. Suitably, the lipid acyltransferase according to the present invention may have, when using the water-rich egg yolk transferase assay, with a water content of 73%, and measured after 10% consumption of the donor molecule (it is say phospholipid), a percentage of acyltransferase activity (relative transferase activity) less than 45%, 47%, 50%, 58%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, referring to the transferase assay in water-rich egg yolk, with a water content of 89%, and measured after 10% consumption of the donor molecule (i.e. phospholipid), the lipid Acyltransferase for use in the compositions and methods of the invention has detectable transferase activity, ie relative transferase activity between 0.1% and 100%, preferably at least 1% relative transferase activity, preferably at least 5 % relative transferase activity, preferably at least 10% relative transferase activity, preferably at least 20% relative transferase activity, preferably at least 30% relative transferase activity, preferably at least 40% relative transferase activity, preferably at least 45%, 50%, 60%, 70%, 80% or 90% relative transferase activity. Suitably, the lipid acyltransferase according to the present invention may have, when using the water-rich egg yolk transferase assay, with a water content of 89%, and measured after 10% consumption of the donor molecule (it is say phospholipid), a percentage of acyltransferase activity (relative transferase activity) less than 45%, 47%, 50%, 60%, 70%, 80%, 90% or 100%.

In a preferred embodiment, with reference to the water-rich egg yolk transferase assay, a lipid acyltransferase for use in the compositions and methods of the invention has significant relative transferase activity (ie at least 0, 1% in both water contents) and has a significant relative transferase activity in egg yolk with a water content of 54% as in an egg yolk with a water content of 73%, when measured after 10% of consumption of the donor molecule (ie phospholipid).

In a preferred embodiment, with reference to the water-rich egg yolk transferase assay, a lipid acyltransferase for use in the compositions and methods of the invention has significant relative transferase activity (ie at least 0, 1% in both water contents) and has a significant relative transferase activity in egg yolk with a water content of 54% as in an egg yolk with a water content of 89%, when measured after 10% of consumption of the donor molecule (ie phospholipid).

In a preferred embodiment, with reference to the water-rich egg yolk transferase assay, a lipid acyltransferase for use in the compositions and methods of the invention has significant relative transferase activity (ie at least 0, 1% in both water contents) and has a significant relative transferase activity in egg yolk with a water content of 73% as in an egg yolk with a water content of 89%, when measured after 10% of consumption of the donor molecule (ie phospholipid).

The term "relative equivalent transferase activity" as referred to herein, means that the enzyme has a relative transferase activity (% acyltransferase activity) that is at least 2% lower, preferably at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% lower, in the egg yolk with the higher water content compared to that of the egg yolk with the lower water content

Transferase assay in a medium with little water

As an alternative to (or in addition to) using the "Test of transferase in egg yolk with a lot of water" and / or the "Test of transferase in buffered substrate", the lipid acyltransferase for use according to the present invention can be identified using the " Transferase assay in medium with little water ".

To determine if an enzyme is a lipid acyltransferase according to the present invention, a "Transferase assay can be performed in a medium with little water", that is to say in an oily medium with 6% water as disclosed in Example 22 This example illustrates that in an oily medium with a water content of 6% the lipid acyltransferase of the invention has a very relative transferase activity, in which the lipolytic enzymes of the prior art exhibit hydrolytic activity.

In one embodiment, the lipid acyltransferase suitable for use in the methods and / or compositions according to the present invention is the one when analyzed using the "Transferase assay in a medium with little water" measured after a selected period. between 30, 20 or 120 minutes, it has a relative transferase activity of at least 1%, preferably at least 2%, preferably at least 5%, preferably at least 10%, preferably at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70% and preferably at least 75%. Suitably, the lipid acyltransferase according to the present invention may have less than 30%, 40%, 50%, 60%, 70% or 80% activity when measured after a period of 10, 20, 30 or 120 minutes, using the "Transferase assay in a medium with little water".

As described above, the lipase acyltransferase of the invention can be identified using either "Transferase Assay in Buffered Substrate" or in the "Transferase Assay in a Medium with Low Water" using cholesterol as an acyl receptor. Of course, the expert will easily find out that, with obvious corrections to the analytical methods, the "Test with transferase in buffered substrate" or "Test with transferase in medium with little water" can be used to determine the activity of lipid acyltransferase for any acyl donor or any combination of acyl receptor. The expert would simply replace, if necessary, the acyl donor substrate (e.g., phospholipid) with an alternative acyl donor substrate (e.g., glycolipid, triacylglycerides) and / or replace the acyl receptor (e.g. cholesterol) with a alternative acyl receptor substrate (for example, a carbohydrate, a protein, another sterol, a stanol or glycerol).

The term "with a lot of water" as used herein means any substrate or food with more than 2% water content, preferably more than 3%, 4%, 5%, 6%, 7%, 8% , 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

The term "with little water" as used means any substrate or food with less than 6% water content, preferably less than 5%, 4%, 3%, 2%, 1% or 0.5%.

Preferably the process and / or the use according to the present invention can be carried out, for example, in a food at a temperature between 15 and 60 ° C, preferably at a temperature between 20 and 60 ° C, preferably between 20 and 50 ° C, preferably between 20 and 45 ° C, preferably between 20 and 40 ° C. For some aspects, for example in the dough, preferably the temperature of the food during which the acyltransferase reaction takes place is between 20 and 40 ° C. For other aspects, for example, with respect to dairy products, such as cheese, the temperature of the food may be appropriately between 30 ° C and 60 ° C. In other aspects still, for example with respect to mayonnaise, the temperature of the food may be appropriately between 20 and 40 ° C, more preferably between 25 and 30 ° C.

Preferably, the emulsifier produced according to the present invention comprises less than 5% by weight of the food.

Preferably, the emulsifier produced according to the present invention comprises from 0.01% to 4% by weight of the food.

Preferably, the emulsifier produced according to the present invention comprises from 0.01% to 2% by weight of the food.

Preferably, the emulsifier produced according to the present invention comprises from 0.01% to 1% by weight of the food.

Preferably, the emulsifier produced according to the present invention comprises from 0.01% to 0.5% by weight of the food.

Preferably, the emulsifier produced according to the present invention comprises from 0.01 to 0.3% by weight of the food product.

Suitably, the process according to the present invention includes inactivating or denaturing the enzyme to provide a food comprising the enzyme and an inactive or denatured form. Properly the enzyme can be denatured by cooking or pasteurization.

The present invention may further comprise the use of a lipid acyltransferase as defined herein in enzymatic compositions for food and / or feed, and may comprise enzymatic compositions for food and / or feed comprising a lipid acyltransferase as defined. In the present memory. Such compositions may contain one or more additional enzymes, such as those listed herein. Alternatively, the enzyme composition of the invention may be used in combination with other ingredients and food additives such as those listed herein, including other enzyme compositions. By formulating the lipid acyltransferase of the invention in a food and / or feed composition, the enzyme can be stabilized to allow prolonged storage under suitable conditions (under suitable conditions) before use in the production of food and / or feed. . In addition, the enzyme composition of the present invention provides the enzyme in a form suitable for safe use during in situ application in the preparation of food and / or feed or ingredients for use in the preparation of food and / or feed. Said compositions may be in liquid, semi-liquid or solid / granular form.

In one embodiment the enzymatic composition of the food may appropriately be a dough improver composition. The dough improver composition may comprise other useful components such as an emulsifier and / or other enzymes such as those listed herein.

Food enzymes are marketed as stabilized liquid concentrates or as particulate solids. The formulation in the enzymatic composition of the food minimizes losses in enzymatic activity during transport, storage and use. Enzymes are often exposed to moist, warm or oxidizing media in the treatment of food and beverages. The formulations improve stability by counteracting the primary forces of deactivation: denaturation, catalytic deactivation at the site and proteolysis. Denaturation occurs by physical unfolding of a tertiary protein structure of the enzyme under thermal or chemical stress. Once an enzyme begins to unfold it is drastically more vulnerable to deactivation and proteolysis. To minimize deployment, the formulator can alter the protein medium in order to produce a compact protein structure; This is done more effectively by "preferential exclusion" of water from the surface of the protein by adding compounds that are associated with water such as sugars, polyhydric alcohols and liotropic salts. The best ways to combat active inactivation at the site are to ensure sufficient concentrations of some required cofactors, to add reversible inhibitors and to exclude oxidizing or reactive species in the formulation.

In addition to enzymatic stability, a formulation would meet several key secondary requirements including preservation against microbial contamination, impeding physical precipitation or fog formation, minimizing the formation of sensitizing dusts or aerosols, and optimizing aesthetic criteria such Like the color and the smell. Many of these problems are best studied by focusing "upstream" as far as possible, including the selection of raw materials in fermentation or the enzyme recovery process. Downstream operations such as diafiltration, adsorption, chromatography, crystallization and extraction can be used to remove impurities responsible for color, odor and precipitation. The risk of physical precipitation is minimized by formulating near the isoelectric point of the enzyme with hydrophilic solvents such as glycerol or propylene glycol. Moderate concentrations of solvation salts can also be added effectively to avoid desalination or "reverse salting." To prevent microbial contamination, a combination of filtration, acidification and minimization of free water can be used; Biocides may be effective, but the range of acceptable chemicals to control or destroy microbes is increasingly circumscribed by health and safety regulations.

Two procedures that produce the most erosion resistant granules to date are high shear granulation and fluidized bed spray coating, see for example T. Becker: "Separation and Purification Processes for Recovery of Industrial Enzymes" in RK Singh , SSH Rizvi (eds.): Bioseparation Processes in Foods. Marcel Dekker, New York, p. 427-445. These procedures use various binders, coatings and particle morphologies to produce non-disintegrable particles that still protect enzymes during storage but allow for easy release in solution during use.

Enzymatic food compositions containing the lipid acyltransferase of the invention can be prepared using conventional formulation techniques, such as spray drying or liquid formulation.

The lipid acyltransferase of the invention can be expressed in any suitable expression host. For example, the lipid acyltransferase of the invention can be expressed in Bacillus subtilis and can be purified by ultrafiltration and / or precipitation in ethanol and / or centrifugation, and can be subsequently lyophilized using starch (maltodextrin) as a vehicle for the enzyme. The lyophilized enzyme can be standardized for specific PLU activity by also adding vehicle in powder form. The techniques involved are well demonstrated and routine in the art.

Alternatively, the lipid acyltransferase for use according to the present invention, for example the heterogeneously produced lipid acyltransferase of the invention, once purified can be stabilized in a suitable liquid formulation such as glycerol-based. Other methods of preparing stabilized enzyme formulations are described in patents EP 0 770 037 and EP 0 702 712.

Powdered acyltransferase can also be used in combination with other enzymes such as those listed herein, for the production of enzymatic compositions with activity defined according to the product specification.

In general, the dosage of the enzymatic formulation for the food is between 10 g and

1,000 g per 1000 kg of food product, preferably between 50 and 200 g per 1000 kg of food product, preferably between 75 and 125 g per 1000 kg of food product.

Preferably the enzyme according to the present invention is present in an inactive form or in a denatured form in the food.

In one embodiment, the enzyme according to the present invention is preferably not immobilized, in particular it is not immobilized on a solid support.

In an alternative embodiment, the enzyme can be immobilized.

The immobilized lipid acyltransferase can be prepared using immobilization techniques known in the art. There are numerous methods of preparing immobilized enzymes that are evident to a person skilled in the art (for example the techniques mentioned in EP 0 746 608; or Balcao VM, Paiva AL, Malcata FX, Enzyme Microb. Technol. May 1996, 1; 18 (6): 392-416; or Reetz MT, Jaeger KE. Chem. Phys. Lipids. June 1998, 93 (1-2): 3-14; or Bornscheuer UT, Bessler C., Srinivas R. , Krishna SH, Trends Biotechnol., Oct. 2002; 20 (10): 433-7.

In one embodiment, the food of the invention may contain food ingredients, which have been prepared using immobilized lipid acyltransferase, but do not contain the lipid acyltransferase in the food ingredient or in the food. For example, the food may contain one or more of the following components: an emulsifier, more than one emulsifier, one or more flavoring agents, one or more texture improvers and / or one or more sterol esters such as phytosterol esters or phytostanol esters.

The enzyme according to the present invention can be used with one or more conventional emulsifiers, including for example monoglycerides, esters of diacetyltartaric acid, mono and diglycerides of fatty acids, and lecithins for example, obtained from soybeans.

The enzyme according to the present invention can be used with one or more other suitable food grade enzymes. Therefore it is within the scope of the present invention that, in addition to the enzyme of the invention, at least one more enzyme is added to the food. Such additional enzymes include starch degrading enzymes such as endo-or exoamylases, pululanases, de-branching enzymes, hemicellulases including xylanases, cellulases, lipases, phospholipases and proteases.

The enzyme according to the present invention can be used with an enzyme or others of suitable food quality. Therefore, it is within the scope of the present invention that in addition to the enzyme of the invention, at least one more enzyme is added to the food. Such additional enzymes include starch degrading enzymes such as endo-or exoamylases, pululanases, de-branching enzymes, hemicellulases including xylanases, cellulases, oxido-reductases for example, glucose oxidase, pyranose oxidase, sulfhydryl oxidase or a carbohydrate oxidase, such as oxidizes maltose, for example hexose oxidase (HOX), lipases, phospholipases and hexose oxidase and proteases.

In a preferred embodiment the lipid acyltransferase is used together with a lipase having a

or more of the following lipase activities: glucolipase activity (EC3.1.1.26), triacylglycerol lipase activity (EC3.1.1.3), phospholipase A2 activity (EC3.1.1.4), phospholipase A1 activity (EC3.1. 1.32). Suitably, lipase enzymes are well known in the art and include, by way of example, the following lipases: LIPOPAN® F and / or LECITASE® ULTRA (Novozymes A / S, Denmark), Phospholipase A2 (for example,

TM TM ®

phospholipase A2 from LIPOMOD22L from Biocatalysts, LIPOMAX from Genecor), LIPOLASE (Novozymes A / S, Denmark), the lipases disclosed in WO 03/97835, EP 0 977 869 or EP 1 193 314. This combination of a lipid acyltransferase as defined herein and a lipase may be particularly preferred in dough or baked goods or in foods such as cakes and pastries.

The use of lipases combined with the enzyme of the invention may be particularly advantageous in cases where some accumulation of free fatty acids may be desired, for example in cheeses in which free fatty acids may communicate a desirable taste, or in The preparation of fine foods. The person skilled in the art may combine proportions of lipolytic enzymes, for example LIPOPAN® F and / or LECITASE® ULTRA (Novozymes A / S, Denmark), phospholipase A2 (for example, LIPOMODTM 22L phospholipase A2 from Biocatalysts, LIPOMAXTM from Genecor) , LIPOLASE® (Novozymes A / S, Denmark), the lipases disclosed in WO 03/97835, EP 0 977 869 or EP 1 193 314 and the lipid acyltransferase of the present invention to provide the desired hydrolytic activity ratio to the transferase which produces a preferred technical effect or the combination of technical effector in the food (such as those listed herein in "Technical Effects".

Traditionally the pastry industry uses improvements in cakes for the production of cakes and to ensure high quality cakes from the point of view of taste, structure, edible quality and appearance. These cake improvers are usually based on lyophilized emulsifiers in a vehicle such as starch and maltodextrin. Some cake improvers are also in gel form based on emulsifiers, sugars and water. These cake improvers are very important in the pastry industry to produce high quality cakes. Cake improvers, however, contain emulsifiers and other "unnatural" ingredients with an E number. Because of consumer demand to reduce the quantities of E numbers, the pastry industry has asked in alternative ways to produce high quality cakes without Use emulsifiers.

An alternative way of producing cakes is to use an enzyme, ie the lipid acyltransferase defined herein or an enzymatic composition according to the present invention.

The lipid acyltransferase as defined herein and / or the food enzyme composition of the present invention can be used in the preparation of a refined food, such as a cake. In such cases, the following constituents can be formed in the refined food:

i) esters of sugar and lysolecithin (from the carbohydrate and from the cake recipe and lecithin in the egg that is also part of the cake recipe); I

ii) acylated peptides and lysolecithin (transforming a fatty acid from lecithin into a protein or peptide during the formation of protein-fatty acid condensates, which are known to be very effective emulsifiers (Herstellung und Anvendungmöglichkeiten von Eiweiss-Fettsäurekondensaten. Andreas Sander , Eberhard Eilers, Andrea Heilemann, Edhit von Kreis, Fett / lipid 99 (1997) No. 4, 115-120).

It is considered in the production of some refined foods, particularly high-fat refined foods, such as cakes, it may be desirable to have some accumulation of fatty acids. Accordingly, the combination of the use of lipolytic enzymes and lipid acyltransferase as defined herein may be particularly beneficial for the production of highly refined foods. Alternatively, additional free fatty acids or fatty acid soap (E470a) can be selected and used in combination with lipid acyltransferase.

The food according to the present invention may appropriately comprise one or more of the following additives:

Soy protein material; carotenoids, flavonoids, antioxidants and phytochemicals (especially anthocyanide, carotenoid, bioflavinoid, glutathione, catechin, isoflavone, lycopene, ginsenoside, picnogenol, alkaloids, pygeum phytosterol, sulforazone, resveretol, grape seed extract or food containing estersol or food containing ), vitamins (especially vitamin C, vitamin A, vitamin B3, vitamin D, vitamin E, thiamine, riboflavin, niacin, pyridoxine, cyanocobalamin, folic acid, biotin, pantothenic acid or vitamin K), minerals (especially calcium, iodine , magnesium, zinc, iron, selenium, manganese, chromium, copper, cobalt, molybdenum or phosphorus), fatty acids (especially gamma-linoleic acid, eicosapentanoic acid or decosahexanoic acid), oils (especially borage oil, rich canola oil carotenoids or flaxseed oil), amino acids (especially tryptophan, lysine, methionine, phenylalanine, threonine, valine, leucine, isoleucine, alanine, arginine, aspartic acid, cysteine, cystine, glutamic acid, glutamine, glycine, histidine, proline, hydroxyproline, serine, taurine or tyrosine), enzymes (especially bromelain, papain, amylase, cellulase or coenzyme Q), lignin, stanol ester or bacteria (especially Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus bifidus, Lactobacillus plantarum or Streptococcus faecium), folic acid and soluble fiber.

TECHNICAL EFFECT

Surprisingly, lipid acyltransferases have significant acyltransferase activity in food. This activity has surprising helpful applications in food preparation procedures.

The present invention is involved in the surprising discovery that lipid acyltransferases according to the present invention can carry out the esterification of carbohydrates by alcohololysis, that is, the transfer of acyl from a lipid, into a food with a significant water content. The prior art suggests that such enzymes if they functioned completely in this way would only work in a solvent medium (that is, in media with little or no water content).

The present invention can provide one or more of the following unexpected technical effects in egg products, particularly mayonnaise: improved thermal stability during pasteurization; Improved organoleptic properties, improved consistency.

The present invention may provide one or more of the following unexpected technical effects on the dough and / or baked goods: an improved specific volume of the dough or baked goods (for example of bread and / or cake); improved stability of the dough; an improved crust score (for example a thinner and / or crunchier crust), an improved crumb score (for example a more homogeneous distribution of the crumb and / or a finer crumb structure and / or a softer crumb); an improved appearance (for example a smooth surface without blisters or holes or substantially without blisters or holes); a reduced hardening, an increase in softness; an improved smell; An improved flavor.

The present invention can provide a beneficial effect on the formation of very active surface materials in a food without formation of substantial amount of free fatty acids, which reduce the ability of the food to oxidize during storage because free fatty acids are more prone to oxidation than the corresponding fatty acid esters.

Suitably, the present invention may provide one or more of the following unexpected technical effects in a food: an improved appearance, an improved mouthfeel, an improved stability, in particular an improved thermal stability, an improved flavor, an improved softness, improved resilience and improved emulsification.

Suitably, the present invention may provide one or more of the following unexpected technical effects on dairy products, such as ice cream for example: an improved mouthfeel (preferably a creamier mouthfeel; an improved taste; a core fusion improved

Suitably, the present invention may provide one or more of the following unexpected technical effects on the egg or egg products: improved emulsion stability; thermal stability of the emulsion; improved flavor; reduced bad smell; improved thickening properties, improved consistency.

The specific technical effects associated with the use of a lipid acyltransferase as defined in

5

10

fifteen

twenty

25

30

35

The present report in the preparation of a food is listed in the following table:

Food

Effect

one

Bread, sweet breads and donuts It strengthens the dough and increases the mechanical resistance and increases the water absorption capacity. Increase the volume of dairy products and maintain the softness of the crumb

2

Frozen dough Prevents decomposition during cooling

3

Biscuit Improves cake volume and uniform soft texture

4

Cookies, crackers and candy Stabilizes grease emulsions and prevents stickiness to the machine. Prevents the flourishing of fat-rich products

5

Flour, milk and eggs and breaded dough Improves the texture of fried products

6

Noodles It prevents the dough from sticking to the machine. Increase the water content and decrease the lack of cooking

7

Instant noodles Prevents filaments from forming on each other

8

Pasta Dough conditioner prevents adhesion during cooking

9

Custard It makes starch paste with a smooth and creamy texture and prevents dehydration

10

Coffee bleach Prevents the separation of oil and water

eleven

Whipped cream Provides stable emulsion

12

Chocolate Prevents or reduces flowering

13

Candy, candies and nougat Improves the emulsification of ground sugar and oil. Prevents oil separation

14

Processed meat and sausages Improves the water-bearing capacity of sausages and pressed jam and prevents the separation of the oil phase from pasta and pate

Suitably, the present invention may provide one or more of the following technical effects in cheese: a decrease in the effect of oil loss in cheese; an increase in cheese yield; an improvement in taste; a reduced bad smell; a reduced "soap" flavor.

In food production, in particular in cheese production, the use of lipid acyltransferase according to the present invention provides a significant advantage in the ability to recover soluble proteins in dairy products. For example, in cheese production almost 20% of all milk protein is eliminated in the whey (that is, the aqueous part of the milk that remains after lump formation). Whey comprises soluble milk proteins, while hydrophobic proteins are kept in the curd. By using the lipid acyltransferase according to the present invention it is possible to transfer an acyl group from a lipid (preferably from a glycolipid or a phospholipid) to a protein (in particular to a whey protein such as lactoglobulin) to form a protein in the condensate of fatty acid. Therefore, producing a product that is more hydrophobic and remains in the curd instead of eluting in the serum. In this way, more milk protein can be maintained in the final food product, that is, the final milk product such as cheese.

In one aspect, the present invention is based in part on the realization that food yields (such as in cheeses) can be improved by the use of a lipid acyltransferase. In addition or alternatively, the taste, texture, oxidative stability and / or food storage stability can be improved. In addition or alternatively, the food may have a reduced cholesterol concentration or an improved content of phytosterol / stanol esters.

Without wishing to be bound by a particular theory, it is considered that the increase in yield may be the result of transesterification of serum products and peptides, resulting in a significant increase in hydrophobia of whey proteins and precipitation. of acylated whey proteins in the curd.

In biological systems, for example, the deposition of membrane bound proteins and enzymes is achieved by two different mechanisms. The membrane-bound proteins possess numerous extensions of the membrane or hydrophobic domains, or alternatively have a fatty acid attached to the polypeptide chain. Fatty acids normally have a chain of 14 or 16 carbon atoms in length. The fatty acids are covalently linked to the polypeptide chain in 3 different positions, the N-terminal amino acid as the amide bond, a cysteine residue as the thioester bond or a serine or threonine amino acid as the ester bond. Only one fatty acid per polypeptide molecule is necessary to incorporate the protein into the cell membrane.

When a fatty acid is covalently bound to a non-membrane protein, the physical and functional properties will change dramatically. WO 97/14713 describes soy and gluten transformed proteins in acyl derivatives by treatment with a Mucor miehei lipase (LipozymeTM, Novozymes) and a fatty acid in organic solvent. The lipid acyltransferase according to the present invention can be used in the production of acylated proteins in a medium with little or a lot of water.

It is noted that acylated proteins form amphiphilic complexes that can be used for numerous cosmetic products. The acylated protein can form gels, bind to water retaining moisture, has emulsifying properties and are very active at the interface between water and lipid.

Therefore, the present invention can provide in one aspect a cosmetic composition comprising a lipid acyltransferase as defined herein.

In addition, the present invention may provide the use of an acyltransferase as defined herein to produce a cosmetic composition.

In a further aspect, the present invention provides a method of producing in situ a protein ester in a cosmetic composition, wherein the method comprises the step of adding to the cosmetic composition (or components thereof) a lipid acyltransferase as defined herein.

Many food proteins are soluble in aqueous solutions and are therefore suitable for in situ modification by lipase acyltransferase. In cheese production, β-lactoglobulin is lost in the whey fraction. After acylation with a lipase acyltransferase, or a variant of lipase acyltransferase, the initial results indicate that β-lactoglobulin can however be deposited on the surface of casein micelles during rennet coagulation. Β-Lactoglobulin has three potential acylation points (serine residues) in three surface loops. Milk contains sufficient amounts of lecithin, a suitable substrate for a lipid acyltransferase enzyme to acylate β-lactoglobulin. The lysolecitin formed may have an additional emulsifying effect.

The improvements observed with the lipid acyltransferase according to the present invention are compared when lipolytic enzymes without acyltransferase activity are used, such as triacylglycerol lipases and phospholipases.

ADVANTAGES

The regeneration of an emulsifier and an in situ sterol / stanol ester from at least one constituent of the food material means that the food material will contain one less material additive. This is advantageous due to the improvement in the ease of production. For example, no additional treatment or addition of ingredients or addition of emulsifiers may be needed. In addition, the food may contain less "additives." The reduction or elimination of "additives" is desirable for consumers and the inclusion of additives should often be declared to the consumer in the ingredients listed in the food. Thus, the present invention has more advantages.

An advantage of the present invention may be the production in situ of an emulsifier in a food without detrimental increase in the free fatty acid content of the food.

The generation of two emulsifiers and / or an in situ carbohydrate ester of at least one constituent of the food material means that the food material will contain at least one less additive material.

Furthermore, when the lipid acyltransferase acts on a glycolipid it is possible to advantageously produce the DGMG emulsifier in situ without a detrimental increase in the fatty acid content of the food material. Thus, reducing the harmful effects attributed to an increase in free fatty acids, including but not limited to a reduction in the "soap" taste in cheese electrophoresis, preventing overdose in the dough and properties of the cooked dough.

In some aspects, an advantage of the present invention is the reduction in concentrations of free cholesterol in the food.

In another aspect, an advantage of the present invention is the increase in sterol / stanol esters in the food. Some sterol / stanol esters can be effective flavoring and / or texturizers. Thus, the present invention can not only result in the in situ production of an emulsifier in a food, but also the in situ production of a flavoring and / or a texturizer. Some sterol / stanol esters are known because they lower blood serum cholesterol and / or low density lipoproteins when consumed in a food. Thus, the present invention can be used to prepare a food with increased concentrations of sterol esters and / or stanol esters.

For some aspects, particularly when the enzyme according to the present invention is used in egg-based products, an advantage is the elimination of unwanted free carbohydrates.

In addition, the emulsification properties of the food advantageously increase, leading to an improved appearance and / or handling properties and / or structure and / or consistency and / or thermal stability without a negative impact on the taste.

Furthermore, for some embodiments advantageously the "overdose" effect observed when lipases are used by themselves, is effectively resolved by the addition of an enzyme according to the present invention. This is due at least in part to the fact that free fatty acids are not produced or only produced to an insignificant degree when the enzyme according to the present invention is used.

ISOLATED

In one aspect, preferably the polypeptide or protein for use in the present invention is an isolated form. The term "isolated" means that the frequency is at least substantially free of at least one other component with which the sequence is naturally associated in nature and as found in nature.

PURIFIED

In one aspect, preferably the polypeptide or protein for use in the present invention is in purified form. The term "purified" means that the sequence is in a relatively pure state, for example, at least about 51% pure, or at least about 75%, or at least about 80%, or at least about 90% pure or at least about 95% pure or at least about 98% pure.

CLONING A NUCLEOTYDIC SEQUENCE THAT CODIFIES A POLIPEPTIDE ACCORDING TO THE PRESENT INVENTION

A nucleotide sequence encoding a polypeptide that has the specific properties defined herein or a polypeptide that is suitable for modification can be isolated from any cell or organism that produces said polypeptide. Several procedures are well known in the art for the isolation of nucleotide sequences.

For example, a genomic DNA and / or a cDNA bank can be constructed using chromosomal DNA or messenger RNA of the organism that produces the polypeptide labeled oligonucleotide probes, can be synthesized and used to identify clones encoding polypeptides of the genomic bank prepared from the organism . Alternatively, a labeled oligonucleotide probe containing sequences homologous to another known polypeptide gene could be used to identify clones encoding polypeptides. In the latter case, the hybridization and washing conditions of less severity are used.

Alternatively, clones encoding polypeptides could be identified by inserting genomic DNA fragments into an expression vector, such as a plasmid, transforming negative bacteria to enzymes with the resulting genomic DNA bank and then plating the agar-transformed bacteria they contain. enzyme inhibited by the polypeptide, thereby allowing clones that express the polypeptide to be identified.

In a still further alternative, the nucleotide sequence encoding the polypeptide can be prepared by synthesis by standard methods demonstrated, for example, the phosphoramidite procedure described by Beucage S. L. et al., (1981) Tetrahedron Letters, 22, p. 1859-1869, or the procedure described by Matthes et al., (1984), EMBO J. 3, p. 801-805. In the phosphoramidite process, oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, hybridized, ligated and cloned into appropriate vectors.

The nucleotide sequence may be of mixed genomic and synthetic origin, of synthetic origin and of mixed cDNA or of genomic and mixed cDNA origin, prepared by linking fragments of synthetic, genomic or cDNA origin (as appropriate) according to conventional techniques. Each ligated fragment corresponds to several parts of the complete nucleotide sequence. The DNA sequence can also be prepared by polymerase chain reaction (PCR) using specific primers, for example, as described in US 4,683,202 or in Saiki R.K. et al. (Science (1988), 239, pp. 487-491).

NUCLEOTYDIC SEQUENCES

The present invention also comprises nucleotide sequences encoding polypeptides having the specific properties defined herein. The term "nucleotide sequence" as used herein refers to an oligonucleotide sequence or a polynucleotide sequence, and to variants, homologs, fragments and derivatives thereof (such as fragments thereof). The nucleotide sequence can be of genomic, synthetic or recombinant origin, which can be double stranded or single stranded if it represents the transcribed or complementary chain.

The term "nucleotide sequence" in relation to the present invention includes genomic DNA, cDNA, synthesis DNA and RNA. It preferably means DNA, more preferably cDNA for the coding sequence.

In a preferred embodiment, the nucleotide sequence itself encoding a polypeptide having the specific properties defined herein does not comprise the natural nucleotide sequence in its natural environment when linked to its associated sequence (s). (s) naturally that it is also in its natural environment. For ease of reference, the authors may call this preferred embodiment the "unnatural nucleotide sequence". In this regard, the term "natural nucleotide sequence" means a complete nucleotide sequence that is in its natural environment and when it is operatively linked to a complete activator with which it is naturally associated, whose activator is also in its natural environment. Thus, the polypeptide of the present invention can be expressed by a nucleotide sequence in its natural organism but in which the nucleotide sequence is not under the control of the activator with which it is naturally associated within this organism.

Preferably the polypeptide is not a natural polypeptide. In this regard, the term "natural polypeptide" means a complete polypeptide that is in its natural environment and when it has been expressed by its natural nucleotide sequence.

Usually the nucleotide sequence encoding polypeptides having the specific properties defined herein is prepared using recombinant DNA techniques (ie recombinant DNA). However, in an alternative embodiment of the invention, the nucleotide sequence could be synthesized in whole or in part, using chemical methods well known in the art (see Caruthers MH et al. (1980), Nuc. Acids Res. Symp Ser., 215-23 and Horn T. et al. (1980), Nuc. Acids Res. Symp. Ser, 225-232).

MOLECULAR EVOLUTION

Once the nucleotide sequence encoding the enzyme has been isolated, or if the nucleotide sequence encoding the enzyme has been identified, it may be desirable to modify the selected nucleotide sequence, for example it may be desirable to mutate the sequence in order to prepare an enzyme according to the present invention.

Mutations can be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences adjacent to the desired mutation zones.

A suitable procedure is disclosed in Morinaga et al. (Biotechnology (1984) 2, pp. 646-649). Another method of introducing mutations in nucleotide sequences encoding enzymes is described in Nelson and Long (Analytical Biochemistry (1989) 180, pp. 147-151).

Instead of site-directed mutagenesis, as described above, random mutations can be introduced, for example using a commercial kit such as the Stratagene GeneMorph PCR mutagenesis kit, or the Diversify PCR random mutagenesis kit from Clontech. EP 0 583 265 refers to PCR-based mutagenesis optimization procedures, which can also be combined with the use of mutagenic DNA analogs such as those described in EP 0 866 796. Error prone technologies and PCR are suitable. for the production of lipid acyltransferase variants with the preferred characteristics. WO 0206457 refers to the molecular evolution of lipases.

A third procedure for obtaining new sequences is to fragment non-identical nucleotide sequences, either using any number of restriction enzymes or an enzyme such as DNase I, and regrouping the complete nucleotide sequences encoding functional proteins. Alternatively, one or multiple non-identical nucleotide sequences can be used and mutations introduced during the entire nucleotide sequence meeting. DNA rearrangement and family rearrangement technologies are suitable for the production of lipid acyltransferase variants with preferred characteristics. Suitable procedures for carrying out the "rearrangement" can be found in patents EP 0 752 008, EP 1 138 763 and EP 1 103 606. The rearrangement can also be combined with other forms of DNA mutagenesis as described in the documents. US 6,180,406 and WO 01/34835.

Therefore, it is possible to produce numerous site-directed or random mutations in a nucleotide sequence, either in vivo or in vitro, and to subsequently identify the enhanced functionality of the polypeptide encoded by various means. Using recombination methods mediated by computer simulation and exo (see WO 00/58517, US No. 6,344,328, US No. 6,361,974), for example, molecular evolution can be carried out in which the variant produced retains very poor homology with known enzymes or proteins. Such variants obtained in this way may have significant structural analogy with known transferase enzymes, but have very low homology to the amino acid sequence.

As a non-limiting example, moreover, the mutations or natural variants of a polynucleotide sequence can be recombined with the wild type variants or with other natural mutations or variants to produce new variants. Such new variants can also identify the enhanced functionality of the encoded polypeptide.

The application of the molecular evolution procedures mentioned above and the like allows the identification and selection of variants of the enzymes of the present invention, which have preferred characteristics without any prior knowledge of the structure or function of the protein and allows the production of mutations or variants not predictable but helpful. There are numerous examples of the application of molecular evolution in the technique for the optimization or alteration of enzymatic activity, such examples include but are not limited to one or more of the following: expression and / or optimized in a host cell or enzymatic activity increased in vitro, altered substrate and / or product specificity, increased or decreased enzymatic structural stability, altered enzyme activity / specificity under preferred environmental conditions, for example, temperature, pH, substrate.

As will be apparent to a person skilled in the art who uses molecular evolution tools, an enzyme can be altered to improve its functionality.

Suitably, the lipid acyltransferase used in the invention may be a variant, that is, it may contain at least one substitution, suppression or addition of amino acids, when compared to an original enzyme. Several enzymes retain at least 1%, 2%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% 70%, 80%, 90%, 95% , 97%, 99% homology with the original enzyme. Suitable precursor enzymes can include any enzyme with esterase or lipase activity. Preferably, the original enzyme aligns with the consensus sequence pfam00657.

In a preferred embodiment, a variant of the lipid acyltransferase enzyme preserves or incorporates at least one or more of the amino acid residues of the consensus sequence pfam00657 found in the GDSx, GANDY and HPT blocks.

Enzymes, such as lipases without any or little lipid acyltransferase activity in an aqueous medium can be mutated using molecular evolution tools to introduce or enhance transferase activity, thereby producing a lipid acyltransferase enzyme with significant transferase activity suitable for the use in the compositions and methods of the present invention.

Suitably, the lipid acyltransferase for use in the invention may be a variant with increased enzymatic activity in polar lipids, preferably phospholipids and / or glycolipids when compared to the original enzyme. Preferably, said variants also have little or no activity on polar lysolipids. The increased activity on polar lipids, phospholipids and / or glycolipids may be the result of hydrolysis and / or transferase activity or a combination of both.

Variants of lipid acyltransferases for use in the invention may have decreased activity on triglycerides, monoglycerides and / or diglycerides compared to the original enzyme.

Suitably, the variant enzyme may have no activity on triglycerides and / or monoglycerides and / or diglycerides.

Alternatively, the enzyme variant for use in the invention may have increased activity on triglycerides, and / or may also have increased activity in one or more of the following, polar lipids, phospholipids, lecithin, phosphatidylcholine, glycolipids, digalactosylmonoglyceride and monogalactosylmonoglyceride.

Variants of lipid acyltransferase are known, and one or more of said variants may be suitable for use in the methods and uses according to the present invention and / or in the enzyme compositions according to the present invention. By way of example only, the lipid acyltransferase variant described in the following references can be used according to the present invention: Hilton & Buckley, J. Biol. Chem., January 1991, 15: 266 (2): 997-1000; Robertson et al., J. Biol. Chem., January 21, 1994; 269 (3): 2146-50; Brumlik et al., J. Bacteriol., April 1996, 178 (7): 2060-4; Peelman et al., Protein Sci., March 1998; 7 (3): 587-99.

SEQUENCES OF AMINO ACIDS

The present invention also comprises amino acid sequence of polypeptides with the specific properties defined herein.

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some cases, the expression "amino acid sequence" is synonymous with the term "peptide."

The amino acid sequence can be prepared / isolated from a suitable source, or it can be prepared by synthesis or it can be prepared by using recombinant DNA techniques.

Appropriately, amino acid sequences can be obtained from isolated peptides disclosed herein by usual techniques.

A suitable procedure to determine the amino acid sequences of isolated peptides is as follows:

The purified polypeptide can be lyophilized and 100 μg of the freeze-dried material can be dissolved in 50 μl of a mixture of 8 M urea and 0.4 M ammonium bicarbonate, pH 8.4. The dissolved protein can be denatured and reduced for 15 minutes at 50 ° C, after covering with nitrogen and adding 5 µl of 45 mM dithiothreitol. After cooling to room temperature, 5 µl of 100 mM iodoacetamide can be added to modify the cysteine residues, for 15 minutes at room temperature in the dark under nitrogen.

135 µl of water and 5 µg of Lys-C endoproteinase in 5 µl of water can be added to the above reaction mixture and digestion can be carried out at 37 ° C under nitrogen for 24 hours.

The resulting peptides can be separated by reverse phase HPLC on a VYDAC C18 column (0.46 x 15 cm; 10 µm; The Separation Group, California, USA) using solvent A: 0.1% TFA in water and solvent B: 0.1% TFA in acetonitrile. Selected peptides can be re-chromatographed on a Develosil C18 column using the same solvent system, before N-terminal sequencing. Sequencing can be done using an Applied Biosystems 476A sequencer, using rapid pulsed liquid cycles according to the manufacturer's instructions (Applied Biosystems, California, USA).

SEQUENCE INTENSITY OR SEQUENCE HOMOLOGY

The present invention further comprises the use of sequences with a degree of sequence identity or sequence homology with the amino acid sequence (s) of a polypeptide having the specific properties defined herein or of any nucleotide sequence that encodes said polypeptide (hereinafter referred to as "homologous sequence (s)"). Here, the term "homologue" means an entity that has a certain homology with the present amino acid sequences and the present nucleotide sequences. Here, the term "homology" may be considered equivalent to "identity."

The homologous amino acid sequence and / or the nucleotide sequence should provide and / or encode a polypeptide that retains functional activity and / or improves enzyme activity.

In the present context, a homologous sequence is considered to include an amino acid sequence that can be at least 75%, 85% or 90% identical, preferably at least 95 or 98% identical with the present sequence. In general, homologues will comprise the same active areas, etc. than the present amino acid sequence. Although homology can also be considered from the point of view of similarity (ie amino acid residues with similar chemical properties / functions), in the context of the present invention it is preferred to express homology from the point of view of sequence identity.

In the present context, a homologous sequence is considered to include an amino acid sequence that can be at least 75%, 85% or 90% identical, preferably at least 95 or 98% identical to a nucleotide sequence encoding a polypeptide of the present invention (the present sequence). In general, homologues will comprise the same sequences that encode the active zones, etc. than the present sequence. Although homology can also be considered from the point of view of similarity (i.e. amino acid residues with similar chemical properties / functions), in the context of the present invention it is preferred to express homology from the point of view of sequence identity.

Homology comparisons can be made with the naked eye, or more commonly, with the help of easily available sequence comparison programs. These commercially available computer programs can calculate the% homology between two or more sequences.

The% homology can be calculated in the adjacent sequences, that is, one sequence is aligned with another sequence and each amino acid in one sequence is compared directly with the corresponding amino acid in the other sequence, one residue at a time. This is called an "no gap" alignment. In general, such alignments without a gap are made only in a relatively short number of remains.

Although this is a very simple and logical procedure, it cannot take into account that, for example, in an identical pair of other sequences, an insertion or deletion results in the following amino acid residues being placed out of alignment, thus resulting in a potentially large reduction in% homology when a global alignment is carried out. Consequently, most sequence comparison procedures are designed to produce optimal alignments that take into account possible insertions and deletions without unduly penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximize local homology.

However, these more complex procedures assign "hole penalties" to each hole that occurs in the alignment so that, for the same number of identical amino acids, an alignment of the sequence with as few gaps as possible (reflecting greater relevance between the two sequences compared), you will get a higher score than one with many gaps. In general, "related costs per hole" are used, which bear a relatively high cost for the existence of a hole and a smaller penalty for each subsequent remainder in the hole. This is the most frequently used gap scoring system. High penalties per hole will of course produce optimized alignments with fewer gaps. Most of the alignment programs allow to modify the penalties per hole. However, it is preferred to use the default values when using said software for sequence comparisons. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for one hole and -4 for each extension.

The calculation of the maximum% homology therefore requires first of all the production of an optimal alignment, taking into account the penalties per hole. A suitable computer program for carrying out such alignment is the GCG Wisconsin Bestfit package (Devereux et al., 1984, Nuc. Acids Research 12 p. 387). Examples of another computer program that can make frequency comparisons include but are not limited to the BLAST package (see Ausubel et al., 1999, Short Protocols in Molecular Biology, 4th ed., Chapter 18), FASTA (Altschul et al., J. Mol. Biol. 403-420) and the GENEWORKS comparison toolkit. Both BLAST and FASTA are available for offline and online research (see Ausubel et al., 1999, pp. 7-58 to 7-60). However, for some applications it is preferred to use the GCG Bestfit program. A new tool called BLAST 2 Secuences is also available to compare protein and nucleotide sequences (see FEMS Microbiol. Lett, 1999, 174 (2): 247-50; FEMS Microbiol. Lett, 1999, 177 (1): 187- 8 and tatiana@ncbi.nlm.nih.gov).

Although the final homology% can be measured from the point of view of identity, the alignment procedure itself is generally not based on a comparison of the all or nothing pair. Instead, a stepwise similarity scoring matrix that assigns scores to each pair comparison based on chemical similarity or evolutionary distance is generally used. An example of such a frequently used matrix is the BLOSUM62 matrix, the default matrix for the BLAST series of programs. GCG Wisconsin programs generally use the default public values and a comparison chart of common symbols if supplied (see user manual for details). For some applications it is preferred to use the public values for the GCG package or in the case of another computer program, the default matrix, such as BLOSUM62. .

Alternatively, the percentage of homologies can be calculated using the multiple alignment feature in DNASISTM (Hitachi Software), based on an algorithm based on CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73 (1), 237-244).

Once the computer program has produced an optimal alignment, it is possible to calculate the% homology, preferably the% sequence identity. The computer program usually performs this as part of the sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions or substitutions of amino acid residues that produce an imperceptible change and result in a functionally equivalent substance. Deliberate amino acid substitutions can be made based on the similarity in polarity, charge, solubility, hydrophobia, hydrophilicity and / or the amphipathic nature of the moieties as long as the secondary binding activity of the substance is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with polar main groups without charge with similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.

Conservative substitutions can be made, for example according to the following Table. The amino acids in the same block in the second column and preferably in the same line and in the third column can replace each other:

Aliphatic

Apolar G A P

I L V

Polar no load

C S T M

N Q

FROM

Polar with charge

K R

AROMATIC

H F W Y

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

The present invention further comprises homologous substitution (substitution and replacement both are used herein to mean the exchange of an existing amino acid residue, for an alternative moiety) that can occur ie similar substitution for similar, such as basic for basic , acid by acid, polar by polar, etc. Non-homologous substitution can also occur that is from one class of residue to another or alternatively that involves the inclusion of artificial amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine ( hereinafter referred to as O), pyrilalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements can also be made by artificial amino acids.

Variant amino acid sequences may include suitable spacer groups that can be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups, in addition to amino acid spacers, such as glycine or β-alanine residues. . An additional form of variation, involving the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to amino acid variant moieties in which the carbon-α substituent group is in the nitrogen atom of the moiety instead of in the carbon-α. Methods for preparing peptides in peptoid form are known in the art, for example Simon, R. J. et al., PNAS (1992), 89 (20), 9367-9371 and Horwell DC., Trends Biotechnol. (1995), 13 (4), 132-134.

Nucleotide sequences for use in the present invention may include synthetic or modified nucleotides therein. Numerous different types of modification for oligonucleotides are known in the art. These include central axes of methyl phosphonate and phosphorothioate and / or the addition of acridine or polylysine chains at the 3 'and / or 5' ends of the molecule. For the sake of the present invention, it should be understood that the nucleotide sequences described herein can be modified by any method available in the art. Such modifications can be made to increase activity in vivo.

or the life span of nucleotide sequences.

The present invention also comprises the use of nucleotide sequences that are complementary to the sequences presented herein or any derivative, fragment or derivatives thereof. If the sequence is complementary to a fragment thereof then this frequency can be used as a probe to identify similar coding sequences in other organisms, etc.

Polynucleotides that are not 100% homologous to the sequences of the present invention but that are within the scope of the invention can be obtained in numerous ways. Other variants of the sequences described herein can be obtained for example, by probing DNA banks prepared from a variety of individuals, for example individuals from different populations. In addition, other viral, bacterial or cellular homologs, particularly cell homologs found in mammalian cells (for example rat, mouse, cattle and primate cells) and said homologs and their fragments in general will be able to selectively hybridize. to the sequences shown in the sequence listing herein. Said sequences can be obtained by probing cDNA banks prepared from genomic DNA banks from other animal species, and probing said banks with probes comprising all or part of any of the sequences in the sequence listings attached under conditions of the medium for high severity Similar considerations apply to obtain homologous species and allele variants of the polypeptide or nucleotide sequences of the invention.

Variants and homologs of strains / species can also be obtained using degenerate PCR that will utilize primers designed for target sequences within variants and homologs encoding amino acid sequences conserved within the sequences of the present invention. The conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants / homologues. Sequence alignments can be performed using the computer program known in the art. For example, the GCG Wisconsin PileUp program is widely used.

The primers used in the degenerate PCR will contain one or more degenerate positions and will be used under conditions of severity lower than those used to clone sequences with single sequence primers against known sequences.

Alternatively, said polynucleotides can be obtained by mutagenesis directed to specific areas of characterized sequences. This can be useful when, for example, changes in the imperceptible codon sequence are needed to optimize codon preferences for a specific host cell in which polynucleotide sequences are being expressed. Other sequence changes may be desired to introduce the restriction enzyme recognition sequences, or to alter the property or function of the polypeptides encoded by the polynucleotides.

Polynucleotides (nucleotide sequences) of the invention can be used to produce a primer, for example, a PCR primer, a primer for an alternative amplification reaction, a probe for example, labeled with a developing label by conventional means using radioactive markers or non-radioactive, or polynucleotides can be cloned into vectors. Said primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also comprised by the expression polynucleotides of the invention as used in the present memory

Polynucleotides such as polynucleotides and DNA probes according to the invention can be produced recombinantly, by synthesis, or by any means available to those skilled in the art. They can also be cloned by conventional techniques.

In general, the primers will be produced by synthetic means, which implies a stepwise preparation of the desired nucleic acid sequence one nucleotide at a time. The techniques to accomplish this, which use automated techniques are readily available in the art.

The major polynucleotides will generally be produced using recombinant means, for example using PCR cloning techniques (polymerase chain reaction). This will involve the preparation of a pair of primers (for example approximately 15 to 30 nucleotides) that flank an area of the sequence that is directed to the lipid to be cloned, putting the primers in contact with the mRNA or cDNA extracted from a animal or human cell, performing a polymerase chain reaction under conditions that cause the extension of the desired area, isolating the enlarged fragment (for example by purifying the reaction mixture on an agarose gel) and recovering the expanded DNA. The primers can be designed to contain suitable restriction enzyme recognition sequences, so that the expanded DNA can be cloned into a suitable cloning vector.

HYBRIDIZATION

The present invention further comprises sequences that are complementary to the nucleic acid sequences of the present invention or sequences that can hybridize either with the sequences of the present invention or with sequences that are complementary thereto.

The term "hybridization" as used herein will include "the procedure by which a nucleic acid chain is linked to a complementary chain by base pairing" as well as the extension procedure as performed in the technologies of polymerase chain reaction (PCR).

The present invention further comprises the use of nucleotide sequences that are capable of hybridizing with sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof.

The present invention further comprises sequences that are complementary to sequences that are capable of hybridizing with the nucleotide sequences set forth herein.

Hybridization conditions are based on the melting temperature ™ of the nucleotide binding complex, as disclosed in Berger and Kimmel (1987, Guide to Molecular Cloning Tecniques, Methods in Enzymology, Vol. 152, Academic Press, San Diego CA) and provides a defined "severity" as explained below.

The maximum severity usually takes place at approximately Tm-5 ° C (5 ° C below the Tm of the probe); high severity at about 5 ° C to 10 ° C below Tm; intermediate severity at approximately 10 ° C to 20 ° C below Tm; and low severity at about 20 ° C to 25 ° C below Tm. As those skilled in the art will understand, a hybridization of maximum severity can be used to identify or detect identical nucleotide sequences while a hybridization of intermediate (or low) severity can be used to identify or detect similar or related polynucleotide sequences.

Preferably, the present invention comprises sequences that are complementary to sequences that are capable of hybridizing under conditions of high severity or severity intermediate to nucleotide sequences encoding polypeptides having the specific properties defined herein.

More preferably, the term "variant" comprises sequences that are complementary to sequences that are capable of hybridizing under severe conditions (for example, 65 ° C and 0.1 x SSC {1 x SSC = 0.15 M NaCl, 0.015 Na citrate) M pH 7.0)) to nucleotide sequences encoding polypeptides having the specific properties defined herein.

The present invention further relates to nucleotide sequences that can hybridize with the nucleotide sequences of the present invention (including the complementary sequences of those set forth herein).

The present invention further relates to nucleotide sequences that are complementary to the sequences that can hybridize with the nucleotide sequences of the present invention (including the complementary sequences of those presented herein).

Further within the scope of the present invention are included polynucleotide sequences that are capable of hybridizing the nucleotide sequences presented herein under conditions of intermediate to maximum severity.

In a preferred aspect, the present invention comprises the nucleotide sequences that can hybridize with the nucleotide sequences of the present invention, or the complement thereof, under severe conditions (for example, 50 ° C and 0.2 x SSC).

In a more preferred aspect, the present invention comprises the nucleotide sequences that can hybridize with the nucleotide sequences set forth herein, or the complement thereof, under severe conditions (for example, 65 ° C and 0.1 x SSC).

EXPRESSION OF POLYPEPTIDES

A nucleotide sequence for use in the present invention or to encode a polypeptide having the specific properties defined herein can be incorporated into a replicable recombinant vector. The vector can be used to replicate and express the nucleotide sequence in the form of a polypeptide, in and / or from a compatible host cell. Expression can be controlled using control sequences that include activators and enhancers and other expression regulation signals. Prokaryotic activators and functional activators can be used in eukaryotic cells. Tissue specific activators or stimulus specific activators can be used. Hybrid activators comprising sequence elements of two or more different activators described above may also be used.

The polypeptide produced by a recombinant host cell by expression of the nucleotide sequence can be segregated or it can be contained within the cell depending on the sequence and / or the vector used. The coding sequences can be designed with signal sequences that direct the secretion of the substance encoding sequences through a specific prokaryotic or eukaryotic cell membrane.

EXPRESSION VECTOR

The expression "expression vector" means a montage capable of expression in vivo or in vitro.

Preferably, the expression vector is incorporated into the genome of a suitable host organism. The incorporated expression preferably comprises stable incorporation into the genome.

The nucleotide sequence of the present invention or that encodes a polypeptide with the specific properties defined herein may be present in a vector, in which the nucleotide sequence is operably linked to regulatory sequences capable of providing expression of the nucleotide sequence by a suitable host organism, that is the vector is an expression vector.

The vectors of the present invention can be transformed into a suitable host cell as described below to provide expression of a polypeptide with the specific properties defined herein.

The choice of the vector, for example, a plasmid, cosmid or phage vector will often depend on the host cell into which it is to be introduced.

The vectors may contain one or more selectable marker genes, such as a gene that provides antibiotic resistance, for example, resistance to ampicillin, kanamycin, chloramphenicol or tetracycline. Alternatively, the selection can be made by joint transformation (as described in WO 91/17243).

Vectors can be used in vitro, for example for RNA production or used to transfect

or transform a host cell.

Therefore, in a further embodiment, the invention provides a method of preparing nucleotide sequences of the present invention by introducing a nucleotide sequence of the present invention into a replicable vector, introducing the vector into a compatible host cell and culturing the cell. host under conditions that produce vector replication.

The vector may further comprise a nucleotide sequence that allows the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and pIJ702.

REGULATORY SEQUENCES

In some applications, the nucleotide sequence for use in the present invention or a nucleotide sequence encoding a polypeptide having the specific properties defined herein may be operably linked to a regulatory sequence that can provide expression of the nucleotide sequence, such as by the selected host cell. By way of example, the present invention comprises a vector comprising the nucleotide sequence of the present invention operably linked to said regulatory sequence, that is, the vector is an expression vector.

The term "operably linked" refers to a juxtaposition in which the components described are in a relationship that allows them to function in the desired manner. A "operably linked" regulatory sequence to an coding sequence is linked in such a way that the expression of the coding sequence is achieved under conditions compatible with the reference sequences.

The term "regulatory sequences" includes activators and enhancers and / or other expression regulation signals.

The term "activator" is used in the normal sense of the technique, for example, an RNA polymerase binding sequence.

The increased expression of the nucleotide sequence encoding the enzyme of the present invention can also be achieved by the selection of heterologous regulatory zones, for example, activators, main and terminator zones of secretion.

Preferably, the nucleotide sequence according to the present invention is operably linked to at least one activator.

Examples of activators suitable for directing transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art.

ASSEMBLIES

The term "assembly" (which is synonymous with terms such as "conjugate", "cassette" and "hybrid") includes a nucleotide sequence for use according to the present invention directly or indirectly linked to an activator. An example of an indirect coupling is the contribution of a suitable spacer group such as an intronic sequence such as Sh1-intron or intron ADH, intermediate the activator and the nucleotide sequence of the present invention. The same is true for the term "merged" in relation to the present invention that includes direct or indirect coupling. In some cases, the terms do not comprise the natural combination of the nucleotide sequence encoding the protein normally associated with the activator of the natural gene and when both are in their natural environment.

The assembly may even contain or express a marker, which allows selection of the genetic assembly.

For some applications, the assembly preferably comprises at least one nucleotide sequence of the present invention or a nucleotide sequence encoding a polypeptide having the specific properties defined herein operatively linked to an activator.

BELLING CELLS

The term "host cell" in connection with the present invention includes any cell that comprises either a nucleotide sequence encoding a polypeptide having the specific properties defined herein or an expression vector as described above and used in the recombinant production of a polypeptide having the specific properties defined herein.

Thus, a further embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence that expresses a polypeptide having the specific properties defined herein. The cells will be selected to be compatible with said vector and may be for example prokaryotic (for example bacterial), fungal, yeast or plant cells. Preferably, the host cells are not human cells.

Examples of suitable bacterial host organisms are gram negative or gram positive bacterial species.

Depending on the nature of the nucleotide sequence encoding a polypeptide having the specific properties defined herein, and / or the convenience of further processing the expressed protein, eukaryotic hosts such as yeasts or other fungi may be preferred. In general, yeast cells are preferred over fungal cells because they are easier to handle. However, some proteins are poorly secreted in the yeast cell, or in some cases they are not properly processed (for example, hyperglycosylation in yeasts). In these cases, a different fungal host organism should be selected.

The use of suitable host cells (such as yeast, fungal and plant host cells) can provide modifications after translation (eg, myristoylation, glycosylation, truncation, stoning and phosphorylation of tyrosine, serine or threonine) since it can it is necessary to provide optimal biological activity in the recombinant expression products of the present invention.

The host cell can be a strain with insufficient protease or no protease.

ORGANISM

The term "organism" in relation to the present invention includes any organism that may comprise a nucleotide sequence according to the present invention or a nucleotide sequence encoding a polypeptide having the specific properties defined herein and / or the products obtained from it. Of the same.

Suitable organisms may include a prokaryotic, a yeast, fungus or a plant.

The term "transgenic organism" in relation to the present invention includes any organism comprising a nucleotide sequence encoding a polypeptide having the specific properties defined herein and / or the products obtained therefrom and / or in the that an activator can allow the expression of the nucleotide sequence encoding a polypeptide that has the specific properties defined herein in the body. Preferably the nucleotide sequence is incorporated into the genome of the organism.

The term "transgenic organism" does not comprise the natural nucleotide coding sequences in its natural environment when they are under the control of its natural activator which is also in its natural environment.

Accordingly, the transgenic organism of the present invention includes an organism comprising some of, or combinations of, a nucleotide sequence encoding a polypeptide having the specific properties defined herein, mounts such as those defined herein, vectors such as those defined herein, plasmids such as those defined herein, cells such as those defined herein, or the products thereof. For example, the transgenic organism may also contain the nucleotide sequence encoding a polypeptide having the specific properties defined herein under the control of a heterologous activator.

TRANSFORMATION OF THE BELLING CELLS / ORGANISMS

As indicated at the beginning, the host organism can be a prokaryotic or eukaryotic organism. Examples of prokaryotic hosts include E. coli and Bacillus subtilis.

What is disclosed in the transformation of prokaryotic hosts is well documented in the art, for example see Sambrook et al., (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press). If a prokaryotic host is used, then it may be necessary for the nucleotide sequence to be properly modified before transformation, such as by intron removal.

In another embodiment the transgenic organism may be a yeast.

Filamentous fungal cells can be transformed using various procedures known in the art, such as procedures that involve protoplast formation and transformation of protoplasts followed by cell wall regeneration in a known manner. The use of Aspergillus as a host microorganism is described in EP 0 238 023.

Another host organism can be a plant. A study of the general techniques used to transform plants can be found in the articles by Potrykus (Annu. Rev. Plant. Physiol. Plant. Mol. Biol. [1991], 42: 205-225) and Christou (Agro-Food-Industry Hi-Tech, March / April 1994, 17-27). Additional lessons on plant transformation can be found in EP A-0449375.

General teachings on the transformation of fungi, yeasts and plants are presented in the following sections.

TRANSFORMED HONGO

A host organism can be a fungus, such as a filamentous fungus. Examples of such suitable hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillium, Mucor, Neurospora, Trichoderma and the like.

The teachings on filamentous fungus transformation are studied in US-A

5,741,665 which explains that conventional techniques for the transformation of filamentous fungi and the cultivation of fungi are well known in the art. An extensive study of the techniques applied to N. crassa is found, for example in Davis and de Serres, Methods Enzymol. (1971) 17A: 79-143.

More teachings on the transformation of filamentous fungi are studied in US-A

5,674,707.

In one aspect, the host organism may be of the genus Aspergillus, such as Aspergillus niger.

A transgenic Aspergillus according to the present invention can also be prepared, following, for example, the teachings of Turner, G. 1994 (Vectors for genetic manipulation. In: Martinelli SD, Kinghorn JR (editors) Aspergillus: 50 years on. Progress in industrial microbiology Vol. 29. Elsevier Amsterdam 1994. pp. 641-666).

Gene expression in filamentous fungi has been studied in Punt et al., (2002) Trends Biotechnol. May 2002. 20 (5): 200-6. Archer & Peberdy Crit. Rev. Biotechnol. (1997) 17 (4): 273-306.

TRANSFORMED YEAST

In another embodiment, the transgenic organism may be a yeast.

A study of the principles of heterologous gene expression in yeast is provided, for example, in Methods Mol. Biol. (1995), 49: 341-54, and Curr. Opin. Biotechnol (1997) Oct; 8 (5): 554-60.

In this regard, yeast (such as Saccharomyces cerevisiae or Pichia pastoris (see FEMS Microbiol. Rev. (2000 24 (1): 45-66))) can be used as a vehicle for heterologous gene expression.

A study of the principles of heterologous gene expression in Saccharomyces cerevisiae and the secretion of gene products is provided by E. Hinchcliffe, E. Kenny (1993), "Yeast as a vehicle for the expression of heterologous genes", Yeasts, Vol. 5. Anthony H. Rose and J. Stuart Harrison, editors, 2nd edition. Academic Press Ltd.).

For the transformation of yeasts, several transformation protocols have been developed. For example, a transgenic Saccharomyces according to the present invention can be prepared following the teachings of Hinnen et al., (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929); Beggs, J. D. (1978, Nature, London, 275, 104); and Ito, H. et al., (1983, J. Bacteriology 153, 163-168).

Transformed yeast cells can be selected using various selective markers, such as auxotrophic markers, markers with dominant antibiotic resistance.

A suitable yeast host organism may be selected from among yeast species such as, but not limited to, the yeast species selected from among Pichia spp., Hansenula spp., Kluyveromyces, Yarrowinia spp., Saccharomyces spp., Including S. cerevisiae , or Schizosaccharomyce spp., including Schizosaccharomyce pombe.

A strain of the methylotropic yeast species Pichia pastoris can be used as a host organism.

In one embodiment, the host organism may be a Hansenula species, such as H. polymorpha (as described in WO 01/39544).

TRANSFORMED VEGETABLE PLANTS / CELLS

A suitable host organism for the present invention can be a plant. A study of the general techniques can be found in the articles by Potrykus (Annu. Rev. Plant. Physiol. Plant. Mol. Biol. [1991], 42: 205-225) and Christou (Agro-Food-industry Hi-Tech, March / April 1994, 17-27), or in WO 01/16308. The transgenic plant can produce increased concentrations of phytosterol esters and phytostanol esters, for example.

Therefore, the present invention further relates to a process for the production of a transgenic plant with increased concentrations of phytosterol esters and phytostanol esters, which comprises the steps of transforming a plant cell with a lipid acyltransferase as defined in the present report (in particular with an expression vector or an assembly comprising a lipid acyltransferase as defined herein) and cultivate a plant from the transformed plant cell.

SECRETION

Often, it is desirable that the expression host secrete the enzyme in the culture medium from which the enzyme can be recovered more easily. According to the present invention, the main secretion sequence can be selected based on the desired expression host. Hybrid signal sequences may also be used in the context of the present invention.

Typical examples of major heterologous secretion sequences are those that originate from the fungal amyloglucosidase (AG) gene (glaA, both 18 and 24 amino acid versions, for example, from Aspergillus), the factor a gene (yeasts for example , Saccharomyces, Kluyveromyces and Hansenula) or the α-amylase (Bacillus) gende.

DETECTION

Several protocols for detecting and measuring the expression of the amino acid sequence are known in the art. Examples include the linked enzyme immunosorbent assay (ELISA), radioimmunoassay (RIA) and fluorescent activated cell classification (FACS).

A wide variety of markers and conjugation techniques are known to those skilled in the art and can be used in various nucleic acid and amino acid analyzes.

Numerous companies, such as Pharmacia Biotech (Piscataway, NJ), Promega, Madison, Wi) and US Biochemical Corp. (Cleveland, OH) provide commercial kits and protocols for these procedures.

Suitable indicator molecules or markers include radionuclides, enzymes, fluorescent agents, chemiluminescent or chromogens, as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents that disclose the use of such markers include documents US-A-3,817,837, US-A-3,850,752, US-A-3,939,350, US-A-3,996,345, US-A- 4,227,437, US-A-4,275,149 and US-A-4,366,241.

In addition, recombinant immunoglobulins can be produced as shown in US-A.

4,816,567.

FUSION PROTEINS

A polypeptide with the specific properties defined herein can be produced as a fusion protein, for example to aid in the extraction and purification thereof. Examples of fusion protein companions include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and / or transcription activation domains) and β-galactosidase. It may also be convenient to include a proteolytic cleavage sequence between the fusion protein companion and the protein sequence of interest that allows the elimination of the fusion protein sequences. Preferably, the fusion protein will not impede the activity of the protein sequence.

Gene fusion expression systems in E. coli have been studied in Curr. Opin. Biotechnol (1995), 6 (5): 501-6.

In another embodiment of the invention, the amino acid sequence of a polypeptide having the specific properties defined herein may be linked to a heterologous sequence to encode a fusion protein. For example, for screening peptide banks by agents capable of affecting the activity of the substance, it may be useful to encode a hybrid substance that expresses a heterologous epithet that is recognized by a commercially available antibody.

The invention is described below, by way of example only, with reference to the following figures and Examples.

Figure 1 shows a consensus sequence pfam00657 of version 6 of the database (SEQ. ID. No. 1);

Figure 2 shows an amino acid sequence (SEQ ID No. 2) extracted from the organism Aeromonas hydrophila (P10480; GI: 121051);

Figure 3 shows an amino acid sequence (SEQ. ID. No. 3) extracted from the organism Aeromonas salmonicida (AAG098404; GI: 9964017);

Figure 4 shows a nucleotide sequence (SEQ ID No. 4) extracted from the organism Streptomyces coelicolor A3 (2) (registration number NP_631558 in the Genbank);

Figure 5 shows a nucleotide sequence (SEQ ID No. 5) extracted from the organism Streptomyces coelicolor A3 (2) (registration number CAC42140 in the Genbank);

Figure 6 shows a nucleotide sequence (SEQ ID No. 4) extracted from the organism Saccharomyces cerevisiae (registration number P41734 in the Genbank);

Figure 7 shows an alignment of the selected sequences for the consensus sequence pfam00657;

Figure 8 presents a pairwise alignment of the SEC. ID. No. 3 with SEC. ID. nº 2 that presents 93% identity in the amino acid sequence. The signal sequence is underlined. + indicates the differences. The GDSX motif containing serine 16 of the active zone and aspartic acid 116 and histidine 291 of the active zones are underlined (see the shaded areas). The figures after the amino acid is less the signal sequence;

Figure 9 shows a nucleotide sequence (SEQ ID No. 7) encoding a lipid acyltransferase according to the present invention extracted from the organism Aeromonas hydrophila;

Figure 10 shows a nucleotide sequence (SEQ ID No. 8) encoding a lipid acyltransferase according to the present invention extracted from the organism Aeromonas salmonicida;

Figure 11 shows a nucleotide sequence (SEQ ID No. 9) encoding a lipid acyltransferase according to the present invention extracted from the organism Streptomyces coelicolor A3 (2) (registration number NC_003888.1: 8327480… 8328367) in the Genbank;

Figure 12 shows a nucleotide sequence (SEQ ID No. 10) encoding a lipid acyltransferase according to the present invention extracted from the organism Streptomyces coelicolor A3 (2) (registration number AL939131.1: 265480… 266367) in the Genbank;

Figure 13 shows a nucleotide sequence (SEQ ID No. 11) encoding a lipid acyltransferase according to the present invention extracted from the organism Saccharomyces cerevisiae (registration number Z75034 in the Genbank);

Figure 14 shows an amino acid sequence (SEQ. ID. No. 12) extracted from the Ralstonia organism (registration number AL646052 in the Genbank);

Figure 15 shows an amino acid sequence (SEQ ID No. 13) encoding an acyl transferase lipid according to the present invention extracted from the Ralstonia organism;

Figure 16 presents the SEC. ID. No. 20. Registration code of the conserved hypothetical protein, Scoe1 NCBI protein registration code CAB39707.1 GI: 4539178 [Streptomyces coelicolor A3 (2)];

Figure 17 presents a nucleotide sequence presented as SEC. ID. No. 21 encoding the conserved hypothetical protein, NCBI protein registration code CAB39707.1 GI: 4539178 [Streptomyces coelicolor A3 (2)];

Figure 18 presents an amino acid sequence presented as SEC. ID. No. 22 of the hypothetical conserved protein, registration code CAC01477.1 GI: 9716139 of the Scoe2 NCBI protein. [Streptomyces

coelicolor A3 (2)];

Figure 19 presents a nucleotide sequence presented as SEC. ID. No. 23 encoding the hypothetical conserved protein, registration code CAC01477.1 GI: 9716139 of the Scoe2 NCBI protein. [Streptomyces coelicolor A3 (2)];

Figure 20 shows an amino acid sequence (SEQ ID No. 24) of the supposed segregated protein, registration code CAB88833.1 GI: 7635996 of the Scoe3 NCBI protein [Streptomyces coelicolor A3 (2)];

Figure 21 presents a nucleotide sequence presented as SEC. ID. No. 25 of the alleged segregated protein, registration code CAB88833.1 GI: 7635996 of the Scoe3 NCBI protein [Streptomyces coelicolor A3 (2)];

Figure 22 shows an amino acid sequence (SEQ. ID. No. 26) of the supposed segregated protein registration code CAB89450.1 GI: 7672261 of the Scoe4 NCBI protein. [Streptomyces coelicolor A3 (2)];

Figure 23 shows a nucleotide sequence presented as SEC. ID. No. 27 encoding the supposed segregated protein registration code CAB89450.1 GI: 7672261 of the Scoe4 NCBI protein. [Streptomyces coelicolor A3 (2)];

Figure 24 shows an amino acid sequence (SEQ ID No. 28) of the supposed lipoprotein registration code CAB62724.1 GI: 6562793 of the Scoe5 NCBI protein [Streptomyces coelicolor A3 (2)];

Figure 25 presents a nucleotide sequence presented as SEC. ID. No. 29 encoding the alleged lipoprotein registration code CAB62724.1 GI: 6562793 of the Scoe5 NCBI protein. [Streptomyces coelicolor A3 (2)];

Figure 26 shows an amino acid sequence (SEQ ID No. 30) of GDSL-lipase registration code AAK84028.1 GI: 15082088 of the Srim1 NCBI protein [Streptomyces rimosus];

Figure 27 presents a nucleotide sequence presented as SEC. ID. No. 31 encoding the GDSLlipase registration code AAK84028.1 GI: 15082088 of the Srim1 NCBI protein [Streptomyces rimosus];

Figure 28 shows an amino acid sequence (SEQ ID No. 32) of a lipid acyltransferase from Aeromonas hydrophila (ATCC No. 7965);

Figure 29 presents a nucleotide sequence (SEQ ID No. 33) encoding a lipid acyltransferase from Aeromonas hydrophila (ATCC No. 7965);

Figure 30 shows an amino acid sequence (SEQ ID No. 34) of a lipid acyltransferase from Aeromonas salmonicida subsp. Salmonicide (ATCC No. 14174);

Figure 31 shows an amino acid sequence (SEQ ID No. 35) of a lipid acyltransferase from Aeromonas salmonicida subsp. Salmonicide (ATCC No. 14174);

Figure 32 demonstrates that Aeromonas gene homologs can be identified using the basic local alignment tool search service in the National Center for Biotechnology Information, NIH, MD, USA and the complete genome databases. The GDSX motif was used in the database search and numerous sequences and genes that potentially encode enzymes with lipolytic activity were identified. Streptomyces, Xanthomonas and Ralstonia genus genes were identified. As an example below, Ralstonia solanacearum aligned to the Aeromonas salmonicida (satA) gene. The alignment in pairs presented 23% identity. The active zone serine is present in the amino terminal and the sterine and aspartic acid of the catalytic moieties can be identified.

Figure 33 shows the consensus sequence pfam00657.11 [family 00657, version 11 of the database] (hereinafter referred to as the Pfam consensus) and the alignment of several sequences to the Pfam consensus sequence. The arrows indicate the remains of the active site, the underlined boxes indicate three of the homology boxes indicated by [Upton C and Buckley J.T (1995), Trends Biochem. Sci., 20; 179-179]. Capital letters in the Pfam consensus indicate remains preserved in many family members. The symbol - indicates a position in which the Markov model hidden from the Pfam consensus that can be expected to join a rest but does not, so that it is inserted into a hole. The symbol indicates a remainder without a corresponding remainder in the Pfam consensus. The sequences are the amino acid sequences listed in Figures 16, 18, 20, 22, 24, 26, 28 and 30.

Figure 34 shows the consensus sequence pfam00657.11 [family 00657, version 11 of the database] (hereinafter referred to as the Pfam consensus) and the alignment of several sequences to the Pfam consensus sequence. The arrows indicate the remains of the active site, the underlined boxes indicate three of the homology boxes indicated by [Upton C and Buckley J.T (1995), Trends Biochem. Sci., 20; 179-179]. Capital letters in the Pfam consensus indicate remains preserved in many family members. The symbol - indicates a position in which the Markov model hidden from the Pfam consensus that can be expected to join a rest but does not, so that it is inserted into a hole. The symbol indicates a remainder without a corresponding remainder in the Pfam consensus. The sequences are the amino acid sequences listed in Figures 2, 16, 18, 20, 26, 28 and

30. It was discovered that all these proteins were active against lipid substrates.

Figure 35 shows a pet12-AsalGCAT = pSM expression vector containing the His-activated Salmonic Aeromonas lipid acyltransferase lipid gene with C-terminal;

Figure 36 presents the results of experimentation with cell extracts in an nEFA analysis kit, which represents the activity of a recombinant lipid acyltransferase from A. salmonicide, to lecithin. The wells from left to right indicate: a positive control, a negative control (ie empty plasmid extracts) and the samples collected after 0, 1, 2 and 3 hours of culture after induction of IPTG.

Figure 37 shows the optimization of the growth of BL21 (DE3) pLysS that houses the expression vector pet12-AsalGCAT = pSM that shows the culture at 30 ° C, resulting in the production of the enzyme with great activity towards lecithin. Phospholipase activity in cell extracts was determined using the NEFA assay kit. Few from left to right: positive reference; negative reference; 20 ° C; 30 ° C;

Figure 38 shows crude cell extracts of BL21 (DE3) pLysS expressing the active lipid acyltransferase incubated with the lecithin substrate and the reaction mixture was analyzed using thin layer chromatography showing the presence of degradation products. Bands: 1. without enzyme; 2. + A.sal-10 μl 37 ° C; 3. + A.sal-20 μl 37 ° C; 4. + A.sal-10 μl 24ºC; 5. + A.sal-20 μl 24ºC;

Figure 39 shows the partial purification of Aeromonas salmonicide acyltransferase showing phospholipase activity associated with the His tag purified protein. SE = ultrasound extracts, His = purified with Qiagen Ni-NTA rotation kit;

Figure 40 shows the expression vector pet12-A.h.GCAT = pSMa containing the His-activated Aeromonas hydrophila glycerolipid (GCAT) gene in terminal C was used to transform E. coli strain BL21 (DE3) pLysS;

Figure 41 shows the activity of the crude extracts (5 and 10 μl) containing the recombinant Aeromonas hydrophila GCAT enzyme was determined for lecithin using the non-esterified fatty acid kit (NEFA) (Roche, Switzerland) demonstrated the presence of the active enzyme with the phospholipid lecithin;

Figure 42 shows the optimization of the growth of BL21 (DE3) pLysS that houses the expression vector pet12-AsalGCAT = pSM that shows the culture at 30 ° C, resulting in the production of the enzyme with great activity towards lecithin. Phospholipase activity in cell extracts was determined using the NEFA assay kit.

Figure 43 shows the partial purification of the acyltransferases of Aeromonas hydrophila and Aeromonas salmonicida that exhibit phospholipase activity associated with the His tag purified protein. SE = ultrasound extracts, His = purified with Qiagen Ni-NTA rotation kit;

Figure 44 shows the expression of the Aeromonas genes in Bacillus subtilis 163 which shows the production of the secreted enzyme with activity for both lecithin and DGDG. pUB-AH = assembly containing the A. hydrophila gene and pUB-AS, assembly with the A. salmonicide gene. The culture filtrate was incubated with the substrates for 60 minutes.

Figure 45 and Figure 46 present a TLC plate in the developing solvent IV (chloroform: methanol: water (65: 25: 4)); Band 1: 40 mg sitosterol 30 min .; Band 2: transferase + 40 mg sitosterol 30 min .; Band 3: transferase + 80 mg sitosterol 30 min .; Band 4: transferase + 40 mg sitosterol 120 minutes; Band 5: transferase + 80 mg sitosterol 120 minutes; Band 6: transferase + 40 mg sitosterol 300 minutes; Band 7: transferase + 40 mg sitosterol 300 minutes; Band 8: cholesterol; Band 9: sitosterol;

Figure 47 represents the reaction between phosphatidylcholine and cholesterol that is catalyzed by a lipid acyltransferase;

Figure 48 presents a TLC analysis of the lipids extracted from the yolk treated or untreated with the enzyme, 6) 0.31 PLU / g of transferase No. 179, 7) 1.25 PLU / g of transferase No. 178 -9.8) 23.25 PLU / g phospholipase # 3108.9) reference.

Figure 49 shows samples of mayonnaise for analysis produced by treated or untreated egg yolk: 5) 0.31 PLU / g of Transferase No. 179 ,. 6) 1.25 PLU / g of transferase No. 178-9, 7) 23.3 PLU / g of phospholipase No. 3108, 8) reference, water.

Figure 50 shows a TLC (in solvent I) of the egg yolk lipid treated with a lipid acyltransferase from A. hydrophila;

Figure 51 shows a TLC (in solvent IV) of the egg yolk lipid treated with a lipid acyltransferase from A. hydrophila;

Figure 52 presents a TLC analysis of transferase treated with egg yolk lipid over time;

Figure 53 shows the amount of cholesterol ester fatty acid produced as a function of time when a lipid acyltransferase (transf. No. 178-9) is used compared to when a reference lipolytic enzyme, Thermomyces lanuginosus is used;

Figure 54 shows the relative activity of the transferase as% of transferase and the hydrolytic activity in enzymatic reactions in egg yolk with high water content, No. 1991 (phospholipase A2) and No. 2427 (phospholipase A1), are phospholipases of reference, No. 178 is a lipid acyltransferase;

Figure 55 shows the effect of water content in the transferase activity test; of transferase No. 178 in transferase reactions in egg yolk with high water content;

Figure 56 shows the transferase activity for a lipid acyltransferase (# 178) as a function of the reaction time in the egg yolk transferase reactions with high water content;

Figure 57 and Figure 58 present the graphs that represent fatty acid and cholesterol ester as a function of time. The graphs represent the results obtained by GLC analysis in the assay for the measurement of acyltransferase activity using lecithin and cholesterol in buffer as a substrate;

Figure 59 shows a TLC in solvent I. Egg yolk treated with lipid acyltransferase No. 138 from Aeromonas salmonidica (Band No. 1 and No. 2) or with a phospholipase No. 2938 (LIPOPAN® F) (Band No. 3) or yolk untreated egg (Band # 4);

Figure 60 shows a TLC in solvent IV. Egg yolk treated with lipid acyltransferase No. 138 (band # 1 and # 2) or with phospholipase # 2938 (band # 3) or untreated egg yolk (band # 4);

Figure 61 shows an egg yolk treated with lipid acyltransferase No. 138 (samples No. 1 and No. 2) and with phospholipase No. 2938 (sample No. 3) or untreated egg yolk (sample No. 4);

Figure 62 shows a food emulsion after 2 hours at 100 ° C. 0) untreated egg yolk. 1) egg yolk treated with lipid acyltransferase No. 138 for 210 minutes. 3) egg yolk treated with phospholipase reference 2938 for 210 minutes;

Figure 63 shows TLC plates showing the identification of transferase activity in vegetable sterol and glycerol. PC = phosphatidylcholine; LPC = lysophosphatidylcholine; PE = phosphatidylethanolamine; monogl = monoglyceride;

Figure 64 shows a TLC plate in solvent I, samples 1 to 6 after 24 hours and samples 1 to 4 after 4 hours of reaction time. The TLC analysis confirms the formation of the sterol ester in samples 1, 2, 5 and 6;

Figure 65 shows a TLC plate in solvent I when the transferase activity of an immobilized acyltransferase from Aeromonas salmonicide was determined in an oil mixture, with the samples taken at 0.5, 1, 3, 6 and 24 h;

Figures 66 and 67 show the TLC plates in solvents I and IV. Band 1 = lecithin; Band 2 = reference-10 min .; Band 3 = 0.75 PLU, 10 min .; Band 4 = 0.75 PLU, 60 min. ; Band 5 = 0.75 PLU, 220 min .; Band 6 = reference, 20 h; Band 7 = 0.75 PLU, 20 h; and Band 8 = cholesterol ester;

Figures 68 and 69 present TLC plates in solvent IV. Band 1 = lecithin; Band 2 = reference 10 min .; Band 3 = 1 PLU, 10 min .; Band 4 = 1 PLU, 60 min. ; Band 5 = 1 PLU, 180 min .; Band 6 = 1 PLU, 220 min .; Band 7 = 1 PLU, 1,200 min .; Band 8 = reference, 1200 min; Band 9 = glucose ester; Band 10 = cholesterol; and Band 11 = glucose;

Figure 70 shows the reaction between DGDG and glucose when catalyzed by a lipid acyltransferase;

Figure 71 shows an amino acid sequence (SEQ ID No. 36) of the fusion assembly used for the mutagenesis of the Aeromonas hydrophila lipid acyltransferase gene in Example 17. The underlined amino acids are a xylanase signal peptide;

Figure 72 shows a nucleotide sequence (SEQ ID No. 45) encoding an Aeromonas hydrophila enzyme that includes a xylanase signal peptide; Y

Figure 73 shows a TLC plate that clearly shows the formation of the vegetable sterol ester and monoglyceride. Band 1 is after a reaction time of 1 hour, Band 2 is after a reaction time of 4 hours, Band 3 is after a reaction time of 24 hours and Band 4 is a plant sterol.

EXAMPLES

Except where indicated, the TLC analysis was performed as described in Example 6 and the GLC analysis was performed as described in Example 11.

EXAMPLE 1: Cloning, sequencing and heterologous expression of a transferase from Aeromonas salmonicida subsp. Salmonicide

Strains used

Aeromonas salmonicida subsp. Salmonicide (ATCC 14174) was purchased from ATCC and grown overnight at 30 ° C in the middle of Luria-Bertani (LB). The cells were centrifuged and the genomic DNA was isolated using the procedures for the isolation of genomic DNA from Qiagen Ltd .; Genomic DNA buffer kit (cat. 19060), protease K (cat. 19131) and RNAse A (cat. 19101) were all purchased from Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

Bacterial strain BL21 of the host (DE3) pLysS (Novagen) was used for the production of recombinant Aeromonas enzymes. Competent cells of BL21 (DE3) pLysS were used as host for transformation with the expression vector pet12-AsalGCAT = pSM. Transforms containing the appropriate plasmid were grown at 37 ° C in LB medium with agar-agar containing 100 µg ampicillin / ml.

Construction of the expression vector pet12-AsalGCAT = pSM

For all DNA extensions of the transferase genes from Aeromonas, genomic DNA (0.2-1 μl) was used as a template and pfu DNA polymerase (2.5 units) was used with 10 μl of 10 x pfu buffer, 1 μl of each primer (50 pmoles / μl), 200 μM dNTP in a total reaction volume of 100 μl. The PCR reactions were carried out in a programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, 60 ° C for 1 minute and 68 ° C for 2 minutes. An additional extension of 5 minutes at 72 ° C was applied.

PCR amplification of the transferase gene from A. salmonicide was carried out in 2 separate PCR reactions. The PCR reaction 1 was carried out using primer pairs, such as 1USNEW (5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG3 '[SEQ ID No. 36]) and asls950new (5' GTG ATG GTG GGC GAG GAA CTC GTA CTG3 '[SEC ID No. 37]). A second PCR reaction was carried out to incorporate a histidine tag into the C terminal using the PCR product from the first reaction and the primers: as1USNEW (5'AGCATATGAAAA AATGGTTTGT TTGTTTATTG GGG3 '[SEQ ID No. 38 ]) and AHLS1001 (5'TTGGATCC GAATTCAT CAATG GTG ATG GTG ATG GTG GGC3 '[SEQ ID No. 39]). The PCR product from the second reaction was purified and digested with restriction enzymes Nde1 and BamHI. 2 μg of the DNA vector pET12a was also digested with restriction enzymes Nde1 and BamHI and treated with phosphatase. The pet12a treated with the restriction enzyme and the PCR product of reaction 2 were purified and ligated using a rapid ligation kit (Roche, Switzerland). Ligation mixture was used to transform E. coli TOP10 cells. The transformants were plated on LB agar-agar medium containing 100 μg / ml ampicillin.

T7 activator primer (5'TAATACGACTCACTATAG3 '[SEQ. ID. No. 40]) and T7 terminator primer (5'CTAGTTATTGCTCAGCGG3' [SEQ. ID. No. 41]) were used to verify the sequences and orientation of the Transferase genes cloned into the pET12a vector. The DNA sequencing kit of the terminator cycle was performed using ABI Prism® BigDyeTM with 500 ng of plasmid DNA as a template and 3.2 pmoles of T7 activator and terminator primers.

The assembly shown in Figure 35 was used to transform competent strain BL21 (DE3) pLysS (Novagen) from the bacterial host and ampicillin resistant transformants were selected and used for expression analysis.

Expression of recombinant Aeromonas salmonicide lipid acyltransferase

The quantification of the enzymatic activity towards lecithin was determined in cell extracts using the non-esterified fatty acid kit (NEFA) (Roche, Switzerland).

In Figure 36, BL21 (DE3) pLysS housing the pet12-AsalGCAT = pSM expression vector was cultured in LB medium + 100 μg / ml ampicillin and incubated with shaking at 37 ° C until OD 600 is reached = 0.6 to 1.0. Cultures were then induced using IPTG (0.4 mM) and incubation was continued for the next 3 hours. Samples were taken at 0, 1, 2 and 3 hours after induction with IPTG. Enzymatic activity was determined using the NEFA kit and lecithin as a substrate.

Growth optimization for the production of more active enzymes

BL21 (DE3) pLysS housing the pet12-AsalGCAT = pSM expression vector was grown in LB +100 µg / ml ampicillin medium and incubated with stirring at different culture temperatures (37 ° C, 30 ° C and 20 ° C). The optimal condition for the production of the active lipid acyltransferase enzyme was when the cultures are grown at 30 ° C as shown in Figure 37.

Partial purification of recombinant Aeromonas salmonicide transferase

Strain BL21 (DE3) pLysS which houses the expression vector pet12-AsalGCAT = pSM was cultured at 37 ° C and crude cell extracts were prepared by ultrasonic treatment. The recombinant enzyme was further purified from the crude cell extracts treated with ultrasound using the Qiagen Ni-NTA rotation kit. Phospholipase activity was determined using the NEFA kit and lecithin as a substrate. The crude cell extracts of BL21 (DE3) pLysS expressing the active transferase incubated with the lecithin substrate and the reaction mixture was analyzed using thin layer chromatography showing the presence of degradation products (see Figure 38).

Partial purification of the recombinant transferase of Aeromonas salmonicidae. Strain BL21 (DE3) pLysS which houses the expression vector pet12-AsalGCAT = pSM was cultured at 37 ° C and crude cell extracts were prepared by ultrasonic treatment. The recombinant enzyme was further purified from the crude cell extracts treated with ultrasound using the Qiagen Ni-NTA rotation kit. Phospholipase activity was determined using the NEFA kit and lecithin as a substrate (see Figure 39).

EXAMPLE 2: Cloning and expression of Aeromonas hydrophila transferase in E. coli

Aeromonas hydrophila (ATCC No. 7965) was purchased from the ATCC and grown overnight at 30 ° C in the middle of Luria-Bertani (LB). The cells were centrifuged and the genomic DNA was isolated using the procedures for the isolation of genomic DNA from Qiagen Ltd .; Genomic DNA buffer kit (cat. 19060), protease K (cat. 19131) and RNAse A (cat. 19101) were all purchased from Qiagen Ltd. (Boundary court Gatwick Court, West Sussex, RH10 2AX).

Bacterial strain BL21 of the host (DE3) pLysS (Novagen) was used for the production of recombinant Aeromonas enzymes. Competent BL21 (DE3) pLysS cells were used as hosts for transformation with the pet12a-A.h.GCAT = pSMa expression vector. Transforms containing the appropriate plasmid were grown at 37 ° C in LB medium with agar-agar containing 100 µg ampicillin / ml.

Construction of the expression vector pet12a-AsalGCAT = pSMa:

For all DNA extensions of the transferase genes from Aeromonas, genomic DNA (0.2-1 μl) was used as a template and pfu DNA polymerase (2.5 units) was used with 10 μl of 10 x pfu buffer, 1 μl of each primer (50 pmoles / μl), 200 μM dNTP in a total reaction volume of 100 μl. The PCR reactions were carried out in a programmable thermal cycler using the following conditions: 95 ° C for 30 seconds, 30 cycles at 95 ° C for 30 seconds, 60 ° C for 1 minute and 68 ° C for 2 minutes. An additional extension of 5 minutes at 72 ° C was applied.

The PCR amplification of the transferase gene from A. hydrophila (ATCC No. 7965) was carried out in 2 separate PCR reactions.

The

reaction one from the PCR be performed using peers from primers, AHUS1

(5’GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ’,

SEC. ID. nº 42) Y ahls950

(5’ATGGTGATGGTGGGCGAGGAACTCGTACTG3 ’, SEC. ID. No. 43).

A second PCR reaction was performed to incorporate the histidine tag into the C terminal using the

PCR product of the first reaction and primer pairs:

AHUS1 (5’GTCATATGAAAAAATGGTTTGTGTGTTTATTGGGATTGGTC3 ’SEQ ID 44,) and AHLS1001 (5’TTGGATCCGAATTCATCAATGGTGATGGTGATGGTGGGC3’ SEQ ID 45).

The PCR product from the second reaction was purified and digested with restriction enzymes Nde1 and BamHI. 2 μg of the DNA vector pET12a was also digested with restriction enzymes Nde1 and BamHI and treated with phosphatase. Pet 12a treated with the restriction enzyme and the PCR product of reaction 2 were purified and ligated using a rapid ligation kit (Roche, Switzerland). Ligation mixture was used to transform E. coli TOP10 cells. The transformants were plated on LB agar medium containing 100 μg / ml ampicillin.

The T7 activator primer (5'TAATACGACTCACTATAG3 'and the T7 terminator primer (5'CTAGTTATTGCTCAGCGG3' were used to verify the sequences and orientation of the GCAT cloned genes in the pET12a vector. DNA sequencing of the terminator cycle was performed. using the ABI Prism® BigDyeTM terminator cycle sequencing kit with 500 ng of plasmid DNA as a template and 3.2 pmoles of T7 activator and terminator primers.

The assembly shown in Figure 40 was used to transform competent strain BL21 (DE3) pLysS (Novagen) from the bacterial host and ampicillin resistant transformants were selected and used for expression analysis.

Aeromonas hydrophila transferase expression in BL21 (DE3) pLysS

The E. coli strain BL21 (DE3) pLysS that houses the expression vector pet12a-AhGCAT = pSMa was grown in LB medium + 100 μg / ml ampicillin and incubated with shaking at 37 ° C until an OD 600 is reached = 0.6 to 1.0. Cultures were then induced using IPTG (0.4 mM) and incubation was continued for the next 3 hours. Samples were taken at 0, 1, 2 and 3 hours after induction with IPTG. Enzymatic activity was determined using the NEFA kit and lecithin as a substrate (Figure 41).

Growth optimization for the production of more active enzymes

BL21 (DE3) pLysS housing the pet12a-A.h.GCAT = pSMa expression vector was grown in LB +100 µg / ml ampicillin medium and incubated with stirring at different culture temperatures (37 ° C, 30 ° C and 20 ° C). The optimal condition for the production of the active GCAT enzyme was when the cultures are grown at 30 ° C as shown in Figure 42.

Partial purification of recombinant A. hydrophila transferase (GCAT)

The BL21 (DE3) pLysS strain harboring the pet12a-A.h.GCAT = pSMa expression vector was cultured at 37 ° C and crude cell extracts were prepared by ultrasonic treatment. The recombinant enzyme was further purified from the crude cell extracts treated with ultrasound using the Qiagen Ni-NTA rotation kit. Phospholipase activity was determined using the NEFA kit and lecithin as a substrate. (figure 43).

EXAMPLE 3: Aeromonas transferase expression in Bacillus subtilis 163

Plasmid Construction

Two different Bacillus subtilis expression vectors (pUB 110 and pBE5) were used for heterologous expression of Aeromonas genes in Bacillus subtilis. The pUB110 vector contains the alpha-amylase activator while the pBE vector has the P32 activator as a regulatory zone for the expression of Aeromonas fused genes. In pUB110 the first amino acid of the Aeromonas mature GCAT genes were fused in the frame with the last amino acid of the Bacillus subtilis xylanase signal peptide sequence using the Nhe1 restriction sequence, creating 2 additional amino acids in front of the proteins mature PBE5 contains the fusion of the cgtase signal sequence in the Ncol sequence for the secretion of recombinant proteins in the culture filtrate.

PCR reactions were performed to obtain the fusion of Aeromonas genes in the framework for the signal sequences of the pUB 110 and pBE5 vectors. PCRs were performed using the following primer pairs for the A. hydrophila gene:

PCR reaction 1: usAHncol (5’ATGCCATGGCCGACAGCCGTCCCGCC3 ’, SEQ ID No. 46) and lsAH (5’TTGGATCCGAATTCATCAATGGTGATG3’, SEQ ID No. 47)

PCR reaction 2: US-AhnheI (5’TTGCTAGCGCCGACAGCCGTCCCGCC3 ’, SEQ ID No. 48.) and lsAH (5’TTGGATCCGAATTCATCAATGGTGATG3, SEQ ID No. 49)

PRCs were performed using the following primer pairs for the A. salmonicida gene:

PCR reaction 3: US-Asncol (5’TTGCCATGGCCGACACTCGCCCCGGC3 ’, SEQ ID No. 50) and lsAH (5’TTGGATCCGAATTCATCAATGGTGATG3’, SEQ ID No. 51)

PCR reaction 4: US-ASnhe1 (5’TTGCTAGCGCCGACACTCGCCCCGCC3 ’, SEQ ID No. 52) and 1Sah (5’TTGGATCCGAATTCATCAATGGTGATG3’, SEQ ID No. 53)

All PCR products were cloned into PCR truncation II (TOPO vector) and sequenced with complementary and transcribed sequencing primers.

Clones from reactions 1 and 3 of the PCR were cut with Nco1 and Bam HI and used as inserts for ligation of the pBE5 vector cut with Nco1 / BamH1 / phosphatase. Clones from reactions 2 and 4 of the PCR were cut with Nhe1 and Bam H1 and used as inserts for ligation of the pUB vector that was cut with Nhe1 / BamH1 / phosphatase.

Expression of Aeromonas transferase genes in Bacillus subtilis and characterization of enzymatic activity

The acyltrasnfersas of the two Aeromonas species have been expressed successfully in E. coli (results above). Bacillus pUB110 and pBE5 fusion gene assemblies were used to transform Bacillus subtilis and those transformed by plating with kanamycin were selected. Kanamycin resistant transformants isolated and cultured in 2 x YT are capable of heterologous expression of Aeromonas genes in Bacillus. The culture filtrates have digalactosyldiacylglycerol (DGDG) galactolipase activity, in addition to having both acyltransferase and phospholipase activities. The activity towards digalactosyldiacylglycerol (DGDG) was measured after 60 minutes of incubation of the culture supernatant with the substrate. DGDG from wheat flour (can be purchased in Sigma) as well as the activity towards lecithin as shown in Figure 44. Bacillus produced the enzyme after overnight (20 to 24 hours) at 48 hours of cultivation in the culture medium as a segregated protein. In some cases, the expression of Aeromonas genes has been shown to interfere with cell viability and growth in Bacillus and E. coli, it is therefore necessary to carefully select expression strains and optimize culture conditions to ensure expression . For example, several Bacillus host strains (B.s 163, DB104 and OS 21) were transformed with the expression vectors for growth comparison. B.s163 can be transformed with 2 Aeromonas genes and can express the active protein. DB104 can be transformed with all mounts but can only express A. salmonicida transferase.

EXAMPLE 4: Fermentation and purification of Aeromonas lipid acyltransferases produced in E. coli

E. coli fermentations:

Microorganisms

Two strains of Escherichia coli were used in this study, one containing one Aeromonas hydrophila lipid acyltransferase (Example 2) and two strains containing Aeromonas salmonicide lipid acyltransferases (Example 1).

The E. coli strain that contained the A. hydrophila gene was named DIDK0124 and the E. coli strain that contained the A. salmonicide gene was named DIDK0125. The fermentation with DIDK0124 was called HYDRO0303 and the fermentation with DIDK0125 was called SAL0302. The purified HYDRO025 protein was called REF138. The purified HYDRO0303 protein was called REF135.

Culture media and culture conditions

LB with agar-agar

The LB plates with agar-agar used to maintain the strains contained: 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 15 g / l of agar-agar, 100 mg / l of ampicillin and 35 mg / l of chloramphenicol. The agar-agar plates were incubated at 30 ° C.

Stirring flask with LB

The LB medium (50 ml per shaking flask) used for the production of inoculum material for bioreactor cultures contained: 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 100 mg / l ampicillin and 35 mg / l chloramphenicol. Stirring flasks were inoculated on the plates with LB agar-agar and incubated at 30 ° C and 200 rpm.

Bioreactor culture

Cultures were carried out in 6 l bioreactors built in plants filled with 4 l of medium containing: 10 g / l of tryptone, 5 g / l of yeast extract, 5 g / l of NaCl, 8 g / l of KH2PO4, 0.9 g / l MgSO4 · 7H2O, 40 g / l glucose monohydrate, 0.4 ml / ADD APT® Foamstop Sin 260 (ADD APT Chemicals AG, Helmond, The Netherlands), 10 mg / l of (NH4) 2Fe (SO4) 2 · 6H2O, 0.7 mg / l of CuSO4 · 5H2O, 3 mg / l of ZnSO4 · 7H2O, 3 mg / l of MnSO4 · H2O, 10 mg / l of EDTA, 0.1 mg / l NiSO4 · 6H2O, 0.1 mg / l CoCl2, 0.1 mg / l H3BO4, 0.1 mg / l Kl, 0.1 mg / l Na2MoO4 · 2H2O, 1 g / l ampicillin and 35 mg / l chloramphenicol.

The bioreactors were inoculated with an amount of LB culture that guarantees the end of the culture after approximately 20 hours of culture (calculated from the maximum specific growth rate of 0.6 h-1, the

D.O.600 of the flask in agitation with LB and the final D.O.600 in the bioreactor of approximately 20).

SAL0302 was inoculated with 10 ml of LB culture and HYDRO0303 was inoculated with 4 ml of LB culture.

The bioreactors were operated under the following conditions: temperature 30 ° C, agitation between 800 and 1000 rpm (depending on the experiment), 5 l / min aeration, pH 6.9, control pH 8.75% (w / v), NH3 -water and 2M H2SO4. Induction was achieved by adding isopropyl β-D-thiogalactoside at a final concentration of 0.6 mM when 0.4 moles (HYDRO0303) and 0.7 moles of CO2 respectively were produced.

Harvest

The following procedure was used for the collection and homogenization of biomass:

1) The fermentation fermentation broth was centrifuged at 5,000 x g and 4 ° C for 10 minutes, and the supernatant was discharged. The biomass was stored at -20 until its use. The biomass was thawed and resuspended in 500 ml of 20 mM NaH2PO4, pH 7.4, 500 mM NaCl, 10 mM imidazole and complete protease inhibitor (without EDTA) (Roche, Germany).

2) The suspended biomass was homogenized at 2 kbar and 4 ° C in a cell destroyer from Constant Systems Ltd. (Warwick, U.K.)

3) Cell debris was separated by centrifugation at 10,000 x g and 4 ° C for 30 minutes followed by supernatant collection.

4) The supernatant was further clarified by centrifugation at 13,700 x g and 4 ° C for 60 minutes followed by collection of the supernatant.

5) The supernatant was filtered through 0.2 μm Vacu Cap filters (Pall Life Sciences, U.K.) and the filtrate was collected for immediate chromatographic purification.

Chromatographic purification of transferases

A column (2.5 x 10 cm) was filled with 50 ml of Sepharose Chelating gel ff. and charged with nickel sulfate (according to the procedure described by the manufacturer Amersham Biosciences). The column was equilibrated with 200 ml of 20 mM NaH2PO4, pH 7.4, 500 mM NaCl, 10 mM imidazole. 400 ml of crude product was applied to the column at a flow rate of 5 ml / min. The column was then washed with 20 mM NaH2PO4, pH 7.4, 500 mM NaCl, 10 mM imidazole until UV280 reached the reference line. The GCAT was then eluted with 40 ml of 20 mM NaH2PO4, pH 7.4, 500 mM NaCl and 500 mM imidazole.

EXAMPLE 5: Fermentation and purification of Aeromonas lipid acyltransferases produced in Bacillus subtilis

Fermentations

BAC0318-19, BAC0323-24

Microorganisms

The microorganisms used in this study originate in the transformation of a strain of the host Bacillus subtilis, No. 163 with a plasmid containing the gene encoding the Aeromonas transferase salomonicide inserted into the vector pUB110OIS. The expression of the gene is controlled by an alphaamylase activator, and the secretion of the transferase is mediated by the signal sequence of the Bacillus subtilis xylanase (Example 3). The strains were named DIDK0138 (fermentation of BAC0318-19) and DIDK0153 (fermentation of

10

fifteen

twenty

25

30

35

40

Four. Five

BAC0323-24).

Culture media and culture conditions

Preculture medium

To a shake flask (total volume of 500 ml, with partitions) 100 ml of a medium containing:

NaCl 5 g / l K2HPO4 10 g / l Soy flour 20 g / l Yeast extract BioSpringer 106 20 g / l Antifoam SIN260 5 ml / l

the pH was adjusted to 7.0 before sterilization in the autoclave.

After autoclaving, 6 ml of 50% Nutriose (w / w) were added per flask. Kanamycin was added at a concentration of 50 mg / l after autoclaving.

Inoculation

A shake preculture flask was inoculated with frozen culture directly in a stock solution in 25% glycerol (w / v). The shake flask was incubated at 33 ° C and 175 rpm for approximately 16 hours, during which 50 ml was used to inoculate the fermenter.

Fermentations

The fermentations were carried out in 6 l fermenters built in the plant. The medium (3 l) of the lot contained:

Fermented corn liquor (50% w) 40 g / l BioSpringer 153 yeast extract (50% w) 10 g / l NaCl 5 g / l CaCl2 · 2H2O 0.25 g / l Mn (NO3) 2 · H2O 0.2 g / l Antifoam SIN260 1 ml / l Kanamycin (sterilized in filter for the fermenter after 50 mg / l autoclave sterilization

The food contained:

Monohydrated glucose 540 g / kg MgSO4 · 7H2O 4.8 g / kg Antifoam SIN260 4 ml / kg BioSpringer 153 yeast extract (50% w) (sterilized in 150 g / kg autoclave separately)

The fermentation feed of BAC0318 and BAC0323 was started based on the accumulated CO2, according to the following equations:

Feed-Flow [g / h] = 0, AcCO2 <0.15 Feeding - Flow rate [g / h] = 2.85 + t · 1.54, AcCO2 ≥ 0.15 and t <12 Feed-Flow [g / h] = 21.3, t> 12

t: time (in hours) from the moment the accumulated CO2 (AcCO2) reached 0.15 moles.

The fermentation feed of BAC0319 and BAC0324 was started based on the accumulated CO2 according to the following equations:

Feed-Flow [g / h] = 0, AcCO2 <0.15 Feeding - Flow rate [g / h] = 2.0 + t · 1.08, AcCO2 ≥ 0.15 and t <12 Feed-Flow [g / h] = 15, t> 12

t: time (in hours) from the moment the accumulated CO2 (AcCO2) reached 0.15 moles.

The pH was controlled at 7.0 by adding 12.5% (w / v) NH3-water or 2M phosphoric acid. The aeration was 3 l / min corresponding to 1 vvm. The temperature was 33 ° C.

The fermenter was equipped with two 8 cm Ø Rushton agitators placed at a distance of 10 cm.

Harvest

The biomass was separated by centrifugation at 16,000 x g for 10 minutes at room temperature. The supernatant was sterilized by filtration and the filtrate was used for purification and application tests.

EXAMPLE 6. Application tests in egg yolk

In the following experiments, the isolated transferase of Aeromonas salmonicida expressed in E. coli was tested in egg yolk alone and in egg yolk to which a vegetable sterol had been added.

Material

Transferase from Aeromonas salmonicida Ref. Nº 138 Egg yolk: fresh egg (chicken eggs) Vegetable sterol: β-sitosterol, Sigma, S 5753 TLC plates: Merck silica plates nº 1.05715.0001.

TLC analysis.

The TLC plate was activated in an oven (110 ° C) for ½ h.

100 ml of developing solvent was poured into a chromatography chamber with a lid. The walls of the chamber were covered with filter paper (Whatman 2) in order to saturate the chamber with solvent vapor.

The TLC plate was placed in a frame and the sample was applied on the TLC plate 2 cm from the bottom. The TLC plate was then placed in the TLC chamber with the developing solvent. When the developing solvent took 14 cm from the bottom of the plate, the TLC plate was removed and dried on a table of vapors, and then placed in the oven at 110 ° C for 10 minutes.

The TLC plate was then immersed in the development reagent and dried in the oven at 110 ° C for 15 minutes.

Developer Solvent:

No. IV: chloroform: methanol: H2O (65: 25: 4) No. I: P-ether: MTBE: acetic acid (60: 40: 1)

Development buffer (vanadate buffer):

32 g of Na2CO3 and 300 ml of H2O (1 M) 18.2 g of vanadate pentoxide (V2O5) are added and dissolved during gentle heating. The solution is cooled to room temperature. 460 ml of 2.5 M H2SO4 (460 ml of H2O + 61 ml of H2SO4) are carefully added. Water is added up to 1000 ml.

Phospholipase activity

Substratum:

0.6% of vegetable 95% L-α phosphatidylcholine (Avanti No. 441601) + 0.4% Triton-X 100 (Sigma-X-100) + 5 mM CaCl2 is dissolved in 0.05 M HEPES buffer, pH 7.

Process

400 µl of substrate was added to a 1.5 ml Eppendorf tube and placed in an Eppendorf thermometer at 30 ° C for 5 minutes.

At time T = 0 50 µl of enzymatic solution was added. A blank was also analyzed with water instead of the enzyme.

The sample was mixed at 1000 rpm in the Eppendorf thermomixer at 30 ° C for 10 minutes. At

time T = 10 min. The Eppendorf tube was placed in another thermomixer at 99 ° C for 10 minutes to interrupt

the reaction.

5 Free fatty acids in the samples were analyzed using an NEFA kit from WAKO GmbH.

The enzymatic activity of PLU-7 at pH 7 was calculated as micromoles of fatty acid produced per minute under the test conditions. 10 Lipid Extraction

1 g of egg yolk and 7.5 ml of chloroform: methanol 2: 1 were mixed in a Whirley and centrifuged at 750 x g for 10 minutes. 15 3 ml of the chloroform phase was isolated and used for subsequent lipid analysis.

Results:

20 The phospholipase activity in the transferase (REF. # 138) of Aeromonas salmonicida expressed in E. coli was analyzed as described above and also determined in egg yolk with or without β-sitosterol. The sample was stirred with a magnetic stirrer during the reaction. The experimental design is shown in Table 1. Table 1

Proof

Reaction time at 37 ° C Yolk Sitosterol Transferase No. 138

nº

minutes grams mg Units

one

30  one 40

2

30 one 40 0.75 PLU

3

30 one 80 0.75 PLU

4

120 one 40 0.75 PLU

5

120 one 80 0.75 PLU

6

300 one 40 0.75 PLU

8

300 one 40

The reaction was stopped by adding 7.5 ml of chloroform: methanol (2: 1) and mixed in a mixer.

25 Whirley for 30 seconds. The chloroform phase was isolated by centrifugation and 2 µl of the chloroform phase was transferred to a previously activated silica TLC plate and eluted with developing solvent No. I, and another TLC plate in developing solvent No. IV.

The results of the TLC analysis are shown in Figures 45 and 46.

The reaction of transferase with a transferase from Aeromonas salmonicida in egg yolk in which vegetable sterol was added has shown that the enzyme transfers fatty acid from lecithin in egg yolk to cholesterol during cholesterol ester formation. The TLC chromatogram further indicated that the part of the sterol added to the egg yolk was transferred to the sterol ester.

The amount of sterol ester in relation to the amount of cholesterol ester formed during the reaction can be analyzed by HPLC or GLC.

It is known that plant sterol esters reduce the absorption of cholesterol in the intestine. Indicated

40 also in the literature that cholesterol esters are absorbed less than free cholesterol in the intestine. When a transferase and vegetable sterol are added to the egg yolk, a product is obtained that causes reduced cholesterol absorption, and at the same time lisolecitin is produced which improves the emulsification properties of the egg yolk. An additional advantage of adding transferase and vegetable sterol to egg yolk is that the plant sterol ester is ingested together with the available natural cholesterol, which can be expected to

45 has the greatest effect on reducing cholesterol absorption.

EXAMPLE 7: Modification of egg yolk by lipid acyltransferase from Aeromonas salmonicida

According to the present invention it has now been demonstrated that it is possible to produce lysolecitin from the egg yolk without substantial formation of free fatty acid by the use of a transferase.

The lecithin content of egg yolk is an important emulsifier for the production of mayonnaise with the limitation that mayonnaise is not heat stable. It has therefore been known for several years to use a phospholipase from the pancreas to modify the lecithin in egg yolk to lisolecithin, which is a more effective emulsifier. The use of enzyme-modified egg yolk in the production of mayonnaise contributes to a better heat stability of mayonnaise during pasteurization. A limitation of the use of the phospholipase of the pancreas in the egg yolk is that the amount of fatty acid also increases, which contributes to a reduced oxidative stability because free fatty acids are more prone to oxidation than the corresponding ester. Free fatty acid can also contribute to a soap flavor.

Transferase from Aeromonas salmonicida was successfully expressed in B.subtilis and fermented to

Laboratory scale as described in Example 5, was purified by liquid chromatography and used to

Modify the egg yolk lipids. Enzyme-modified egg yolk was used to produce

5 heat-stable mayonnaise.

A. salmonicide transferase can be used to produce lysolecitin and cholesterol in the yolk of

egg without the production of significant amounts of free fatty acids. That is, without increasing or increasing

substantially free fatty acids in the food.

10 The enzyme-modified egg yolk produced by the transferase had improved emulsification properties and can be used for the production of heat-stable mayonnaise.

This enzyme was very functional in egg yolk modification catalyzing the reaction of lipid transfer between lecithin and cholesterol, figure 47.

This study investigated further the use of transferase for the modification of egg yolk and the use of modified egg yolk in the production of heat-stable mayonnaise.

20 This example describes the fermentation, isolation and application of transferase in egg yolks, as well as the application of enzyme-modified egg yolk in mayonnaise. The example is divided into two parts:

A. Application of transferase in egg yolk

25

B. Experiment of enzyme-modified egg yolk in mayonnaise

EXPERIMENTAL PART

30 A. Application Enzyme and substrate

Transferase No. 178-9 of A. salmonicide, purification 2554-100 C73, 15 PLU-7 / ml. Transferase No. 179 of A. 35 salmonicide, 18.5 PLU-7 / ml.

Phospholipase A1 LECITASETM ULTRA (Novozymes A / S, Denmark) Egg yolk: liquid egg yolk with 8% salt, SANOVA FOODS, DK

40 The TLC analysis was performed as described above (see Example 6 above).

Phospholipase activity: see previous examples.

Lipid Extraction

45 g of egg yolk, 7.5 ml of chloroform: 2: 1 methanol were mixed in a Whirley for 30 s. and centrifuged at 750 for x g for 10 minutes.

4 ml of the chloroform phase was isolated and used for subsequent lipid analysis. fifty

Oxidation Stability Test

The oxidation stability of mayonnaise was measured in an ML OXIPRESS device in which the sample is oxidative tensioned by heat under pressure in an oxygen atmosphere. 55

After a certain time, called the induction period (IP), the oxidation of the sample produces a

determined oxygen consumption, which is recorded as a pressure change of a pressure transducer. He

Higher induction period indicates better oxidation stability.

Process

5 grams of mayonnaise are placed in a glass container and the glass container is closed with the pressure transducer. The container is filled with oxygen at 5 bars. The valve opens to empty the container. 5 This procedure is repeated twice and the sample with an atmosphere of oxygen at 5 bar is placed at 80 ° C. The

Oxygen pressure is measured as a function of time and the induction period (IP) in hours is calculated.

Results

10 The purified transferase from Aeromonas salmonicida of samples No. 179 and No. 178-9 were used to treat egg yolk as summarized in Table 2. The initial test has shown that GCAT transferase should be added with much less activity of phospholipase (PLU), than a commercial phospholipase. This is explained by the fact that GCAT is a transferase and therefore has much less hydrolytic activity than a normal phospholipase.

Table 2

Egg yolk Sanofo 8% salt

2344-44 C89 18.5 PLU-7 / ml Transferase No. 178-9 nº 3108, Lecitasa Ultra Water

nº

Yolk Transferase No. 179 18.5 PLU-7 / ml 1500 PLU-7 / ml 7 / ml

grams

grams

grams

ml  grams PLU-7 / ml

6

120 2.00 8.00 0.31

7

120 10 0 1.25

8

120 1.86 8.14 23.25

9

120 10 0

15 Enzymatic reactions were performed by weighing the egg yolk and the enzyme in a beaker. Samples were placed in an oven at 37 ° C during slow stirring. After 1, 2 and 4 hours of reaction time a sample was extracted for TLC analysis. After 4 hours of reaction time the product was stored at 5 ° C and used for experiments with mayonnaise.

20 TLC analysis of lipids extracted from enzyme-treated egg yolk is presented in the figure

48.

The TLC analyzes of Figure 48 show a clear hydrolytic effect of phospholipase No. 3108 in

Triglyceride during the formation of free fatty acids, as well as some mono- and diglycerides. Phospholipase # 3108 seems to have no effect on cholesterol. Both transferase samples obviously contribute to the corresponding cholesterol ester formation with the reduction of cholesterol contents.

D. Egg yolk modified with enzymes in mayonnaise

30 To investigate the effect of the modification of the egg yolk sample mentioned in Table 2, application tests were performed on mayonnaise with a fat content of 50%. A mayonnaise containing untreated egg yolk was also produced.

35 The objective of the investigation was to determine the impact of the emulsification properties of the enzyme-modified egg yolk and the impact on thermal stability. All samples of mayonnaise contained the same amount of oil and were emulsified only with egg yolk. All mayonnaise samples were produced using a Koruma mixer (Disho V60 / 10) and heated during treatment at 95 ° C for 5 minutes.

40 The samples of mayonnaise (figure 49) produced by the egg yolk treated with enzymes were adequate and homogeneous without oil separation. The reference sample was separated in an oil and in an aqueous phase.

45 The particle size of the oil droplet in the enzyme-treated egg yolk mayonnaise samples was measured in a Malvern Mastersizer. The sample was mixed with 0.1% SDS in 0.1 M phosphate buffer, pH 7, before measurement. The reading was the average size of all the particles shown in Table 3.

Table 3

Experiment

Enzyme Average particle size μm

6

Transferase No. 179, 0.31 PLU-7 / g 12.9

7

Transferase No. 178-9, 1.25 PLU-7 / g 7.2

8

Lecitasa Ultra nº 3108, 23 PLU-7 / g 5.2

The results of the particle size measurement clearly demonstrate the effect of the increased dose of transferase from A. salmonicide. With the high dose of transferase the particle size 5 is close to that of the mayonnaise produced by Lecitasa Ultra. It should be kept in mind however that Lecitasa

Ultra produces many fatty acids, which can contribute to a finer particle distribution.

The size of the mayonnaise oil droplet prepared with the enzyme is significantly smaller than the size of the mayonnaise oil droplet prepared without the enzyme (ie, the reference mayonnaise).

Oxidation stability

The oxidation stability of samples 7 and 8 of mayonnaise was analyzed in an OXIPRESS ML with the 15 results shown in Table 4.

Table 4

Sample

Induction period Induction period

1. determination of hours

2. determination of hours

7

37.44 38.08

8

35.68 35.52

20 The measurement of oxidation stability provided a clear significant difference in oxidation stability. Mayonnaise with egg yolk treated with transferase 179-8 had a significantly better oxidation stability than mayonnaise with egg yolk treated with Lecitasa Ultra. This can be explained by the fact that Lecitasa Ultra produces more free fatty acids that are more prone to oxidation than the corresponding fatty acid esters.

A sample of the egg yolks used for the production of mayonnaise was extracted with chloroform, and the egg yolk lipids were analyzed by GLC using the results presented in Table 5.

Table 5

30

Experiment

Enzyme Fatty acid Cholesterol Cholesterol ester Triglyceride

6

Transferase No. 179, 0.96 0.94 0.49 23.95

7

Transferase No. 178-9 1.84 0.60 1.06 24.54

8

Lecitasa Ultra nº 3108 14.05 1.16 0.12 2.45

9

Reference 0.48 1.16 0.13 22.87

The results of the GLC in Table 5 confirm in the results of the TLC analysis that Ultra Lecitea produces a very high amount of free fatty acids and a large part of the triglyceride is hydrolyzed. On the other hand, transferase produces only a modest amount of free fatty acids and no triglyceride is

35 hydrolyzes. It is also clearly demonstrated that transferase produces cholesterol ester from cholesterol.

The results indicate that the amount of PC in "enzyme-treated" mayonnaise is reduced compared to the reference mayonnaise, while the amount of LPC increases in mayonnaise with treated enzyme compared to the reference mayonnaise. The increase in the amount of LPC may well explain the improved emulsification properties of enzyme-treated mayonnaise compared to the reference mayonnaise. The HPLC and GLC analyzes also indicate a lower level of free cholesterol in the enzyme-treated mayonnaise compared to the reference mayonnaise, probably due to the cholesterol that is being used as a receptor molecule in the transferase reaction that produces an increase in the The amount of cholesterol esters in enzyme-treated mayonnaise compared to the reference mayonnaise. In addition, the results indicate that the amount of free fatty acids does not increase significantly when egg yolk is treated with transferase. The results further indicate that the amount of free fatty acids produced in the food treated with the lipid acyltransferase is significantly less than in the food treated with the reference phospholipase, this is true even if the amount of lisolecithin formed in

50 food is the same.

EXAMPLE 8: Effect of Aeromonas salmonicide transferase in cakes

The effect of GCAT acyl transferase from Aeromonas salmonicida is tested in a cake recipe. The enzyme is tested alone and combined with other lipolytic enzymes. Enzymes are added to any of the ingredients of the cake or added together with the other ingredients of the cake before mixing in the cake.

Preliminary results demonstrate that acyl transferase combined with a hydrolysis enzyme of

Triglycerides improves cake volume and crumb structure compared to a reference.

In the following experiments a transferase produced from A. salmonicide and its variants are tested alone and combined with triglyceride hydrolyzing enzymes. These enzymes are active in

lipid components in egg and butter as well as in carbohydrates, proteins, glycerol and cholesterol (in the

egg), which is part of the cake recipe.

Materials and procedure 15

Enzyme

Acil-transferase nº 179 of Aeromonas salmonicida Grindamyl EXEL 16, Lipase from Thermomyces lanuginosus 20 Cake recipe:

Ingredients

% g

Sugar 35/20

20.37 204

Cake flour, Albatross

18.11 181

Wheat starch

5.21 52

Baker's yeast

0.36 4

Pasteurized liquid whole egg

22.63 226

Manteo Vegao (Aarhus United)

18.11 181

Whey powder

0.68 7

75% glucose syrup 42 DE

4.53 Four. Five

Glycerol

1.36 14

Salt

0.32 3

Rapeseed oil

6.34 63

Potassium sorbate

0.18 1.8

Team

25 Mixer: Hobart N50 with a spatula Stove: Simon cake stove

Process:

30 All ingredients must be at room temperature.

1. Burn sugar and butter for 3 minutes, start at the 2nd speed and move to the 3rd speed in 30 s.

35 2. Add the remaining ingredients and start at 1st speed and move to 2nd speed in 30 s.-5 min. of total mixture.

3. Measure the volume of the butter in a 1 dl glass.

40 4. The beaten cake molds are sprayed with powdered "Babette" oil and covered with paper.

5. Weigh 2 x 350 g in the cake molds beaten.

6.

Spread the dough evenly with a spatula. Four. Five

7. Before putting it in the oven, add a jet of oil on the top of the cake (in the middle) to cut the cake in half.

8.

Bake for 50 min at 180 ° C. fifty

9.

After baking take out the mold from the oven and "drop it" on the table before removing the cakes from the molds.

10.

Remove the paper from the cakes and turn it upside down.

eleven.

The cakes are cooled on a grill for 60 min. before weighing and measuring the volume

5 Observations

The enzyme (s) used (s) are added at the beginning of mixing or added to some of the cake ingredients before adding (s) to other cake ingredients. 10 Enzymes are only active during mixing or reaction of cake components and enzymes are inactivated during cake cooking.

Results 15 The following experiments are performed as shown in the following table:

one

2 3 4

Whole egg

G 250 250 250 250

Glucose syrup, 75% DE 42

G 10 10 10 10

Acyl transferase No. 179, 26 PLU / ml

Ml 25 25

Gryndamil EXEL 16

Mg 37.5 37.5

Water

25

Egg, glucose syrup and enzyme are reacted for 30 minutes at 37 ° C and then pruned the 20 eggs are used to produce cake according to the recipe mentioned above.

Preliminary results show that a combination of acyltransferase and a glyceride that hydrolyzes the lipase from Thermomyces lanoginosus improves the volume of the cake, and also the crumb structure, the quality and appearance of the food is improved compared to a reference with water. The

Preliminary results indicate in the cake that a combination of lipid acyltransferase and a lipase can preferably be used.

EXAMPLE 9: The purpose of these experiments was to test a transferase of A. hydrophila expressed in E.coli

The reaction with A. hydrophila No. 135 transferase (0.5 NEFA-PLU / ml) was tested in egg yolk. The experimental setup is shown in Table 6.

Table 6

Reaction time

Yolk No. 135 conc.

nº

minutes grams PLU-NEFA units

one

30  one 0.000

2

30  2 0.100

3

60 2 0.100

4

150 2 0.100

5

240 2 0.100

6

1560 2 0.100

7

1560 one 0.000

The egg yolk was heated to 37 ° C and the enzyme was added. After the reaction time 35 7 ml of CHCl3: methanol 2: 1 was added and mixed in a Whirley for 30 seconds.

The sample was centrifuged at 800 x g for 10 minutes and the lower solvent phase was isolated. 2 µl of this sample was applied on a TLC silica plate and eluted in elution solvent IV. The results of the TLC analysis are shown in Figures 50 and 51.

40 The procedures and materials mentioned in this example are those detailed in the previous examples.

Samples of this experiment were analyzed well by GLC as TMS derivatives. The results of the GLC analysis are presented in Table 7.

Table 7. GLC analysis of egg yolk lipids

nº

Reaction Transferase No. 135 conc.

weather

Units / g egg yolk Free fatty acid Cholesterol Cholesterol ester

min

% % %

7

Reference 0 0.25 2.88 0.34

3

60 0.025 0.25 2.68 0.56

4

150 0.025 0.29 1.85 1.72

5

240 0.025 0.53 1.42 3.54

6

1560 0.025 0.95 0.3 4.43

From the GLC analysis of free fatty acid, cholesterol and cholesterol ester it is possible to calculate the 5 molar concentration of each component and calculate the% transferase activity as shown in the Table

7. Calculation of% transferase activity 10 From the results, increases in free fatty acid and sterol esters are calculated: Δ% fatty acid =% fatty acid (enzyme) -% fatty acid (reference) Δ% ester of sterol =% sterol / stanol ester (enzyme) -% sterol / stanol ester (reference) 15

Transferase activity is calculated in% of total enzyme activity:% activity of Δ% sterol ester / (Mv sterol ester) x 100

=

transferase Δ% sterol ester / (Mv sterol ester) + Δ% fatty acid / (Mv fatty acid)

in which:

20 Mv sterol ester = average molecular weight of the sterol esters Mv fatty acid = average molecular weight of the fatty acids

Table 8. Transferase activity in the egg yolk of A.hydrophila No. 135

No.

Reaction Transferase No. 135 conc.

weather

Units / g yolk Fatty acid Cholesterol Ester of Activity of

of egg

free cholesterol transferase

min

mM mM mM %

7

Control 0 8.9 74.5 5.3 -

3

60 0.05 8.9 69.3 8.7 100

4

150 0.05 10.4 47.8 26.5 93

5

240 0.05 18.9 36.7 54.6 77

6

1560 0.05 33.9 7.8 68.4 48

The analyzes by both TLC and GLC confirm that initially the A.hydrophila transferase reaction No. 135 is the dominant reaction. After 150 minutes of reaction time some hydrolytic activity occurs. After 1560 minutes the transferase reaction and the hydrolytic reaction have reached almost the same level. The results further indicate that as long as the cholesterol receptor molecule is available, the transferase reaction is the dominant reaction. When the cholesterol concentration decreases the

30 hydrolytic activity becomes more dominant.

EXAMPLE 10: Test for measuring transferase activity using egg yolk as a substrate - hereinafter referred to as "Egg yolk test"

35 A lipid acyltransferase from Aeromonas salmonicida was isolated and expressed in Bacillus subtilis. The purpose of this work is to develop an analytical method, which is capable of improving the activity of both transferase and hydrolytic enzymes, and from these analyzes it is possible to define the activity of both transferase and hydrolytic enzymes using a substrate that It contains lecithin and cholesterol.

In this work, egg yolk was used as a substrate for the enzymatic assay because the egg yolk contains both lecithin and cholesterol and it is known that transferases and phospholipases act very well in this substrate.

The drawback of using egg yolk is that this substrate is a complex mixture of water, lipids and proteins. The lipid components include 66.2% glycerides; 29.6% phospholipids and 4.2% cholesterol. Phospholipids consist of 73% lecithin, 15% cephalin and 12% other phospholipids. Of the fatty acids, 33% are saturated and 67% unsaturated, including 42% oleic acid and 7% linoleic acid (ref. Kirk-Othmer Encyclopedia of Chemical Technology, John Wiley & Sons, Inc.).

Some variations in the composition of the egg yolk can be expected. In the literature (Biochimica et Biophysica Acta, 1124 (1992) 205-222), however, it is mentioned that: "The mature egg yolk of domestic chickens has a remarkably constant lipid and lipoprotein composition despite the great variation in diet and environmental conditions "and it is also cited" As a result the egg yolk continues to provide a food of almost constant composition that serves to maintain its chemical and physical-chemical properties for reliable use in the bakery, cosmetics and pharmaceutical industries ".

This reference indicates that the composition of the egg yolk is very constant and it was therefore decided to use chicken egg yolk as a substrate for the egg yolk test.

The quantification of the lipid reaction products from the enzymatic treatment of the egg yolk was carried out by extraction of lipids from the substrate followed by GLC analysis of the lipid components.

Process

materials

Egg yolk: pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde. HEPES buffer, Sigma cat. No. H 3375. Chloroform, analytical grade

Enzymes

Purified A. salmonicide lipid acyltransferase No. 178-9.

Thermomyces lanuginosus lipase. GRINDAMYL EXEL 16, article number 147060 (reference).

Enzymatic assay with egg yolk substrate

In a 20 ml Wheaton glass, 5 g of liquid egg yolk were weighed and heated to 35 ° C. 0.25 ml of enzymatic solution was added and a stopwatch was started.

At regular intervals, 0.5 g samples were transferred to a 10 ml Dram glass.

20 µl of 4M HCl was added to interrupt the enzymatic reaction and acidify the fatty acid soap.

3 ml of chloroform was added and the sample was mixed in a Whirley mixer for 30 s.

The sample was centrifuged at 3000 g for 10 min and 0.8 ml of the chloroform phase was transferred to a tarred Dram vessel. The chloroform was evaporated at 60 ° C under a stream of nitrogen. The Dram glass was weighed again.

Isolated lipids were analyzed by GLC and TLC. TLC analysis, as described herein. GLC analysis, as described herein.

Results

Table 9 shows the experiment performed for the egg yolk test using egg yolk as a substrate.

Table 9

one

2 3

Egg yolk, liquid

grams 5 5 5

Transferase No. 178-9, 32 PLU-7 / ml *

ml 0.25

T. lanuginosus lipase, 200 LIPU / ml

ml 0.25

Water

ml 0.25

0.5 g samples were taken after 15. 30, 60, 120 and 1,080 minutes, and the lipid was isolated by solvent extraction. Lipids were analyzed by TLC using solvent I and IV respectively. The photograph of the TLC plate is shown in Figure 52.

The TLC analysis clearly indicates the activity of transferase No. 178-9 of A. salmonicide (sample 3). This is seen by the decrease in PC and PE phospholipids. The results also indicate that the amount of

10 LPC lysolecithin is not as high as expected. This may indicate hydrolytic activity in lysolecitin or may also be caused by insufficient extraction because lysolecitin is very polar and therefore could be partially distributed in the aqueous phase.

The lipids isolated by solvent extraction were also analyzed by GLC in order to quantify the amount of free fatty acid, cholesterol and cholesterol ester. The results of the GLC are shown in the Table

10.

twenty

Table 10. GLC analysis of lipid from enzyme-treated egg yolk. The results are expressed in% based on lipid content

fifteen

30 60 120 1080

Minutes

Minutes

Minutes

Minutes

Minutes

Free fatty acids

Reference one 0,328 0.304 0,332 0,333 0,369

T. lanuginosus

2 0.391 0.376 0.459 0.627 22,909

A. salmonicide nº178-9

3 1,007 1,668 4,013 6,761 15,098

Cholesterol

Reference one 3,075 2,968 3,103 3,056 3,099

T. lanuginosus

2 3,130 3,032 3,045 3,026 3,225

A. salmonicide No. 178-9

3 2,835 1,912 0.356 0.220 0.206

Cholesterol ester

Reference one 0.416 0.397 0.422 0.408 0.437

T.lanuginosus

2 0.436 0.400 0.425 0.419 0.416

A. salmonicide No. 178-9

3 1,414 2,988 6,107 6,694 5,760

Triglyceride

Reference one 76,153 73,505 75,565 79,344 77,382

T. lanuginosus

2 74,099 74,413 77,079 74,284 21,781

A. salmonicide No. 178-9

3 73,781 73,342 77,857 82,040 72,117

From the results it was observed that almost all the cholesterol was esterified after 60 minutes in sample 3. It was concluded that in the first 30 minutes there was an excess substrate for the reaction. The results of the samples taken after 15 and 30 minutes were therefore used to calculate the

25 enzyme activities.

Based on the information in Table 10 and the fact that the egg yolk contains 27% lipids, the amount of fatty acid and cholesterol ester in micromoles produced per ml of enzymes was calculated with the results shown in Table 11.

30 The results in Table 11 were obtained in the following calculations of the results of fatty acids in sample # 3 (A. Salmonicide, 15 min.).

Lipid in 5 g in egg yolk = 5 x 0.27 = 1.35 grams 35 1.35 grams of lipid contain 1.007% of fatty acids = 1.35 x 1.007 / 100 = 0.01359 grams.

Average molecular weight of fatty acids is 272. 0.01350 grams = 0.01359 x 1.000.000 / 272 μmoles = 49.9798 μmoles 40 0.25 ml of enzyme is added μmoles of fatty acid / ml of enzyme = 49, 9798 / 0.25 = 199.9

Table 11

Micromoles / ml enzyme

0 min

15 min 30 min

Free fatty acid

Reference 65.01 60.37

T. lanuginosa

77.61 74.71

Transferase No. 178-9

199.86 331.06

Cholesterol ester

Reference 35.09 33.50

T. lanuginosa

36.77 33.73

Transfer nº178-9

119.29 252.15

From the results in Table 11 it is possible to calculate the change in the amount of fatty acid and cholesterol ester produced by the enzyme with respect to the reference as shown in Table 12:

Table 12

Δ Micromoles / ml enzyme

0 min 15 min 30 min

Free fatty acid

T. lanuginosus 0 12,593 14,340

Transfer nº178-9

0 134,843 270,691

Cholesterol ester

T. lanuginosus 0 1,677 0.235

Transfer nº178-9

0 84,196 218,652

10 The amount of fatty acid or cholesterol ester produced as a function of time is shown in the figure

53.

From the slope of the curve the hydrolytic activity (formation of FFA) and the activity of lipid acyltransferase (formation of cholesterol ester) were calculated as a function of time. The relative transferase activity 15 (% acyltransferase activity) and the relative hydrolytic activity were calculated as shown in Table 13. The relative transferase activity was determined using the protocol for the determination of% activity activity. acyltransferase as described above. For example, the calculation of the relative activity for No. 178-9. The total activity is the activity of FFA + transferase activity = 9.023 + 7.2884 = 16.311 μmoles / min / ml. Relative transferase activity = 7.2884 x 100 / 16.311 = 44.7, relative hydrolytic activity =

20 9.023 x 100 / 16.311 = 55.3.

Table 13

T. lanuginosus

FFA activity 0.4780 mol / min / ml

A. salmonicide # 178-9

FFA activity 9.0230 mol / min / ml

T. lanuginosus

Cholesterol ester activity 0.0078 mol / min / ml

A. salmonicide # 178-9

Cholesterol ester activity 7.2884 mol / min / ml

T. lanuginosus

Relative Transferase Activity 1.6

A. salmonicide # 178-9

44.7

T. lanuginosus

Relative hydrolytic activity 98.4

A. salmonicide # 178-9

55.3

25 The results in Table 13 confirmed that the A. salmonicide transferase enzyme has a significant transferase activity, but the results also confirmed that this enzyme has a significant hydrolytic activity. Lipase from T. lanuginosus mainly has hydrolytic activity and the relative transferase activity 1.6 was not proof of any transferase activity but was explained by the uncertainty of the analyzes.

30 Conclusion

Egg yolk was used as a substrate for the measurement of transferase and hydrolase activity of Aeromonas salmonicida lipid acyltransferase and a lipase from Thermomyces lanuginosus. In the

In the test conditions there was initially a linear relationship between the cholesterol ester and the formation of free fatty acid and time for the lipid acyltransferase enzyme. Based on this linear relationship it was possible to calculate the hydrolytic activity (FFA formation) and the transferase activity (cholesterol ester formation). The relative hydrolytic and transferase activity was also calculated. Lipid acyltransferase (in this case a GCAT) from Aeromonas salmonicida, showed almost equal hydrolytic and transferase activity under these test conditions.

40 Thermomyces lanuginosus lipase had very little hydrolytic activity and the transferase activity was not significant.

5

fifteen

25

35

Four. Five

55

EXAMPLE 11: Test with transferase in egg yolk with lots of water Introduction

A lipid acyltransferase was isolated according to the present invention of Aeromonas salmonicida and expressed in Bacillus subtilis. Initial experiments have shown that this enzyme is very effective in transferring fatty acids from lecithin to cholesterol using egg yolk as a substrate.

In the following experiments the transferase reaction was studied in more detail using egg yolk as a substrate with special attention to the concentration of water in the substrate. Materials Procedure

Egg yolk: Pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde. HEPES buffer ,. Cat. H 3375 by Sigma Chloroform, squalene analytical quality, analytical quality

Enzymes

No. 178-9 lipid acyltransferase according to the present invention of A. salmonicida

No. 2427 Phospholipase A1 of Fusarium oxysporum. LIPOPAN®F from Novozymes, DK (lipolytic enzyme

comparative) No. 1991 phospholipase A2 of the pancreas, LIPOMOD 22L from Biocatalysts, U.K. (comparative lipolytic enzyme).

Enzymatic assay with egg yolk substrate

5 grams of liquid egg yolk were weighed in a 20 ml Wheaton glass and heated to 35 ° C.

Water and enzyme solution were added and a stopwatch was started.

At regular intervals, 0.5 g of samples were transferred to a 10 ml Dram glass.

20 µl of 4M HCl was added to interrupt the enzymatic reaction and acidify the fatty acid soap.

3 ml of chloroform was added and the sample was mixed in a Whirley mixer for 30 s.

The sample was centrifuged at 3,000 g for 10 min and 0.8 ml of the chloroform phase was transferred to a vessel

Tar Drained. The chloroform was evaporated at 60 ° C under nitrogen vapor. The Dram glass is weighed again.

The isolated lipids are analyzed by GLC. GLC analysis

A Perkin Elmer Autosystem 9000 capillary gas chromatograph equipped with a WCOT fused silica column of 12.5 m x 0.25 mm ID x 5% phenylmethylsilicone 0.1 μm thick film (CP Sil 8 CB

from Chrompack).

Carrier gas: helium

Injector. PSSI injection cold split injection (initial temp. 50 ° C heated to 385 ° C), volume

1.0 μl FID detector: 395 ° C

Stove program: Stove temperature, ºC Isotherm, min. Temperature rhythm, ºC / min.

1 90 1 15 2 280 0 4 3 350 10

Sample preparation: 30 mg of sample were dissolved in 9 ml of heptane: pyridine, 2: 1 containing the internal heptadecane standard, 0.5 mg / ml. 300 µl of the sample solution was transferred to a vial with an airtight cap, 300 µl of MSTFA (N-methyl-N-trimethylsilyltrifluoroacetamide) was added and reacted for 20 minutes at 60 ° C.

Calculation: The response factors for mono-di-triglycerides and free fatty acids of Pattern 2 (mono-di-triglycerides), in cholesterol, cholesterol palmitate and cholesterol stearate were determined and the response factors of the material of pure reference (heavy of the pure material 10 mg).

Results

Egg yolk containing 2% squalene was used as a substrate particularly the reactions. Squalene was added as an internal standard for GLC analysis, to quantify the lipid components in egg yolk.

The experiment was mounted as shown in Table 14.

Table 14

one

2 3 4 5 6 7 8

Substrate, egg yolk with 2% squalene

g 5 5 5 5 5 5 2.5 2.5

Transferase No. 178-9, 14 PLU-7 / ml

ml 0.25 0.25 0.13

LIPOPAN® F solution, 200 PLU-7 / ml

ml 0.25 0.13

Phospholipase A2 No. 1991, 6300 PLU / ml

ml 0.25 0.25

Water

ml 0.25 3.8 3.8 8.75 8.75

15 Samples were taken after 30, 60 and 120 minutes and analyzed according to the procedure described above (0.5 ml (exp. 1-4) 0.86 ml (exp. 5-6) and 2.2 ml (exp 7-8) samples were taken).

The results of the GLC analysis are shown in Table 15. The GLC results were expressed as a percentage of the substrate (egg yolk). The table also indicates the reaction time and the total amount of water 20 in the reaction mixture.

Table 15

Enzyme

Reaction time % of water GLC GLC GLC

minutes

in the reaction % fatty acid % cholesterol % cholesterol ester

Reference

120 54 0,247 0.863 0.083

# 178

30 54 0.422 0.669 0.445

# 178

60 54 0.515 0.549 0.672

# 178

120 54 0.711 0.364 1,029

# 2427

30 54 2,366 0.848 0.090

# 2427

60 54 3,175 0.837 0.088

# 2427

120 54 3,926 0.833 0.082

# 1991

30 54 1,606 0.911 0.083

# 1991

60 54 1,701 0.838 0.080

# 1991

120 54 1,781 0.763 0.053

# 178

30 73 0.377 0.764 0.495

# 178

60 73 0.488 0.665 0.719

# 178

120 73 0.626 0.426 0.931

# 2427

30 73 2,471 0.853 0.092

# 2427

60 73 3,284 0.858 0.087

# 2427

120 73 4,176 0.837 0.081

# 178

30 89 0,344 0.720 0.308

# 178

60 89 0.443 0.725 0.446

# 178

120 89 0.610 0.597 0.607

# 2427

30 89 0.510 0.167 0.010

# 2427

60 89 0.602 0.133 0.010

# 2427

120 89 0.867 0.147 0.009

Based on the analysis of fatty acid, cholesterol and cholesterol ester it was possible to calculate the amount of free fatty acid and cholesterol ester produced based on the reaction time and the water content. Based on these results, it was possible to calculate the total enzymatic activity such as the sum of fatty acid formation and cholesterol ester formation. The relative hydrolytic activity and the relative transferase activity (ie,% acyltransferase activity) were then calculated with the results presented in Table 16.

65

The results in Table 16, were also statistically analyzed using an ANOVA Statgraphic Multifactor. The statistical results in Figure 54 confirm that phospholipase A1, No. 2427 and phospholipase A2, No. 1991 have no transferase activity while transferase No. 178-9 exhibited almost 50% transferase activity under these analytical conditions.

5

The effect of the water content in the test on the activity of transferase No. 178 was also analyzed.

statistically as shown in figure 55. These results indicate that in the range between 54 and 89% of

Water in the test did not exist any strong effect of the water content on the activity of the relative transferase.

10 The impact of the reaction time of the transferase activity for transferase # 178 was evaluated with the results shown in Table 16 and Figure 56. The results in Figure 56 indicate that the relative activity of the transferase decreases as a function of reaction time. This can be explained by the fact that most of the molecular cholesterol receptor is consumed and consequently increases the relative hydrolytic activity. The negative values for the transferase reaction for No. 2427 only indicate that there is no activity of

15 transferase within the variation of the analytical method.

Table 16

Enzyme

Reaction time minutes % water in reaction mixture Fatty Acid Produced Cholesterol consumed Cholesterol ester produced % Hydrolytic activity % transferase activity

# 178

30 54 0.175 0.194 0.362 53 47

# 178

60 54 0.268 0.314 0.589 52 48

# 178

120 54 0.464 0.499 0.946 53 47

# 2427

30 54 2,119 0.015 0.007 100 0

# 2427

120 54 2,928 0.026 0.005 100 0

# 2427

60 54 3,679 0.030 -0.001 100 0

# 1991

30 54 1,359 -0,048 0.000 100 0

# 1991

60 54 1,454 0.025 -0.003 100 0

# 1991

120 54 1,534 0.100 -0.030 101 -one

# 178

30 73 0,130 0.099 0.412 42 58

# 178

60 73 0.241 0.198 0.636 47 53

# 178

120 73 0,379 0.437 0.848 51 49

# 2427

30 73 2,224 0.410 0.009 100 0

# 2427

60 73 3,037 0.005 0.004 100 0

# 2427

120 73 3,929 0.026 -0.002 100 0

# 178

30 89 0.097 0.143 0.225 fifty fifty

# 178

60 89 0.196 0.138 0,363 56 44

# 178

120 89 0,363 0.266 0.524 62 38

# 2427

30 89 0.263 0.696 -0.073 113 -13

# 2427

60 89 0.355 0.730 -0.073 110 -10

# 2427

120 89 0.620 0.716 -0.074 105 -5

20 Conclusion

Aeromonas salmonicida lipid acyltransferase was analyzed in the egg yolk as a substrate and with

Different amounts of water content. This enzyme was compared with the reference lipolytic enzymes, it is

say Fusarium oxysporum phospholipase A1 and a pancreas phospholipase A2.

25 The results have shown that only transferase catalyzed the transferase reaction between lecithin and cholesterol during cholesterol ester formation. The results showed that in the range between 54% and 89% of water in the substrate the relative activity of the transferase was almost the same as for the Aeromonas salmonicida transferase.

EXAMPLE 12: "Transferase assay in buffered substrate" for the measurement of acyltransferase activity (for example, for use in a food that uses lecithin and cholesterol)

Lipid acyltransferase from Aeromonas salmonicida was isolated and expressed in Bacillus subtilis. This

Enzyme is very effective in transferring fatty acids from lecithin to cholesterol during the formation of cholesterol esters. It has also been shown that the enzyme has some hydrolytic activity, which is observed by the formation of free fatty acid. Traditional phospholipases (EC 3.1.1.4 and EC 3.1.1.32) have the ability to hydrolyze lecithin during the formation of free fatty acids and lysolecitin, and no transferase reactions have been described for these enzymes.

A test that can measure the activity of both transferase and hydrolytic enzymes and thus identify lipid acyltransferases according to the present invention is detailed herein, the assay uses a substrate containing lecithin and cholesterol. In this work a substrate based on phosphatidylcholine and cholesterol dispersed in a buffer was used. The quantification of the reaction products was done by extraction of

5 substrate lipids followed by GLC analysis of lipid components.

Process

materials

10 L-alpha-phosphatidylcholine 95% (vegetable) Avanti No. 441601 Cholesterol: Cat.C 8503 from Sigma Cholesteryl palmitate, Sigma C 6072 Cholesteryl stearate, Sigma C 3549

15 HEPES buffer, cat. nº H 3375 of Sigma Chloroform, analytical quality.

Enzymes

20 GCAT purified from A. salmonicide No. 178-9

TLC analysis was performed as described in Example 6.

GLC analysis was performed as described in Example 11.

25 Results: transferase assay based on phosphatidylcholine and cholesterol as substrates.

The transferase activity of the transferase in a substrate based on phosphatidylcholine and cholesterol was then determined according to the following procedure. 30

450 mg of phosphatidylcholine (> 95% PC Avanti article No. 441601) and 50 mg of cholesterol were dissolved in chloroform and evaporated to dryness in vacuo. 300 mg of the cholesterol / phosphatidylcholine mixture was transferred to a Wheaton glass and 15 ml of 50 mM HEPES buffer, pH 7 was added. The lipid was dispersed in the buffer during stirring.

The substrate was heated at 35 ° C during mixing with a magnetic stirrer and 0.25 ml of enzyme was added. This is a medium abundant in water with approximately 95% water.

2 ml samples were taken after 0.5, 10, 15, 25 and 60 minutes of reaction time.

Immediately 25 µl of 4M HCl was added to acidify the free fatty acid and the reaction mixture was interrupted. 3.00 ml of chloroform was added and the sample was stirred vigorously in a Whirley for 30 seconds. The sample was centrifuged and 2 ml of the chloroform phase was isolated and filtered through 0.45 μm filters in a 10 ml tar Dram vessel. The chloroform was evaporated under a stream of nitrogen at 60 ° C, and

45 samples were weighed again. The lipid extracted by GLC was analyzed.

The results of the GLC analysis are shown in Table 17. The results are expressed in% calculated.

on the extracted lipid. The amount of fatty acid and cholesterol ester formed as a function of time is illustrated in

Figure 57. It can be concluded from Figure 57 that the enzymatic reaction is not linear as a function of time, because

50 an initially strong hydrolytic and transferase activity is observed. After about 10 minutes and up to about 60 minutes the reaction presents an almost linear response of formation of fatty acid and cholesterol ester as a function of time. It was therefore decided to observe in the enzymatic reaction in this time interval.

Table 17

Minutes

0 5 10 fifteen 25 40 60

Cholesterol,%

10,064 8,943 8,577 8,656 8,102 7,856 7,809

Cholesterol ester,%

0.000 1,571 2,030 2,058 2,282 2,659 3,081

Total FFA,%

0.260 1,197 1,239 1,466 2,445 2,943 3,940

From the knowledge about the amount of lipid in the reaction mixture and the amount of

added enzyme it was possible to calculate the formation of fatty acid and cholesterol ester expressed in μmoles / ml

enzyme (Table 18 and figure 58)

Table 18

Minutes

10 fifteen 25 40 60

mol / ml

mol / ml

mol / ml

mol / ml

mol / ml

Total FFA

58.1 68.7 114.6 138.0 184.7

Ester cholesterol

88.8 90.0 99.3 115.6 133.8

From the results in Table 18 and the slope of the curves in Figure 58, it was possible to calculate the amount of fatty acid and cholesterol ester based on the time expressed in μmoles / min per ml of enzyme.

The calculation of hydrolytic activity and transferase activity is presented in Table 19. The activity

Relative transferase was determined using the protocol for the determination of% activity of

acyltransferase as described hereinbefore.

Table 19

Hydrolytic activity (fatty acid)

2.52 Pmol / min per ml of enzyme

Transferase activity (cholesterol ester)

0.94 Pmol / min per ml of enzyme

Total activity

3.45 Pmol / min per ml of enzyme

Relative Transferase Activity

27.1 %

Relative hydrolytic activity

72.9 %

Identification of other enzymes by transferase activity

The procedure mentioned above was used to identify the different transferase and hydrolytic activity different lipolytic enzymes. Enzymes were determined as shown in Table 20.

Table 20

one

2 3 4 5

Substratum

ml fifteen fifteen fifteen fifteen fifteen

Transferase No. 178-9 of A. salmonicide 32 PLU-7 / ml

ml 0.25

No. 3016 at 5%, LIPOPAN® F (F.oxysporum)

ml 0.25

5% Thermomyces lanuginosus

ml 0.25

Rugged Candidate No. 2983 at 5%

ml 0.25

Candida cylindracea nº 3076 at 5%

ml 0.25

The substrate containing 300 mg phosphatidylcholine / cholesterol dispersed in 50 mM HEPES buffer, pH 7.0, was heated to 35 ° C with stirring. Enzymatic solution was added and the sample was maintained at 35 ° C with stirring. Samples were taken at regular intervals and extracted with chloroform. The isolated lipids were analyzed by GLC with the results shown in Table 21.

Table 21

Sample

one

Transferase 178-9

minutes

0 5 10 fifteen 25 40 60

FFA

1,216 2,516 2,983 2.62 2,894 3,448 3,911

Cholesterol

7,547 6,438 6,365 6.15 6,136 5,936 5,662

Cholesterol ester

0 1,835 2,177 2.44 2.58 2,851 3,331

2

Fusarium oxysporum (LIPOPAN®F) 0 5 10 fifteen 25 40 60

FFA

1,216 1,345 1,796 1.95 2,487 2,424 2,977

Cholesterol

7,547 7,309 7,366 7.33 7,429 7,341 7,326

Cholesterol ester

0 0.26 0.386 0.35 0.267 0.36 0.394

5

10

fifteen

twenty

25

30

35

Table 21 (continued)

Sample

3

Thermomyces lanuginosus 0 5 10 fifteen 25 40 60

FFA

1,216 0.853 0.875 one 0.896 1,105 1,009

Cholesterol

7,547 7,384 7,639 7.63 7,675 7,603 7,529

Cholesterol ester

0 0 0 0 0 0 0

4

Rugged Candida (nº 2938) 0 5 10 fifteen 25 40 60

FFA

1,216 0.982 0.987 1.02 1,135 1,131 1.15

Cholesterol

7,547 7,438 7,656 7.66 7,638 7,575 7,585

Cholesterol ester

0 0 0 0 0 0 0

5

Candida cylindracea nº 3076 0  5 10 fifteen 25 40 60

FFA

1,216 1,032 1,097 1.07 1,203 1,131 1.43

Cholesterol

7,547 7,502 7,425 7.65 7,619 7,502 7,411

Cholesterol ester

0 0 0 0 0 0 0

From the analysis by GLC it was observed that only the lipid acyltransferase (178-9) produced a significant amount of cholesterol and fatty acid esters. Fusarium oxysporum phospholipase also provided a steady increase in free fatty acid but only an initial formation in a small amount of cholesterol ester was formed, but no increase in cholesterol ester was observed as a function of time.

Based on the knowledge of the amount of the lipid substrate and the GLC analyzes it was possible to calculate the relative activity of the transferase and the relative hydrolytic activity based on the results of 10 to 60 minutes of reaction time. The results of transferase 178-9 and Fusaruim oxysporum lipase are shown in Table 21. The other enzymes tested did not show any activity.

Table 21

Transferase 178-9

Fusaruim oxysporum

Hydrolytic activity, micromoles / min. per ml of enzyme

1.03 0.96

Transferase activity, micromoles / min. per ml of enzyme

0.40 0.01

Total activity, micromoles / min. per ml of enzyme

1.43 0.98

Relative hydrolytic activity

71.8 98.7

Relative Transferase Activity

28.2 1.3

The results shown in Table 21 confirm a significant transferase activity from the lipid acyltransferase (sample 178-9). It is further observed that the relative activity of transferase is very much in agreement with that of the experiment mentioned in Table 19.

A very low transferase activity of Fusaruim oxysporum phospholipase was observed however. This level of transferase is so low that it falls within the uncertainty of the analysis. As expected, Fusaruim oxysporum phospholipase has a significant hydrolytic activity.

conclusion

Instead of egg yolk (shown in Example 11), an artificial substrate based on purified phosphatidylcholine and cholesterol was used as a substrate to measure the activity of the Aeromonas salmonicide transferase. Between 10 minutes and 60 minutes of reaction time the assay provided an almost linear formation of free fatty acids and cholesterol ester as a function of time. Based on the activity between 10 and 60 minutes of reaction time, the hydrolytic activity and the transferase activity were calculated.

The substrate concentration in this test was relatively lower than in the egg yolk, and the amount of water in the test was relatively higher.

Based on the results of the lipid acyltransferase test (in this case a GCAT) of Aeromonas salmonicida on an artificial phosphatidylcholine / cholesterol substrate in buffer, it is concluded that this enzyme has a very good transferase activity also in a system With a very high water content.

Both tests based on egg yolk (see Example 11) and phosphatidylcholine / cholesterol in buffer (Example 12) can be used to measure the transferase and hydrolytic activity of enzymes. Egg yolk is preferred from the point of view that the hydrolytic and transferase activity is linear as a function of time, but the phosphatidylcholine / cholesterol in the buffer is only linear within a certain time limit.

EXAMPLE 13: Food Emulsions

The effect of enzyme-modified liquid egg yolk was tested in a standard emulsion 5 food recipe with 60% oil.

Standard procedures and materials are as detailed in the previous examples.

Egg yolk was treated with a lipid acyltransferase from Aeromonas salmonicida No. 138 or 10 phospholipase, that is, a commercially available Lipopan F® enzyme (Novozymes A / S, Denmark) (No. 2938) as shown in the Table 22

Table 22. Enzymatic treatment of egg yolk

one

2 3 4

Egg yolk, product nº 1123 P2 by Sanofo

g 10 1 210 10 1 360 10 1 210 10 1 210

No. 138, 10 PLU / ml

Ml

No. 2938, 200 PLU / ml

Ml

Water

Ml

Reaction time

Minutes

15 TLC analysis of egg yolk lipids from enzyme-treated egg yolk (Table 9) is shown in Figures 59 and 60.

In this experiment the dose of No. 2938 was increased by a factor of 10 and this gave a very evident activity in the egg yolk. The amount of free fatty acid increased significantly and lecithin (PC) 20 was hydrolyzed to lisolecithin (LPC). Transferase No. 138 provided a clear transferase reaction because the

Free cholesterol became cholesterol ester and part of the lecithin was converted to lysolectin.

Another interesting aspect of the enzymatic modification was the consistency of the product. The sample treated with phospholipase No. 2938 became very solid, while the samples treated with lipid acyltransferase No. 138 25 maintained the same consistency as the reference sample (see Figure 61).

These modified egg yolks were tested in a food emulsion recipe shown in Table 23.

Table 23. Mayonnaise with enzyme modified egg yolk

0

1st 2nd 3rd 4th

%

%

%

%

%

Rapsolie

60 60 60 60 60

Egg yolk, product No. 1123P2 from Sanofo

2.8

Egg yolk No. 1 modified with enzymes

2.8

Egg yolk No. 2 modified with enzymes

2.8

Egg yolk No. 3 modified with enzymes

2.8

Egg yolk reference 4 (untreated)

2.8

Water

39 36.2 36.2 36.2 36.2

Vinegar, 10% acetic acid

one one one one one

30 The modified egg yolks 1 and 2 were treated with the lipid acyltransferase; and the egg yolk 3 treated with the commercially available phospholipase was modified.

The food emulsion was produced as an oil-in-water emulsion according to the following procedure: the egg yolk and the water were weighed in a beaker. The oil was weighed separately.

35 A Turrax mixer (20,000 rpm) was immersed in the aqueous phase. The oil was pumped into the aqueous phase at a constant speed of 2 minutes. Mixing continued for another 1 minute. The vinegar was then added and mixed for 5 seconds.

The stability of the emulsion was determined in an oven at 100 ° C. After 2 hours at 100 ° C the emulsion was evaluated (see Figure 62).

The stability of the untreated egg yolk emulsion was very good in this experiment. The treatment of egg yolk with lipid acyltransferase No. 138 however improved stability because the amount of water separation was reduced. The egg yolk treated with phospholipase No. 2938 provided a very unstable emulsion with almost complete separation of the oil and water phase at 100 ° C.

It is considered that in some applications the use of the compositions and procedures of the

invention can increase the thermal stability of emulsions, such as dressings of

Oil salad in water and the like. This is particularly important in food emulsions that

5 are pasteurized to ensure long storage stability and / or are heated before serving them, for example, in foods previously prepared for reheating before serving them (eg microwave meals). Although it is not desired to be bound by any particular theory, it is considered that in some applications the accumulation of free fatty acid may be detrimental to the thermal stability of said emulsions. It should be recognized that the increase in thermal stability of food emulsions produced

10 using the methods of the invention may not be found or even desirable, in all food applications. It will be apparent to one skilled in the art that applications of such characteristics are desirable, and that the stability of emulsions can be easily determined using simple heat tests, equivalent to, for example, pasteurization and / or microwave reheating. The inventors have discovered in a preferred embodiment the food emulsions obtained using

The enzymes of the invention have increased thermal stability.

EXAMPLE 14: Transferase reaction in egg yolk enriched with vegetable sterol

The transferase from Aeromonas salmonicida was able to catalyze the formation of lysolecitin,

20 monoglyceride and esters of vegetable sterol in egg yolk enriched with vegetable sterol and glycerol. The same enzyme was also tested in a system with little water containing palm oil, lecithin, vegetable sterol and glycerol by means of TLC and GLC analyzes it was shown that monoglyceride and plant sterol esters were produced under these reaction conditions.

25 Introduction

The activity of transferase in the Aeromonas salmonicida transferase in the lecithin, fat, plant sterol and glycerol system almost free of water was tested.

30 Materials:

Egg yolk: Pasteurized liquid egg yolk from Danæg Products A / S, DK-4000 Roskilde GCAT transferase purification 178-9, 32 PLU-7 / ml (Journal 2254-100)

35 Soy Lecithin, Yolking from Aarhus United, Denmark. Palm oil 43, from Aarhus United, Denmark. Vegetable 95% L-α phosphatidylcholine (Avanti No. 441601) Sitosterol, Sigma No. S5753 Vegetable sterol: Generol N122 of Cognis, Germany.

40 Glycerol article no 085915

Results

The initial identification of transferase activity in vegetable sterol and glycerol was performed in egg yolk as shown in Table 24.

Table 24

one

2 3 4

Yolk

grams one one one one

Glycerol

grams 0.1 0.1

Sitosterol: olle 3: 7

0.13 0.13

Transferase No. 178-9

units one one

Water

* *

* Water corresponding to the amount of water in the enzyme solution = 83 μl The ingredients were mixed and heated to 37 ° C and kept at this temperature during stirring

With a magnetic stirrer. 0.1 gram samples were taken after 3 and 23 hours and analyzed by TLC. The results of the TLC analysis are shown in Figure 63.

The result in Figure 63 indicated that both cholesterol and plant sterols were

esterified by the reaction with transferase, corresponding to the formation of lysolecitin (samples 3 and 4)

because almost all free sterol and cholesterol became the corresponding ester in sample 3.

5 The results also indicated that the sample with only glycerol and egg yolk produced monoglyceride. The amount of monoglyceride needs to be confirmed by GLC analysis. When sterol was added together with glycerol (sample 3) the amount of monoglyceride was very low and was not detectable by TLC. This indicated that as long as there is excess sterol or cholesterol the reaction with transferase using glycerol was modest.

In another experiment the enzyme transferase 178-9 was added to a mixture of soy lecithin, glycerol and vegetable sterol to study the catalytic activity of the enzyme in this reaction mixture.

The composition of the reaction mixtures in these experiments is presented in Table 25.

Table 25

one

2 3 4 5 6

Soy lecithin

g 1,875 2.25 1,875 2.5 3.5 3.5

Plantesterol; Generol N 122

g 0.225 0.225 0 0 0.225 0.5

Palm Oil 43

g 2,675 2.25 2.8 2,125 1,062 0.831

Glycerol

g 0.225 0.275 0.325 0.375 0.248 0.238

Transferase No. 178-9, 32 PLU / ml

ml 0.2 0.2 0.2 0.2 0.2 0.2

The experiment was performed by mixing the lipid components during stirring at 46 ° C. The enzyme was added and samples were taken after 4 and 24 hours.

The samples were analyzed by TLC as shown in Figure 64.

The sample of experiment 2, 4 and 5 after 24 hours of reaction was also analyzed by GLC whose results are shown in Table 26.

Table 26

245

Glycerol% 3.16 5.71 4.17

Fatty acids% 4.23 5.36 6.67

Mono% 2.24 3.87 3.92

Sterol% 2.13 2.62

Sterol ester% 2.89 2.14

25 The results confirmed that transferase 178-9 was able to catalyze the formation of sterol esters, vegetables and monoglycerides from a reaction mixture containing soy lecithin, glycerol and vegetable sterol. Said reaction mixture could be of interest for use in the production of margarine where monoglyceride is needed for its emulsification properties and plant sterol esters for its cholesterol reduction effect.

30 Conclusion

The CGAT transferase of Aeromonas salmonicida was able to catalyze the formation of sterol esters

Vegetable and monoglyceride in egg yolk where vegetable sterol and glycerol were added. The same enzyme

it also catalyzed the formation of vegetable sterol esters and monoglyceride in a mixture of palm oil,

35 lecithin, vegetable sterol and glycerol. The enzyme is therefore of interest for use in margarine and other foods that contain oil where monoglyceride and lysolecitin are needed to improve emulsification and plant sterol ester for its cholesterol reduction effects.

EXAMPLE 15: Immobilization of a lipid acyltransferase from Aeromonas salmonicida and 40 used in the synthesis of sterol esters

A lipid acyltransferase (in this case a GCAT) from Aeromonas salmonicida was immobilized in Celite by precipitation with acetone. 10 ml of enzymatic solution in 20 mM TEA buffer pH 7 with 0.1 gram of Celite 535 535 (from Fluka) was slowly stirred for 2 hours at room temperature.

50 ml of cold acetone was added during continued stirring. The precipitate was isolated by centrifugation at 5,000 g for 1 minute. The precipitate was washed twice with 20 ml of cold acetone. Celite was tested at room temperature for about 1 hour.

The immobilized transferase was tested in an oil mixture containing 13% phosphatidylcholine and 7% vegetable sterol (Table 27).

Table 27

%

Avanti Lecithin

12.0

Vegetable sterol Generol 122 N

6.6

Palm 43

71.4

Glycerol

5.0

Transferase No. 178 immobilized, 45 U / g

2.0

Water

3.0

5 Lecithin, vegetable sterol and soybean oil were heated to 46 ° C and the vegetable sterol was dissolved. Immobilized transferase was added.

The transferase reaction continued at 46 ° C during gentle stirring with a magnetic stirrer. Samples were taken for analysis after 1/2, 1, 3, 6 and 24 hours and analyzed by TLC. The reaction was stopped after 24 hours of reaction and the immobilized enzyme was filtered.

The samples were analyzed by TLC as shown in Figure 65.

The TLC analysis clearly shows the effect of immobilized transferase from A.

15 salmonicide in the transformation of cholesterol into cholesterol ester. It was also observed that a small amount of monoglyceride is formed. The enzyme had also been shown to have a high activity in aqueous media with high water content (6-89%), the use of transferase and other transferases by use in the invention can therefore also be used in enzyme applications immobilized with a significant water content. This allows the substitution of the solvents used by lipases

20 current assets in the bioconversion of lipids that use transferases.

EXAMPLE 16. Aeromonas hydrophila transferase can transfer from a phospholipid to a sterol to form a sterol ester and / or a sugar molecule to form a sugar ester

A lipid acyltransferase from Aeromonas hydrophila expressed in E. coli (Hydro 0303 HVP) labeled No. 139 was purified on a Chelating Sepharose FF, HR2.5 / 10 column and phospholipase activity was analyzed. Transferase activity was evaluated in egg yolk for enzymatic activity and functionality in egg yolk. The enzyme was also tested in egg yolk that contains glucose.

30 Phospholipase Activity

Transferase # 139 isolated from a HR 2.5 / 10 column of Sepharose Chelator FF was tested by NEFA / PLU (pH 7). The activity was 1.15 units of NEFA / PLU / ml.

35 Egg Yolk

In an initial application the test transferase No. 139 was tested in the egg yolk according to the following procedure.

40 1 gram of fresh egg yolk was weighed in a 10 ml flask with screw cap. The enzyme preparation was added and mixed in a Vortex mixer. The sample was placed at 37 ° C and stirred with a magnetic stirrer.

The reaction was stopped by adding 7.5 ml of chloroform: ethanol (2: 1) and mixed in a Whirley mixer for 30 seconds. The chloroform phase was isolated by centrifugation and 2 µl of the chloroform phase was transferred to a pre-activated silica TLC plate and eluted with current No. I buffer and another TLC plate in current IV buffer.

The experimental setup is presented in Table 28.

Table 28

Test

Reaction time Yolk Transferase No. 139

nº

min. g units

one

10

one

2

10 one 0.75 NEFA-PLU

3

60 one 0.75 NEFA-PLU

4

300 one 0.75 NEFA-PLU

5

1200 one

6

1200 one 0.75 NEFA-PLU

The TLC analysis is shown in Figure 66 and in Figure 67. The TLC analysis clearly demonstrates the transferase reaction of transferase # 139. Cholesterol is converted into cholesterol ester and the amount

5 lecithin is reduced. These results indicate, however, that lysolecitin accumulates only in a very small amount because transferase # 139 is also active in lysolecitin. This observation is supported by the formation of free fatty acids (FFA).

Egg yolk and glucose

10 It was demonstrated at the outset that a transferase from Aeromonas salmonicida (# 138) could use glucose as a receptor molecule in a reaction with transferase. It has also been tested whether transferase # 139 can use glucose as a receptor molecule. The experimental setup is seen in Table 29.

Table 29

Test

Reaction time Yolk Glucose, 70% Transferase No. 139

nº

Minutes g mg units

one

10  one 500

2

10 one 500 1 NEFA-PLU

3

60 one 500 1 NEFA-PLU

4

180 one 500 1NEFA-PLU

5

300 one 500 1 NEFA-PLU

6

1200 one 500 1 NEFA-PLU

7

1200 one 500

The reaction products were analyzed by TLC (figure 68 and figure 69).

TLC analysis indicates the formation of glucose ester after 220 min of reaction time (figure 69 band 6) but after 1,200 min of reaction time no glucose ester is seen.

20 It must therefore be concluded that transferase No. 139 exhibits both transferase and hydrolytic activity. This is also supported by the fact that the amount of free fatty acids increases regularly depending on the reaction time.

Summary

25 Transferase from Aeromonas hydrophila was tested in egg yolk. The results confirm that this enzyme catalyzes the corresponding cholesterol ester formation with the formation of lisolecitin. After a prolonged reaction time when most of the cholesterol is consumed, fatty acids are also formed. Therefore it can be concluded that the enzyme has primary transferase activity but hydrolytic activity was also observed when only water was available as a molecule

30 donor

In an experiment with egg yolk and glucose it has been observed that Aeromonas transferase

hydrophila can catalyze the formation of glucose ester in situ in a food medium with a lot of water (figure

70).

EXAMPLE 17: Variants of a lipid acyltransferase from Aeromonas hydrophila (Ahyd2) (SEQ ID No. 36 (see Figure 71))

Mutations were introduced using the QuikChange® mutagenesis kit directed to several sites, La Jolla, 40 CA 92037, USA following the instructions provided by Stratagene.

The variants in Tyr256 showed an increase in activity towards phospholipids.

The variants in Tyr256 and Tyr260 showed an increase in activity with galactolipids.

Variants in Tyr265 show an increase in transferase activity with galactolipids as the acyl donor.

The numbers indicate positions in the following sequence: An enzyme from the amino acid sequence of Aeromonas hydrophila from which it presents as SEC. ID. No. 36 in Figure 71 (the underlined amino acids show a xylanase signal peptide). The nucleotide sequence is as shown by SEC. ID. No. 54 in FIGURE 72.

EXAMPLE 18: Use of the acyl transferase reaction for the production of a vegetable sterol ester and monoglyceride for the production of margarine

An acyltransferase from Aeromonas salmonicida presented in Bacillus subtilis was tested on a palm oil sample containing vegetable lecithin, vegetable sterol and glycerol. Acyltransferase had the ability to use both plant sterol and glycerol as receptor molecules during the production of a plant sterol ester and monoglyceride. The reaction mixture was used to produce good quality table margarine based on the monoglyceride in the reaction mixture and at the same time the margarine was enriched with plant sterol ester, which has been shown to have a cholesterol lowering effect.

The objective of this work was to study the probability of producing monoglyceride and vegetable sterol ester by enzymatic reaction of lecithin, vegetable sterol and glycerol dissolved in vegetable fat.

Initial experiments have shown that it was possible to use acyltransferase from Aeromonas salmonicida to produce monoglyceride and plant sterol ester from lecithin, glycerol and plant sterol.

In this experiment said reaction mixture was used to produce table margarine.

materials

Lipid acyltransferase from Aeromonas salmonicida, No. 196 C101, 18.6 PLU / g (Journal 2254-104)

Palm oil 43 from Aarhus United, DK Vegetable 95% L-α phosphatidylcholine (Avanti No. 441601) Vegetable sterol: Generol N122 from Cognis, Germany Glycerol article no 085915 Distilled monoglyceride, Dimodan HP from Danisco.

Margarine production

one.

The ingredients of the aqueous phase are mixed. (If required, the aqueous phase is pasteurized by heating at approx. 80 ° C). The pH is adjusted to 5.5.

2.

The fatty phase is melted and tempered to approx. 40-45 ° C.

3.

The emulsifier is heated with some oil in a proportion of one part of emulsifier to 5 parts of oil at a temperature (75-80 ° C), which is 5 to 10 ° C higher than the melting point of the emulsifier. When this mixture is completely melted and well stirred, it is added to the remaining hot oil, continuously stirring.

Four.

The flavoring is added.

5.

The aqueous phase is added to the fatty phase with continuous stirring.

6.

It is cooled in a tube refrigerant (normal capacity, normal cooling) to an external temperature between 8 and 10 ° C.

Results

Acyltransferase from A. salmonicide was tested in a palm oil mixture as shown in Table 30. The lecithin, vegetable sterol, glycerol and palm oil was heated at 60 ° C during stirring to dissolve the vegetable sterol and lecithin.

Table 30

Substrate% Avanti Lecithin 12 Plant sterol, Generol 122 N 6.6 Palm oil, melting point 43 76.4 Glycerol 5

The substrate was cooled to 48 ° C and acyltransferase No. 196 was added in the amount shown in Table 31. The reaction mixture was maintained at 48 ° C for 24 hours under slow stirring.

Table 31

Substrate grams Transferase No. 196 C101, 18.6 220 PLU / g 15

10 Samples of the reaction mixture were taken after 1, 4 and 24 hours of reaction time and analyzed by TLC in solvent I (Figure 73). The TLC results clearly show the formation of the vegetable sterol ester and monoglyceride. In Figure 73, the first band is after 1 hour of reaction time, band 2 is 4 hours of reaction time, band 3 is 24 hours of reaction time and band 4 is a plant sterol. The reaction was interrupted after 24 hours of reaction time and residues of the undissolved vegetable sterol were removed and the clear solution was used to produce margarine.

Margarine 20 The reaction mixture containing monoglyceride and vegetable sterol ester was used to produce table margarine according to the recipe shown in Table 32

Table 32

Jour. No. 3734

one 2

Aqueous phase

Aqueous phase

16 16

Salt

0.5 0.5

Powdered Milk Cream

one one

Potassium sorbate

0.1 0.1

EDTA

0.015 0.015

pH

5.5 5.5

Total aqueous phase

16.6 16.6

Fat phase

Palma 43

25 25

Rapeseed oil

75 75

Total fat phase

83.2 78.4

Dimodan HP

0.2

Reaction mixture

5

25 Margarine produced from the reaction mixture was evaluated in good quality with good extensibility

and good taste and without lack of flavor. Margarine was compared at a quality level referring to the

margarine produced using Dimodan HP distilled monoglyceride.

The only difference observed was that the margarine jour. 3734 No. 2 with the reaction mixture was slightly more consistent, which was explained by the fact that this recipe contained more Palm 43 than the reference margarine.

EXAMPLE 19: Use of a lipid acyltransferase during bread production

35 One of the limitations of using lipases in bread making is that free fatty acid is formed during the lipase reaction. It is well known that the formation of too much free fatty acid will have a negative impact on the cooking performance of the flour because the gluten also gives stiffness and forms a spongy (ie less elastic) dough that cannot expand during fermentation and cooking

The formation of free fatty acid should also be avoided from the point of oxidative stability, because

5

fifteen

25

35

Four. Five

55

Free fatty acids are more prone to lipid oxidation than the corresponding triglyceride.

In the present invention the problems of formation of free fatty acids by adding a lipolytic enzyme to a mass has been overcome using a lipid acyltransferase which, instead of producing free fatty acids, transfers one or more fatty acids from the lipid-acylate donor to a receiving molecule without water present in the dough, such as a carbohydrate, a protein or a peptide, or if used in bread with milk fat, a sterol, alternatively or in combination with other receptors listed above can be added to the dough, by example phytosterols or phytostanols. Preferably, the receptor molecule in a mass may be one or more of glucose, sucrose or maltose and / or other carbohydrates normally available in a mass.

In the following experiments, acyltransferase is tested in mini scale cooking experiments. The formation of reaction products, and the lipid components in the fully tested mass is extracted by water-saturated butanol and analyzed by HPLC and GLC analysis.

Materials and procedures

Enzymes

Acyltransferase, 550 PLU-7 / ml

LipopanTM F BG, Novozymes commercial lipase, 12000 LIPU / g or Grindamyl Exel 16. 12000 LIPU / g.

Lecithin powder, 95% phospholipids (available from Danisco A / S, Denmark)

Digalactosyl diglyceride whole wheat flour (from Sigma D4651)

Flour: Sølvmel nº 2001084 (Danish wheat flour purchased in Havnemøllerne, Odense, Dinamrca)

Mini cooking test

50 grams of flour, 10 grams of anhydrous yeast, 0.8 grams of glucose, 0.8 grams of salt, 70 ppm of ascorbic acid and 400 Brabender units of water were kneaded in a 50 g Brabender mixing bowl for 5 min at 30 ° C.

The remaining time was 10 min. at 34 ° C. 15 grams of dough were weighed. It was then molded into a special device where the dough is kneaded with rollers on a wooden plate and a plexiglass frame. The doughs were canned tightly for 45 min at 34 ° C and cooked in a Voss 8 min domestic oven. at 225 ° C.

After cooking the breads are cooled to room temperature and after 20 min. the loaves are weighed and the volume is determined by the method of displacement of the rapeseed seed. The breads are also cut and crumb and crust are evaluated.

Results and conclusion

Preliminary results indicate that lipid acyltransferase clearly demonstrates a positive effect on both the volume of the bread and the appearance of the bread. In particular, preliminary results indicate that lipid acyltransferase produces an increase in specific bread volume compared to that obtained with the reference (without enzyme) and with that obtained with the use of a commercially available lipolytic enzyme, that is Grindamyl Exel 16 or Lipopan FTM.

EXAMPLE 20: Conventional ice cream with milk fat

The function of the emulsifiers used in the ice cream is to effect the controlled crystallization of the fat and the mild destabilization due to the desorption of the proteins during the aging of the ice cream. This change improves the quality of the ice cream. Monodiglycerides are normally used for the production of ice cream but it is also known to use polar emulsifiers such as polysorbates and sugar esters in the production of ice cream combined with monodiglycerides to facilitate the controlled destabilization of fat and produce ice cream with very good creaminess and texture. soft in the mouth

The emulsifiers used for ice cream are normally added to the powder ice cream mixture. Recently it has been shown, however, that monodiglycerides can be produced by enzymatic action of the fat in the ice cream recipe using lipases. The problem with using lipases is, however, that lipases also catalyze the formation of free fatty acids when water is available in the reaction mixture.

It has surprisingly been shown, however, that lipid acyltransferase exceeds the limitation by lipase because acyltransferase can transfer fatty acid from lecithin and other lipids from receptor molecules such as sterol, cholesterol, glucose, glycerol and proteins / peptides without the formation of an amount. Significant free fatty acids.

One of the main ingredients in ice cream is milk cream that contains 38% fat

milk. Milk cream also contains smaller amounts of lecithin, which is a donor molecule.

for acyltransferase ("complex milk lipids total approximately 1% of the total fat in the

5 milk and are mainly composed of phospholipids ". Ref. Ullmann's Encyclopedia of Industrial Chemistry Copyright® 2003 by Wiley VCH Verlag GmbH & Co. KGaA.). Milk cream also contains small amounts of cholesterol which is an acyltransferase receptor molecule .

From the ice cream constituents it is thus possible to produce both monoglycerides and 10 polar emulsifiers such as lysolecithin and sugar ester, which are known for their beneficial effects on ice cream production.

An additional beneficial effect of the acyltransferase reaction in milk cream is the formation of the cholesterol ester, which can reduce the absorption of cholesterol in the intestine. 15 Ice Cream Recipe

With emulsifier With enzyme

Milk cream, 38% 23.65 23.65 Skim milk 53.30 53.30 Skim milk powder 4.90 11.30 Sugar 12.00 12.00 Glucose syrup, DE 42, 75% TS 4.25 4.25 Glycerol 1.0 1.0 Stabilizer mixture 0.2 0.2 Cremodan SE 30 0.6 Lipid acyltransferase, 500 PLU / g 0.1 Grindsted yeast 2976 0.1 0.1 Color + +

Ice cream production procedure 20

1. Milk cream, glucose syrup and glycerol are heated to approx. 40 ° C The lipid acyltransferase is added and the mixture is allowed to act for 30 minutes. A sample is taken for analysis.

2.

All other liquid ingredients are heated to approx. 40 ° C 25

3. The other dry ingredients are added. (The stabilizing mixture is mixed with sugar before the addition).

Four.

When the dry ingredients are dissolved, the milk-glucose 30 cream mixture is added

5.

It is pasteurized between 80 to 85 ° C / 20 to 40 seconds.

6.

It is homogenized at 80ºC (190 bars for recipe 1 and 175 bars for recipe 2)

35 7. Cool to aging temperature, 4 ° C

8. Freeze in a continuous freezer for desired overproduction (100% recommended)

9. It hardens in a tunnel at -40 ° C. 40

10. It is stored below -25ºC

Results

45 Acyltransferase uses in ice cream production contribute to the production of ice cream with very good flavor and excellent creamy sensation on the palate comparable to ice cream produced using a commercial Cremodan Se 30 emulsifier. Melting of ice cream produced by lipid acyltransferase improves too.

EXAMPLE 21: Acyltransferase in cheeses

Cheese is the solid or semi-solid, fresh or ripened product obtained by coagulation of milk, skim milk, partially skim milk, cream, buttermilk or butter, or by any combination of these materials, by the action of rennet or other suitable coagulating agents and partially draining the serum which produces said coagulation.

The performance in cheese depends mainly on the fat and protein content of milk. Salt (particularly calcium salts) and protein concentrations, as well as acidity, are very important for coagulation (ref. Ullmann’s Encyclopedia of Industrial Chemistry Copyright® 2003 by Wiley VCH Verlag GmbH & Co).

Such efforts have been made to optimize and increase the yield in cheese by optimizing the cheese-making process (US Patent No. 4,959,229) or using the improved coagulation procedure (US Patent No. 4,581,240), which increases the amount of whey protein in cottage cheese.

In the present invention the amount of whey proteins in the cottage cheese increases by enzymatic modification of the whey protein by treating the milk during cheese making with a lipid acyltransferase.

When a fatty acid is covalently bound to a non-membrane protein such as β-lactoglobulin, the physical and functional properties will change dramatically.

For the production of cheese of the present invention, acyltransferase is added to the milk before or at the same time that the rennet is added to the milk.

During precipitation with casein, acyltransferase can use lecithin and other lipids in milk as a donor and peptides or proteins as a receptor molecule during the formation of acylated protein or acylated peptides.

The change in the hydrophobic properties of milk protein helps to increase the precipitation of protein in the cottage cheese during cheese production.

Given the increase in cheese yield obtained by the present invention originates from the increase in retention in the cheese clot of proteins that are normally lost in the whey, a suitable procedure, directly related to the mechanism of the invention, It is based on the determination of the amount of protein that ends up in the serum. Lower whey protein necessarily means more protein in cottage cheese and higher cheese yield.

The assay of the amount of protein in serum electrophoresis can be performed as follows. Skim or whole milk is heated to a temperature suitable for coagulation with rennet, usually from 30 to 35 ° C in a 100 ml beaker. Optionally 1% of a lactic acid initiating bacterium is added for the most part, and normal rennet is added in an amount corresponding to, for example, 0.03 to 0.05%. When the milk has become a solid clot sufficient to allow it to be cut into small cubes with a blade of approximately 0.05 cm in length, said cut is made with a sharp knife. The syneresis is started in this way and after 30 minutes of waiting period, allowing the curd to settle, a serum sample is extracted, and centrifuged in a laboratory centrifuge for 10 min. In this sample the protein content is analyzed, using for example the Kjeldahl method. Alternatively, and / or as a complement, the sample can be analyzed by procedures that allow establishing the type and quantity of the individual protein components.

EXAMPLE 22 "Test in medium with little water"

Transferase reactions of lipolytic enzymes in a medium with little water.

Process

materials

Cholesterol Sigma cat. C 8503 95% L-alpha-phosphatidylcholine (vegetable) Aventi No. 441601 Soybean oil, Aarhus United, DK Chloroform, analytical quality

Enzymes

No. 179, GCAT of A. salmonicida

5 No. 2427, Fusarium oxysporum phospholipase A1, LIPOPAN® F from Novozymes, Denmark

No. 1991, phospholipase A2 of the pancreas, LIPOMOD 22L from Biocatalysts, UK

No. 2373, Candida antarcica lipase, Novozyme 525 L from Novozymes, Denmark. 10 Enzymatic analysis

13.1% lecithin and 6.6% cholesterol were dissolved in soybean oil by heating at 60 ° C during stirring. The substrate was weighed in a 20 ml Wheaton glass and heated to 46 ° C

Water and enzyme solution were added and a stopwatch was started.

At regular intervals, 50 mg samples were transferred to a 10 ml Dram glass and frozen.

Isolated lipids were analyzed by GLC.

GLC Analysis 25 GLC analysis was performed as described in Example 11.

Results

30 The experiment was carried out as shown in Table 33.

The soybean oil-based substrate containing 13.1% lecithin and 6.6% cholesterol was heated to 46 ° C. The enzyme solution was added and a stopwatch was started.

After 30, 60 and 120 minutes of reaction time samples were taken for the GLC analysis.

Table 33

12345 Substrate g55555 Transferase No. 179-C72, 56 PLU-7 / ml ml 0.3 No. 2427, 200 PLU-7 / ml ml 0.3 Pancreas PLA2 No. 1991 6300 PLU / ml ml 0.3 Novozymes 525 L, No. 2373 , 200 LIPU / ml ml 0.3 Water ml 0.3% water 66666

40 The results of the GLC analysis are shown in Table 34. The results are expressed as a percentage referring to the total composition of the sample. Based on the results of the GLC, it was possible to calculate the amount of fatty acids and cholesterol ester produced by the enzymatic reaction corresponding to the reference sample without added enzyme. Under these experimental conditions the total enzyme activity was estimated as the hydrolytic activity measured as the formation of free fatty acid and the transferase activity estimated as cholesterol ester formation. From these results and information about the molecular weight of fatty acid and cholesterol ester it was possible to calculate the relative molar hydrolytic activity and the relative molar transferase activity as shown in Table 35.

Table 34

Control

Reaction time, Fatty acid, Cholesterol, Cholesterol ester,

enzymatic

minutes % % %

Control

120 0.533 7,094 0.000

# 179

30 0.770 5,761 2,229

# 179

60 0.852 5,369 2,883

# 179

120 0.876 4,900 3,667

# 2427

30 3,269 7,094 0.000

# 2427

60 3,420 7,094 0.000

# 2427

120 3,710 7,094 0.000

# 1991

30 2,871 7,094 0.000

# 1991

60 3,578 7,094 0.000

# 1991

120 3,928 7,094 0.000

# 2373

30 1,418 7,094 0.000

# 2373

60 1,421 7,094 0.000

# 2373

120 1,915 7,094 0.000

Table 35

Enzyme Acid Time Cholesterol Cholesterol ester Activity Reaction activity, fat used produced hydrolytic, transferase,% minutes produced%

# 179 30 0.238 1,334 2,229 20 80 # 179 60 0,319 1,725 2,883 21 79 # 179 120 0,343 2,195 3,667 18 82

# 2427 30 2,737 0.000 0.000 100 0 # 2427 60 2.887 0.000 0.000 100 0 # 2427 120 3.177 0.000 0.000 100 0 # 1991 30 2.338 0.000 0.000 100 0 # 1991 60 3.046 0.000 0.000 100 0 # 1991 120 3.395 0.000 0.000 100 0 # 2373 30 0.885 0.000 0.000 100 0 # 2373 60 0.888 0.000 0.000 100 0 # 2373 120 1.383 0.000 0.000 100 0

5 Conclusion

In these experiments it was observed that all the enzymes tested had hydrolytic activity

due to the increased amount of fatty acid. However, the only enzyme that had activity of

Transferase was GCAT of A. salmonicide. It is therefore concluded that the only system with lecithin and cholesterol

10 containing 6% phospholipase A1 in Fusarium oxysporum water, pancreas phospholipase A2 and Candida antarcica lipase only had hydrolytic activity.

Claims (26)

one.

Process for the production in situ of an emulsifier in a food containing water, in which the process comprises the step of adding a lipid acyltransferase to the food, in which the lipid acyltransferase is characterized as an enzyme that exhibits acyltransferase activity and comprising the GDSX motif of the amino acid sequence, in which X is one or more of the following amino acid residues L, A, V, I, F, Y, H, Q, T, N, M or S.

2. A method according to claim 1, wherein at least 2 emulsifiers are produced.

3.

Method according to claim 1 or 2, wherein the lipid acyltransferase is one that can transfer an acyl group from a lipid to one or more of the following acyl receptors: a sterol, a stanol, a carbohydrate, a protein or a subunit of it, glycerol.

Four.

Process according to claim 2, wherein at least one of the emulsifiers is a carbohydrate ester.

5.

Process according to claim 2, wherein at least one of the emulsifiers is a protein ester.

6.

Process according to any one of the preceding claims in which one or more of a sterol ester or a stanol ester or a protein ester or a carbohydrate ester or a diglyceride or a monoglyceride is produced in situ in the food.

7.

Method according to claim 6, wherein the sterol ester is one or more of the alpha-sitosterol ester, beta-sitosterol ester, stigmasterol ester, ergosterol ester, campesterol ester or cholesterol ester.

8.

Process according to claim 6, wherein the stanol ester is one or more of betasitostanol or ss-sitostanol.

9.

Method according to any of the preceding claims, wherein the lipid acyltransferase enzyme comprises H-309 or comprises a histidine residue at a position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme presented as SEC. ID. nº 2 or SEC. ID. nº 32.

10.

Method according to any one of the preceding claims in which the lipid acyltransferase can be obtained from an organism of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Campyloaecterium, Campyloaceae, Vibraaceae , Xylella, Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida.

eleven.

Method according to any of the preceding claims wherein the lipid acyltransferase comprises one or more of the following amino acid sequences: (i) the amino acid sequence presented as SEC. ID. No. 2; (ii) the amino acid sequence presented as SEC. ID. No. 3; (iii) the amino acid sequence presented as SEC. ID. No. 4; (iv) the amino acid sequence presented as SEC. ID. No. 5; (v) the amino acid sequence presented as SEC. ID. No. 6; (vi) the amino acid sequence presented as SEC. ID. No. 12, (vii) the amino acid sequence presented as SEC. ID. No. 20, (viii) the amino acid sequence presented as SEC. ID. No. 22, (ix) the amino acid sequence presented as SEC. ID. No. 24,

(x) the amino acid sequence presented as SEC. ID. No. 26, (xi) the amino acid sequence presented as SEC. ID. No. 28, (xii) the amino acid sequence presented as SEC. ID. No. 30 (see Figure 26), (xiii) the amino acid sequence presented as SEC. ID. No. 32, (xiv) the amino acid sequence presented as SEC. ID. No. 34, or an amino acid sequence that has 75% or more identity with any of the sequences presented as SEC. ID. No. 2, SEC. ID. No. 3, SEC. ID. No. 4, SEC. ID. No. 5, SEC. ID. No. 6, SEC. ID. No. 12, SEC. ID. No. 20, SEC. ID. No. 22, SEC. ID. No. 24, SEC. ID. No. 26, SEC. ID. No. 28, SEC. ID. No. 30, SEC. ID. No. 32 or SEC. ID. No. 34. 12. A method according to any one of claims 1 to 10 wherein the lipid acyltransferase comprises an amino acid sequence produced by the expression of one or more of the following nucleotide sequences:

(to)

the nucleotide sequence presented as SEC. ID. No. 7 (see Figure 9);

(b)

the nucleotide sequence presented as SEC. ID. No. 8 (see Figure 10);

(C)

the nucleotide sequence presented as SEC. ID. No. 9 (see Figure 11);

(d)

the nucleotide sequence presented as SEC. ID. No. 10 (see Figure 12);

(and)

the nucleotide sequence presented as SEC. ID. No. 11 (see Figure 13);

(F)

the nucleotide sequence presented as SEC. ID. No. 13 (see Figure 15);

(g)

the nucleotide sequence presented as SEC. ID. No. 21 (see Figure 17);

(h)

the nucleotide sequence presented as SEC. ID. No. 23 (see Figure 19);

(i)

the nucleotide sequence presented as SEC. ID. No. 25 (see Figure 21);

(j)

the nucleotide sequence presented as SEC. ID. No. 27 (see Figure 23);

(k)

the nucleotide sequence presented as SEC. ID. No. 29 (see Figure 25);

(l)

the nucleotide sequence presented as SEC. ID. No. 31 (see Figure 27);

(m)

the nucleotide sequence presented as SEC. ID. No. 33 (see Figure 29);

(n)

the nucleotide sequence presented as SEC. ID. No. 35 (see Figure 31);

(or)

or

a nucleotide sequence that has 75% or more identity with any of the sequences presented as SEC. ID. No. 7, SEC. ID. No. 8, SEC. ID. No. 9, SEC. ID. No. 10, SEC. ID. No. 11, SEC. ID. No. 13, SEC. ID. No. 21, SEC. ID. No. 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. No. 29, SEC. ID. No. 31, SEC. ID. No. 33 or SEC. ID. No. 35. 13. Method according to any of the preceding claims, wherein the emulsifier is one or more of the following: a monoglyceride, a lysophosphatidylcholine, a digalactosyl monoglyceride.

14.

Use of a lipid acyltransferase to prepare from a food material a food comprising an emulsifier, in which the emulsifier is produced without increasing or substantially increasing the free fatty acids in the food, and in which the emulsifier is generated by the lipid acyltransferase from the constituents of the food material, in which the lipid acyltransferase is characterized as an enzyme exhibiting acyltransferase activity and comprising the GDSX motif of the amino acid sequence, in which X is one or more of the amino acid residues following L, A, V, I, F, Y, H, Q, T, N, M or S.

15. Use according to claim 14, wherein at least two emulsifiers are produced.

16.

Use according to claim 15, wherein at least one of the emulsifiers is a carbohydrate ester.

17.

Use according to claim 15, wherein at least one of the emulsifiers is a protein ester.

18.

Use according to any of claims 14 to 15 wherein one or more of a sterol ester or a stanol ester or a protein ester or a carbohydrate ester or a diglyceride or a monoglyceride is also produced in situ in the food .

19.

Use according to claim 18, wherein the sterol ester is one or more of the alpha-sitosterol ester, beta-sitosterol ester, stigmasterol ester, ergosterol ester, campesterol ester or cholesterol ester.

twenty.

Use according to claim 18, wherein the sterol ester is one or more of betasitostanol or ss-sitostanol.

twenty-one.

Use according to any of claims 14 to 20, wherein the lipid acyltransferase enzyme comprises H-309 or comprises a histidine residue at a position corresponding to His-309 in the amino acid sequence of the Aeromonas hydrophila lipolytic enzyme presented as SEC . ID. nº 2 or SEC. ID. nº 32.

22

Use according to any of claims 14 to 21, wherein the lipid acyltransferase can be obtained from an organism of one or more of the following genera: Aeromonas, Streptomyces, Saccharomyces, Lactococcus, Mycobacterium, Streptococcus, Lactobacillus, Desulfitobacterium, Bacillus, Bacillus,

Campylobacter, Vibrionaceae, Xylella, Sulfolobus, Aspergillus, Schizosaccharomyces, Listeria, Neisseria, Mesorhizobium, Ralstonia, Xanthomonas and Candida. 23. Use according to any of claims 14 to 22, wherein the lipid acyltransferase comprises one or more of the following amino acid sequences: (i) the amino acid sequence presented as SEC. ID. No. 2; (ii) the amino acid sequence presented as SEC. ID. No. 3; (iii) the amino acid sequence presented as SEC. ID. No. 4; (iv) the amino acid sequence presented as SEC. ID. No. 5; (v) the amino acid sequence presented as SEC. ID. No. 6; (vi) the amino acid sequence presented as SEC. ID. No. 12, (vii) the amino acid sequence presented as SEC. ID. No. 20, (viii) the amino acid sequence presented as SEC. ID. No. 22, (ix) the amino acid sequence presented as SEC. ID. No. 24, (x) the amino acid sequence presented as SEC. ID. No. 26, (xi) the amino acid sequence presented as SEC. ID. No. 28, (xii) the amino acid sequence presented as SEC. ID. No. 30, (xiii) the amino acid sequence presented as SEC. ID. No. 32, (xiv) the amino acid sequence presented as SEC. ID. No. 34, or an amino acid sequence that has 75% or more identity with any of the sequences presented as SEC. ID. No. 2, SEC. ID. No. 3, SEC. ID. No. 4, SEC. ID. No. 5, SEC. ID. No. 6, SEC. ID. No. 12, SEC. ID. No. 20, SEC. ID. No. 22, SEC. ID. No. 24, SEC. ID. No. 26, SEC. ID. No. 28, SEC. ID. No. 30, SEC. ID. No. 32 or SEC. ID. No. 34. 24. Use according to any of claims 14 to 23, wherein the lipid acyltransferase comprises an amino acid sequence produced by the expression of one or more of the following nucleotide sequences:

(to)

the nucleotide sequence presented as SEC. ID. No. 7 (see Figure 9);

(b)

the nucleotide sequence presented as SEC. ID. No. 8 (see Figure 10);

(C)

the nucleotide sequence presented as SEC. ID. No. 9 (see Figure 11);

(d)

the nucleotide sequence presented as SEC. ID. No. 10 (see Figure 12);

(and)

the nucleotide sequence presented as SEC. ID. No. 11 (see Figure 13);

(F)

the nucleotide sequence presented as SEC. ID. No. 13 (see Figure 15);

(g)

the nucleotide sequence presented as SEC. ID. No. 21 (see Figure 17);

(h)

the nucleotide sequence presented as SEC. ID. No. 23 (see Figure 19);

(i)

the nucleotide sequence presented as SEC. ID. No. 25 (see Figure 21);

(j)

the nucleotide sequence presented as SEC. ID. No. 27 (see Figure 23);

(k)

the nucleotide sequence presented as SEC. ID. No. 29 (see Figure 25);

(l)

the nucleotide sequence presented as SEC. ID. No. 31 (see Figure 27);

(m)

the nucleotide sequence presented as SEC. ID. No. 33 (see Figure 29);

(n)

the nucleotide sequence presented as SEC. ID. No. 35 (see Figure 31);

(or)

or

a nucleotide sequence that has 75% or more identity with any of the sequences presented as SEC. ID. No. 7, SEC. ID. No. 8, SEC. ID. No. 9, SEC. ID. No. 10, SEC. ID. No. 11, SEC. ID. No. 13, SEC. ID. No. 21, SEC. ID. No. 23, SEC. ID. No. 25, SEC. ID. No. 27, SEC. ID. No. 29, SEC. ID. No. 31, SEC. ID. No. 33 or SEC. ID. No. 35.

25.

Use according to any of claims 14 to 24, wherein the emulsifier is one or more of the following: a monoglyceride, a lysophosphatidylcholine, a digalactosyl monoglyceride.

26.

Food containing water that can be obtained by the process according to any one of claims 1 to 13, wherein the food comprises a lipid acyl transferase as defined in claim 1 and an emulsifier.