DK175248B1 - Kit for amplification and detection of specific nucleic acid sequences - Google Patents

Abstract

A kit (I) for the amplification and detection of at least 1 specific nucleic acid in a sample comprises in a packaged multicontainer unit form: (a) primers for each specific nucleic acid, that are complementary to both strands, such that the extension prod. of a primer can serve as a template for the complementary strand; (b) means for synthesising primer extension prods.; and (c) means for detecting amplified seuqence or sequences.

Description

in DK 175248 B1

The present invention relates to a first and a second single-stranded oligonucleotide that allows exponential multiplication of existing nucleic acid sequences and attachment of a promoter sequence by polymerase chain reaction. More particularly, the invention relates to oligonucleotides useful in a method of producing any particular nucleic acid sequence from a given sequence of DNA or RNA in amounts that are large compared to the amount initially present. The DNA and RNA may be single-stranded or double-stranded and may be relatively pure forms or a component of a mixture of nucleic acids. The oligonucleotides utilize a repeated reaction to perform the multiplication of the desired nucleic acid sequence and the attachment of a promoter sequence.

Particularly for diagnostic applications, the target nucleic acid sequence may be only a small amount of the DNA or RNA in question, so that its presence may be difficult to detect using non-isotopically labeled or end-labeled oligonucleotide probes. Great efforts are being made to increase the sensitivity of the probe detection systems, but little research has been done on multiplying the target sequence so that it is present in amounts sufficient to be easily detected using currently available methods.

20

Several methods have been described in the literature for synthesis of nucleic acids de novo or from an existing sequence. By these methods, one is able to generate large amounts of a given nucleic acid with a completely specified sequence.

One known method for synthesizing nucleic acids de novo involves organic synthesis of a nucleic acid from nucleoside derivatives. This synthesis can be carried out in solution or on a solid support. One type of organic synthesis is the phosphotriester method which has been used to produce gene fragments or short genes. In the phosphotriester method, oligonucleotides are prepared which can be linked to form longer nucleic acids. For a description of this method see Narang, S.A. et al., Meth. Enzvmol. 68. 90 (1979) and US Pat.

4356270. The patent specification describes the synthesis and cloning of the somatostatin gene. 1

Another type of organic synthesis is the phosphodiester method, which has been used to produce a tRNA gene. See Brown, E. L. et al., Meth. Enzymoi .. 68f 109 (1979) for a description of this method. As with the phosphotriester method

I 2 DK 175248 B1 I

In, the phosphodiester method involves synthesis of oligonucleotides, which are then linked I

together to form the desired nucleic acid. IN

Although the aforementioned methods of de novo synthesis can be used to synthesize long I

In 5 strands of nucleic acid, they are not very practical to use for the synthesis of large amounts of I

of a nucleic acid. Both processes are labor intensive and time consuming, requiring expensive I

In equipment and expensive reagents and has a low overall efficiency. The low overall efficiency

You may be due to the inefficiency in the synthesis of the oligonucleotides and joining I

In the reactions. By the synthesis of a long nucleic acid or even by the synthesis of a large I

In 10 amounts of a shorter nucleic acid it will be necessary to synthesize many I

In oligonucleotides and many joining reactions are needed. Accordingly, these would

Methods may not be practical for synthesizing large quantities of any I

In the desired nucleic acid. IN

I 15 There are also methods for producing large quantities of nucleic acids from small I

In amounts of the initially existing nucleic acid. These methods involve the cloning of I

In a nucleic acid In an appropriate host system, where the desired nucleic acid is inserted into I

In a suitable vector used to transform the host. When the host is grown, you replicate

In the vector, and thus multiple copies of the desired nucleic acid are produced. For an I

For a brief description of subcloning nucleic acid fragments, see Maniatis T. et al., Molecular I

In Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, pp. 390-401 (1982). IN

See also the methods described in the disclosure of U.S. Patents Nos. 4,416,988 and I

In No. 4,403,036. IN

A third method for synthesizing nucleic acids described in U.S. Patent No. I

At 4,293,652, is a hybrid of the organic synthesis and molecular I described above

In cloning. By this method, the appropriate number of oligonucleotides for I is prepared

In constituting the desired nucleic acid sequence by organic synthesis and inserted sequentially into I

In a vector which is multiplied by cultivation prior to each subsequent insertion. IN

I 30 I

In The Pharmacia Catalog "Molecular Biologicals" (1984), "Gene Cartridges", viz. IN

double-stranded restriction fragments containing a trp promoter / operator. This I

However, the document does not disclose the use of these fragments for multiplying an I

In nucleic acid sequence, and even if the fragments were used for multiplication, I permits

35 fragments do not attach a promoter sequence at one end of the multiplied I

In nucleic acid. IN

3 DK 175248 B1

The method of the present invention bears some resemblance to the molecular cloning method; however, it does not involve the proliferation of any organism, thereby avoiding the potential risks associated with it or the inconvenience this may cause. Also, the present invention does not require synthesis of nucleic acid sequences which are not related to the desired sequence, thus avoiding the need for a comprehensive purification of the product from a complicated biological mixture.

The present invention relates to a first and a second single-stranded oligonucleotide 10 (primer) that allows exponential multiplication by polymerase chain reaction of one or more specific nucleic acid sequences present in a nucleic acid, or in a mixture thereof, and attachment of a promoter sequence. The hybrid product of one primer, when hybridized to the other, becomes a template for the preparation of the desired specific nucleic acid sequence and vice versa, and the process is repeated as often as necessary to produce the desired amount of the sequence. It is expected that this method is more efficient than methods described above for producing large amounts of nucleic acid from a target sequence and for producing such nucleic acid for a short period of time, by comparison.

The present method is particularly useful for multiplying rare 20 nucleic acids present in a mixture of nucleic acids to efficiently detect such forms.

In Kleppe et al., J. Mol. Biol. 56: 341 (1971) discloses a method for synthesizing DNA using primer-initiating, template-conducting repair replication, and it is proposed that replication cycles may be repeated by adding a fresh dose of DNA polymerase each time. However, there is no suggestion that primer extension products should be complete enough to be able to form stable primer-template complexes to act as templates for primers in subsequent rounds of primer extension and that exponential in vitro multiplication is only possible by forming such complexes which act as complete templates in subsequent rounds.

Specifically, the present invention provides a first and second single-stranded oligonucleotide that allow exponential multiplication by polymerase chain reaction of a specific nucleic acid sequence contained in a single-stranded or double-stranded nucleic acid, or in a mixture of such nucleic acids, wherein:

I DK 175248 B1 I

4 I

(a) the first single-stranded oligonucleotide is substantially complementary to I

In the single-stranded nucleic acid or to the one strand of the double-stranded I

In nucleic acid; IN

In (b) the second single-stranded oligonucleotide is substantially complementary to I

In 5 a complement of the single stranded nucleic acid or to the second strand of I

In the double-stranded nucleic acid; IN

(C) one of the single-stranded oligonucleotides further contains an I

In sequence which is non-complementary to the nucleic acid, which sequence is an I

In promoter sequence; and in

I (d) those portions of the substantially complementary oligonucleotides,

You define the ends of the specific nucleic acid sequence to be

You multiply. IN

European Patent No. 200,362 describes methods of detection and I

In cloning of multiplicated nucleic acid sequences, these sequences have become I

multiplied by applying the method of the present application, I

I and the present application are a divided application of European application I

In No. 86 30 2299.2. IN

The oligonucleotides of the present invention may be useful not only to

produce large amounts of an existing nucleic acid of complete I

specified sequence, but also to produce nucleic acid sequences known in the art

to exist but are not fully specified, and subsequently I

In transcription of the multiplied nucleic acid, an initial copy of I

In the sequence to be multiplied, be available in each case, albeit not

You need to be a pure or separate molecule. IN

In Fig. 1, a 94 base pair sequence of human β-globin is desired, which is desired

multiplied. The single base pair change associated with sickle cell anemia is I

In 30 depicted under the 94-mer. IN

In FIG. 2 shows an autoradiogram of polyacrylamide gel electrophoresis showing I

In multiplication of the 94 mer contained in human wild-type DNA and in a plasmid which I

I contains a 1.9 kb BamHI fragment of the normal β globin {designated I

In 35 pBR328: HbA). IN

In FIG. 3 shows an autoradiogram of polyacrylamide gel electrophoresis demonstrating I

In multiplying any of the specific 94-mer target sequence to I

Present in pBR328: HbA, a plasmid containing, a 1.9 kb BamHI fragment of the β-globin sickle cell allele (designated pBR328: HbS), pBR328: HbA where the sequence to be multiplied is cleaved with MstH. and pBR328: HbS, where the sequence to be multiplied has been treated with, but not digested with 5 Mitll.

FIG. Figure 4 shows in detail the steps and products of the polymerase chain reaction for multiplying the desired 94-mer sequence of human β-globin for 3 cycles using two oligonucleotide primers.

10

FIG. Figure 5 shows an autoradiogram of polyacrylamide gel electrophoresis showing multiplication after 4 cycles of a 240-mer sequence in pBR328: HbA, wherein the sub-samples are digested with [Mcol (lane 3), MstH (lane 4) or Hinfl (lane 5). Lane 1 is the molecular weight standard and Lane 2 contains the intact 240 bp product.

FIG. 6 shows the sequence of the normal (βΑ) β globin and sickle cell (βδ) β globin in the region of Ddel and Hinfl restriction sites, where the single underscore for βΑ marks the position of the Ddel restriction site (CTGAG) and the double underscore for βΑ and β "mark the position of the Hinfl restriction site (GACTC).

FIG. Figure 7 shows the results of sequential digestion of normal β-globin using the 40-mer probe and the Ddel restriction enzyme, followed by the Hinfl restriction enzyme.

FIG. 8 shows the sequential digestion of sickle cell β-globin using the same 40-mer probe as in FIG. 7 and the Ddel restriction enzyme, followed by the Hinfl restriction enzyme.

FIG. 9 shows an autoradiogram of polyacrylamide gel electrophoresis showing the use of the same 40-mer probe as in FIG. 7 to specifically characterize the beta-globin alleles present in samples of whole human DNA which have been subjected to multiplication by the method of the invention.

FIG. Figure 10 shows a photograph of a 6% NuSieve agarose gel visualized using ethidium bromide and UV light. This photograph demonstrates the multiplication of a sub-fragment of a 110-bp long multiplication product, which sub-fragment is an intrinsically inserted set of the 110-bp long fragment.

I DK 175248 B1 I

6 I

The term "oligonucleotide" as used herein with reference to primers, probes, I

oligomer fragments to be detected, oligomer controls and unlabeled blocking I

In oligomers, is defined as a molecule comprising 2 or more deoxyribonucleotides or I

In ribonucleotides, preferably more than three. Its exact size will depend on I

In 5 many factors which in turn depend on the final function or use of I

In the oligonucleotide. IN

As used herein, the term "primer" refers to an oligonucleotide, whether or not I

You occur naturally as in a purified restriction digest or are produced

10 synthetic, which is capable of acting as an initiation point for synthesis when it I

is placed under conditions whereby the synthesis of a primer extension product which is I

complementary to a nucleic acid strand is induced, i.e. in the presence of nucleotides I

and an inducing agent such as DNA polymerase and a suitable temperature and pH value. IN

Preferably, the primer is single-stranded to achieve maximum efficiency by multiplication, I

15 but may alternatively be double-stranded. If the primer is double stranded, it should first be I

You are processed to separate its strands prior to being used to generate I

In extension products. The primer is preferably an oligodeoxyribonucleotide. The primer must

You are sufficiently long to prime the synthesis of extension products in the presence of I

In the inducing agent. The exact lengths of the primers will depend on many factors, I

In 20 inclusive temperature, primer source and application of the method. For example. diagnostic I

In purpose, the oligonucleotide primer contains, depending on the complexity of the target sequence I

Typically, 15-25 or more nucleotides, although it may contain fewer nucleotides. For those of you

other applications, the oligonucleotide primer is typically shorter, e.g. 7-15 nucleotides. IN

Such short primer molecules usually require lower temperatures to form

In 25 sufficiently stable hybrid complexes with the template. IN

Here, the primers are selected to be "substantially" complementary to those I

In different strings of each specific sequence to be multiplied. This means, I

In that the primers must be sufficiently complementary to hybridize with their I

In 30 respective strings. Therefore, the primer sequence need not reflect it

In exact sequence of the template. IN

One of the primers used for multiplication further contains an I

In promoter sequence which is non-complementary to the sequence desired I

In 35 multiplied. Non-complementary bases or longer sequences may be distributed in I

the primer, provided that the primer sequence has sufficient complementarity with I

In the sequence of the string to be multiplied to hybridize thereto and I

DK 175248 B1 thereby forms a template for the synthesis of the extension product of the second primer.

As used herein, the terms "restriction endonucleases" and 5 "restriction enzymes" refer to bacterial enzymes, each of which cuts double-stranded DNA at or near a specific nucleotide sequence.

As used herein, the term "DNA polymorphism" refers to the state in which two or more different nucleotide sequences may exist at a particular site in the DNA.

The term "restriction fragment length polymorphism" ("RFLP") refers to the differences in individuals in the lengths of restriction fragments formed by digestion with a particular restriction endonuclease.

15

The use of the present invention involves single-stranded oligonucleotides useful in a method for exponential multiplication by polymerase chain reaction of any one or more desired specific nucleic acid sequences found in a nucleic acid and for attachment of a promoter sequence. Since large amounts of a specific sequence can be prepared by the present method, the present invention can be used to improve the efficiency of cloning DNA or mRNA and to multiply a target sequence to facilitate its detection. The present invention is also useful for obtaining large amounts of the desired sequence from a mixture of nucleic acids resulting from a non-perfect chemical synthesis.

In general, the single-stranded oligonucleotides of the present invention can be used in a process involving a chain reaction to produce, in exponential amounts, in the preposition for the number of reaction steps involved, at least one specific nucleic acid sequence provided that (a) the ends of the required sequence are known in sufficient detail to allow oligonucleotides to be synthesized which will hybridize thereto; The product of the chain reaction will be a separate nucleic acid duplex with termini corresponding to the ends of the 35 specific primers used.

Any source of nucleic acid, in purified or non-purified form, may be used as the starting nucleic acid (s), provided that it contains

I DK 175248 B1 I

8 I

or suspected of containing the desired specific nucleic acid sequence. IN

Thus, in the process, e.g. DNA or RNA, including I, is used

mRNA, which DNA or RNA may be single-stranded or double-stranded. IN

In addition, a DNA-RNA hybrid containing a strand of I can be used

5 each. A mixture of any of these may also be used

nucleic acids, or nucleic acids produced by an I may also be used

In previous multiplication reaction as described herein using the I

In the same or different primers. The specific nucleic acid sequence to be I

Multiplying may be just a fraction of a larger molecule or may be to I

I 10 is initially present as a separate molecule so that the specific sequence I

You make up the whole nucleic acid. It is not necessary that the sequence to be

In multiplying, the present is initially in a pure form; it may be a smaller fraction of I

In a complex mixture such as a portion of the β-globin gene contained in whole human DNA, I

I or a portion of the nucleic acid sequence derived from a particular microorganism,

In which organism may simply constitute a very small fraction of a particular biological I

In trial. The starting nucleic acid may also contain more than the desired I

specific nucleic acid sequence which may be the same or different. The I

Therefore, in the present oligonucleotides, it is not only useful for producing large I

quantities of a specific nucleic acid sequence, but also for simultaneous multiplication I

In 20 of more than one different specific nucleic acid sequence located on the I

In the same or different nucleic acid molecules. IN

In the nucleic acid or acids can be obtained from any source, e.g. from plasmids I

In seed compBR322, from cloned DNA or RNA, or from natural DNA or RNA from any one I

In any source, including bacteria, yeast, viruses or higher organisms, such as plants I

In or animals. DNA or RNA can be extracted from blood, tissue material such as chorionic villi, I

I or from amnium cells by a variety of methods, such as described by Maniatis et al., I

In Molecular Cloning. (1980), 280-281. IN

Any specific nucleic acid sequence can be generated with the oligonucleotides of the present invention.

In the present invention. It is only necessary that a sufficient number of bases at both I

At the ends of the sequence are known in sufficient detail so that two I can be prepared

In oligonucleotides which will hybridize to different strands of the desired sequence I

I and at relative positions along the sequence such that an extension product I

When synthesized from a primer, when separated from its template (complement),

as a template for extending the second primer to a nucleic acid having a defined I

In length. The greater the knowledge of the bases at both ends of the sequence, the greater you can

the specificity of the primers for the target nucleic acid sequence is, and the greater is I

9 E 175248 B1 efficiency of the method. It will be appreciated that the word "primer" as used herein may refer to more than one primer, particularly in the case where there is any ambiguity regarding the terminal sequence (s) of the fragment which must be multiplied. Eg. in the case where a nucleic acid sequence is deduced from protein sequence information, a collection of primers containing sequences representing all possible codon variations based on the degeneration of the genetic code will be used for each strand. A primer from this collection will be 100% homologous to the end of the desired sequence to be multiplied.

The oligonucleotide primers may be prepared using any suitable method, such as e.g. the phosphotriester method or the phosphodiester method described above or automated embodiments thereof. In one such automated embodiment, diethylphosphoramidites are used as starting materials and can be synthesized as described by Beaucage et al., Tetrahedron Letters (1981), 22: 1859-1862. A method for synthesizing oligonucleotides on a modified solid support is disclosed in U.S. Patent No. 4,458,066. It is also possible to use a primer which has been isolated from a biological source (such as a restriction end o n digestive digestion).

The specific nucleic acid sequence is generated by using the nucleic acid containing this sequence as a template. If the nucleic acid contains two strands, it is necessary to separate the strands of the nucleic acid before it can be used as a template, either in a separate step or simultaneously with the synthesis of the primer extension products. This strand separation can be achieved by any suitable method, including physical, chemical or enzymatic methods. A physical method of separating the strands of the nucleic acid involves heating the nucleic acid until it is completely (> 99%) denatured.

Typical heat denaturation may involve temperatures ranging from ca. 80 to 105 ° C for periods of time on fraca. for up to 10 minutes. String separation can also be induced by an enzyme from the class of enzymes known as helicases, or the enzyme RecA, which has helicase activity and is known to denature DNA in the presence of riboATP. The reaction conditions suitable for separating the nucleic acid strands by helicases are described by Kuhn Haffmann-Berling, CSH-Ouantitative Bioloav. 42: 63 (1978) and methods for using RecA are summarized in 35 C. Radding, Ann. Rev. Genetics. 16: 405-37 (1982).

If the original nucleic acid containing the sequence to be multiplied is single-stranded, its complement is synthesized by adding a

I 10 DK 175248 B1 I

In or more oligonucleotide primers thereto. If an appropriate single primer I

is added, a primer extension product is synthesized in the presence of the primer, an I

In inducer or catalyst for the synthesis and the 4 nucleotides described below. IN

The product will be partially complementary to the single-stranded nucleic acid and will

I hybridize with the nucleic acid strand to form a duplex of odd long I

In strings which can then be separated into single strings, as described above to I

In generating two single, complementary strings separated. Alternatively, two I

appropriate primers are added to the single-stranded nucleic acid and reacted

The tion can be performed. IN

I 10 I

If the original nucleic acid is the sequence to be multiplied, you will

In the primer extension product (s) produced, I

You are completely complementary to the strands of the original nucleic acid and I

You will hybridize herewith to form a duplex of strings of equal length as you

In 15 can be separated into single-stranded molecules. IN

When the complementary strands of the nucleic acid or acids are separated, the strands are I

In either the nucleic acid was originally double stranded or single stranded - ready to

You will be used as a template for the synthesis of additional nucleic acid strands. This one

In synthesis can be carried out using any suitable method. Generally speaking, I

It takes place in a buffered aqueous solution, preferably at a pH of 7-9, most preferably ca. IN

Preferably, a molar excess is added (for cloned nucleic acid usually about 1

In 1000: 1 primer: template, and for genomic nucleic acid usually approx. 106: 1 primer: I

In template) of the two oligonucleotide primers for the buffer containing the separated I

In 25 template strings. However, it should be understood that the amount of complementary strand may be I

is not known if the present method is used for diagnostic purposes, I

so that the amount of primer relative to the amount of complementary strand cannot

determined with certainty. As a practical precaution, the amount of primer I added

however, generally be in molar excess relative to the amount of complementary I

30 template when the sequence to be multiplied is contained in a mixture of I

complicated, long-chain nucleic acid strands. A large molar excess I is preferred

to improve the efficiency of the method. IN

In the Deoxyribonucleoside triphosphates dATP, dCTP, dGTP and TTP are also added to I

In the synthesis mixture in appropriate amounts and the resulting solution is heated

I to approx. 90-100 ° C for approx. 1 to 10 minutes, preferably 1 to 4 minutes. After this I

heating period, the solution is allowed to cool to room temperature, which is to I

Preferably for primer hybridization. To the cooled mixture is added a suitable I

B1 agent for inducing or catalyzing the primer extension reaction (herein called inducing agent), and the reaction is allowed to proceed under conditions known in the art. This synthesis reaction can take place at from room temperature up to a temperature above which the inducing agent no longer functions effectively. Thus, if the DNA polymerase, e.g. When used as an inducing agent, the temperature will generally not be greater than ca. 40eC. It is most convenient for the reaction to take place at room temperature.

The inducing agent may be any compound or system which will function to perform the synthesis of primer extension products, including enzymes. Suitable enzymes for this purpose include e.g. E. coli DNA polymerase I, Klenow fragment of E. coli DNA polymerase I, T4 DNA polymerase or other available DNA polymerases, reverse transcriptase and other enzymes, including heat-stable enzymes, which will facilitate the combination of the nucleotides on the appropriate way to form the primer extension products which are complementary to each nucleic acid strand.

The synthesis will generally be initiated at the 3 'end of each primer and proceed in the 5' direction along the template strand until the synthesis stops, producing molecules of different lengths. However, there may be inducers which initiate synthesis at the 5 'end and the synthesis proceeds in the other direction using the same process 20 as described above.

The newly synthesized strand and its complementary nucleic acid strand form a double stranded molecule which is used in the subsequent steps of the process. In the next step, the strands are separated from the double-stranded molecule using any of the methods described above to produce single-stranded molecules.

New nucleic acid is synthesized on the single-stranded molecules. Additional inducers, nucleotides and primers may be added if necessary to continue the process under the conditions described above. The synthesis will again be initiated at one end of the oligonucleotide primers and will proceed along the individual strands of the template to generate additional nucleic acid. After this step, half of the extension product will consist of the specific nucleic acid sequence bounded by the two primers.

The steps of strand separation and extension product synthesis can be repeated as often as necessary to produce the desired amount of the specific nucleic acid sequence. As will be discussed in further detail below, the amount of the specific nucleic acid sequence produced will accumulate exponentially.

I 12 DK 175248 B1 I

I When it is desired to generate more than one specific nucleic acid sequence from the first I

In nucleic acid or a mixture of nucleic acids, the appropriate number of I is used

In various oligonucleotide primers. For example, if must be made two different, I

In 5 specific nucleic acid sequences, 4 primers are used. Two of the primers are specific

I for one of the specific nucleic acid sequences and the other two primers are specific for that I

In other specific nucleic acid sequence. In this way, each of the two different I

In specific sequences, exponentially is prepared by the present method. IN

The oligonucleotides of the present invention can be used in an exponential I

In multiplication method, which is carried out in a stepwise manner, where after each I

new reagents are added or all reagents are added simultaneously in I

the initial stage or partially incrementally and partially simultaneously, where fresh reagent I

You are added after a given number of steps. If you use string I for string separation

In a method such as heat which will inactivate the inducing agent, which is I

In the case of heat-labile enzyme, it is necessary to supplement it

In inducing agent after each strand separation step. When there to strings- I

In the separation step, enzymatic agents are used, the simultaneous method I

You are used. In the simultaneous procedure, the reaction mixture may be in addition to I

In the nucleic acid strand (s) contain the desired sequence, strand I

In the separation enzyme (eg helicase), a suitable energy source for strand separation I

the enzyme such as rATP, the 4 nucleotides, the oligonucleotide primers in molar excess I

I and the inducing agent, e.g. Klenow fragment of E.coli DNA polymerase I. I

If heat is used for denaturation in a simultaneous process, a heat-stable I

In an inducing agent such as a thermostable polymerase, which I

polymerase will function at an elevated temperature, preferably 65-90 ° C depending on I

In the inducing agent at which temperature the nucleic acid will consist of individual and I

In double strings in equilibrium. For smaller lengths of nucleic acid, lower I

At temperatures of approx. 50 ° C is used. The upper temperature will depend on the temperature

At the temperature at which the enzyme will decompose or the temperature at which I

an insufficient level of primer hybridization will occur. Such an I

In heat stable enzyme is described in e.g. A.S. Kaledin et al., Biokhimiva. 45, 644-651 I

In (1980). Each step in the process will occur sequentially despite all the reagents being in you

You present in the beginning. Additional material can be added as needed. After you

A suitable time has elapsed to produce the desired amount of the I

In specific nucleic acid sequence, the reaction can be stopped by inactivating I

In the enzymes in known manner or separate the components of the reaction. IN

13 DK 175248 B1

A method using the oligonucleotides of the present invention can be performed continuously. In one embodiment of an automated process, the reaction can take place in cycles through a denaturation region, a reagent addition region, and a reaction region. In another embodiment, the enzyme used for the synthesis of the primer extension products can be immobilized on a column.

The other reaction components can be circulated continuously through the column through a column and a heating coil in series, so that the produced nucleic acids 10 can be repeatedly denatured without inactivating the enzyme.

A method using the oligonucleotides of the present invention is shown in diagram below, where double-stranded DNA containing the desired sequence [S] consisting of complementary strands [S +] and [S '] is used as the nucleic acid. During the first and each subsequent reaction cycle, elongation of each oligonucleotide primer on the original template will produce a new undefined length ssDNA molecule product that terminates with only one of the primers. These products, hereafter referred to as "long products", will accumulate in a linear fashion; i.e. that the amount present after any number of cycles will be 20 proportional to the number of cycles.

The long products thus produced will act as templates for one or the other of the oligonucleotide primers during subsequent cycles and will produce molecules of the desired sequence [S +] or [S ']. These molecules will also act as templates for one or the other oligonucleotide primers to generate additional [S +] and [S '], thus conducting a chain reaction which will result in the accumulation of [S] at an exponential rate relative to the number of cycles.

By-products produced by oligonucleotide hybridizations other than those desired are 30 non-catalytic (except in rare cases) and thus accumulate at a linear rate.

The specific sequence to be multiplied, [S], can be plotted in diagram as follows: 35 [Sf] 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3' [S] 3 ΎΤΤΤΤΤΤΤΤΤΥΥ YYYY YY YY GGGGGGGGGG51

The suitable oligonucleotide primers would be:

I DK 175248 B1 I

14

In Primer 1: GGGGGGGGGG I

| Primer 2: AAAAAAAAAA I

In such that if DNA containing [S] I

Is I

I ... zzzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz ... I

I ... ZZZZZZ2ZZZZZZZZZI 11 I I I I 111 YYYYYVYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz ... I

I are separated into single strands and the single strands hybridized with primers 1 and 2, I can

In the following elongation reactions, DNA polymerase is catalyzed in the presence of the four I

In deoxyribonucleoside triphosphates: I

I 3 '5' I

By extension <------------------------------------ G03QQGQQQG primer 1 I

I 15 I

I .... zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz .... I

In original template string + I

In original template string 'I

I 20 .... ZZZZZZZZZZZZZZZZl I I I I I I I I IVYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz .... I

In primer 2 'AAAAAAAAAA ....................................> extension I

I 5 3 I

25 When denaturing the two duplexes formed, the products are: I

I 3 '5' I

I .... zzzzzzzzzzzzzzzzzzi I ΓΙ Ι I l ΠI mYYYYYYYGGGGGGGGGG I

recently synthesized long product 1 I

I 30 I

I I

I .... zzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz .... I

original template string + I 1

3 'I

I .... zzzzzzzzzzzzzzzzizi 11111 π i ifYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz .... I

original template string 'I

15 DK 175248 B1 5 '3' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz .... recently synthesized long product 2 5 If these 4 strands are allowed to rehybridize with primers 1 and 2 of the next cycle, the inducing agent will catalyze the following reactions:

Primer 2 5 'AAAAAAAAAA ----------------------> extended here 10 3' ... .zzzzzzzzzzzzzzzzTTTTTTTTTTYYYYYYYYYYGGGGGGGGGG 5 'newly synthesized long product 1 extension <---- --------------------- GGGGGGGGGG 5 'primer 1 original template string *

Primer 2 5 'AAAAAAAAAA ....................> extended 20 3' ... zzzzzzzzzzzzzzzzI ΓΓΤΊΊ II 11 YYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz .... 5 'original template string "extension here < ....................... GGGGGGGGGG 5 'primer 1 25 5' AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz .... 31 newly synthesized long product 2

If the strands of the above four duplexes are separated, the following strings are found: 30 5'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCC 3 'newly synthesized [S +] 3' .... zzzzzzzzzzzzzzzzzzI III II III IyYYYYYYYYYGGGGGGGGGGG 5 'first-synthesized .zzzzzzzzzzzzzzzzzz ΓΠ IIIIIII YYYYYYYYYYGGGGGGGGGG 5 'newly synthesized long product 1

I DK 175248 B1 I

16 I

I 5 '—zzzzzzzzzzzzzzzzzzAAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzzzz — 3' I

In original template string * I

I 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz .... 3' I

In 5 newly synthesized long product 2 I

3 '.... ζζζζζζζζζζζζζζζζΊ I I I I I 1111 YYYYYYYYYYGGGGGGGGGGzzzzzzzzzzzzzzzz .... 5' I

In original template string 'I

I 10 3'I I I ITTTI'I IYYYYYYYYYYGGGGGGGGGG 5 'I

In newly synthesized [S '] I

I 5 'AAAAAAAAAAXXXXXXXXXXCCCCCCCCCCzzzzzzzzzzzzzzzz .... 3' I

first-cycle synthesized long product 2 I

I 15 I

It appears that each strand terminating with the oligonucleotide sequence of a primer and the

In the complementary sequence of the other, the specific nucleic acid sequence [S], as

You wanted to make. IN

I The steps of this process can be repeated infinitely, being limited only by I

In the amount of primers 1 and 2, inducing agent and nucleotides present. IN

The amount of original nucleic acid remains constant throughout the process because it does not

You get replicated. The quantity of long products increases linearly because they are only produced in I

from the original nucleic acid. The amount of specific sequence increases exponentially. IN

Thus, the specific sequence will become the dominant form. This is illustrated in the I

following table, which gives the relative quantities of the forms theoretically present I

I after n cycles, assuming 100% efficiency in each cycle:

17 DK 175248 B1

Number of double strings after 0 to n cycles

Cvc Number of Template Long Products Specific Sequence [S] 5 0 1 - 111 0 2 12 1 3 13 4 5 15 26 10 10 1 10 1013 15 1 15 32,752 20 1 20 1,048,555 η 1 n (2n-nl) 15 If using a single-stranded nucleic acid as a template, only 1 long product per cycle.

The oligonucleotides (primers) of the present invention can be used to clone a particular nucleic acid sequence for insertion into a suitable expression vector. The vector can then be used to transform a suitable host organism to produce the gene product of the sequence by standard methods of recombinant DNA technology.

Furthermore, the oligonucleotides can be used for in vitro mutagenization. The oligodeoxyribonucleotide primers need not be exactly complementary to the 25 DNA sequence to be multiplied. It is only necessary that it be capable of hybridizing to the sequence sufficiently to be elongated by the polymerase enzyme or other inducing agent now used.

The product of a polymerase chain reaction in which the primers used are not exactly complementary to the original template will contain the sequence of the primer rather than of the template, thereby introducing an in vitro mutation. IN

For further cycles, this mutation will be multiplied by unimpaired efficiency because no additional mismatch primings are required. The mutant thus produced can then be inserted into a suitable vector by standard molecular biological methods and can confer mutant properties on this vector, such as the potential for producing an altered protein.

The method of producing an altered DNA sequence, as described above, can be repeated on the altered DNA using different primers, thus I

that further sequence changes are induced. In this way, gradually you can

H is generated a series of mutated sequences, with each addition in the series only I

will differ from the latter to a lesser extent, but from the original DNA

source sequence increasingly. In this way, you can ultimately do it

5 changes which were not appropriate in a single step due to the fact that I

very severe mismatch primer cannot work. IN

Furthermore, one of the oligonucleotides of the present invention, as part of its I

sequence contain a non-complementary sequence, provided that sufficient quantities I

10 of the primer contains a sequence that is complementary to the strand I

must be multiplied. IN

After the extension primer is added, sufficient cycles are made to

obtain the desired amount of the new template containing the non-I

15 complementary nucleotide insertion. This allows the production of large quantities of I

combined fragments in a relatively short time (e.g., 2 hours or less) under I

In applying a simple technique. IN

The oligonucleotides described herein may also be used to enable detection of I

20 and / or characterize specific nucleic acid sequences associated with infectious I

diseases, genetic or cellular diseases such as cancer. Multiplication I

You are useful when the amount of nucleic acid available for analysis is very small

such as e.g. in prenatal diagnosis of sickle cell anemia using DNA I

In obtained from fetal cells. Multiplication is particularly useful if such an analysis

25 should be performed on a small sample using non-radioactive I

detection methods which may be intrinsically insensitive or radioactive

methods are used but how fast detection is desirable. IN

In relation to the present invention, genetic diseases may include I

30 specific deletions and / or mutations in the genomic DNA of any one I

preferably organism, such as e.g. a person suffering from sickle cell anemia, cystic

fibrosis, α-thalassemia, β-thalassemia and the like. Sickle cell anemia can easily be detected by I

by oligomer restriction analysis or an RFLP-like assay followed by multiplying the appropriate DNA sequence by the present method. α-Thalassemia can be detected in the absence of a sequence, and β-Thalassemia I can be detected in the presence of a polymorphic restriction site closely linked to a mutation that causes the disease.

19 DK 175248 B1

All of these genetic diseases can be detected by multiplying the appropriate sequence and analyzing it by Southern blot technique without the use of radioactive probes. In a side approach, e.g. a small sample of DNA from e.g. amniotic fluid containing a very low level of the desired sequence is cut with a restriction enzyme and analyzed by a Southern blotting technique. The use of non-radioactive probes is facilitated by the high level of the multiplied signal.

In another embodiment, a small sample of DNA can be multiplied to a suitable 10 level, and then a further cycle of elongation reactions can be carried out, with nucleotide derivatives easily detectable (such as the 1 2 3 4 5 6 7 8 9 10 11 P label). or biotin-labeled nucleoside triphosphate) is directly incorporated into the final DNA product which can be assayed by restriction analysis and electrophoretic separation or by any other suitable method. An example of this technique in a model model system is shown in Figure 5.

In a further embodiment, shown in a model system of Figure 3, the nucleic acid may be subjected to a particular restriction endonuclease for the multiplication. Since a sequence that has been cut cannot be multiplied, the presence of a multiplied fragment, despite prior restriction on the DNA sample, means the absence of a recognition site for the endonuclease in the multiplied sequence. The presence or absence of a multiplied sequence can be detected by a suitable method.

A practical application of this technique can be illustrated by its use to make it easier to detect sickle cell anemia by oligomer restriction technique 3 described hereinafter and by R.Saiki et al., Bio / Technoloav 3: 1008-1012 (1985).

4

Sickle cell anemia is a hemoglobin disease that results from a single base pair shift in the 6.

5 codon of the β-globin gene. Figure 6 shows the sequences of normal β-globin genes and 6 sickle cell β-globin genes in the region of their polymorphism, with a single 7 underlining marking the location of a Ddel recognition site that is present only in the normal gene and where the double underlining marks the location of 9 is a Hinfl recognition site that is not polymorphic and thus is present in both the normal and sickle cell alleles. Figure 7 shows the oligomer restriction process of normal β-globin DNA using a probe; which spans both restriction sites and the mark where an asterisk is indicated. The DNA multiplied as provided herein is denatured and annealed to the labeled probe. The enzyme Ddel cleaves the DNA at the recovered one

I 20 DK 175248 B1 I

DdeI qenkendelsessted. and creates a labeled octamer. Under the I used

Under conditions of the sample, the octamer is short enough to dissociate from the duplex. And I

In subsequent addition of the enzyme Hinfl has no effect on the now single I

In stringed octams. Figure 8 shows the same process applied to I

5 the sickle cell allele of β-globin DNA. The enzyme Ddel cannot cleave the duplex that is I

I formed by the multiplied DNA and the labeled probe, due to an A-A I

In base pair pairing. However, the enzyme Hinfl cleaves the hybrid and I is produced

In a labeled trimer. In practice, the method can diagnose the DNA of an individual such as I

is either homozytic for the wild type, homozygous for the sickle cell type or hetero-I

I zygotic carrier of the sickle cell system, since a specific signal is associated with I

In the presence of both alleles. Application of the method described above

Multiplying the relevant sequence allows rapid analysis of a single I gene

copy using a probe with just a single 32P label. IN

15 Various infectious diseases can be diagnosed in clinical trials

In specific DNA sequences characteristic of the pathogenic I

In microorganism. These include bacteria such as Salmonella, Chlamydia, Neisseria, I

viruses such as hepatitis viruses and protozoparasites such as Plasmodium causing I

In malaria. In the specification of US Patent No. 4,358,535 issued to Falkow, I is mentioned

20 the use of specific DNA hybridization probes for the diagnosis of infectious I

diseases. An inherent problem in the Falkow procedure is that there may be an I

relatively small number of pathogenic organisms present in a clinical trial from an I

infected patient, and the DNA extracted from them may constitute just one

H only very small fraction of the total DNA in the sample. Specific multiplication of I

H 25 suspected sequences prior to immobilization and hybridization detection of DNA-I

the tests would greatly improve the sensitivity and specificity of these procedures. IN

Routine clinical applications of DNA probes for the diagnosis of infectious I

diseases would be considerably simplified if non-I could be used

30 radiolabelled probes as described in EP 63,879 to Ward. In this I

In the process, biotin-containing DNA probes are detected by chromogenic I

enzymes bound to avidin or biotin-specific antibodies. This type of detection I

You are comfortable, but relatively insensitive. The combination of specific DNA multiplication I

by the present method and the use of stably labeled I

In 35 probes, provide the convenient and sensitive method required to do so

The Falkow and Ward procedures are useful in a routine clinical setting. IN

----- - ~ - - = - · -1- 21 DK 175248 B1

The oligonucleotides of the present invention may also be used to generate sufficient amounts of DNA from a human single copy gene so that detection with a simple, non-specific DNA color such as ethidium bromide can be used to produce a direct DNA diagnosis.

5

In addition to detecting infectious diseases and pathological abnormalities in the genome of the organisms, the oligonucleotides of the invention can also be used to detect DNA polymorphisms that may not be associated with a pathological condition.

The following examples are given by way of illustration and are not intended to limit the invention in any way. In these examples, all percentages are expressed in percentages by weight for solids and in percentages by volume for liquids, and all temperatures are in degrees Celsius unless otherwise stated.

15

Example 1

A 25 base pair long sequence with the nucleotide sequence 20 5'CCTGGGCACCGTCACCCTGGATGCT 3 '3'GGAGGGGTGGCAGTGGGACCTACGA 5 * contained in a 47 base pair Fokl restriction fragment of pBR322 obtained from ATCC was prepared. A Fokl digest of pBR322 containing the 47 bp fragment was prepared by digesting pBR322 with Fokl according to the conditions proposed by the supplier, New England Biolabs Inc. The primers used were 5 'd (CCTCGGCACCG) 3' and 5 'd (AGC-ATCCAGGGTG) 3' and were prepared using conventional methods. The following ingredients were added to 33 μ 33 buffer composed of 25 mM 30 potassium phosphate, 10 mM magnesium chloride and 100 mM sodium chloride at pH 7.5: 2433 pmol of each of the primers described above, 2.4 pmol of the Fokl digested pBR322, 12 nmoldATP, 22 nmol dCTP, 19 nmol dGTP and 10 nmol TTP.

The mixture was heated to 85 ° C for 5 minutes and allowed to cool to ambient temperature. Five units of Klenow fragment from E. coli DNA polymerase I were added and the temperature was maintained for 15 minutes. After this time, the mixture was again heated to 85 ° C for 5 minutes and allowed to cool. 5 units of Klenow fragment were again added and the reaction allowed to proceed for 15

I 22 DK 175248 B1 I

minutes. The steps of heating, cooling and synthesis were repeated even more

In the hallways. IN

After the last repeat, a 5 μΙ sub-sample was taken from reaction I

5 mixture. This was heated to 85 ° C for 3 minutes and allowed to cool to 1

ambient temperature. 12.5 pmol of α-P32 deoxycytidine triphosphate and 5 units I

Klenow fragment was added and the reaction allowed to proceed for 15 minutes. The I

labeled products were investigated by polyacrylamide gel electrophoresis. Fokl- I

In digestion was labeled in a similar manner and served as a control and molecular I

10 weight markers. The only strongly labeled band visible after the 13 cycles, I

In was the intended 25 base pair long sequence. IN

In Example 2 I

I I

The desired sequence to be multiplied was a 94 base pair sequence I

contained in the human β-globin and extending over the MstH site. there is in

involved in sickle cell anemia. The sequence has the nucleotide sequence shown in Figure 1. IN

20 1. Synthesis of Primers I

The following two oligodeoxyribonucleotide primers were prepared at the one below

method described: I

I 25 5 'CACAGGGCAGTAACG 3' Primer A I

I and

I 5 'TTTGCTTCTGACAGA 3' Primer B

Automated Synthesis Procedure: Diethyl Phosphoramidites Synthesized I

According to Beaucage and Caruthers (Tetrahedron Letters (1981) 22: 1859-1862),

H is sequentially condensed into a nucleoside derivatized controlled pore size glass carrier using a Biosearch SAM-1. The procedure included detritylation with trichloroacetic acid in dichloromethane, condensation using benzotriazole as activating proton donor, and capping with acetic anhydride and dimethylaminopyridine in tetrahydrafuran and pyridine.

In Cycle time was approx. 30 minutes. Yield at each stage was largely quantitative and was determined by collection and spectroscopic examination of the dimethoxytrityl alcohol released during detritylation.

23 DK 175248 B1

Removal of oligodeoxyribonucleotide protection and purification procedure: The solid support was removed from the column and exposed to 1 ml of concentrated ammonium hydroxide at room temperature for 4 hours in a sealed glass. The support was then removed by filtration and the solution containing the partially protected oligodeoxynucleotide was heated to 55 ° C for 5 hours. Ammonia was removed and the residue was applied to a preparative polyacrylamide gel. Electrophoresis was performed at 30 volts / cm for 90 minutes, after which the band containing the product was identified by UV shading of a fluorescence plate. The strip was cut and eluted with 1 ml of distilled water overnight at 4 ° C. This solution was loaded onto an Altech RP18 column and eluted with a 7-13% gradient of acetonitrile in 1% ammonium acetate buffer at pH 6.0. The elution was measured by UV absorption at 260 nm, and the appropriate fraction was collected, quantified by UV absorbance in a fixed volume and evaporated to dryness at room temperature in a vacuum centrifuge.

Characterization of oligodeoxyribonucleotides: Test samples of the purified oligonucleotides were 32P-labeled with polynucleotide kinase and γ-32Ρ-ΑΤΡ. The labeled compounds were examined by autoradiography of 14-20% polyacrylamide gels after 20 electrophoresis for 45 minutes at 50 volts / cm. This procedure verified the molecular weight. The base composition was determined by digestion of the oligodeoxyribonucleotide to nucleosides using poison diesterase and bacterial, alkaline phosphatase and subsequent separation and quantification of the derived nucleosides using a reverse phase HPLC column and a mobile phase of 25% acetonitrile. , 1% ammonium acetate.

II. DNA source.

A. Extraction of whole human wild-type DNA

30 Human genomic DNA homozygous for normal β-globin was extracted from the cell line Molt4 (obtained from the Human Genetic Mutant Cell Repository and identified as GM2219c) using the technique described by Stetler et al., Proc.Natl.Acad .Sci. (1982), 79: 5966-5970. 1 B. Construction of cloned alobines

A 1.9 kb Bam HI fragment of the normal β globin was isolated from the cosmid pFC11 and inserted into the Bam HI restriction site of pBR328 (Soberon et al., Gene (1980) 2: 287-305). This fragment, which comprises the region that hybridizes to the I DK 175248 B1

Η 24 I

In synthetic 40-mer probes, the first and second exons include the first I

intron and the 5 'flanking sequences of the gene (Lawn et al., Cell (1978), I

15: 1157-1174). This clone was designated pBR328: HbA and was deposited under ATCC I

I No. 39,698 May 25, 1984. I

I I

The corresponding 1.9 kb BamHI fragment of the B-globin I seal cell allele

was isolated from the cosmid pFC12 and cloned as described above. This clone I

I was designated pBR328: HbS and deposited under ATCC No. 39,699 on May 25, I

1984. I

I 10 I

Each recombinant plasmid was transformed into and propagated in E. coli MM294 I

I (ATCC No. 39,607). IN

In C. Digestion of Cloned Olobinos with Mstll I

In 15 A total of 100 µg of each of pBR328: HbA and pBR328: HbS were digested individually with 20 I

In units of Mstll (New England Biolabs) for 16 hours at 37 ° C in 200 μΙ 150 mM Naa, 12 mM I

In Tris Ha (pH 7.5), 12 mM MgCl2.1 mM dithiothreitol (DTT) and 100 µg / ml I

In bovine serum albumin (BSA). The products were designated pBR328: HbA / Mstll I

In pBR328: HbS / Mstll, respectively. IN

I 20 I

III. Polymerase Chain Reaction I

For 100µ! buffer consisting of 60 mM sodium acetate, 30 mM Trisacetate and 10 mM I

magnesium acetate at pH 8.0 was added 2 μΙ of a solution containing 100 picomol I

Primer A (with the sequence d (CACAGGGCACTAACG)), 100 picomoles of Primer B (with I

sequence d (TTTGCTTCTGACACA)) and 1000 picomoles of each of dATP, dCTP, I

dGTP and TTP. In addition, one of the following DNA sources described above was added: I

10 μς whole, human, wild-type DNA (reaction I) I

In 0.1 picomol of pBR328: HbA (reaction II). IN

In 0.1 picomol pB R328: .HbS (reaction III). IN

In 0.1 picomol of pBR328: HbA / MstII (reaction IV). IN

In 0.1 picomol of pBR328: HbS / MstII (reaction V).

No Target DNA (Reaction VI) I 35

Each of the resulting solutions was heated to 100 ° C for 4 minutes and allowed to cool to room temperature for 2 minutes, after which 1 μΙ containing 4 units

Klenow fragment of E. coli DNA polymerase was added. Each reaction was allowed to proceed for 10 minutes, after which the cycle of addition of primers, nucleotides and DNA, heating, cooling, addition of polymerase and reaction was repeated 19 times for reaction I and 4 times for reactions II-VI.

5 4 microliters of sub-samples of reactions I and II removed before the first cycle and after the last cycle of each reaction were loaded with a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts / cm for 4 hours, transferred to a nylon membrane serving as solid-phase support and probed with a 10 synthetic 5'-32P-labeled 40 bp fragment prepared by standard technique. sequence: 5'd (TCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAG) 3 '15 in 30% formamide, 3x SSPE, 5x Denhardt's, 5% sodium dodecyl sulfate at pH 7.4. Figure 2 is an autoradiogram of the probe-treated nylon membrane for reactions I and II. Lane 1 is 0.1 picomole of a 58 bp synthetic fragment control, with 1 strand complementary to the above probe. Lane 2 is 4 μΙ of reaction I prior to the first multiplication cycle. Lane 3 is 4 μΙ of reaction I after 20.

20 multiplication cycle. Lane 4 is 4 μΙ of reaction II after five multiplication cycles. Lane 5 is a molecular weight standard consisting of a Fokl (New England Biolabs) digestion of pBR322 (New England Biolabs) labeled with α-32P-dNTPs and polymerase. Lane 3 shows that after 20 cycles, reaction mixture I contained a large amount of the specific sequence with the correct molecular weight and no other detectable products. Reaction mixture II, after 5 cycles, also contained this product, as well as the starting nucleic acid and other products, as shown by lane 4.

To 5.0 μΙ sub-sample of reactions II-VI after 5 cycles, 5 pmol of each of the primers described above was added. The solutions were heated to 100 ° C for 4 minutes and allowed to equilibrate to room temperature. 3 pmoles of each of α-32P-dATP, α-32P-dCTP, α-32P-dGTP, α-32P-dTTP and 4 units of Klenow fragment were added. The reaction was allowed to proceed for 10 minutes at a final volume of 10 μΙ and at the salt concentrations indicated above. The polymerase activity was terminated by heating for 20 min at 60 ° C. 4 μΙ subsamples of reactions II-VI were loaded onto a 12% polyacrylamide gel 0.089 M in Tris-35 borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts / cm for 4 hours, after which autoradiography was performed.

I DK 175248 B1 I

Η 26 I

In Figure 3 is an autoradiogram of the electrophoresis. Lane 1 is a molecular weight standard, Lane 2 is I

In reaction II, lane 3 is reaction III, lane 4 is reaction IV and lane 5 is reaction V. Another I

In the path of reaction VI as control and without added DNA, no markings had any of I

In the lanes. It can be seen from the drawing that the 94 bp fragment which was I

I predicted from target DNA were present only where intact β-globin DNA sequences were I

In available for multiplication, ie pBR328: HbA (lane 2), pBR328: HbS (lane 3) and I

In pBR328: HbS / Mstll (lane S). MstII digestion intersects pBR328: HbA in the 94-mer sequence, and I

You thereby make it unable to be multiplied and the 94-more band does not appear in lane I

In 4.1, in contrast, the 94-mer sequence in pBR328: HbS is not excised when I

In the plasmid is digested with MstII. and is thus available for multiplication as shown in lane 5. I

Figure 4 shows the chain reaction for 3 cycles by multiplying the 94 bp I

In sequence. PCO1 and PC02 are primers A and B. The numbers on the right hand side indicate the cycles, I

Whereas the numbers on the left indicate the cycle numbers in which a particular molecule became I

I produced. IN

In Example. 3 I

In this example, the multiplication of a 110 bp sequence spanning I

In the allele MstII recognition site in the human hemoglobin. IN

In total 1.0 micrograms of whole human DNA, 100 picomol d (ACACAACTGTGTTCACTAGC) and I

In 100 picomol d (CAACTTCATCCACGTTCACC) where the primers had been prepared I

I by the method of Example 2, was dissolved in 100 μΙ of a solution comprising I

In 25 of: I

1.5 mM of each of the four deoxyribonucleoside triphosphates I

In 30 mM Trisacetate Buffer at pH 7.9 L

In 60 mM sodium acetate I

In 10 mM magnesium acetate I

In 0.25 mM dithiothreitol. IN

The solution was heated to 100 ° C for 1 minute and rapidly brought to 25 ° C for 1 minute

Then 2.5 units of Klenow fragment of DNA polymerase were added. IN

In the polymerase reaction was allowed to proceed for 2 minutes at 25 ° C, after which the cycle of I

In heating, cooling, addition of Klenow fragment and turnover, I

You repeated as often as desired. IN

2? DK 175248 B1

With an efficiency of 70% at each cycle, 15 cycles resulted in the synthesis of 1.4 femtomoles of the desired 110 bp fragment of the β-globin gene.

Example 4 5

This example shows the multiplication of a 240 bp sequence spanning the allele MstII recognition site in the human hemoglobin. This sequence contains Ncol. Hinfl and Mstll restriction sites.

10 To 100 μΙ of a mixture of 60 mM sodium acetate, 30 mM Trisacetate and 10 mM magnesium acetate at pH 8.0 containing 0.1 pmol of pBR328: HbA was added 2 μΙ of solution A containing: 100 picomol d (GGTTGGCCAATCTACTCCCAGG) primer.

15 100 picomol d (TAACCTTGATACCAACCTGCCC) primer 1000 pmol of each of dATP, dCTP, dGTP and TTP.

The two primers were prepared by the method described in Example 2. The solution was heated to 100 ° C for 4 minutes and allowed to cool in ambient air for 2 minutes, then 1 μΙ containing four units of Klenow fragment of E.coli DNA polymerase was added. . The reaction was allowed to proceed for 10 minutes, after which the cycle consisting of addition of solution A, heating, cooling, addition of polymerase and reaction was repeated 3 times. To a subset of 5.0 μΙ of the reactions, 5 picomoles of each of the above oligonucleotide primers were added.

The solution was heated to 100 ° C for 4 minutes and allowed to set to ambient temperature, after which 3 picomoles of each of the α-32P-labeled deoxyribonucleoside triphosphates and 4 units of Klenow fragment were added. The reaction was allowed to proceed for 10 minutes at a final volume of 10 μΙ and at the salt concentrations given above. The polymerase activity was terminated by heating for 20 30 minutes at 60 ° C. 2 μΙ aliquots were digested with Ncol. Mstl or Hinfl and applied to a 12% polyacrylamide gel 0.089 M in Tris-borate buffer at pH 8.3 and 2.5 mM in EDTA. The gel was electrophoresed at 25 volts / cm for 4 hours and autoradiography was performed. Figure 5 shows the autoradiogram of the electrophoresis, where lane 1 is the molecular weight standard, lane 2 is without digestion with enzyme (240 35 bp intact), lane 3 is digestion with NcoI (131 and 109 bp), lane 4 is digestion with

MstII (149 and 91 bp), and lane 5 is digestion with Hinfl (144 and 96 bp). The car radio is consistent with the multiplication of the 240 bp sequence.

I DK 175248 B1 I

28 I

In Example 5 I

This example shows the use of the method described herein for detecting I

In sickle cell anemia by sequential digestion. IN

Is I

In Synthesis and Phosphorylation of Oil Odeox Vribonucleotides I

I A labeled DNA probe, RS06, with the sequence I

5 '* CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG 3' I

In which * indicates the label, and an unlabeled, blocking oligomer, RS10, with I

In the sequence: I

3'GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5 'I

Those having 3 base pairs mismatched with RS06 were synthesized according to I

In the methods as set forth in Example 2 (1). Probe RS06 was labeled by I

In contact 5 pmol thereof with 4 units of T4 polynucleotide kinase (New England Biolabs) I

At 20 and 50 pmol γ-32Ρ-ΑΤΡ (New England Nuclear, about 7200 Ci / mmol) in a 40 µl I

In reaction volume containing 70 mM Tris buffer (pH 7.6), 10 mM MgCl 2, 1.5 mM I

In spermine and 2.5 mM dithiothreitol for 90 minutes at 37 ° C. The total volume was 1

You are then set to 100µΙ with 25mM EDTA and purified according to the procedure of I

In Maniatis et al., Molecular Cloning (1982), 464-465 over a 1 ml Bio Gel P-4 I

In 25 spin dialysis column from BioRad equilibrated with Tris-EDTA (TE) buffer (10 mM Tris-I

In buffer, 0.1 mM EDTA, pH 8.0). The labeled probe was further purified by I

In electrophoresis on an 18% polyacrylamide gel (19: 1 acrylamide.BIS, BioRad) in Tris-boric acid.

In EDTA (TBE) buffer (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA, pH 8.3) for 500 hr. IN

After localization by autoradiography, the portion of the gel containing the I

In 30 labeled probes, cut, crushed and eluted in 0.2 ml TE buffer overnight at I

At 4 ° C. TCA precipitation of the reaction product indicates that the specific activity I

was 4.9 Ci / mmol and the final concentration was 20 pmol / ml. IN

The unlabeled RS10 blocking oligomer was used at a concentration of 200 L

At 35 pmol / ml. IN

29 DK 175248 B1

Isolation of Human Aenomic DNA from Cell Lines

High molecular weight genomic DNA was isolated from the lymphoid cell lines Molt4, SC-1 and GM2064 using essentially the method described by 5 Stetler et al. in PNAS (1982) 79, 5966-5970 (for Molt4) and Maniatis et al. in Molecular Cloning (1982), 280-281.

Molt4 (Human Mutant Cell Repository, GM2219C) is a T cell line that is homozygous for normal β-globin, and SC-1, deposited with ATCC on March 19, 1985, is a 10 EBV-transformed B cell line that is homozygous for the sickle cell allele. The GM2064 (Human Mutant Cell Repository, GM2064) was initially isolated from an individual homozygous with hereditary persistence of fetal hemoglobin (HPFH) and contains no beta or participant lobe gene sequences. All cell lines were maintained in RPMI-1640 with 10% fetal calf serum.

15

Isolation of human oenomic DNA from clinical blood samples

A clinical blood sample, designated CH12, from a known sickle cell carrier (AS) was obtained from Dr. Bertram Lubin from Children's Hospital in Oakland, California.

Genomic DNA was prepared from the "buffy coat" fraction, which consists primarily of peripheral blood lymphocytes, using a modification of the method described by Nunberg et al. in Proc.Nat.Acad.Sci. 75, 5553-5556 (1978).

The cells were resuspended in. 5 ml of Tris-EDTA-NaC! (TEN) buffer (10 mM Tris buffer pH 8, 1 mM EDTA, 10 mM NaCl) and adjusted to 0.2 mg / ml proteinase K, 0.5% SDS, and incubated overnight at 37 ° C. Sodium perchlorate was then added to 0.7 M and the lysate was gently shaken for 1-2 hours at room temperature. The lysate was extracted with 30 ml of phenol / chloroform (1: 1), then with 30 ml of chloroform 30 and followed by ethanol precipitation of the nucleic acids. The pellet was resuspended in 2 ml TE buffer and RNase A was added to 0.005 mg / ml. After digestion for 1 hour at 37 ° C, the DNA was extracted once with an equal volume of phenol, phenol / chloroform and chloroform and ethanol was precipitated. The DNA was resuspended in 0.5 ml of TE buffer and the concentration determined by absorption at 260 nm.

Polymerase Chain Reaction to Selective Multiolicerina of Phthallobin Sequences 35 I DK 175248 B1

30 I

I Two micrograms of genomic DNA was multiplied into an initial 100 μΙ reaction volume I

containing 10 mM Tris buffer (pH 7.5), 50 mM NaCl, 10 mM MgCl 2, 150 pmol Primer A I

I with the sequence d (CACAGGGCACTAACG) and 150 pmol of Primer B with the sequence I

I d (CTTTGCTTCTGACACA) and was covered by ca. 100 μΙ mineral oil to supply I

5 prevent evaporation. IN

Each DNA sample underwent 15 multiplication cycles in which one cycle consisted of I

3 steps: I

10) denaturation in a heat block set at 95 ° C for 2 minutes;

2) immediate transfer to a heat block set at 30 ° C for 2 minutes so that I

allow primers and genomic DNA to anneal, I

3) adding 2 μΙ of a solution containing 5 units of Klenow-I

fragment of E. coli DNA polymerase I (New England Biolabs), 1 nmol of each of I

In 15 dATP, dCTP, dGTP and TTP in a buffer composed of 10 mM Tris (pH 7.5), 50 I

mM NaCl, 10mMMgCl2 and 4mM dithiothreitol. This extension reaction got you

Allow to run for 10 minutes at 30 ° C. IN

After the final cycle, the reaction was terminated by heating at 95 ° C for 2 L

20 minutes. The mineral oil was extracted with 0.2 ml of chloroform and discarded. IN

The final reaction volume was 130 μΙ. IN

Hybridiserino / digestion of multiclated. oenomic DNA with probes οα Ddel / Hinfl I

25 45 μΙ of the multiplied genomic DNA was ethanol precipitated and I

resuspended in the same volume of TE buffer. 10 µΙ (containing the pre- I

multiplied equivalent to 154 ng of genomic DNA) was transferred to a 1.5 ml of I

Micrafuge glass and 20 μΙ TE buffer to a final volume of 30 μΙ. The sample was covered

with mineral oil and denatured at 95 ° C for 10 minutes. 10 μΙ 0.6 M NaCl I

30 containing 0.02 pmol of labeled R306 probe was added to the glass which became I

You blended lightly and the glass was immediately transferred to a 56 ° C hot block for 1 hour. IN

4 µl of unlabeled RS10 blocking oligomer (0.8 pmol) was added and I

the hybridization was continued for another 10 minutes at the same temperature. There you

I added 5 μΙ 60 mM MgCl 7 / 0.1% BSA or 1 μ I Ddel (10 units, New England I

In 35 Biolabs), and the reanneal DNA was digested for 30 min at S6 ° C. Then you

I added 1 μΙ Hinfl (10 units, New England Biolabs) and the mixture I

H was incubated for a further 30 minutes. The reaction was stopped by adding 4 L

μΙ 75 mM EDTA and 6 μΙ trace color to a final volume of 61 μΙ. IN

DK 175248 B1

The mineral oil was extracted with 0.2 ml of chloroform and 18 μΙ of the reaction mixture (45 ng of genomic DNA) was placed on a 30% polyacrylamide minigel (19: 1, Bio Rad) in a Hoeffer SE200 apparatus. The gel was electrophoresed at ca. 300 volts in. 1 hour until the bromophenol blue color front had walked 3.0 cm from the site of application. The top 1.5 cm of the gel was removed and the remaining gel was exposed for 4 days with a sensitivity enhancing screen at -70 ° C.

Discussion of autoradioorafi ffia.9) 10

Each lane contains 45 ng of multiplied genomic DNA. Lane A contains MoT4 DNA; lane B, CH 12; lane C, SC-1 and lane D, GM2064. Molt4 represents the genotype of a normal individual with 2 copies of the pA gene per cell (AA), CH12 is a clinical sample from a sickle cell carrier with one βΑ and one ps gene per cell. cell (AS), 15 and SCI represent the genotype of a sickle cell individual with two copies of the ps gene per cell. cell (SS). GM2064, which does not contain beta or participant lobby sequences, is present as a negative control.

As seen on the autoradiogram, the Ddgl-cleaved pA-specific octamer is only present in the DNAs containing the pA gene (lanes A and B) and the Hinfl-cleaved ps-specific trimer is present only in the DNAs containing the ps gene (lanes B and C). The presence of both the trimer and the octamer (lane B) is diagnostic of a sickle cell carrier and can be distinguished from a normal individual (lane A) by the octamer alone and from a sickle cell-plagued individual (lane C) by trimer alone.

. -25

By comparison, the repetition of the experiment described above using non-multiplied genomic DNA showed that multiplication increased detection sensitivity at least 1000 times.

Example 6

This example illustrates direct detection of a completely uncleaned, single gene copy in whole, human DNA on gels without the need for a labeled probe. 1

Using the method described in Example 3, a 110 bp fragment from a sequence in the first exon region of the beta-globin gene was multiplied from 10 micrograms of whole human DNA after 20 cycles: This 110

I DK 175248 B1 I

32 I

In bp fragments produced after 20 cycles, gels readily visible could be seen

You were stained with ethidium bromide. IN

The sequence was not multiplied once it was cut with the restriction enzyme I

I 5 Ddel. except if the sequence, as in betaglobin S allele, did not contain I

At the restriction site that the enzyme recognizes. IN

In Example 7 I

In 10 A. A total of 100 µmol pBR328 containing a 1.9 kb insert of human I

In beta-globin A allet, 50 nmol of each of ct-32P-dNTP at 500 Ci / mol and 1 nmol of each of I

The primers used in Example 3 were dissolved in a solution containing 100 μΙ I

30 mM Tris-acetate at pH 7.9, 60 mM sodium acetate, 100 mM dithiothreitol and 10 mM I

In magnesium acetate. The solution was brought to 100 ° C for 2 minutes and cooled to 25 ° C for 1 L

For 15 minutes. A total of 1 μΙ containing 4.5 units of Klenow fragment of E. coli DNA polymerase I I

I and 0.09 units of inorganic pyrophosphatase were added to prevent the possible I

In the accumulation of pyrophosphate in the reaction mixture and the reaction was allowed to

You run for 2 minutes at 25 ° C, after which the cycle of heating, cooling,

In enzyme addition and reaction was repeated 9 times. 10 μΙ samples were taken and I

In 20, 1 μΙ 600 mM EDTA was added after each synthesis cycle. Each was analyzed on I

In a 14% polyacrylamide gel in 90 mM Tris-borate and 2.5 mM EDTA at pH 8.3 and 24 L

volts / cm for 2.5 hours. The finished gel was soaked for 20 minutes in the same buffer I

I with the addition of 0.5 µg / ml ethidium bromide, washed with the original buffer and I

In photographed in UV light using a red filter. IN

I 25 I

In the 101bpp fragment prepared, the gel was excised from the gel under ultraviolet light and the I

In incorporated 32P was measured by Cerenkov irradiation. An attempt to fit the results into I

In the equation of the form: pmol / 10 μΙ = 0.01 [(l + y) N-yl \ l - 1], where N represents the number I

of cycles and y is the fraction yield per cycle, was optimal with γ = 0.619. This I

I 30 indicates that a significant multiplication was obtained. IN

In B. The above experiment was repeated except that 100 nmol of each dNTP I

I was added to a 100 μΙ reaction, no radioactive labeling was used and sub-samples I

You were not removed after each cycle. After 10 cycles, the reaction was terminated at I

At boiling for 2 minutes and the re-hybridization was performed at 57 ° C for 1 hour. The sequence I

I of the 110 bp product was confirmed by subjecting 8 μΙ partial samples to I

In restriction analysis by adding 1 μΙ bovine serum albumin (25 mg / ml) and 1 μ 1 of the I

B1 appropriate restriction enzyme (HinfI, Mnll. Mstll. NcoH and by reaction at 37 ° C for 15 hours.

PAGE was performed as described above.

Example 8 5

This example illustrates the use of different primers for multiplying different fragments of pBR328 and 322.

A. The experiment described in Example 7 was repeated except that the following primers were used: d (TTTGCTTCTGACACAACTGTGTTCACTAGC) and d (GCCTCACCACCAACTTCATCCACGTTCACC) to produce a 130 bp fragment of pBR328.

B. The experiment described in Example 7A was repeated except that the following primers were used: d (GGTTGGCCAATCTACTCCCAGG) and d (TGGTCTCCTTAAACCTGTCTTG) to produce a 262 bp fragment of pBR328. The turnover time was 20 minutes per minute. cycle.

C. The experiment described in Example 8B was repeated except that 100 µmol of 20 MstII digest of pBR328 containing a 1.9 kb insert of the human beta globin 5 allele was used as the initial template. This plasmid was cleaved several times by MstII but not within the sequence to be multiplied. In addition, the primers used were as follows: 25 d (GGTTGGCCAATCTACTCCCAGG) and d (TAACCTTGATACCAACCTGCCC) to form a 240 bp fragment.

D. The experiment described in Example 7B was repeated except that 100 ffnol of aNrul digest of pBR328 was used as template, 200 nmol of each dNTP was used in 100 µl reaction and the primers were: d (TAGGCGTATCACGAGGCCCT) and 35 d (CTTCCCCATCGGTGATGTCG)

I DK 175248 B1 I

I 34 I

I to form a 500 bp fragment from pBR328. Turnover times were 20 minutes per minute. IN

B cycle at 37 ° C. Final re-hybridization was 15 hours at 57 ° C. Electrophoresis occurred on I

B and 4% agarose gel. IN

B 5 Fax 9 I

B This example illustrates the method of the invention introducing an I

B in vitro mutation in the multiplied segment. IN

B 10 A. A total of 100 fmol of pBR322 linearized with Nrul, 1 nmol of each of the primers: I

I d (CGCATTAAAGCTTATCGATG) and I

B d (TAGGCGTATCACGAGGCCCT) I

B 15 designed to generate a 75 bp fragment, 100 nmol of each dNTP in 100 μΙ 40 I

In mM Tris at pH 8, 20 mM in MgCl 2, 5 mM in dithiothreitol and 5 mg / ml bovine serum albumin

In combined. The mixture was brought to 100 ° C for 1 minute, cooled for 0.5 minutes in 1 L

In water bath at 23 ° C, 4.5 units of Ktenow fragment and 0.09 units of I were added

Inorganic pyrophosphatase and the reaction were allowed to proceed for 3 minutes. The cycle of I

B 20 heating, cooling, enzyme addition and turnover were repeated 9 times. On the 10th

B turnover cycle was stopped by freezing and an 8 μΙ sub-sample of I

The B reaction mixture was loaded onto a 4% agarose gel visualized with ethidium bromide. IN

B B. The experiment described in Example 9A was repeated except that they used I

B 25 oligonucleotide primers were: I

I d (CGCATTAAAGCTTATCGATG) and I

B d (AATTAATACGACTCACTATAGGGAGATAGGCGTATCACGAGGCCCT). IN

B 30 These primers are designed to produce a 101 bp fragment, of which 26 nucleotides (in I

B the primer listed as number two) is not present in pBR322. These nucleotides I

B represents the sequence of the T7 promoter which was added to the 75 bp I

B sequence from pBR322 using the primer with 20 complementary bases and a 26 base long I

B S 'extension. The procedure required less than 2 hours and 2 picomol I was produced

B 35 relatively pure 101 bp fragment from 100 fmol pBR322. IN

The B T7 promoter can be used to initiate RNA transcription. T7 polymerase can be added to I

B the 101 bp fragment to produce single-stranded RNA. IN

The experiment described in Example 8D was repeated except that the oligonucleotide primers used were as follows: 5 d (TAGGCGTATCACGAGGCCCT) and d (CCAGCAAGACGTAGCCCAGC) to produce a 1000 bp fragment from pBR322.

D. The experiment described in Example 9C was repeated except that the oligonucleotide primers used were as follows: d (TAGGCGTATCACGAGGCCCT) and d (AATT AATACG ACT CACT AT AGGG AGAT AGGCGTATCACGAGGCCCT) so as to produce a of which 26 nucleotides (in the primer listed as second) are not present in pBR322 and represent the T7 promoter described above. The promoter has been inserted adjacent to a 1000 bp fragment from pBR322.

20

The results indicate that a primer which is not a perfect pairing to the template sequence but which is nonetheless capable of hybridizing sufficiently to be enzymatically extended produces a long product which contains rather the sequence of the primer than the corresponding sequence of the original template. The long product serves as template 25 for the second primer to introduce an in vitro mutation. This mutation is multiplied in further cycles with an undiminished efficiency because no additional mismatched primings are required. In this case, a primer carrying a non-complementary extension at its 5 'end was used to insert a new sequence into the product adjacent to the template sequence being copied.

E. Because the reaction with polymerase develops pyrophosphate and is theoretically reversible (Kornberg, A., DNA Replication, W.H.Freeman, San Francisco, 1980), the effect of adding an inorganic pyrophosphatase to avoid potential pyrophosphorolysis of the product was investigated. Qualitative polyacrylamide gel electrophoresis reaction of 35 plus and minus pyrophosphatase showed a minor but significant increase in product homogeneity as a result of adding this enzyme.

Example 10

I DK 175248 B1 I

I 36 I

This example illustrates the use of inserted set depressors to reduce background I

in the multiplication of single copy genes. IN

Whole human DNA, homozygous for the wild-type β-globin allele, was exposed to 20 L

multiplication cycles of the following mite: A total of 10 Mg DNA, 200 pmolaf each of the primers: I

I d (ACACAACTGTGTTCACTAGC) and. IN

I d (CAACTTCATCCACGTTCACC) I

I 10 I

and 100 nmol of each dNTP in 100 μΙ of 30 mM Tris-acetate pH 7.9, 60 mM sodium acetate, I

10 mM dithiothreitol and 10 mM magnesium acetate were heated to 100 ° C for 1 minute, cooled for 1 minute.

I to 25 ° C for 1 minute and treated with 2 units of Klenow fragment for 2 minutes. The cycle of I

heating, cooling and adding Klenow fragment was repeated 19 times. A partial sample I

15 µl of 10 µΙ was removed from the reaction mixture and subjected to a further 10 multiplication I

cycles using each of the primers:

I d (CAGACACCATGGTGCACCTGACTCCTG) and I

I d (CCCCACAGGGCAGTA ACGGCAGACTTCTCC), I

20 I

which multiplies a 58 bp fragment contained in the 100 bp I prepared above

long fragment. These last 10 multiplication cycles were performed by diluting I

10 µl of the partial sample in 90 µl of fresh Tris-acetate buffer described above containing 100 nmol of I

each dNTP and 200 pmol of each primer. The reaction conditions were as above

25. After 10 cycles, a 10 μΙ sub-sample (equivalent to 100 ng of the original I) was added

DNA) applied to a 6% NuSieve (FMC Corp.) agarose gel and visualized using I

ethidium bromide. IN

Figure 10 illustrates this gel illuminated with UV light and photographed through a red filter, I

30 which is known in the art. Lane 1 is molecular weight markers. Lane 2 is a - I

partial sample of the reaction mixture described above. Lane 3 is a partial sample identical to I

with the above described except that the original wild-type DNA was cleaved

with Ddel prior to the multiplication. Lane 4 is a partial sample of a reaction identical to that of I

described above except that human DNA which is homozygous for I

The sickle cell beta globin allele was treated with Ddel prior to multiplication (the sickle cell allele I

does not contain a Ddel restriction site in the fragment multiplied here). Lane 5 is an I

partial sample of a reaction identical to that described above except that I

salmon sperm DNA was used instead of human DNA. Lane 6 is a partial sample of a reaction I

identical to the one described above except that the sub-sample was treated with Part I

37 DK 175248 B1 after multiplication (Ddel was to convert the 58 bp wild-type product into 27 and 31 bp long fragments). Lane 7 is a sub-sample of the material from Lane 4 treated with Ddel after multiplication (the 58 bp sickle cell product contains no Ddel recognition site).

Detection of a 58 bp fragment representative of a single copy gene from 1 microgram of human DNA using only ethidium bromide staining of an agarose gel requires a multiplication of about 500,000 times. This was achieved by using the two inserted sets of oligonucleotide primers described herein. First, the 110 10 bp fragment multiplies and the inner inserted set multiplies a sub-fragment of this product up to a level suitable for detection, as shown in Figure 10. This method of using primers that multiply a small sequence contained in the sequence multiplied in the previous multiplication process and contained in extension products of the other 15 primers makes it possible to distinguish between the wild type and the sickle cell allele at the β-globin locus without resorting to neither radioisotopic nor other cumbersome methods, such as described by Conner et al., PNAS (USA), £ 8: 278 (1983) and Leary et al., PNAS (USA), 80: 4045 (1983).

Example 11

It is expected that the present method is useful in detecting in a patient DNA sample a specific sequence associated with an infectious disease, such as e.g. Chlamydia, using a biotinylated hybridization probe spanning the desired multiplied sequence and using the method described in U.S. Patent No. 4,358,535, see above.

The biotinylated hybridization probe can be prepared by intercalating and irradiating a partially double-stranded DNA with a 4'-methylene-substituted 4,5'-8-trimethylpsoralen attached to biotin via a spacer arm of the formula: RR "* ii (CH2) 2-0 - [(CH2) x01y-CH2CH2-N- where R represents -H or a -CHO group, R" represents -H, x numbers of 1 to 35 4, and y is a number of 2 to 4, as described in EP 156,287. Detection of biotinyl groups on the probe can be achieved by using a streptavidic acid phosphatase complex which can be obtained commercially from Enzo Biochemical using the detection methods proposed by the supplier in its brochure. The hybridized sample is seen as a patch of precipitated color due to the binding to the detection complex

I DK 175248 B1 I

I 38 I

I and the subsequent reaction catalyzed by acid phosphatase, producing an I

In foldable color. IN

Cell line SC-1 (CTCC No. 0082) was deposited March 19, 1985, with American Type I

I 5 Culture Collection (ATCC) 12301 Parklawn Drive, Rockville, Maryland 20852 USA with I

I ATCC Deposit No. CRL No. 8756. I

In summary, the present invention relates to oligonucleotides (primers) which I

H allows exponential multiplication by polymerase chain reaction of one or more I

H 10 specific nucleic acid sequences and attachment of a promoter sequence, whereby I

H primer extension products are produced which can subsequently act as I

In templates for further primer extension reactions. The oligonucleotides are especially I

Useful for detecting nucleic acid sequences initially present only in I

In very small quantities. IN

Claims (8)

39 DK 175248 B1 A first and a second single-stranded oligonucleotide allowing exponential multiplication by polymerase chain reaction of a specific nucleic acid sequence contained in a single-stranded or double-stranded nucleic acid, or in a mixture of such nucleic acids, characterized in that (a) the first single-stranded oligonucleotide oligonucleotide is substantially complementary to the single-stranded nucleic acid or to the one strand of the double-stranded nucleic acid; (b) the second single-stranded oligonucleotide is substantially complementary to a complement of the single-stranded nucleic acid or to the second strand of the double-stranded nucleic acid; (C) one of the single-stranded oligonucleotides further contains a sequence which is non-complementary to the nucleic acid, which sequence is a promoter sequence; and (d) those portions of the substantially complementary oligonucleotides define the ends of the specific nucleic acid sequence to be multiplied. Oligonucleotides according to claim 1, characterized in that the promoter is the T7 promoter. Oligonucleotides according to claim 1 or 2, characterized in that the specific nucleic acid sequence is contained in a larger sequence. Oligonucleotides according to any one of claims 1-3, 30, characterized in that the nucleic acid is DNA or RNA, including mRNA, which DNA or RNA is single or double stranded or is a DNA-RNA hybrid. Oligonucleotides according to any one of claims 1-4, characterized in that the nucleic acid is genomic DNA. Oligonucleotides according to any one of claims 1-5, characterized in that the portions of the oligonucleotides which are substantially complementary contain from at least approx. 7 to 25 nucleotides. I 40 DK 175248 B1 I Use of the oligonucleotides according to any of claims 1-6 for exponential I multiplication by polymerase chain reaction of a specific nucleic acid sequence contained in a single or double stranded nucleic acid or in a mixture of such nucleic acids. IN Use according to claim 7 to allow for the multiplication, detection and / or characterization of specific nucleic acid sequences associated with infectious diseases, such as those caused by bacteria, viruses and protozoparasites; genetic disorders such as those caused by specific deletions and / or mutations in genomic DNA; or cellulosic disorders such as cancer. I 10 Use according to claim 7 for enabling RNA transcription.