DK175778B1 - Kit for amplification and detection of specific nucleic acid sequences - used to characterise or detect sequences associated with infectious diseases, genetic disorders and cellular disorders - Google Patents

Abstract

A kit (I) for the amplification and detection of at least 1 specific nucleic acid in a sample comprises in a packaged multicontainer unit form: (a) primers for each specific nucleic acid, that are complementary to both strands, such that the extension prod. of a primer can serve as a template for the complementary strand; (b) means for synthesising primer extension prods.; and (c) means for detecting amplified seuqence or sequences.

Description

in DK 175778 B1

The present invention relates to a kit for use in multiplying existing nucleic acid sequences if present in a test sample and to detect them if present using a probe. In particular, the oligonucleotides allow the production of any particular nucleic acid sequence 5 from a given sequence of DNA or RNA in amounts that are large compared to the amount initially present, so that detection of the sequences is facilitated.

The DNA and RNA may be single-stranded or double-stranded and may be either in relatively pure form or as a component of a mixture of nucleic acids. The process utilizes a repeated reaction to perform the multiplication of the desired nucleic acid sequence.

Particularly for diagnostic applications, the target nucleic acid sequence may be only a small portion of the DNA or RNA concerned, so that it may be difficult to detect its presence using non-isotopically labeled or end-labeled oligonucleotide probes. A great deal of effort is used to increase the sensitivity of the probe detection systems, but not much research has been done on multiplying the target sequence to be present in amounts sufficient to be easily detectable using the methods used for time is available.

(20 Several methods have been described in the literature on de novo synthesis of nucleic acids or synthesis of nucleic acids from an existing sequence. These methods are capable of generating large amounts of a given nucleic acid with fully specified sequence.

One known method for de novo synthesis of nucleic acids involves organic synthesis of a nucleic acid from nucleoside derivatives. This synthesis can be carried out in solution or on a solid support. One type of organic synthesis is the phosphotriester method, which has been used to produce gene fragments or short genes. In the phosphotriester method, oligonucleotides are prepared which can then be joined to form long nucleic acids. For a description of this method see Narang, S.A. et al.,

Meth. Enzymol. 68. 90 (1979) and US Patent No. 4,356,270. The patent describes the synthesis and cloning of the somatostatin gene.

Another type of organic synthesis is the phosphodiester method, which has been used to produce a tRNA gene. See Brown, E.L. et al., Meth. Enzvmol .. 68. 109 (1979) for a description of this method. As in the phosphotriester method, the phosphodiester method comprises synthesis of oligonucleotides which are subsequently joined to form the desired nucleic acid.

Although the aforementioned de novo synthesis methods can be used for the synthesis of long strands of nucleic acid, they are not very practical to use for the synthesis of large amounts of a nucleic acid. Both approaches are labor intensive and

I DK 175778 B1 I

I I

time consuming, requires expensive equipment and expensive reagents and has a low overall efficiency.

I The low overall efficiency may be due to inefficiencies in the synthesis of oligonucleotide H

In there and in the joining reactions. 1 the synthesis of a long nucleic acid or even H

in the synthesis of a large amount of a short nucleic acid it will be necessary to synthesize- H

Many oligonucleotides are present in 5, and many joining reactions will be needed

In tions. As a result, these methods will not be practical for the synthesis of large H

In amounts of any desired nucleic acid. H

Methods for the preparation of nucleic acids in large quantities also exist

In 10 from small amounts of the initially present nucleic acid. These methods- H

In which, cloning of a nucleic acid comprises a suitable host system wherein the desired H

In nucleic acid is inserted into a suitable vector which is used to transform weather H

H ten. As the host is grown, the vector is replicated, thus producing multiple copies of H

the desired nucleic acid. For a brief description of the subcloning of nucleic acid fragments I

15 See Maniatis T. et al., Molecular Cloning: A Laboratory Manual. Cold Spring I

In Harbor Laboratory, pp. 390-401 (1982). See also the techniques described in U.S. Patent No. I

I 4,416,988 and No. 4,403,036. IN

I A third method for synthesizing nucleic acids described in U.S. Pat

In Tent No. 4,293,652, a hybrid is between the organic synthesis described above and H

In Methods of Molecular Cloning. In this process, a suitable number of H is obtained

oligonucleotides to form the desired nucleic acid sequence synthesized organic H

I and inserted sequentially into a vector that is multiplied by growth prior to each successive H

In the past insert. IN

I I

The methods which can be performed using the kit of the present invention

The present invention bears some resemblance to the method of molecular cloning, but it does

However, you do not include the propagation of any organism, thereby avoiding the possible I

hazards or impractical conditions that result. The process also requires H

30 non-synthesis of nucleic acid sequences unrelated to the desired sequence, H

thereby avoiding the need for extensive purification of the product from an H

complicated biological mixing. IN

In J. Mol. Bio .. 56, pp. 341-361 (1971) discusses Kleppe et al. primer extension reaction- I

35 using templates corresponding to portions of a tRNA gene in which the reaction I

tions the primers used are complementary to essential parts of corresponding tem

plates and extended along these to produce duplex DNAs. These templates- I

copy reactions involving simple primer extension are referred to as repair replicas

I tion ”by the authors. The last section of the article puts forward theories that if you

In 40 duplex DNA denaturation affected by the presence of suitable primers, I would

You could create two structures consisting of full-length template strings in I

In complex with a primer after cooling and "repair replication" obtained by the addition of I

I i I

I I

3 DK 175778 B1 DNA polymerase. It is proposed in that section that the procedure could be repeated.

However, no detailed explanation of exactly which techniques can be used or any discussion of which primers are "suitable" and the possibility of a template renaturation problem (recovery of a duplex) is discussed with the suggestion, if necessary, that separation of strings must necessarily be reversed with subsequent "repair replication".

The kit of the present invention is used in methods for multiplication of one or more specific nucleic acid sequences present in a nucleic acid or mixture thereof using primers and agents for polymerization and then detecting the multiplied sequence. The hybrid product of one primer, when hybridized to the other, becomes a template for the production of the desired specific nucleic acid sequence and vice versa, and the process can be repeated as often as necessary to produce the desired amount of the sequence. This method is expected to be more effective than the methods described above for generating large amounts of nucleic acid from a target sequence and for producing such nucleic acids in a comparatively short time. The method is particularly useful for multiplying rare nucleic acids present in a mixture of nucleic acids for efficient detection of such rare nucleic acids.

Specifically, the present invention provides an exponential multiplication and detection kit for multiplying and detecting a specific template nucleic acid sequence or specific template nucleic acid sequences contained in a single or double stranded nucleic acid or in a mixture of such nucleic acids. in a sample, the kit comprising: (a) at least one first and second oligonucleotide primer which are mutually different, wherein I (aa) one of the primers is substantially complementary to the single (ab) the second of the primers is substantially complementary to a complement of the single-stranded nucleic acid or to the second strand of the double-stranded nucleic acid, and wherein (ac) the primers delineate the ends of the specific nucleic acid sequence to be multiplied and detected; (b) a polymerizing agent; and (c) means for detecting the multiplied specific nucleic acid sequence.

Preferred embodiments of the invention are set forth in claims 2 to 12.

40

DK 175778 B1 I

The invention further provides the use of the kit as described above to H

enabling detection and / or characterization of specific nucleic acid sequences, H

which are associated with infectious diseases, such as those caused by bacteria, H

viruses and protozoparasites, genetic disorders such as those caused by specific I

5 deletions and / or mutations in genomic DMA or cellular disorders such as cancer. H

Pending European Patent Application No. 201184 discloses methods H

for the multiplication of nucleic acid sequences and this application is derived from the Euro-I

European Patent Application No. 86 302298.4. IN

Fig. 1 shows a 94 base pair sequence of human β-globin desired to be multiplied. H

The single base pair change that accompanies sickle cell anemia is indicated under 94-me

clean. H

FIG. 2 shows a photograph of an ethidium bromide stained polyacrylamide gel demonstrating H

multiplication of the 94 mer contained in human wild-type DNA and in a plasmid containing H

contains a 1.9 kb BamHI fragment of the normal β-globin gene (designated H

pBR328: HbA). IN

FIG. 3 shows a photograph of an ethidium bromide stained polyacrylamide gel demonstrating H

multiplying any of the specific 94-more target sequences present in

pBR328: HbA, a plasmid containing a 1.9 kb Bam HI fragment of the sickle cell allele I

of β-globin (designated pBR328: HbS), pBR328: HbA, wherein the sequence to be multiplied

ceres, is cleaved with Mstll. and pBR328: HbS, wherein the sequence to be multiplied is I

25 have been treated with but not digested with Mstll. H

Fig. 4 shows in detail the steps and products of the polymerase chain reaction for multi * H

application of the desired 94-mer sequence of human β-globin for 3 cycles under an-I

reversal of two oligonucleotide primers. IN

FIG. 5 shows a photograph of an ethidium bromide stained polyacrylamide gel demonstrating

multiplication after 4 cycles of a 240-mer sequence in pBR328: HbA, where the aliquots I

is digested with Ncol (lane 3), Mstll (lane 4) or Hinfl (lane 5). Lane 1 is molecular H

the weight standard, and lane 2 contains the intact 240 bp product. H

FIG. 6 shows the sequence of the normal (βΑ) and sickle cell (β5) β-globin genes in Ddel and H

Next, the restriction site area, where the individual lines for βΑ marks the position of I

The Ddel site (CTGAG) and the double dashes for βΑ and β5 mark the position of Hinfl

the site (GACTC). IN

, DK 175778 B1 5

FIG. Figure 7 shows the results of sequential digestion of normal β-globin using a 40-mer probe and the Ddel restriction enzyme, followed by the Hinfl restriction enzyme.

FIG. 8 shows the results of sequential digestion of sickle cell β-globin using the same 40-mer probe as in FIG. 7 and the Ddel restriction enzyme, followed by the Hinfl restriction enzyme.

FIG. 9 shows a photograph of an ethidium bromide stained polyacrylamide gel demonstrating the use of the same 40-mer probe as in FIG. 7 for specific characterization of beta globin alleles present in the sample of whole human DIMA, which has been subjected to multiplication, probe hybridization and sequential digestion with Ddel and Hinfl.

FIG. Figure 10 shows a photograph of a 6% NuSieve agarose gel visualized using 15 ethidium bromide and UV light. This photograph demonstrates the multiplication of a sub-fragment of a 110-bp multiplication product, which sub-fragment is an inner portion of the 110-bp fragment.

The term "oligonucleotide" as used herein with reference to primers, probes, oligomer fragments to be detected, oligomer controls, and unlabeled blocking oligomers is defined as a molecule consisting of 2 or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its exact size will depend on many factors which in turn depend on the ultimate function or use of the oligonucleotide.

25

The term "primer" as used herein refers to an oligonucleotide, whether naturally occurring, as in a purified restriction digest, or produced synthetically, which oligonucleotide is capable of acting as an initiation point for synthesis when placed under conditions. which synthesis of a primer extension product complementary to a nucleic acid strand is induced, i.e. in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at a suitable temperature and pH. The primer is preferably single-stranded for maximum efficiency by multiplication, but may alternatively be double-stranded. If double stranded, the primer is first treated to separate its strands before being used to form extension products. The primer is preferably an oligodeoxyribonucleotide. The primer must be long enough to prime the synthesis of the extension products in the presence of the polymerization agent. The exact lengths of the primers will depend on many factors, including temperature and the primer source. Depending on the complexity of the target sequence, the oligonucleotide primer contains e.g. typically 40 to 25 or more nucleotides, although it may contain fewer nucleotides. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template.

I I DK 175778 B1 I

I 6 I

In the primers referred to herein, are selected to be "substantially" complementary to the Η

In different strings of each specific sequence to be multiplied. This means that you

In the primers must be sufficiently complementary to hybridize with their respect- H

In 5 tive strings. Therefore, the primer sequence does not need to reflect the exact sequence

In of the template. Eg. For example, a non-complementary nucleotide fragment may be attached to I

At the 5 'end of the primer, while the rest of the primer sequence is complementary to strand H

gene. Alternatively, non-complementary bases or longer sequences may be located H

In scattered in the primer, provided that the primer sequence has sufficient complementarity H

I 10 with the sequence of the string to be multiplied to hybridize therewith and there- H

by forming a template for the synthesis of the extension product of the second primer. H

H

As used herein, "restriction endonucleases" and "restriction enzymes" denote

In terry enzymes, each cutting double-stranded DNA at or near a specific nucleo-H

15 time sequence. IN

I As used herein, "DNA polymorphism" refers to the relationship in which two or more forms of H

Various nucleotide sequences may occur at a particular site in the DNA. IN

In the term "restriction fragment length polymorphism" ("RFLP") denotes the differences in H

H different individuals in the lengths of restriction fragments formed by digestion H

I with a special restriction endonuclease. IN

The present invention is directed to a kit for multiplication and detection of one-I

In each of one or more desired specific nucleic acid sequences presumed to be I

You are present in a nucleic acid. Because large quantities of a specific sequence can be produced

In the kit, the present invention can be used to improve the efficiency of I

DNA or mRNA cloning and for multiplying a target sequence to facilitate its detection.

I 30 I

In general, the method which can be performed using the kit comprises I

H a chain reaction for in exponential quantities relative to the number of I involved

reaction step to produce at least one specific nucleic acid sequence under part I

in that the (a) ends of the required sequence are known in sufficient detail to

35 oligonucleotides which will hybridize with them can be synthesized and (b) a small I

amount of the sequence is available to initiate the chain reaction. The product from I

the chain reaction will be a separated nucleic acid duplex with ends corresponding to one-

In there of the specific primers used. IN

Any source of nucleic acid may be used in purified or non-purified form as

In gait nucleic acid or acids, provided it is believed to contain the desired, H

In specific nucleic acid sequence. The method may e.g. thus using DNA or H

7 DK 175778 B1 clays RNA, including mRNA, which DNA or RNA may be single-stranded or double-stranded. In addition, a DNA-RNA hybrid containing one strand of each can be used. A mixture of any of these nucleic acids may also be used, or the nucleic acids produced from a previously used multiplication reaction using the same or different primers may be used thus. The specific nucleic acid sequence to be multiplied may be merely a fraction of a larger molecule or may be initially present as a separate molecule such that the specific sequence constitutes the entire nucleic acid. It is not necessary that the sequence to be multiplied is initially present in pure form; it may be a minor fraction of a complex mixture, such as a portion of the f5 globin gene found in whole human DNA, or a portion of a nucleic acid sequence due to a particular microorganism, which organism may constitute only a very small part of a special biological sample. The starting nucleic acid may contain more than one desired specific nucleic acid sequence, which may be the same or different. The present method is therefore not only applicable to the production of large amounts of a specific nucleic acid sequence, but also to simultaneously multiply more than one different specific nucleic acid sequence located on the same or different nucleic acid molecules.

The nucleic acid or acids may be obtained from any source, e.g. from plasmids such as pBR322, from cloned DNA or RNA, or from natural DNA or RNA from any source, including bacteria, yeast, viruses or higher organisms such as plants or animals. DNA or RNA may be extracted from blood, tissue material such as chorionic villi or amnium cells by various methods such as that described by Maniatis et al., Molecular Clonino. (1982), 280-281.

Any specific nucleic acid sequence can be produced using the present kit. It is only necessary that a sufficient number of bases at both ends of the sequence be known in sufficient detail so that two oligonucleotide primers can be prepared which will hybridize to different strands of the desired sequence and at relative positions along the sequence so that an extension product , Synthesized from one primer, can serve as a template, when separated from its template (complement), to extend the second primer into a defined length nucleic acid. The greater knowledge one has of the bases at both ends of the sequence, the more specific the primer for the target nucleic acid sequence can be made and the more efficient the method can be. It will be understood that the term "primer" as used herein refers to more than one primer, especially in the case where there is any ambiguity in the information regarding the end sequences of the fragment to be multiplied. In the case where a nucleic acid sequence e.g. When derived from protein sequence information, a collection of primers containing sequences representing all possible codon variations based on the degeneration of the genetic code will be used for each strand. One primer from this collection will be homologous to the end of the desired sequence to be multiplied.

IN

I DK 175778 B1 I

I s I

H The oligonucleotide primers can be prepared using any eg H

net method such as e.g. the above-described phosphotriester and phos- I

H phodiester methods, or automated embodiments thereof. 1 thus one

In the modified embodiment, diethylphosphoramidites are used as starting material H

I and can be synthesized as described by Beaucage et al., Tetrahedron Letters (1981), H

H 22: 1859-1862. One method for synthesizing oligonucleotides on a modifier

Certain solid support material is disclosed in U.S. Patent No. 4,458,066. It is also possible H

In using a primer which has been isolated from a biological source (such as by a re-I

striktionsendonukleasefordøjelse). H

I i ° I

The specific nucleic acid sequence is produced using the nucleic acid that

You contain this sequence as a template. If the nucleic acid contains two strands, I

H, it is necessary to separate the strands of the nucleic acid before it can be used as I

template, either at a separate step or simultaneously with the synthesis of primer extension I

15 products. This strand separation can be performed by any eg

net denaturation method, including physical, chemical or enzymatic methods. One five- I

sical method of separating the strands of the nucleic acid involves heating the nucleus

the small acid until completely (> 99%) denatured. Typical heat denaturation can be

include temperatures in the range of from 80 to 105 ° C for time periods of from about 1 to 10 H

20 minutes. String separation can also be induced with an enzyme of the class of one-H

enzymes known as helicases, or the enzyme RecA, which has helicase activity, and H

which in the presence of riboATP is known to denature DNA. The appropriate turnover H

H conditions for separating the nucleic acid strands by helicases are described H

by Kuhn Hoffmann-Berlino. CSH-Ouantitative Biologist. 43: 63 (1978) and an I is given

25 Summary of Methods Using RecA in C.Radding, Ann.Rev.Genetics .. 16: I

405-37 (1982). IN

H If the original nucleic acid containing the sequence to be multiplied is I

single strand, its complementary strand is synthesized by adding one or two I

H oligonucleotide primers thereto. If a suitable single primer is added, I is synthesized

a primer extension product in the presence of the primer, a polymerization I

In the medium and the 4 nucleotides described below. The product will be partially complete

mentored to the single-stranded nucleic acid and will hybridize with the nucleic acid strain

gene to form a duplex of odd lengths which can then be separated

35 to single strands, as described above to form two single, separated I

complementary strings. Alternatively, two suitable primers may be added to the single I

stranded nucleic acid and the reaction is carried out.

If the original nucleic acid constitutes the sequence to be multiplied, it will pro- I

40 induced primer extension products (the primer extension products produced) I

be completely complementary to the strands of the original nucleic acid and will

Thus, hybridisers hybridize to form a duplex of the same length strands which can be J separated into single stranded molecules.

When the complementary strands of the nucleic acid (s) are separated - whether the nucleic acid was originally double-stranded or single-stranded - the strands are prepared to be used as a template for the synthesis of additional nucleic acid strands. This synthesis can be carried out using any suitable method. Generally, it takes place in a buffered aqueous solution, preferably at a pH of 7-9, most preferably ca. 8. It is preferred that a molar excess (for cloned nucleic acid usually 1000: 1 primer: template, and for genomic nucleic acid generally about 106: 1 primer: template) of the two oligonucleotide primers be added to the buffer containing the separated tempiatestrenge. However, it should be understood that the amount of complementary strand is not necessarily if the method described herein is used for diagnostic applications, so that the amount of primer relative to the amount of complementary strand cannot be determined with certainty. However, for practical reasons, the amount of primer added will generally be in molar excess relative to the amount of complementary strand (template) when the sequence to be multiplied is found in a mixture of complicated, long chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the method.

The deoxyribonucleoside triphosphates dATP, dCTP, dGTP and TTP are also added to the synthesis mixture in sufficient amounts and the resulting solution is heated to ca. 90-100 ° C for approx. 1 to 10 minutes, preferably 1 to 4 minutes. After this warm-up period, the solution is allowed to cool to 20-40 ° C, which is preferred for primer hybridization. To the cooled mixture is added a polymerizing agent and the reaction is allowed to proceed under conditions known in the art.

This synthesis reaction can be carried out at from room temperature up to a temperature above which the polymerizing agent no longer functions effectively. Thus, if the DNA polymerase is e.g. When used as a polymerizing agent, the temperature is generally no higher than approx. 45 ° C. An amount of dimethyl sulfoxide (DMSO) is preferably present which is effective for detecting the signal or the temperature is 35-40 ° C.

Most preferred is the presence of 5-10% by volume of DMSO and the temperature is 35-40 ° C. For certain applications where the sequences to be multiplied are over I 110 110 base pairs of fragments, such as HLA DQ-α or β genes, an effective amount (e.g., 10% by volume) of DMSO is added to the multiplication mixture and the reaction is performed at 35-40 ° C to obtain detectable results or to enable cloning.

The polymerizing agent may be any compound or system which will function to perform the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include, e.g. E.coli DNA polymerase I, Klenow i i

I DK 175778 B1 I

I I

B fragment of E. coli DNA polymerase I, T4 DNA polymerase, other available DNA-B

B polymerases, reverse transcriptase and other enzymes, including heat-stable enzymes, B

B which will facilitate the combination of the nucleotides in a correct manner to form pri- B

B elongation products that are complementary to each nucleic acid strand. Gene * B

5, the synthesis will be initiated at the 3 'end of each primer and proceed in 5' direction B

gene along the template strand until synthesis ends, producing molecules of Form B

B different lengths. However, there may be agents that initiate the synthesis at the 5 'end B

B and proceeds in the other direction using the same procedure as B

described above. B

I 10 I

The newly synthesized strand and its complementary nucleic acid strand form a B

double stranded molecule used in the subsequent steps of the process. 1 B

in the next step, the strands of the double-stranded molecule are separated during application B

any of the above-described procedures for forming one-B

15 cell-stranded molecules. B

B New nucleic acid is synthesized on the single-stranded molecules. Further Inducing B

B agent, nucleotides and primers can be added, if necessary, to process B

B may proceed under the conditions prescribed above. The synthesis will again be initiated B

B 20 at one end of the oligonucleotide primers and will extend along the single strand B of the template

B to generate additional nucleic acid. After this step, half of the extension B

The synthesis product consists of the specific nucleic acid sequence bounded by the two primers. B

B The steps of strand separation and extension product synthesis can be repeated B

B 25 as often as needed to produce a desired amount of the specific B

B nucleic acid sequence. As will be discussed in further detail below, B

B the amount of specific nucleic acid sequence produced accumulate on fl

exponential way. B

When it is desired to produce more than one specific nucleic acid sequence from the prior B

In the case of nucleic acid or mixture of nucleic acids, an appropriate number of differences is used

straight oligonucleotide primers. For example, two different specific nucleic acid sequences B

to be produced, 4 primers are used. Two of the primers are specific to one of the specific B

have nucleic acid sequences, and the other two primers are specific for the other specific B

35 nucleic acid sequence. In this way, each of the two different specific se- B

sequences are produced exponentially by the present method. B

The present invention can be carried out in a stepwise manner where new reagents are added H

after each step, or at the same time that all reagents are added in the initial step, or H

For 40 clays, partially incrementally and partially simultaneously, where fresh reagent is added after a given number of H

step. If a method of string separation is used there, e.g. j H

B heat, will inactivate the polymerizer, as is the case with a heat-labile one- B

It is necessary to add the polymerizer again after each strand separation step. The simultaneous method can be used when a number of purified components, including an enzymatic agent such as helicase, are used for the strand separation step. In the simultaneous process, in addition to the nucleic acid strand (s) containing the desired sequence, the reaction mixture may also contain the strand separating enzyme (e.g. helicase), an appropriate source of energy for the strand separating enzyme such as rATP, the four nucleotides. , the oligonucleotide primers in molar excess and the inducing agent, e.g. Klenow fragment of E. coli DNA polymerase 1. If heat is used for denaturation in a simultaneous process, a heat-stable inducing agent such as a thermostable polymerase which will operate at elevated temperatures, preferably 65-90 ° C, may be used depending of the inducing agent at which temperature nucleic acids will consist of single and double strands in equilibrium.

For smaller lengths of nucleic acid, lower temperatures of approx. 50 ° C is used.

The upper temperature will depend on the temperature at which the enzyme will degrade or the temperature above which primer hybridization will be insufficient. Such a heat-stable enzyme is described, e.g. by A.S.Kaledin et al.,

Biokhimiva. 35, 644-651 (1980). Each step of the process will proceed sequentially regardless of the initial presence of all the reagents. Additional materials can be added if necessary. After a suitable time has elapsed to produce the desired amount of the specific nucleic acid sequence, the reaction can be stopped by inactivating the enzymes in any known manner or by separating the components of the reaction.

The process that can be performed using the kit of the present invention can be performed continuously. In one embodiment of an automated process, the reaction can be cycled through a denaturing region, a reagent addition region, and a reaction region. In another embodiment, the enzyme used for the synthesis of the primer extension products can be immobilized in a column. The other reaction components can be continuously circulated through the column and a heat coil in series by means of a pump and thus the nucleic acids produced can be denatured repeatedly without inactivation of the enzyme.

The method that can be carried out using the kit of the present invention is schematically illustrated below, where double-stranded DNA containing the desired sequence [S] consisting of complementary strands [S ^ jog [S '] is used as the nucleic acid. During the first and each subsequent turnover cycle, elongation of each oligonucleotide primer on the original template will produce one new unspecified length ssDNA molecule product that terminates with only one of the primers. These products, hereinafter referred to as "long products",! 40 will accumulate in a linear fashion, i.e. that the amount present after any number of cycles will be proportional to the number of cycles.

I DK 175778 B1 I

I 12 I

The long products thus produced will act as templates for the one

or the other of the oligonucleotide primers in subsequent cycles and will produce I

In molecules of the desired sequence [S '] or [S']. These molecules will also act as templates for one or the other of the oligonucleotide primers, producing

In another [S +] and [S], a chain reaction can thus be maintained which will result in

ters in the accumulation of [S] at an exponential rate with respect to the number of I cycles.

By-products formed by oligonucleotide hybridizations other than those intended are not self-catalytic (except in rare cases) and thus accumulate with linear ha

In 10 stages. IN

The specific sequence to be multiplied [S] can be indicated schematically as:

I [S +] 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCCC 3' I

I 15 [S] 3 'ΙΙΊΙΙ I Ti I I mYYYYYYYGGGGGGGGGG 5' I

The appropriate oligonucleotide primers would be:

Primer 1: GGGGGGGGGG I

Primer 2: AAAAAAAAAA I

so that if DNA containing [SJ I

... .zzzzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz ... I

I 25 ... zzzzzzzzzzzzzzzzTl i I I I rTTTyYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz ... I

You are separated into single strands and its single strands hybridized to primers 1 and 2, they can

subsequent elongation reactions are catalyzed by DNA polymerase during the present I

room of the four deoxyribonucleoside triphosphates: I

I 30 I

I I

extension <-—— GGGGGGGGGG primer 1 I

I —ZZZZZZZZZZZZZZZZAAAAAAAAAAXXXXXXXXXX CCCCCCCCCCZZZZZZZZZZZZZZZZZZZZZZZZ .... I

original template string + I

35 I

original template string * I

.... zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGGGzzzzzzzzzzzzzzzzz .... I

primer 2 AAAAAAAAAA - -> extension I

I 40 5 '3' I

ί I

13 DK 175778 B1

After denaturation of the two duplexes formed, the products are: 3 'S' .... ZZZZZZZZZZZZZZZZ Π IIIIIIII VYYYYYYYVYG6GGGGGGGG 5 newly synthesized long product 1 5 '... .ZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZAZ zzzzzzzzzzzzzzzz ΙΎΓΙ f II 11 I YYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz .... original template string 15 5 '3' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz .... recently synthesized long product 2

If these 4 strands are allowed to re-hybridize with primers 1 and 2 in the next cycle, the polymerizing agent will catalyze the following reactions:

Primer 2 5 'AAAAAAAAAA-> extension thereto 3' ... .ζζζζζζζζζζζζζζζζ'Π 'IIIIIII IYYYYYYYYYYGGGGGGGGGGG 5' newly synthesized long product 1 25 extension <-GGGGGGGGGGG 5 'primer 1 5' .... zzzzzzzzzzzzzzzzAXAXXAXAXXAXAX original template string 30 Primer 2 5 'AAAAAAAAAA -> extension 3' ... zzzzzzzzzzzzzzzz iiiiiiiii I YYYYYYYYVYGGGGGGGGGzzzzzzz .... 5 'original template string *

I DK 175778 B1 I

I I

extension thereto <- - - GGGGGGGGGG 5 'primer 1

I 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCZZZZZZZZZ2ZZZ .... 3' I

newly synthesized long product 2 H

I 5 If the strings of the four duplexes above are separated, the following strings are found:

I 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3' I

In newly synthesized [S4] 10

I 3 '... .Z2ZZZ2ZZZZZZZZZZ1111111 µ in YYYYYYYWYGGGGGGGGGG 5' I

In first-cycle synthesized long product 1H

I 3 '—zzzzzzzzzzzzzzzzzzI I I I I II I I I I YYYYYYYYYYGGGGGGGGGG 5'

In 15 recently synthesized long product 1 H

I 5 '.... zzzzzzzzzzzzzzzzAAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzz .... 3' I

In original template string + I

I 5'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCZZZZZZZZZZZZZZZZ .... 3 · I

newly synthesized long product 2 I

I 3 '.... zzzzzzzzzzzzzzzz i i i μ i μ I TYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzz____5' I

In original template string H

I 25 I

3 'TI I ΙΤΠ 111YYYYYYYYYYGGGGGGGGGG 5' I

In newly synthesized [S] I

I 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz .... 3' I

In 30 first-cycle synthesized long product 2 I

It will be seen that each strand ending with the oligonucleotide sequence of one primer and the H

In the complementary sequence of the other, the specific nucleic acid sequence [S] which I

In it is desired to produce. IN

I I

The steps of this procedure can be repeated infinitely, and are limited only by H

In the amount of primers 1 and 2, the polymerizing agent and nucleotides present. IN

In the number of cycles used for detection, those required to produce an

In visual signal, a quantity, e.g. will depend on the nature of the test. For example, the sample I

In 40 is clean or diluted, fewer cycles may be required than if it is a complex I

15 DK 175778 B1 mixture. If the sample is human genomic DNA, the number of cycles is preferably from ca. 10 to 30.

The amount of original nucleic acid remains constant throughout the process because it is not replicated. The amount of long products increases linearly because they are produced only from the original nucleic acid. The amount of the specific sequence increases exponentially. Thus, the specific sequence will become the dominant one. This is shown in the following table, which indicates the relative amounts of theoretical types present after n cycles, assuming 100% efficiency for each cycle: I 10! Number of double strand after 0 to n cycles

specific

Cycle Number Template Long Products Sequence [S] 15 0 1 1 1 1 0 2 12 1 3 13 4 5 1 5 26 - 20 10 1 10 1013 15 1 15 32,752 20 1 20 1,048,555 η 1 n (2n-nl) When a single-stranded nucleic acid is used as the template, only 1 long product per cycle.

The oligonucleotides herein can be used to clone a particular nucleic acid sequence for insertion into a suitable expression vector. The vector can then be used to transform an appropriate host organism to generate the gene product of the sequence by standard methods of recombinant DNA technology.

Normally, such cloning will either involve direct ligation into a vector or the addition of oligonucleotide linkers followed by restriction enzyme cleavage. However, both of these methods 35 involve the ineffective blunt-ended ligation reaction. In addition, none of the techniques will control the orientation or multiplication of the insertion of the multiplied product into the cloning vector.

The multiplication process, which can be performed using the kit herein, can provide a mixture of nucleic acids, derived from the original template nucleic acid, the expected target multiplication products, and various non-target background products. The multiplied product may also be a mixture if the original template DNA

I DK 175778 B1! IN

I I

I contains multiple target sequences, such as in a heterozygous diploid genome, or when H

there is a family of related genes. H

The primers described herein may be modified to aid in rapid and specific cleavage

In the mixture of the DNA produced by multiplication reaction. 1 such a H

modification is the same or different restriction sites incorporated at 5'-one-. I h

of the primers, resulting in restriction sites at the two ends of the multi- | H

complicated product. When excised with the appropriate enzymes, it can multiply

The prepared product is then readily inserted into plasmid or virus vectors and cloned. This ! H

10 cloning allows analysis or expression of individual multiplied products, not H

a mixture. H

Although the same restriction site can be used for both primers, use permits! H

the insertion of the product into the vector by a specific restriction site with a specific one in H

15 orientation and suppresses multiple insertions as well as insertions that stem H

more from multiplications based on only one of the two primers- The specific H

orientation is useful when cloned into single-strand sequencing vectors when single-H

strand hybridization probes are used or when the cloned product is expressed. H

One method for producing the primers is to select a primer sequence that differs from H

H minimal from the target sequence. Areas in which each of the primers must be placed will be H

In screened for homology to restriction sites appropriate for the desired vector. H

In the target sequence "CAGTATCCGA ...", e.g. with only one base from one containing

You hold a BamHI place. A primer sequence is selected to fit the target precisely at its H

H 25 3 'end and containing the altered sequence and restriction site near its 5' end H

I (e.g. "CAGgATCCGA ...", where the lowercase symbolizes a device that does not fit.

You see with the target sequence). This minimally altered sequence will not interfere with H

In the ability of the primer to hybridize to the original target sequence and to initiate poly-H

In the merger. After the first multiplication cycle the primer is copied, even I

In the 30 target and pair exactly with new primers. After the multiplication process, pro- H is cleaved

In the ducts with appropriate restriction enzymes optionally separated from ligation H

In onion inhibitors such as nucleotide triphosphates and salts upon passage over a desalting H

column or molecular weight chromatography column and inserted by ligation into a cloning growth H

In tor, such as bacteriophage M13. The gene can then be sequenced and / or expressed under H

35 using known methods.

In The second method of preparing the primers involves taking the 3 'end of the primers I

from the target sequence and adding the desired restriction site (s) to the 5 'end of H

In the primer. For the example given above, a HindIII site could be added to dan-H

In the sequence "cgaagcttCAGTATCCGA ...", where lowercase letters are as described in

above. The added bases would not contribute to the hybridization of the first multiplication I

on-cycle, but would fit in subsequent cycles. The final multiplied pro- H

Then, in restriction enzyme (s), clones are expressed and expressed as described above. The gene that is multiplied can e.g. be human β-hemoglobin or human HLA DQ, DR or DP-α and -β genes.

In addition, the kit herein may be used for in vitro mutagenization. The oligodeoxyribonucleotide primers need not be exactly complementary to the DNA sequence to be multiplied. It is only necessary that they be capable of hybridizing sufficiently well to the sequence to be elongated by the polymerase enzyme or by any other inducing agent used. The product of a polymerase chain reaction in which the primers used are not exactly complementary to the original template will contain the sequence of the primer rather than the sequence of the template, thereby introducing an in vitro mutation. In further cycles, this mutation will be multiplied by an unlimited efficiency because no additional unpaired primer reactions are required. The mutant thus produced may be inserted into a suitable vector by standard molecular biological techniques and may optionally transfer mutant properties to this vector, such as the production potential of an altered protein.

The method of producing an altered DNA sequence as described above can be repeated on the altered DNA using different primers thus to induce further sequence changes. In this way, a series of mutated sequences can be produced gradually, in which each new addition to the series may differ slightly from the previous one but from the sequence of the original DNA source to an ever greater extent. In this way, changes can eventually be made that are not possible in a single step due to the inability of a very serious mismatch primer.

Additionally, as part of its sequence, the primer may contain a non-complementary sequence, provided that a sufficient amount of the primer contains a sequence complementary to the string to be multiplied. A nucleotide sequence which is not complementary to the template sequence (such as, for example, a promoter, linker, coding in sequence, etc.) can be e.g. be added to the 5 'end of one or both primers and thereby attached to the product of the multiplication process. After the extension primer is added, sufficient cycles are performed to obtain the desired amount of new template containing the non-complementary nucleotide insert. This allows the production of large amounts of the combined fragments in a relatively short time (e.g., two hours or less) using a simple technique.

The kit herein can further be used to synthesize a nucleic acid fragment from an existing nucleic acid fragment shorter than its product (called the core segment) using certain primers whose 3 'ends are complementary to or substantially complementary to 3 'ends of the single strands produced by separating the strands of the original shorter nucleic acid fragments, and wherein

I DK 175778 B1 I

I I

At the 5 'ends of the primers contain sequence information to be added to the core sequence H

In the ment. The method comprises:

In (a) treating the strands of the existing fragment with 2 oligonucleotide-H

In 5 primers under such conditions where an extension product of H is synthesized

In each primer which is complementary to each nucleic acid strand and in which the primers out- H

You are chosen so as to be substantially complementary to the 3 'end of each strand of H

In the existing fragment, so that the extension product synthesized from H

H a primer, when separated from its complement, can serve as a template for H

H 10 synthesis of the extension product of the second primer, and wherein each primer in its 5 '- H

end contains a sequence of nucleotides which are not complementary to the ex H

In sterile fragment, corresponding to the two ends of the nucleic acid fragment which is to be H

I synthesized; H

(B) separating the primer extension products from the templates on which they became H

synthesized, to produce single-stranded molecules; and in

(c) treating the single-stranded molecules produced in step (b) with I

In the primers of step (a) under such conditions that a primer extension product H

I 20 is synthesized using each of the single strings generated in step (b), H

H as a template, so as to produce two intermediate, double-stranded nuclear I

acidic molecules wherein each nucleotide sequence of H

present at the 5 'end of one of the oligonucleotide primers, and two double-stranded nucleic acid H

full-length molecules where nucleotide H has been incorporated into each of these

The sequence present at the 5 'ends of both oligonucleotide primers; IN

(d) repeating steps (b) and (c) a sufficient number of times to produce I

of the full-length double-stranded molecules in an effective amount; H

(E) treating the strands of the product of step (d) with two primers, thus H

In extending the product of step (d) at both ends; and H

I (f) repeating steps (a) - (d) using the product of step (d) as I

In the nuclear fragment and two oligonucleotide primers which are complementary or in total

35 late complementary to the 3 'ends of the single strings produced by I

separating the strands of the product from step (d). IN

Steps (b) and (c) are repeated as often as necessary, usually at least 5 times, to I

In producing the required amount of the double stranded full length product

40 for synthesizing the final product (i.e., the effective amount). The core segment

can be further obtained as the product of a previous multiplication cycle. The product H

DK 175778 B1 I 19! generated in step (d) may be purified prior to a new extension and multiplication cycle or may be used directly using the reaction mixture containing the product.

If the 3 'ends of the primers are not exactly complementary to the 3' ends of the single strands of the original shorter nucleic acid, the core fragment of the product will not be exactly the same as the sequence information deposited in the original shorter nucleic acid. Therefore, mutants of the original nucleic acid can be made by using primers which are substantially complementary at their 3 'ends to the 3' ends of the single strands of the original shorter nucleic acid.

10

If restriction site linkers are incorporated into the primers, the multiplied double-stranded products can be digested with the appropriate restriction enzymes and ligated directly into an M13 vector for rapid cloning and sequencing. M13 plaques containing the specific multiplied target sequences can be identified by hybridizing plaque lift filters with a probe specific to the target sequence.

The kit herein may also be used to enable detection and / or characterization of specific nucleic acid sequences associated with infectious diseases, genetic disorders or cellular diseases such as cancer, e.g. oncogenes. Multiplication is useful when the amount of nucleic acid available for analysis is very small, e.g. in prenatal diagnosis of sickle cell anemia using DNA obtained j from fetal cells. Multiplication is particularly useful if such analysis is to be performed on a small sample using non-radioactive detection methods which may be inherently insensitive or where radioactive methods are used but where rapid detection is desirable.

For purposes of this invention, genetic diseases may comprise specific deletions and / or mutations in genomic DNA from any organism, such as, for example. sickle cell anemia, cystic fibrosis, α-thalassemia, β-thalassemia and the like. Sickle cell anemia can easily be detected by oligomer restriction analysis or an RFLP-like analysis after multiplying the appropriate DNA sequence by the method of the invention. α-Thalassemia can be detected in the absence of a sequence, and β-Thalassemia can be detected in the presence of a polymorphic restriction site closely linked to a mutation causing the disease.

35

All of these genetic diseases can be detected by multiplying the appropriate sequence and analyzing it by Southern blot technique without the use of radioactive probes. In such a method, e.g. a small sample of DNA from e.g. amniotic fluid containing a very low level of the desired sequence is multiplied, cut with a restriction enzyme and analyzed by Southern blotting technique. The use of non-radioactive probes is facilitated by the high level of the multiplied signal.

I DK 175778 B1 I

I 20 I

] In another embodiment, a small sample of DNA can be multiplied to a suitable nine * H

veau, and then a further cycle of elongation reactions can be performed, where H

H nucleotide derivatives which are readily detectable (such as 32 P-labeled or biotin-labeled H

nucleoside triphosphates) are directly incorporated into the final DNA product which can be assayed for analysis

5 by restriction analysis and electrophoretic separation or any other

the appropriate method. An example of this technique in a model system is demonstrated

in Figure 5. I

In yet another embodiment, demonstrated in a model system of Figure 3,

The small acid is subjected to a special restriction endonuclease prior to multiplication. IN

Since a sequence that has been cut up cannot be multiplied, it results in the formation of a sequence

the occurrence of a multiplied fragment in the absence of a site for the endonuclease in the multiple

typed sequence, despite prior restriction of the DNA sample. Presence- I

the late or absence of a multiplied sequence can be detected by an appropriate method. IN

I 15 I

A practical application of this technique can be illustrated by its use to facilitate I

In the detection of sickle cell anemia using this and in Saiki et al., Biotechnology I

Oligomer restriction technique described in 2: 1008-1012 (1985). Sickle cell anemia is an I

hemoglobin disease caused by a change of a single base pair in the I

In the 6th codon of the β-giobene gene. Figure 6 shows the sequences of normal β-globin genes and I

sickle cell β-globin genes in the region of their polymorphism, with the individual lines I

You mark the location of a Ddel location. that is present only in the normal gene and where the double strand marks the location of a Hinfl site. which are non-polymorphic and thus are present in both normal and sickle cell alleles. Figure 7 shows the oligomeric fl I restriction process for normal β-globin DNA using a probe which

You span both restriction sites and are marked where an I is indicated

H star. (The probe is preferably labeled at the end which is fewer base pairs from the restriction

location at the other end of the probe). The DNA multiplied as directed

herein, denatured and annealed to the labeled probe. The multiplication can be performed I

I at elevated temperatures (35-40 ° C) in the presence of dimethyl sulfoxide to I

minimizing the formation of secondary structure. The enzyme Ddel cleaves the DNA at it

recovered Ddel site and forms a labeled octamer. Under the conditions which you are

used in the sample, the octamer is short enough to dissociate from the duplex. An afterthought

H following addition of the enzyme Hinfl has no effect on the now single stranded I

H 35 octamer. Figure 8 shows the same process applied to the sickle cell allele of β-globin DNA. IN

In the Enzyme Ddel, the duplex formed by the multiplied DNA and

In the labeled probe because the A-A base pair mismatches. The enzyme Hinfl limits I

H however, the hybrid and a labeled trimer is produced. In practice, the method I

In diagnosing the DNA of an individual who is either homocytic to the wild type, homozygous I

I 40 for the sickle cell type or heterozygous carrier of the sickle cell plant, since an I

specific signal is associated with the presence of each allele. Use of the I

The method described above for multiplying the relevant sequence allows rapid I

i

IN

DK 175778 B1 21 single copy gene analysis using a single 32P label probe.

Various infectious diseases can be diagnosed by the presence in clinical samples of specific DNA sequences characteristic of the microorganism causing the infection. These include bacteria such as Salmonella, Chlamydia,

Neisseria, viruses such as hepatitis viruses, and parasites such as Plasmodium causing malaria. U.S. Patent No. 4,358,535 to Falkow discloses the use of specific DNA hybridization probes for the diagnosis of infectious diseases. An inherent problem in the Falkow procedure is that a relatively small number of pathogenic organisms may be present in a clinical sample of an infected patient and that the DNA extracted from these may constitute only a very small fraction of it. total DNA in the sample. Specific multiplication of suspected sequences prior to immobilization and hybridization detection of the DNA samples could greatly increase the sensitivity and specificity of these procedures.

Clinical routine applications of DNA probes to diagnose infectious diseases would be considerably simplified if non-radiolabelled probes could be used as described in Ward 63 of EP 63,879. In this method, biotin-containing DNA probes with chromogenic enzymes linked to avidin or biotin-specific antibodies are detected. This type of detection is convenient, but relatively insensitive. The combination of specific DNA multiplication by the present method and the use of stably labeled probes could provide the simplicity and sensitivity required to make the Falkow and Ward methods useful in clinical routine work.

In addition, the probe may be a biotinylated probe wherein the biotin is attached to a spacer arm of the formula:

K

T-fCH 2) - () - [(CH 2 J 2 O 2 - -CH 2 CH 2 -N 1 - where Y is 0, NH or N-CHO, x is a number from 1 to 4, and y is a number from 2 to 4. The spacer arm is itself attached to a psoralen unit of the formula: in X? CKr 40 ~ j

in C κι J

CH3.

I DK 175778 B1 I

I 22 I

The psoralen unit intercalates into and cross-connects a probe with a "hole circle" as I

described by Courage-Tebbe et al., Biochem. Biophys. Acta (1982) 697. 1-5 wherein it I

In single-stranded hybridization region of the hollow circle, the region, H

5 contained in the primers. H

The kit herein may also be used to prepare sufficient amounts of DNA from H

In a single-copy human gene, so as to detect a simple non-specific DNA stain- H

Hing, such as ethidium bromide, may be performed so as to perform a DNA diagnosis of I

In 10 direct ways. IN

In addition to detecting infectious diseases and morbid abnormalities in the genome of or- H

H anisms, the kit as described herein can also be used for the detection of DNA polymor- H

fism, which need not be associated with any morbid condition. H

I 15 I

The following examples are given to illustrate the invention and are not intended H

In limiting this in any way. In these examples, all percentages are weight percent- H

In terms of solids, and volume percentages, of liquids, and all tem- H

peratures are in degrees Celsius unless otherwise stated. H

20 I

In Example 1 H

I A 25 base pair sequence with the nucleotide sequence I

I 5 'CCTCGGCACCGTCACCCTGGATGCT 3' I

I 3 'GGAGCCGTGGCAGTGGGACCTACGA 5' I

I contained on a 47 base pair Fok1 restriction fragment of pBR322 obtained from I

H ATCC, was prepared as follows. An Fokl digest of pBR322 containing it 47 l

bp long fragment was prepared by digesting pBR322 with Fok1 in accordance with H

In accordance with the terms proposed by the supplier, New England Biolabs Inc. IN

In the primers used, 5 * d (CCTCGGCACCG) was 3 'and 5' d (AGCATC-I)

In CAGGGTG) 3 'and was prepared using traditional methods. The after- H

The following ingredients were added to 33 μΙ buffer consisting of 25 mM potassium phosphate:

10 mM magnesium chloride and 100 mM sodium chloride at pH 7.5: 2433 pmol of each I

35 of the primers described above, 2.4 pmol of the Fok1 digested pBR322, 12 nmol I

In dATP, 22 nmol dCTP, 19 nmol dGTP and 10 nmol TTP. IN

The mixture was heated to 85 ° C for 5 minutes and allowed to cool to ambient temperature.

In perature. Five units of Klenow fragment of E. coli DNA polymerase 1 were added and tem

At 40 the temperature was kept for 15 minutes. After this time, the mixture was again heated to 1

At 85 ° C for 5 minutes and allowed to cool. Five units of Klenow fragment were again added, I

I H

H 1 I i

1 I

The reaction was carried out for 15 minutes. The heating, cooling and synthesis steps were repeated an additional 11 times.

After the last repeat, a 5 µl aliquot was taken from the reaction mixture.

This was heated to 85 ° C for 3 minutes and allowed to cool to ambient temperature. 12.5 pmol of u-P32 deoxycytidine triphosphate and 5 units of Klenow fragment were added and the reaction allowed to proceed for 15 minutes. The labeled products were investigated by polyacrylamide gel electrophoresis. The fokl digest was similarly labeled and served as control and molecular weight markers. The only strongly labeled 10 band visible after the 13 cycles was the intended 25-base pair sequence.

Example 2

The sequence that was wanted to be multiplied was a 94 base pair long sequence contained in the human β-globin and spanning the MstII site. who are involved in sickle cell anemia. The sequence has the nucleotide sequence shown in Figure 1.

1. Synthesis of Primers The following two oligodeoxyribonucleotide primers were prepared by the method described below: 5 'CACAGGGCAGTAACG 3' Primer A and

5 'TTTGCTTCTGACACA 3' Primer B

25

Automated Synthesis Procedure: Diethylphosphoramidites synthesized according to Beaucage and Caruthers (Tetrahedron Letters (1981) 22: 1859-1862) were sequentially condensed into a nucleoside derivatized guided pore glass support using Biosearch SAM-1. The process included detritylation with trichloroacetic acid in dichloromethane, condensation using benzotriazole as activating proton donor, and capping with acetic anhydride and dimethylaminopyridine in tetrahydrofuran and pyridine. Cycle time was approx. 30 minutes. Yield at each step was essentially quantitative and was determined by the collection and spectroscopic examination of dimethoxytrityl alcohol released during detritylation.

35

Oligodeoxyribonucleotide deprotection and purification procedures: The solid support was removed from the column and exposed to 1 ml of concentrated ammonium hydroxide at room temperature for 4 hours in a closed tube. The support was then removed by filtration and the solution containing the partially protected oligodeoxynucleotide was heated to 55 ° C for 5 hours. Ammonia was removed and the residue was applied to a preparative polyacrylamide gel. Electrophoresis was performed at 30 volts / cm for 90 minutes, after which the band containing the product was identified by UV shading of a

DK 175778 B1 I

I I

fluorescensplade. The strip was cut and eluted with 1 ml of distilled water overnight

H above at 4 ° C. This solution was applied to an Altech RP18 column and eluted with an I

1 7-13% gradient of acetonitrile in 1% ammonium acetate buffer at pH 6.0. The eluate became I

measured by UV absorption at 260 nm and an appropriate fraction collected, quantified

5 was UV-absorbed in a fixed volume and evaporated to dryness at 1

room temperature in a vacuum centrifuge. IN

Characterization of Oligodeoxyribonucleotides: Test Aliquots of the Purified Oligo-I

nucleotides were labeled with 32 P with polynucleotide kinase and γ-32Ρ-ΑΤΡ. They labeled you

Ten compounds were examined by autoradiography of 14-20% polyacrylamide gels after

electrophoresis for 45 minutes at 50 volts / cm. This method verifies the molecular I

kylvægten. The base composition was determined by digestion of oligodeoxyribolo

the nucleotide to nucleosides using poison diesterase and bacterial, alkaline I

phosphatase and subsequent separation and quantification of the deduced nucleosides I

15 using a reverse phase HPLC column and a 10% acetonitrile, 1% am-I

monium acetate mobile phase. IN

I II. DNA source I

A. Extraction of Whole Human Wild DNA DNA I

Human genomic DNA, homozygous for normal β-globin, was extracted from I

In the cell line Molt4 (obtained from the Human Genetic Mutant Cell Repository and identified I

as GM229c) using the technique described by Stetler et al., I

In Proc.Natl.Acad.Sci. (19821. 79: 5966-5970)

I 25 I

In B. Construction of Cloned Olobronos

H A 1.9 kb BamHI fragment of the normal β globin was isolated from the cosmid

pFCII and inserted into the BamHI site of pBR328 (Soberon et al., Gene (1980) 2

305). This fragment, comprising the region hybridizing to the synthetic 40-I

For 30 mer probe, the first and second exons, the first intron and the 5 'flank I include

sequencing of the gene (Lawn et al., Cell (1978), 15: 1157-1174). This clone I-

I signed pBR328: HbA and was deposited under ATCC No. 39,698 May 25, 1984. I

H The corresponding 1.9 kb BamHI fragment of the sickle cell allele of β-globin was isolated in I

35 from the cosmid pFC122 and cloned as described above. This clone was designated I

In pBR328: HbS and deposited under ATCC No. 39,699 May 25, 1984. I

Each recombinant plasmid was transformed into and propagated in E. coli MM294 (ATCC I

In No. 39,607). IN

I 40 I

DK 175778 B1

C. Digestion of Cloned Allobinos with MstH

A total of 100 µg of each of pBR328: HbA and pBR328: HbS was individually digested with 20 units of MstH (New England Biolabs) for 16 hours at 37 ° C in 200 μΙ 150 mM NaCl, 12 mM Tris HCl (pH 7, 5), 12 mM MgCl 2, 1 mM dithiothreitol (DTT), and 100 pg / ml bovine serum albumin (BSA). The products were designated pBR328: HbA / MstIl and pBR328: HbS / MstII, respectively.

III. Polymerase chain reaction

To 100 μΙ buffer consisting of 60 mM sodium acetate, 30 mM Trisacetate and 10 mM 10 magnesium acetate at pH 8.0 was added 2 μΙ of a solution containing 100 picomol of Primer A (with the sequence d (CACAGGGCACTAACG)), 100 picomol of Primer B (with sequence d (TTTGCTTCTGACACA)) and 1000 picomoles of each of dATP, dCTP, dGTP and TTP. In addition, one of the following DNA sources described above was added: 10 µm of whole human wild type DNA (reaction]) 0.1 picomol pBR328: HbA (reaction II).

0.1 picomol pBR328: HbS (reaction III).

0.1 picomol pBR328: HbA / MstII (reaction IV).

0.1 picomol pBR328: HbS / MstII (reaction V).

No Target DNA (Reaction VI)

Each resulting solution was heated to 100 ° C for 4 minutes and allowed to cool to room temperature for 2 minutes, then 1 μΙ containing 4 units of Klenow fragment of E. coli DNA polymerase was added. Each reaction was allowed to proceed for 10 minutes, after which the cycle of addition of primers, nucleotides and DNA, heating, cooling, addition of polymerase and reaction was repeated 19 times for reaction I and 4 times for reactions II-VI.

Aliquots of 4 microliters of reactions I and II removed before the first cycle 30 and after the last cycle of each reaction were loaded with a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts / cm for 4 hours, transferred to a nylon membrane which served as solid phase support material and probed with a synthetic 5'-32P-labeled 40 bp fragment prepared by standard technique. sequence: 5 'd (TCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG) 3' in 30% formamide, 3 x SSPE, 5 x Denhardt's, 5% sodium dodecyl sulfate at pH 7.4. Figure 2 is an autoradiogram of the probe-treated nylon membrane for reactions I 40 and II. Lane 1 is 0.1 picomol of a 58 bp synthetic fragment control, with 1 strand complementary to the above probe. Lane 2 is 4 μΙ of reaction I prior to the first multiplication cycle. Lane 3 is 4 μΙ of reaction 1 after the 20th multiplier

I I

kationscyklus. Lane 4 is 4 μΙ of reaction II after five multiplication cycles. Lane 5 I

is a molecular weight standard consisting of a Fokl (New England Biolabs) digestion of I

pBR322 (New England Biolabs) labeled with α-32P-dNTPs and polymerase. Lane 3 vi- I

see that after 20 cycles, reaction mixture I contained a large amount of the diluent

5 is a sequence of the appropriate molecular weight and no other detectable products. Re- I

action mixture II after 5 cycles also contained this product, as well as starting I

the nucleic acid and other products, as shown by lane 4. I

H To 5.0 μΙ aliquots of reactions II-VI after the 4th cycle, 5 pmol of each of I was added

H 10 the primers described above. The solutions were heated to 100 ° C for 4 minutes and 1 hour

H was allowed to equilibrate to room temperature. 3 pmol of each of α-32P-dATP, α-32P-dCTP, I

H «-32P-dGTP, α-32P-dTTP and 4 units of Klenow fragment were added. The reaction was obtained in an I

final volume of 10 μΙ and allowed to proceed at 10 l at the salt concentrations indicated above

H minutes. The polymerase activity was terminated by heating for 20 minutes at 60 ° C. IN

15 aliquots of 4 μΐ of reactions II-Vi were loaded on a 12% polyacrylamide gel 0.089 Μ I

in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed

at 25 volts / cm for 4 hours, after which autoradiography was performed. IN

Figure 3 is an autoradiogram of the electrophoresis. Lane 1 is a molecular weight standard, I

Lane 2 is reaction II, lane 3 is reaction III, lane 4 is reaction IV and lane 5 is reaction I

tion V. Another pathway for reaction VI as control and without added DNA had no I

markings in any of the lanes. It can be seen from the drawing that the 94 bp long I

fragment predicted from target DNA was present only where intact β-globin-I

DNA sequences were available for multiplication, i.e. pBR328: HbA (lane 2), I

In pBR328: HbS (lane 3) and pBR328: HbS / MstII (lane 5). MstII digestion cuts I

H pBR328: HbA in the 94-mer sequence, thereby making it unable to become multi-

pleated, and the 94-more band does not appear in lane 4. In contrast, you are cut

the 94-mer sequence in pBR328: AbS does not when the plasmid is digested with MstI I.

be made available for multiplication as shown in lane 5. I

I 30

H Figure 4 shows the chain reaction for 3 cycles in multiplying the 94 bp sequence: I

frequency. PC01 and PC02 are primers A and B. The numbers on the right hand side indicate the cycles, I

whereas the numbers on the left indicate the cycle numbers in which a particular molecule I

You were produced. IN

35

This example shows the multiplication of a 110 bp sequence spanning the allele

MstI I site in the human hemoglobin.

I A total of 1.0 micrograms of whole human DNA, 100 picomol d (ACACAACTGTGTTCAC-I TAGC) and 100 picomol d (CAACTTCATCCACGTTCACC) where the primers obtained by the method of Example 2 were dissolved in 100 µl of a solution consisting of: 1.5 mM of each of the four deoxyribonucleoside triphosphates 5 30 mM Trisacetate buffer at pH 7.9 60 mM sodium acetate 10 mM magnesium acetate 0.25 mM dithiothreitol.

The solution was heated to 100 ° C for 1 minute and rapidly brought to 25 ° C for 1 minute, after which 2.5 units of Klenow fragment of DNA polymerase were added. The polymerase reaction was allowed to proceed for 2 minutes at 25 ° C, after which the cycle of heating, cooling, addition of Klenow fragment and reaction was repeated as often as desired.

15

However, a 70% efficiency at each cycle resulted in 15 cycles of synthesis of 1.4 femtomoles of the desired 110 bp fragment of the β-globin gene.

Example 4 20 This example shows the multiplication of a 240 bp sequence spanning the all MstII site of the human hemoglobin. This sequence contains Ncol. Hinfl and Mstll restriction sites.

To 100 µl of a mixture of 60 mM sodium acetate, 30 mM Tris acetate and 10 mM magnesium acetate at pH 8.0 containing 0.1 pmol of pBR328: HbA was added 2 µl of solution A containing: 100 picomol d (GGTTGGCCAATCTACTCCCAGG ) primer.

100 picomol d (TAACCTTGATACCAACCTGCCC) primes 30 1000 pmol of each of dATP, dCTP, dGTP and TTP.

The two primers were prepared by the method described in Example 2. The solution was heated to 100 ° C for 4 minutes and allowed to cool in ambient air for 2 minutes, then 1 µl containing four units of Klenow fragment of E. coli DNA poly was added. 35 merase. The reaction was allowed to proceed for 10 minutes, after which the cycle consisting of addition of solution A, heating, cooling, addition of polymerase and reaction was repeated 3 times. To a subset of 5.0 µl of the reactions, 5 picomoles of each of the above oligonucleotide primers were added. The solution was heated to 100 ° C for 4 minutes and allowed to set to ambient temperature, then titrated 3 picomoles of 40 each of the α-32P-labeled deoxyribonucleoside triphosphates and 4 units of Klenow fragment. The reaction was allowed to proceed at a final volume of 10 µl and at the salt concentrations given above for 10 minutes. The polymerase activity was terminated

DK 175778 B1 I

Η I

by heating for 20 minutes at 60 ° C. 2 µl aliquots were digested with NcoI. MstI I

or Hinfl and applied to a 12% polyacrylamide gel 0.089 M in Tris-Borate buffer at pH 8.3 L

and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts / cm for 4 hours, and 1

H autoradiography was performed. Figure 5 shows the autoradiogram of the electrophoresis, where I

H 5 lane 1 is the molecular weight standard, lane 2 is without digestion with enzyme (240 bp I

H intact), lane 3 is digestion with NcoI (131 and 109 bp), lane 4 is digestion with I

NlStll (149 and 91 bp) and lane 5 are digestive with Hinfl (144 and 96 bp). Car Radio I

The h gram is consistent with the multiplication of the 240 bp sequence. IN

Example 5 I

This example demonstrates the use of the method described herein for detecting I

H sickle cell anemia in sequential digestion. IN

Synthesis and Phosphorvlerina of Oil Code Vribonucleotides I

A labeled DNA probe, RS06, with the sequence: I

I 5 '* CTGACT CCT G AG GAG AAGT CTGCCGTTACTGCCCT GTGGG 3' I

wherein * indicates the label, and an unlabeled blocking oligomer, RS10, with se- I

The phrase: I

3 'GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5' I

which has 3 base pairs mismatched with RS06 was synthesized according to methods I

25 as set forth in Example 2 (1). Probe RS06 was labeled by contacting 5 pmol I

thereof with 4 units of T4 polynucleotide kinase (New England Biolabs) and 50 pmol γ-32Ρ-I

ATP (New England Nuclear, about 7200 Ci / mmol) in a 40 μΙ reaction volume

In this 70 mM Tris buffer (pH 7.6), 10 mM MgCl 2, 1.5 mM spermine and 2.5 mM dithi-I

othreitol for 90 minutes at 37 ° C. The total volume was then set to 100 μΙ

30 with 25 mM EDTA and purified according to the method of Maniatis et al., Molecular I

In Clonino (1982), 464-465 over a 1 ml Bio Gel P-4 spin dialysis column from BioRad equiv.

I librated with Tris-EDTA (TE) buffer (10 mM Tris buffer, 0.1 mM EDTA, pH 8.0). The labeled probe was further purified by electrophoresis on an 18% polyacrylamide.

In gel (19: 1 acrylamide: BIS, BioRad) in Tris-boric acid EDTA (TBE) buffer (89 mM Tris, I

In 89 mM boric acid, 2.5 mM EDTA, pH 8.3) for 500 hr. After localization by autoradiography, the portion of the gel containing the labeled probe was excised, crushed and eluted in 0.2 ml of TE buffer overnight at 4 ° C. TCA precipitation of the reaction product showed that the specific activity was 4.9 Ci / mmol and the final concentration was 20 pmol / ml.

The unlabeled RS10 blocking oligomer was used at a concentration of 200 pmol / ml.

29 DK 175778 B1

Isolation of human oenomic DNA from cell lines

High molecular weight genomic DIMA was isolated from the lymphoid cell lines Molt4, SC-1 and GM2064 using essentially the method described by Stetler et al. in PNAS (1982) 22; 5966-5970 (for Molt4) and Maniatis et al. in Molecular Cloning 5 (1982), 280-281.

Molt4 (Human Mutant Cell Repository, GM2219C) is a T cell line homozygous for normal β-globin, and SC-1, deposited with ATCC on March 19, 1985, is an EBV trans-propagated B cell line that is homozygous for the sickle cell allele. The GM2064 (Human Mutant 10 Cell Repository, GM2064) was initially isolated from an individual homozygous with hereditary persistence of fetal hemoglobin (HPFH) and does not contain any beta or participant lobing sequences. All cell lines were maintained in RPM1-1640 with 10% fetal calf serum.

15 Isolation of human oenomic DNA from clinical blood samples

A clinical blood sample, designated CH12, from a known sickle cell carrier (AS) was obtained from Dr. Bertram Lubin from Children's Hospital in Oakland, California. Genomic DNA was prepared from the "buffy coat" fraction, which is composed primarily of peripheral blood lymphocytes, using a modification of the method described by Nunberg et al. in Proc.Nat.Acad.Sci. 75, 5553-5556 (1978).

The cells were resuspended in 5 ml Tris-EDTA-NaCl (TEN) buffer (10 mM Tris buffer pH 8, 1 mM EDTA, 10 mM NaCl) and adjusted to 0.2 mg / ml proteinase K, 0.5% SDS, and incubated overnight at 37 ° C. Sodium perchlorate was then added to 0.7 M and the lysate was gently shaken for 1-2 hours at room temperature. The lysate was extracted with 30 ml of phenol / chloroform (1: 1), then with 30 ml of chloroform and followed by ethanol precipitation of the nucleic acids. The pellet was resuspended in 2 ml TE buffer and RNase A was added to 0.005 mg / ml. After digestion for 1 hour at 37 ° C, the DNA was extracted once with each of equal volumes of phenol, phenol / chloroform and chloroform and ethanol precipitated. The DNA was resuspended in 0.5 ml of TE buffer and the concentration determined by absorption at 260 nm.

Polymeasure Chain Reaction for Selective Multiplication of B-Olobin Sequences Two micrograms of genomic DNA were multiplied into an initial 100 µl of reaction volume 35 containing 10 mM Tris buffer (pH 7.5), 50 mM NaCl, 10 mM MgCl 2, 150 pmol Primer A with the sequence d ( CACAGGGCACTAACG) and 150 pmol of Primer B with the sequence d (L1 in iGCΓΙCTGACACA) and covered by ca. 100 μΙ mineral oil to prevent evaporation.

Each DNA sample underwent 15 multiplication cycles, in which a cycle is composed of 3 steps:

I DK 175778 B1 I

I 30 I

, 1) denaturation in a heat block set at 95 ° C for 2 minutes;

2) immediate transfer to a heat block set at 30 ° C for 2 minutes to allow pri- I

more and genomic DNA to anneal, I

I 5 I

H 3) adding 2 µl of a solution containing 5 units of Klenow-I

fragment of E. coli DNA polymerase 1 (New England Biolabs), 1 nmol of each of dATP, I

dCTP, dGTP and TTP in a buffer composed of 10 mM Tris (pH 7.5), 50 mM I

NaCl, 10 mM MgCl 2 and 4 mM dithiothreitol. This extension reaction was allowed to extend

-10 run for 10 minutes at 30 ° C. IN

After the final cycle, the reaction was terminated by heating at 95 ° C for 2 minutes. IN

The mineral oil was extracted with 0.2 ml of chloroform and discarded. End reaction vo

the lumen was 130 μΙ. IN

I 15 I

In Hybridization / Digestion of Multiple Genomic DNA with Probes I

I oo Ddel / Hinfl 'I

45 ml of the multiplied genomic DNA was ethanol precipitated and resuspended

right in the same volume of TE buffer. 10 μΙ (containing the pre-multiplied equiv- ι I

For 20 liters to 154 ng of genomic DNA) was transferred to a 1.5 ml Microfuge tube and 20 μΙ TE, I

buffer to a final volume of 30 μ). The sample was covered with mineral oil and denatu I

Stir at 95 ° C for 10 minutes. 10 μΙ 0.6 M NaCl containing 0.02 pmol labeled R206-. IN

Probe was added to the tube, mixed lightly and immediately transferred to a 56 ° C hot block in 1 L

For hours. Four microliters of unlabeled RS10 blocking oligomer (0.8 pmol) was added and hy-I

The bridging was continued for a further 10 minutes at the same temperature. 5 μΙ 60 mM I

In MgCl 2/0, 1% BSA and 1 μΙ Ddel (10 units, New England Biolabs) were added and

annealed DNA was digested for 30 min at 56 ° C. 1 µΙ Hinfl (10 units, New I

England Biolabs) were then added and incubated for a further 30 minutes. Reaction I

I was stopped by the addition of 4 μΙ 75 mM EDTA and 6 μΙ tracer to a final void of I

30 61 μΙ. IN

The mineral oil was extracted with 0.2 ml of chloroform and 18 μΙ of the reaction mixture I

(45 ng genomic DNA) was loaded onto a 30% polyacrylamide minigel (19: 1, Bio Rad) in a

Hoeffer SE200 device. The gel was electrophoresed at ca. 300 volts for 1 hour, I

35 until the bromophenol blue color front was horizontal 3.0 cm from the site of application. They practice

1.5 cm of the gel was removed and the remaining gel was exposed for 4 days with an I

intensifier screen at -70 ° C. IN

Discussion of photography ffia.9) I

40 Each lane contains 45 ng of multiplied genomic DNA. Lane A contains Molt4 I

DNA; lane B, CH 12; lane C, SC-1 and lane D, GM2064. Molt4 represents genotype I

pen of a normal individual with 2 copies of the pA gene per cell (AA), CH12 is a clinical I

DK 175778 B1 I

sample from a sickle cell carrier with one µA and one ps gene per cell (AS), and SCI repre- I

the genotype of a sickle cell individual with two copies of the ps gene per cell (SS). IN

GM2064, which does not contain beta or participant lobby sequences, is present as a ne-I

gative control. IN

As seen in the photograph, the Ddel is split. pA-specific octams only present in I

the DNAs containing the pA gene (lanes A and B) and the Hinfl cleaved p5 specific I

trimer is present only in the DNAs containing the ps gene (lanes B and C). Present- I

the room of both the trimer and the octamer (lane B) is diagnostic for a sickle cell carrier and I

10 can be distinguished from a normal individual (lane A) by the octamer alone and from a sickle cell.

tormented individual (lane C) with trims alone. IN

Repeating the above-described experiment using non-multiplied, I

By comparison, genomic DNA showed that the multiplication increased detection sensitivity at least 1000 times.

Example 6

This example illustrates direct detection of a completely uncleaned, single-copy whole human DNA on gels without the need for a labeled probe.

Using the method described in Example 3, a 110 bp fragment from a sequence in the first exon region of the beta-globin gene was multiplied from 10 micrograms of whole human DNA after 20 cycles. This 110 bp fragment produced after 20 cycles could easily be seen on gels stained with ethidium bromide.

The sequence was not multiplied once cut by the restriction enzyme Ddel. except, as in the beta-globin S allele, if the sequence did not contain the restriction site that the enzyme recognizes.

Example 7 A. A total of 100 µmol of pBR328 containing a 1.9 kb insert of the human beta-globin A allele, 50 nmol of each of ct-32P-dNTP at 500 Ci / mol and 1 nmol of each of the primers used in Example 3 were dissolved in a solution containing 100 μΙ 30 mM Tris-acetate at pH 7.9, 60 mM sodium acetate, 100 mM dithi-othreitol and 10 mM magnesium acetate. The solution was brought to 100 ° C for 2 minutes and cooled to 25 ° C for 1 minute. A total of 1 μΙ containing 4.5 units of Klenow fragment of E. coli DNA polymerase I and 0.09 units of inorganic pyrophosphatase was added to prevent the possible accumulation of pyrophosphate in the reaction mixture and the reaction was allowed to run for 2 minutes at 25 ° C, after which the cycle of heating, cooling, enzyme addition and reaction was repeated 9 times. 10 μΙ subsamples were taken and added to 1 μΙ 600 mM EDTA after each synthesis cycle. Each was analyzed in DK 175778 B1

Served on a 14% polyacrylamide gel in 90 mM Tris-borate and 2.5 mM EDTA at pH 8.3 and I

24 volts / cm for 2.5 hours. The finished gel was soaked for 20 minutes in the same buffer with the addition of 0.5 µg / ml ethidium bromide, washed with the original buffer and photographed under UV light using a red filter.

The 110 bp fragment produced was excised from the gel under ultraviolet light and the incorporated 32 P was measured by Cerenkov irradiation. An attempt to fit the results into the equation of the form: pmol / 10 pi = 0.01 [(1 + y) N- yN - 1], where N denotes ^ R the number of cycles and y is the fraction yield per day. cycle, was optimal with γ = 0.619.

This indicates that a significant multiplication was obtained.

^ R B. The above experiment was repeated except that 100 nmol of each dNTP

H was added to a 100 µl reaction, no radioactive labeling was used and subsamples H were not removed at each cycle. After 10 cycles, the reaction was terminated by boiling for 2 minutes and the re-hybridization was carried out at 57 ° C for 1 hour. The sequence of the H 110 bp product was confirmed by subjecting 8 µl of partial samples to restriction H analysis by adding 1 µl bovine serum albumin (25 mg / ml) and 1 µl of the appropriate H restriction enzyme (Hinfl, Mnll. Mstll, Ncol). and by reaction at 37 ° C for 15 hours.

In PAGE was performed as described above.

Example 8

This example illustrates the use of different primers for multiplying different fragments of pBR328 and 322.

A. The experiment described in Example 7A was repeated except that the following primers were used: d (TTTGCTTCTGACACAACTGTGTTCACTAGC) and I d (GCCTCACCACCAACTTCATCCACGTTCACC) to produce a 130 bp fragment of pBR328.

B. The experiment described in Example 7A was repeated except that the following primers were used: d (GGTTGGCCAATCTACTCCCAGG) and I d (TGGTCTCCTTAAACCTGTCTTG) to produce a 262 bp fragment of I pBR328. The turnover time was 20 minutes per minute. cycle.

In 35 C. The experiment described in Example 8A was repeated except that 100 fmol of a MstII digest of pBR328 containing a 1.9 kb insert from the human beta-globin S allele was used as initial template. This plasmid was digested several times with MstII. but not within the sequence to be multiplied.

In addition, the primers used were the following: d (GGTTGGCCAATCTACTCCCAGG) and I 40 d (TAACCTTGATACCAACCTGCCC) to form a 240 bp fragment.

DK 175778 B1 I

D. The experiment described in Example 7B was repeated except that I

100 fmol of a Nrul digest of pBR328 was used as template, 200 nmol of

in each dNTP was used in the 100 µl reaction and the primers were: I

d (TAGGCGTATCACGAGGCCCT) and d {CTT CCCCAT CGGT GAT GT CG) to form a

5,500 bp fragment from pBR328. Turnover times were 20 minutes per minute. cycle at 1

at 37 ° C. Final re-hybridization was 15 hours at 57 ° C. Electrophoresis was on a 4% agarol

segel. IN

Example 9 I

This example illustrates the method of the invention, wherein an in vitro I

mutation is introduced in the multiplied segment. IN

A. A total of 100 fmol pBR322 linearized with IMruI. 1 nmol of each of the primers: I

d (CGCATTAAAGCTTATCGATG) and d (TAGGCGTATCACGAGGCCCT) designed to produce

Producing a 75 bp fragment, 100 nmol of each of dNTP, in 100 µl of 40 mM Tris I

at pH 8, 20 mM in MgCl, 5 mM in dithiothreitol and 5 mg / ml bovine serum albumin

In combined. The mixture was brought to 100 ° C for 1 minute, cooled for 0.5 minutes in an aqueous one

bath at 23 ° C, after which 4.5 units of Klenow fragment and 0.09 units of inorganic I

pyrophosphatase was added and a reaction allowed to proceed for 3 minutes. Cycle I

The heating, cooling, enzyme addition and reaction were repeated 9 L

times. The 10th turnover cycle was completed by freezing and an 8 µl sub-sample I

of the reaction mixture was put on a 4% agarose gel visualized with ethidium bromide

B. The experiment described in Example 9A was repeated except that the oligonucleotide primers used were: d (CGCATTAAAGCTTATCGATG) and d (AATTAATACGACTCACTATAGGGAGATAGGCGTAT-CACGAGGCCCT) 30, primers of -times (in the primer listed as number two) are not present in pBR322. These nucleotides represent the sequence of the T7 promoter, which was added to the 75 bp sequence from pBR322 using the primer with 20 complementary bases and a 26 base long S 'extension. The procedure required less than 2 hours and produced two picomoles of the relatively pure 101 bp fragment from 100 fmol of pBR322.

The T7 promoter can be used to initiate RNA transcription. T7 polymerase can be added to the 101 bp fragment to produce single-stranded RNA.

C. The experiment described in Example 8D was repeated except that the I

oligonucleotide primers used were as follows: In DK 175778 B1

Η I

H d (TAGGCGTATCACGAGGCCCT) and d (CCAGCAAGACGTAGCCCAGC) to produce I

a 1000 bp fragment from pBR322. IN

D. The experiment described in Example 9C was repeated except that the I

5 oligonucleotide primers used were as follows: I

d (TAGGCGTATCACGAGGCCCT) and d (AATTAATACGACTCACTATAGGGAGATAGGCGTAT ·

CACGAGGCCCT) to produce a 1026 bp fragment, of which 26 I

nucleotides (in the primer listed as second) are not present in pBR322 I

and represents the T7 promoter described above. The promoter has been inserted

10 adjacent to a 1000 bp fragment from pBR322.

H The results indicate that a primer which is not a perfect pairing for the template H sequence, which is nonetheless capable of hybridizing sufficiently to be H enzymatically extended, produces a long product containing the sequence of pri- H 15 rather than the corresponding sequence of the original template. The long product serves as a template for the second primer to introduce an in vitro mutation. This mutation is multiplied in further cycles with an undiminished efficiency because no additional mismatched primings are required. In this case, an H primer bearing a non-complementary extension at its 5 'end was used to insert a new sequence into the product adjacent to the template sequence being copied.

Example 10

This example illustrates the use of interleaved sets of primers to reduce the background of the single copy multiplication.

Whole human DNA, homozygous for the wild-type β-globin allele, was subjected to 20 multiplication cycles as follows: A total of 10 µg DNA, 200 pmol of each of the primers: d (ACACAACT GT GTT C ACTAGC) and d (C AACTT CAT CC ACGTT C ACC) and 100 nmol,

In 30 of each dNTP in 100 μΙ of 30 mM Tris-acetate pH 7.9, 60 mM sodium acetate, 10 mM

In dithiothreitol and 10 mM magnesium acetate were heated to 100 ° C for 1 minute, cooled to H 25 ° C for 1 minute and treated with 2 units of Klenow fragment for 2 minutes. The cycle of heating, cooling and adding Klenow fragment was repeated 19 times.

A sub-sample of 10 μΙ was removed from the reaction mixture and subjected to an additional 10 multiplication cycles using each of the primers: d (CAGACACCATGGTGCACCTGACTCCTG) and d (CCCCACAGGGCAGTAACGGCA-GACTTCTCC), which multiplied a 58 bp fragment. These last 10 multiplication cycles were performed by diluting 10 μ! the sub-sample in 90 μΙ fresh Tris-acetate buffer described above 40 containing 100 nmol of each dNTP and 200 pmol of each primer. The reaction conditions were as stated above. After 10 cycles, a 10 μΙ sub-sample (corresponding to

DK 175778 B1 I

100 ng of the original DIMA) was applied to a 6% NuSieve (FMC Corp.) agarose gel and was H

visualized using ethidium bromide.

Figure 10 illustrates this gel illuminated with UV light and photographed through a red filter, I

5 which is known in the art. Lane 1 is molecular weight markers. Lane 2 is an I

partial sample of the reaction described above. Lane 3 is a partial sample of a reaction

identical to the one described above except that the original wild type I

DNA was digested with Ddel prior to multiplication. Lane 4 is a sub-sample of a re- I

action identical to that described above except that human DIMA ho- I

10 mozygotes for the sickle cell beta-globin allele were treated with Ddel before multiplication I

The {sickle cell allele does not contain a Ddel restriction site in the fragment which becomes I

multiplied here). Lane 5 is a sub-sample of a reaction identical to that described above except that salmon sperm DNA was used instead of human DNA.

Lane 6 is a sub-sample of a reaction identical to the one described above except that the sub-sample was treated with Ddel after multiplication (Ddel was to convert the 58 bp wild-type product into 27 and 31 bp long fragments). Lane 7 is a sub-sample of the material from Lane 4 treated with Ddel after multiplication (the 58 bp sickle cell product contains no Ddel restriction site).

Detection of a 58 bp fragment, representative of a single copy gene, from 1 microgram of human DNA using only ethidium bromide staining of an agarose gel requires a multiplication of about 500,000 times. This was achieved by using the two inserted sets of oligonucleotide primers described herein. The first set multiplies the 110 bp fragment and the inner insert set multiplies a sub-fragment of this product up to a level suitable for detection, as shown in Figure 10. This method of using primers which multiplying a small sequence contained in the sequence multiplied in the previous multiplication process and contained in extension products of the other primers allows the wild type to be distinguished from the sickle cell allele by the β-globin locus 30 without resorting to either radioisotopic or non-radioisotopic probe hybridization methods such as described by Conner et al., PNAS (USA), 80: 278 (1983) and Leary et al., PNAS (USA), SQ: 4045 (1983).

Example 11 It is expected that the present method is useful in detecting in a DNA sample from a patient a specific sequence associated with an infectious disease, such as e.g. Chlamydia using a biotinylated hybridization probe spanning the desired multiplied sequence and using the method described in U.S. Patent 4,358,535, see above. The biotinylated hybridization probe can be prepared by intercalating and irradiating a partially double-stranded DNA with a 4'-methylene-substituted 4,5'-8-trimethylpsoralen attached to biotin via a spacer arm of the formula: I DK 175778 B1 Η I -Y- ( CH2) 2-0- | CH2) xlyly-CH2CH2-N- where Y is 0, IMH or N-CHO, x is a number from 1 to 4 and y is a number from 2 to 4. Provision of biotinyl groups on the probe can be obtained by using a streptavidin-acid phosphatase complex commercially available from Enzo Biochem Inc., using the detection methods suggested by the supplier in its brochure.

The hybridized sample is seen as a stain of precipitated color due to the binding of the H detection complex and the subsequent reaction catalyzed by acid phosphatase, H which produces a precipitated color.

Example 12 H 15 In this example, the procedure described in Example 7 is broadly used to multiply a 119 base pair fragment on the human β-hemoglobin using the primers: I 5'-CTTCTGcagCAACTGTGTTCACTAGC-3 '(GH18) I 20 5' - CACaAgCTT CAT CC ACGTTCACC-3 '(GH19) H where lowercase letters denote mismatches in relation to the wild-type sequence to produce restriction enzyme sites. The full scheme is shown in Table I. Table I illustrates a diagram of primers GH18 and GH19 used for the cloning and sequencing of a 25,119 base-pair fragment of the human β-globin and designed to contain intrinsic restriction sites. The launch codon ATG is underlined. GH18 is a 26 base long oligonucleotide which is complementary to the negative strand and contains an internal Pst I site. GH19 is a 23 base long oligonucleotide that is complementary to the plus strand and contains an internal HindHI recognition sequence. Arrows indicate the direction of elongation of DNA polymerase 1. The framed sequences indicate the restriction enzyme recognition sequences on each primer. These I primers were selected by first screening the regions of the gene for homology to EstI and I HindIII restriction sites in bacteriophage M13. The primers were then prepared as I. described in previous examples.

I i

IN

DK 175778 B1 I

^ w I

<_> O O

<C H <υ o υ ro o o <£ (-> <M h <υ o υ t— * - * 5 t— ·

E- * <H

o o o <E-I <E- <E- *

O O O

O O O

i <H <

t O O O

o υ o e— <<; e— t— * 2 E- «o o o C H <υ o υ

O O O

o o I

o o o υ O <_> o o H <o o i— c

V υ O

Island Island

<_) Oh

o υ H <o o

<H

H <E- * <

ISLAND ISLAND

I O O

O o o o

H C

Island Island

and

O υ Vi <E- «o o e

H <-H

►— <o o v-> i — i (_> O Λ η υ | h <vi 0} t3 O O OJ Vi xi ol <v- ω ro o υ c ε E-ι f-ι C -w -H;

O O I— · VI

O O O.

c E—. (U Vi

(_) O We <U

O <_> jJ J «:

. c IΛ C

ου c η

ol O ILI i — I

E- <>

<1 H U

l_J O CO vi O O «-Ι ·> -»

c E-ι X

o o / \ o x ου σ 'υ o co x o o o co H <<

υ o H

o o υ υ <Η <υ <Η υ <c υ ο υ ε- · υ ο υ ο Η Η <8- c ο Ε— ι Ε— · <Ε— 'Ε- υ, υ ο υ ο υ

. C Ε- * C Η C

'υ ο υ υ υ Ε — I <Η <β 03 υ Ε — ι «2 Ε— · * - · <• -ι Ε ~ ο υ ο χ <χ <Ε— · <ε— ο υ ο υ ι ο υ ο οο ί ~ * - <Ε E— * ro Ε— ο ου υ ε- * c Ε- * <ζ υ <(- <οου ο υ Ε- · c <Ε- οο υ ro υ Ο ro Ε— <Ε-ι υ Η υ ο υ ο υ <Ε- <Ε- 'υ υ ο υ c- · <Η Ε— «S Ε— - - υ ο υ uo ιπ I DK 175778 B1

Multiplication and clonino

After 20 multiplication cycles of 1 microgram of human genomic DNA isolated from the Molt 4 cell line as described in Example 2, 1/14 of the reaction product was hybridized to the labeled β-globin specific oligonucleotide probe, RS06, with the sequence H 5 5'-CTGACTCCTGAGGAGAAGTCTGCCGGT 3 'using the oligomer restriction methods described above. After solution hybridization, the reaction mixture was treated with DdeI under restriction digestion conditions, as described above, to produce an 8-base-pair oligonucleotide. The Maeng-H product of this 8-base pair is proportional to the amount of H 10 multiplied product produced. The digestive products were separated on a 30% polyacrylic H amide gel and visualized by autoradiography.

Analysis of the autoradiogram revealed that the multiplication was comparable in efficiency to the multiplication of primer PC03 (S'-ACACAACTGTGTTCACTAGC-S ') and PC04 (5'-CCACTTGCACCTACTTCAAC-3') complementary to the negative and positive strand, respectively. in wild-type β-globin.

The multiplied product was ethanol precipitated to desalinate and concentrate sample *

friend, was redissolved in a restriction buffer of 10 mM Tris pH 8, 10 mM MgCl 2, 1 mM

20 DTT, 100 mM NaCl and simultaneously digested with PstI and HindIII. After digestion

the sample was desalted with a Centricon 10 concentrator and ligated overnight at 12 ° C

at 0.3 micrograms of the PstI / HindlH digested vector M13mp10w, which is publicly available from Boehringer-Mannheim.

The entire ligation mixture was transformed into E. coli strain JM103, which is publicly available from BRL in Bethesda, MD. The procedure followed to prepare the transformed strain is described in Messing, J. (1981) Third Cleveland Symposium on Macro-molecules: Recombinant DNA, ed. A. Walton, Elsevier, In Amsterdam, 143-153.

In the Transform mixture was plated on x-gal media for screening by means of I plaque hybridization with nylon filters. The filters were probed with a β-globin-specific oligonucleotide probe RS24 with the sequence 5'-CCCACAGGGCAGTAACGGCAGACTTC-I TCCTCAGGAGTCAG-3 'to determine the number of β-globin insertions. The filters were then reprobed with primer PC04 to determine the total number of insertions.

In Udoladnino and screening Table II summarizes the plating and plaque hybridization results. The filters were probed with primer PC04 to determine percent insertion resulting from the multiplication and cloning; 1206 clear plaques (90% of the total clear plaque) hybridized with the primer. 15 plaques hybridized with the β-globin spindle probe RS24. The percentage of β-globin positive plaques among the multiplied primer-positive plaques is approx. 1%.

Table II

5 in Blue No β-Globin-

Plate No. Plaque Inserts * Inserts ** Inserts 1 28 25 246 1 2 29 18 222 2 3 Π 26 180 0 10 4 24 20 192 5 5 22 27 185 5 6 39 21 181 3

Total 158 132 1206 15 15% plaque containing multiplied sequences containing β-globin insert = 15/1206 x 100 = 1.24%.

% total plaque containing β-globin insert = 15/1496 x 100 = approx. 1%.

% total plaque containing multiplied sequences = 1206/1496 x 100 = approx.

0.8%.

* Clear plaque that does not hybridize with primer PC04 ** Clear plaque that hybridizes with primer PC04.

Restriction Enzyme Analysis oo Southern Blot Analysis 25 DNA from phage DNA mini-preparation of 3 β-globin positive and 2 β-globin negative (but PC04 primer positive) plaques were analyzed by restriction enzyme analysis. MstH digestion of DNA from M13 clones containing the multiplied β-globin fragment 1 was to produce a characteristic 283 bp fragment. After MstII digestion, the three β-globin positive clones produced all the predicted 283 bp fragment, 30 while the two clones which were only positive with the primer produced larger fragments.

The gel from this analysis was transferred to an MSI nylon filter and hybridized with a radiolabelled nick-translated β-globin probe prepared by nick translation standard methods, as described by Rigby et al., J. Mol. Biol. (1977), 113: 237-51. The only bands that hybridized to the β-globin probe were the three β-globin positive clones. The other two clones had insertions that did not hybridize to the β-globin probe.

Sequence Analysis 40 10 β-globin positive clones, which were shown by restriction enzyme analysis to contain the β-globin insert, were sequenced using the M13 dideoxy sequencing method. Out of the 10 clones, 9 were identical to the β-globin wild type sequence. The other

I DK 175778 B1 I

I 40 I

that clone was identical to the β-globin gene, which has been shown to be multiplied I

alone to a small extent by the | j-globin primes. IN

In conclusion, the modified link primers were almost as effective as those I

5 unmodified primers to multiply the | 3 globin sequence. The primers were capable I

to facilitate the insertion of multiplied DNA into cloning vectors. Due to multiplicity- I

the ring of other segments of the genome contained only 1% of the hemoglobin I clones

quences. IN

H 10 9 out of the 10 clones were found to be identical to the published | J-globin I

sequence, which shows that the method multiplies genomic DNA with great accuracy. And I

H clone was found to be identical to the published c-globin sequence, which was I

H forces that the primers are specific for the β-globin gene despite having a signi

edge sequence homology with δ-globin. IN

H 15 I

H When cloning was performed with a 267 bp fragment of the β-globin gene,

gene effective only when dimethyl sulfoxide was present (10% by volume at 37 ° C) in multiply

kationsproceduren. IN

20 Restriction site modified primers were also used to multiply and clone and I

partially sequencing the human N-ras oncogene and cloning the 240 bp long sequence

ments of the HLA DQ-α and DQ-β genes. All of these multiplications were performed in close proximity

room of 10 volume percent dimethyl sulfoxide at 37 ° C. The primers for multiplication of I

The HLA DQ-α and DQ-β genes were much more specific for their calculated miles than I

25 β-globin and DR-β primers, which instead of giving separate bands on an ethidium I

bromide stained agarose gel merely gave a smear. Furthermore, HLA produced DQ-α primers I

up to 20% clones with multiplied insertions containing the desired HLA target I

fragment, whereas 1% of the β-globin clones contained the target sequence. HLA DQ-α- and I

The DQ-β gene cloning is effective only when DMSO was present and the temperature was high

For 30 vet. I 1

Example 13 I

In this example, the use of the method of the invention illustrates that I

You make the TNF gene with 494 base pairs starting from 2 oligonucleotides on every 74 bases.

In 35 separ. IN

DK 175778 B1 I

Primer I

The primers used were prepared by the method I described in Example 2

and are identified below as each being 74 meres. IN

(TN10) 5 '-CCTCGTCTACTCCCAGGTCCTCTTCAAGGGCCAAGGCTGCCCCGACTATGTGCTCCTCA-I

CCCACACCGTCAGCC-3 '

(TN11) 5'-GGCAGGGGCTCTTGACGGCAGAGAGGAGGTTGACCTTCTCCTGGTAGGAGATGGCGAAG-I

CGGCTGACGGTGTGG-3 '

(LL09) 5'-CCTGGCCAATGGCATGGATCTGAAAGATAACCAGCTGGTGGTGCCAGCAGATGGCCTGT-I

10 of ACCTCGTCTACTCCC-3 'I

IN! (LL12) 5 * -CTCCCTGATAGATGGGCTCATACCAGGGCTTGAGCTCAGCCCCCTCTGGGGTGTCCTTC-I

, GGGCAGGGGCTCTTG-31 I

(TN08) s-tgtagcaaaccatcaagttgaggagcagctcgagtggctgagccagcgggccaatgccc-I

TCCTGGCCAATGGCA-31 I

(TN13) 5 '-GATACTTGGGCAGATTGACCTCAGCGCTGAGTTGGTCACCCTTCTCCA6CTGGAAGACC-I

CCT CCCT GAT AGATG-3 'I

(LL07) 5 '-CCTTAAGCTTATGCTCAGATCATCTTCTCAAAACTCGAGTGACAAGCCTGTAGCCCATG-I

2o 'TTGT AGCAAACCAT C-3 * I

I (TN14) 5'-GCTCGGATCCTTACAGGGCAATGACTCCAAAGTAGACCTGCCCAGACTCGGCAAAGTCG-I

, AGATACTTGGGCAGA-3 'I

Total Procedure 25 I. 10 cycles of the protocol listed below were performed using primers TN10 and TN11, which interact as shown in the diagram below, step (a).

II. A total of 2 μΙ of the reaction mixture from Section I above was added to primers LL09 and LL12. The protocol described below was performed for 15 cycles such that the 30 primers interacted with the product of Section I as shown in the diagram below, step (b).

III. A total of 2 microliters of the reaction mixture from section II above was added to primers TN08 and TN13. The protocol described below was performed for 15 cycles such that the 35 primers interacted with the product of Section II, as shown in the diagram below, in Step (c). 2 2

A total of 2 microliters of the reaction mixture from section III above was added to primers LL07 and LL14. The protocol described below was performed for 15 cycles such that! The 40 primers interacted with the product from section ill as shown in the diagram below,. step (d).

Η DK 175778 B1 I

i

Protocol I

H Each reaction contained 100 µl of: I

2mM of each of dATP, dCTP, dGTP and TTP I

5 3 µM of each of the primers used in this step I

X 1 x polymerase buffer (30 mM Tris-acetate, 60 mM sodium acetate, 10 mM Mg-1

acetate, 2.5 mM dithiothreitol). IN

Each cycle consisted of: I

I ίο I

H 1) 1 minute in boiling water. IN

H 2) 1 minute cooling at room temperature I

H 3) addition of 1 μ! (5 units) of the Klenow fragment of DNA polymerase I

H 4) the possibility of the polymerization reaction running for 2 minutes. IN

15 For the next cycle, start again at step 1. I

43 DK 175778 B1

Diagram a) 5 'TN10-> <-5' TN11 5 in ------- xxxxxxx product from section 1 xxxxxxxxxxxx <- b) 5 'LL09-> 10 xxxxxxxxx <-5'TNll + 5' TN10-> xxxxxxxx <-5 'LL12 in 15 5' LL09 -: - »xxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxx <-5 'TN11 intermediate mode +' 20 5'TN10 -: -> xxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxx <-5 'LL12 in only the sequence between 5' of LL09 and 5 'of LL12 will be 25 full length. The strands containing TN10 and TN11, I do not have growing 5 'ends.

In this way...

30 5 'LL09- »xxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxx <--—- 5' LL12

This is the product of Section II.

H DK 175778 B1 Η Η c) 5 'ΤΝ08- »

χχχχχχχχχχχχχχχχχχχχχ <-5 'LL12 I

Η I

5'LL09 χχχχχχχχχχχχχχχχ I

Η 5 <-5 'ΤΝ13 I

in the same intermediate scheme I

which (b) I

5 'TN08- »xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx I

10 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx <-5 'TN13 I

This is the product of section 111. I

d) 5 'LL07- »

15 χχχχχχχχχχχχχχχχχχχχχ <-5 'TN 13 I

I i

H 5 'TN08- »χχχχχχχχχχχχχχχχχχχχχ I

<-5 'TN14

in the same intermediate scheme I

20 as (b) and (c) I

H 5 'LL07- »xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx I

H xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx <-5 'TN14 I

H (TNF gene) I

I 25

Deposits of materials

Cell line SC-1 (CTCC No. 0082) was deposited March 19, 1985, with American Type I

In Culture Collection (ATCC) 12301 Parklawn Drive, Rockville, Maryland 20852 USA with I

ATCC Deposit No. CRL No. 8756. The deposit of SC-1 was subject to an I

30 contract between ATCC and assignatar for the present application, Cetus corpora- I

tion. The contract with ATCC gives the public a permanent opportunity for offspring I

of this cell line is available by issuing the US patent which discloses and I

identifies the deposit, or by the publication or disclosure of which I

any US or foreign patent application, whichever comes first and that you

35 offspring of this cell line are available to a person of the US Commissioner of Pat

I tents and Trademarks are designated to be eligible for this under 35 CFR §122 and I

In the Commissioners' Rules pursuant thereto (including § 37.14 CFR with special reference to I

In 886 AND 638). The assignee of the present application has accepted that if cell I

In the line deposited, dies or is lost or destroyed when cultivated under I

Under 40 suitable conditions, it will immediately be replaced by a live coal immediately upon notification

In turn by the same cell line. IN

45 DK 175778 B1

In summary, it is apparent that the present invention provides a method for detecting sequences in nucleic acids by first multiplying one or more specific nucleic acid sequences using a chain reaction, thereby producing primer extension products which can subsequently serve as templates for further primer extension reactions. The method is particularly useful for detecting nucleic acid sequences which are initially present only in very small amounts. The multiplication process can also be used for molecular cloning.

Claims (14)

1. Exponential Multiplication and Detection Kit for Multiplying and Detecting a, I Specific Template Nucleic Acid Sequence or Specific Template Nucleic Acid Sequences Contained in a Single or Double-stranded Nucleic Acid or in a Mixture of So-In Nucleic Acids a sample, comprising in kit form:. In I (a) at least a first and second oligonucleotide primer which are mutually distributed. In several, wherein (aa) one of the primers is substantially complementary to the single-stranded nucleic acid or to a strand of the double-stranded nucleic acid, (ab) the other of the primers is substantially complementary to a complementary nucleic acid. In element of the single-stranded nucleic acid or to the second strand of the double-stranded nucleic acid, wherein the 15 (ac) primers delineate the ends of the specific nucleic acid sequence to be multiplied and detected; In H (b) a polymerizing agent; and: In (c) means for detecting the multiplied specific nucleic acid sequence. i I I 20 The kit of claim 1, wherein the specific template nucleic acid sequence is contained in a larger sequence. IN The kit of claim 1 or 2, wherein the nucleic acid is DNA or RNA, including mRNA, wherein DNA or RNA may be single or double stranded or is a DNA-RNA-I hybrid. IN The kit of any one of claims 1 to 3, wherein the nucleic acid is genomic I in DNA. I I 30 The kit of any one of claims 1 to 4, wherein the primers contain approx. 15 to I 25 nucleotides. IN The kit of any one of claims 1 to 5, wherein at least one of the primers I I has a nucleotide sequence bound to its 5 'end, which sequence is non-complementary to the nucleic acid. The kit of claim 6, wherein the nucleotide sequence bound to the S 'end of the primer, I I is a promoter sequence. IN The kit of claim 7, wherein the promoter is the T7 promoter. I 47 DK 175778 B1 A kit according to any one of claims 1-5, wherein at least one of the primers dispersed comprises bases or a nucleotide sequence, which bases or nucleotide sequence are non-complementary to the specific nucleic acid sequence to be multiplied and detected. 5 The kit of any one of claims 1 to 5, wherein said one primer contains a restriction site. The kit of any one of claims 1 to 10, wherein the polymerizing agent is an enzyme selected from E. coli polymerase 1, the Klenow fragment of E. coli polymerase I, T4 DNA polymerase, other DNA polymerases, reverse transcriptase and heat-stable enzymes. The kit of any one of claims 1 to 11, wherein the means for detecting the multiplied specific template nucleic acid sequence or the multiplied specific template nucleic acid sequences comprises a labeled oligonucleotide probe. Use of a kit according to any one of claims 1 to 12 for multiplication, detection and / or characterization of a specific template nucleic acid sequence or 20 specific template nucleic acid sequences contained in a single or double stranded nucleic acid or in a mixture of such nucleic acids. Use according to claim 13, wherein the specific template nucleic acid sequence or specific template nucleic acid sequences are associated with infectious diseases such as those caused by bacteria, viruses and protozoparasites, genetic disorders such as those caused by specific deletions, and / or mutations in genomic DNA, or cellular disorders such as cancer.