DE69738206T2 - DNA diagnostics by mass spectrometry - Google Patents

Abstract

Fast and highly accurate mass spectrometry-based processes for detecting a particular nucleic acid sequence in a biological sample are provided. Depending on the sequence to be detected, the processed can be used, for example, to diagnose a genetic disease or chromosomal abnormality; a predisposition to a disease or condition, infection by a pathogenic organism, or for determining identity or heredity. A method and apparatus for creating multiple branch wells from a parent well is disclosed. A multiple branching sub is provided for placement at a branching node of a well. Such sub includes a branching chamber and a plurality of branching outlet members. The outlet members during construction of the branching sub, have previously been distorted into oblong shapes so that all of the branching outlet members fit within an imaginary cylinder which is coaxial with and substantially the same radius as the branching chamber. After deployment of the branching sub via a parent casing in the well, a forming tool is lowered to the interior of the sub. The outlet members are extended outwardly by the forming tool and simultaneously formed into substantially round tubes. Next, each outlet member is plugged with cement, after which each branch well is drilled through a respective outlet member. If desired, each branch may be lined with casing and sealed to a branching outlet by means of a casing hanger. A manifold placed in the branching chamber controls the production of each branch well to the parent well.

Description

BACKGROUND OF THE INVENTION

Detection of mutations

The genetic information of all living organisms (eg animals, plants and microorganisms) is in the deoxyribonucleic acid (DNA) coded. In humans, the entire genome is about 100,000 Genes located on 24 chromosomes (The Human Genome, T. Strachan, BIOS Scientific Publishers, 1992). Each gene encodes a specific one Protein, after its expression via transcription and translation fulfills a specific biochemical function in a living cell. amendments in a DNA sequence are known as mutations and may be too Proteins with altered or even lost biochemical activities in some cases; this in turn, can cause a genetic disorder. mutations include nucleotide deletions, insertions or changes (i.e., point mutations). Point mutations can be either missense mutations be that to a change in the amino acid sequence lead a protein or nonsense mutations, the for encode a stop codon and thus lead to a truncated protein.

More as 3000 genetic diseases are currently known (human genome Mutations, D.N. Cooper and M. Krawczak, BIOS Publishers, 1993), including haemophilia, thalassemia, Duchenne muscular dystrophy (DMD), Huntington's disease (HD), Alzheimer's disease and cystic fibrosis (CF). In addition to mutated genes that are too genetic Lead illnesses, certain birth defects are the result of chromosomal anomalies, such as trisomy 21 (Down syndrome), trisomy 13 (Patau syndrome), trisomy 18 (Edward syndrome), X monosomy (Turner syndrome) and other sex chromosome aneuploidies, such as Klinefelter syndrome (XXY). There is also increasing evidence that That particular DNA sequences may be an individual for any one Predispose disease from a range of disorders, such as diabetes, Atherosclerosis, obesity, various autoimmune diseases and cancer (eg, colorectal, breast, uterine, lung cancers).

viruses, Bacteria, fungi and other infectious organisms contain their own Nucleic acid sequences which differ from the sequences contained in the host cell. Therefore, you can infectious Organisms also detected on the basis of their specific DNA sequences and be identified.

There the sequence of about 16 nucleotides for statistical reasons itself for the Size of the human Genome is specific relatively short nucleic acid sequences used to detect normal and defective genes in higher organisms to prove and infectious Microorganisms (eg bacteria, fungi, protists and yeast) and Detect viruses. DNA sequences can even be used as a fingerprint to detect different individuals within the same species (see Thompson, J.S., and M.W. Thompson, eds., Genetics in Medicine, W.B. Saunders Co., Philadelphia, PA (1991)).

Several methods of detecting DNA are currently in use. For example, nucleic acid sequences can be identified by comparing the motility of an amplified nucleic acid fragment with a known standard by gel electrophoresis or by hybridization with a probe that is complementary to the sequence to be identified. However, identification can only take place if the nucleic acid fragment is labeled with a sensitive reporter function (eg radioactive ( ³² P, ³⁵ S), fluorescent or chemiluminescent). Radioactive markers can be dangerous and the signals they produce will fade over time. Non-isotopic labels (eg, fluorescent) suffer from lack of sensitivity and fading of the signal when using high intensity lasers. In addition, the performance of labeling, electrophoresis and subsequent detection are laborious, time consuming and error prone processes. Electrophoresis is particularly prone to error as the size or molecular weight of the nucleic acid can not be correlated directly with motility in the gel matrix. It is known that sequence-specific effects, secondary structure and interactions with the gel matrix cause artifacts.

Use of mass spectrometry for the detection and identification of nucleic acids

Mass spectrometry provides a means of "weighing" individual molecules by ionizing the molecules in vacuo and allowing them to "fly" by evaporation. Under the influence of combinations of electric and magnetic fields, the ions follow trajectories depending on their individual mass (m) and charge (z). In the field of low molecular weight molecules, the mass spectra has long been part of the physico-organic standard repertoire for the analysis and characterization of organic molecules by determining the mass of the parent molecule. In addition, the molecular ion is fragmented by causing collisions of this parent molecule with other particles (eg, argon atoms), so that secondary ions are formed by so-called collision induced dissociation (CID), the fragmentation pattern In the art, numerous applications of mass spectrometric methods are known, particularly in the life sciences (see, eg, Methods in Enzymol., Vol. 193: "Mass Spectrometry" (JA McCloskey, Ed.), 1990, Academic Press, New York).

Because of the obvious analytical advantages of mass spectrometry in providing high detection sensitivity, mass measurement accuracy, detailed structural information through CID coupled with MS / MS configuration and speed, and online data transmission to a computer, there has been interest in the use of mass spectrometry for structural analysis of nucleic acids , Recent reviews summarizing this area include KH Schram "Mass Spectrometry of Nucleic Acid Components, Biomedical Applications of Mass Spectrometry" 34, 203-287 (1990); and PF Cram "Mass Spectrometric Techniques in Nucleic Acid Research", Mass Spectrometry Reviews 9, 505-554 (1990); see also U.S. Patent No. 5,547,835 and U.S. Patent No. 5,622,824 ).

Nucleic acids are however, highly polar biopolymers, which are very difficult to vaporize to let. Consequently, mass spectrometric detection was on low molecular weight synthetic oligonucleotides limited to an already known Oligonukleotidsequenz by determining the mass of Ausgangsmolekülions to or alternatively a known sequence by preparation of secondary ions (fragment ions) via CID in an MS / MS configuration to confirm, in particular for ionization and evaporation, the process of fast atom bombardment (FAB mass spectrometry) or the Plasma desorption (PD-mass spectrometry) was used. For example the application of FAB to the analysis of protected dimers blocks for the chemical synthesis of oligodeoxynucleotides described (Köster et al. (1987) Biomed. Environ. Mass Spectrometry 14, 111-116).

Other ionization / desorption techniques include electron spray / ion spray (ES) and matrix assisted laser desorption ionization (MAIDI) techniques. ES mass spectrometry was reported by Fenn et al. (J. Phys. Chem. 88: 4451-59 (1984); PCT application no. WO 90/14148 and current applications are summarized in reviews (see, for example, Smith et al., (1990) Anal. Chem. 62: 882-89; and Ardrey (1992) Electrospray Mass Spectrometry, Spectroscopy Europe 4: 10-18). The molecular weights of a tetradecanucleotide (see Covey et al., 1988, The Determination of Protein, Oligonucleotides and Peptides Molecular Weights by Ion Spray Mass Spectrometry, Rapid Commun., Mass Spectrometry 2: 249-256) and a 21-mer (Methods in Enzymol., 193, "Mass Spectrometry" (McCloskey, Ed.), P. 425, 1990, Academic Press, New York) have been published. As a mass analyzer usually a quadrupole used. Due to the presence of multiple ion peaks, all of which could be used for mass calculation, the determination of molecular weights at femtomolar amounts of a sample is very accurate.

The MALDI mass spectrometry, on the other hand, can be attractive if one Flight time (time-of-flight, TOF) configuration used as mass analyzer (See Hillenkamp et al. (1990), pp. 49-60 in "Matrix Assisted UV Laser Desorption / Ionization:" A New Approach to Mass Spectrometry of Large Biomolecules, Biological Mass Spectrometry, Burlingame and McCloskey, Ed., Elsevier Science Publishers, Amsterdam). Because in most cases with this technique no Multiple molecular ion peaks are generated, see the mass spectra compared to the ES mass spectrometry basically easier.

Although DNA molecules were desorbed and vaporized to a molecular weight of 410,000 daltons (Williams et al., Volatilization of High Molecular Weight DNA by Pulsed Laser Ablation of Frozen Aqueous Solutions, Science 246, 1585-87 (1989)) Technique only a very low resolution (oligothymidylic acids up to 18 nucleotides in length, Huth-Fehre et al., Rapid Commun in Mass Spectrom., 6, 209-13 (1992); DNA fragments up to a length of 500 nucleotides, K. Tang et al., (1994), Rapid Commun., Mass Spectrom., 8, 727-730; and a 28 base pair double-stranded DNA (Williams et al., 1990). Time-of-Flight Mass Spectrometry of Nucleic Acids by Laser Ablation and Ionization from a Frozen Aqueous Matrix ", Rapid Commun., Mass Spectrom., 4, 348-351). 59-131909 describes an instrument that detects nucleic acid fragments that have been separated by either electrophoresis, liquid chromatography, or high speed gel filtration. Mass spectrometric detection is achieved by the incorporation of atoms not normally found in DNA, such as S, Br, I or Ag, Au Pt, Os, Hg, into the nucleic acids.

The U.S. Patent No. 5,622,824 The same assignee describes methods for DNA sequencing based on mass spectrometric detection. To achieve this, the DNA is progressively degraded in one direction by exonuclease digestion by means of protection, specificity of enzyme activity or immobilization, and the nucleotides or derivatives are detected by mass spectrometry. Prior to enzymatic degradation, sets of ordered deletions spanning a cloned DNA fragment can be generated. In this way, mass-modified nucleotides can be incorporated using a combination of exonuclease and DNA / RNA polymerase. This allows either mass spectrometric multiplex detection or modulation of exonuclease activity to synchronize the degradation process.

The U.S. Patent Nos. 5,605,798 and 5,547,835 The same assignee provides methods for detecting a particular nucleic acid sequence in a biological sample. Depending on the sequence to be detected, the methods can be used, for example, in diagnostic methods. These methods, which are widely useful and applicable to numerous embodiments, are the first disclosure of such applications and can be improved.

WO 96/29431 discloses rapid and highly accurate mass spectrometry-based methods for detecting a particular nucleic acid sequence in a biological sample. For example, depending on the sequence to be detected, the methods of the patent can be used to detect a genetic disease or chromosomal abnormality; a predisposition to a disease or condition to diagnose infection by a pathogenic organism, or to determine identity or heredity.

WO 94/16101 discloses a method of sequencing DNA using Sanger sequencing and assembling the sequence information by analyzing the nested fragments obtained by base-specific chain termination over their different molecular masses using mass spectrometry.

WO 96/32504 discloses a method for detecting and sequencing target nucleic acid sequences. The method involves hybridizing nucleic acids complementary to a homologous sequence to a target of an array of nucleic acid probes. The molecular weights of the hybridized nucleic acids can be determined by mass spectrometry and the sequence can be determined from the molecular weight.

WO 97/42348 discloses methods and kits for the simultaneous amplification and sequencing of nucleic acid molecules and the performance of high throughput DNA sequencing.

Therefore the object of the present invention is to provide improved Method for sequencing and detecting DNA molecules in biological Rehearse. It is also a goal, improved methods for the diagnosis of genetic diseases, predispositions for certain Diseases, cancers and infections.

SUMMARY OF THE INVENTION

In certain embodiments In the present invention, the nucleic acid is either on a solid support directly or via immobilized a linker and / or a bead.

In certain embodiments the DNA on the carrier is transferred via a selectively cleavable linker immobilized. Selectively cleavable linker include but are not limited to photocleavable linkers, chemically cleavable linkers and enzymatically cleavable linkers (such as for example a restriction site (nucleic acid linker), a protease site). By incorporating a selectively cleavable linker the possibilities become The MALDI-TOF MS analysis has been extended as it applies to all designs of the Immobilization of DNA for the MALDI-TOF-MS the DNA linkage to the carrier over the 3'- or 5'-end of a nucleic acid allows.

In a preferred embodiment, the selectively cleavable linker is a chemically cleavable or photocleavable linker which is cleaved during the ionization step of mass spectrometry. Examples of linkers include linkers containing a disulfide group, a leucinyl group, an acid labile trityl group, and a hydrophobic trityl group. In other embodiments, the enzymatically cleavable linker may be a nucleic acid that is an RNA nucleotide or encodes a restriction endonuclease site. Other enzymatically cleavable linkers include linkers containing a pyrophosphate group, an arginine-arginine group contain pe and a lysine-lysine group. Other linkers are mentioned here by way of example.

method to arrange DNA fragments are provided to this order to be carried out generated with certain bases-terminated fragments of a target nucleic acid. The analysis of fragments instead of the full-length nucleic acid shifts the mass of ions to be determined in a range lower Measures that generally for the mass spectrometric detection is more accessible. For example Due to the shift to lower masses, the mass resolution, the Mass accuracy and in particular the sensitivity for detection improved. Hybridization events and the actual Molecular weights of the fragments, as determined by mass spectrometry, provide sequence information (eg, the presence and / or identity of a Mutation). In a preferred embodiment, the fragments become before hybridization and / or mass spectrometric detection on a solid support recorded. The generated fragments are ordered to the sequence to provide the larger nucleic acid.

The method for producing base-specific terminated fragments of a nucleic acid is performed by bringing an appropriate amount of a target nucleic acid into association with an appropriate amount of a specific endonuclease, resulting in partial digestion of the target nucleic acid. Endonucleases typically degrade a sequence to pieces of no more than about 50-70 nucleotides, even if the reaction is not done to completion. In a preferred embodiment, the nucleic acid is a ribonucleic acid, and the endonuclease is a ribonuclease (RNase) selected from: the G-specific RNase T ₁ , the A-specific RNase U ₂ , the A / U-specific RNase PhyM, U / C-specific RNase A, C-specific chicken liver RNase (RNase CL ₃ ) or crisavitin. In another preferred embodiment, the endonuclease is a restriction enzyme that cleaves at least one site contained in the target nucleic acid. By incorporating a label at the 5 'and / or 3' end of a target nucleic acid, ordering of fragments can be facilitated.

method for determining the sequence of an unknown nucleic acid, wherein the 5 'and / or 3' end of the target nucleic acid a May contain mark are disclosed. The installation of a non-natural Marking at the 3'-end is also suitable for the exclusion or compensation of the influence of 3'-heterogeneity, premature Termination and unspecific extension. The marker can an affinity tag (e.g., biotin or a nucleic acid that hybridizes to a capture nucleic acid). The affinity tag facilitates binding of the nucleic acid to a solid support. alternative the label is a mass marker (i.e., a marker with a Mass that does not correspond to the mass of one of the four nucleotides). The mark can also be a natural mark, such as such as a poly A tail or the natural 3 'heterogeneity, for example, from a Transcription reaction originate can.

method for sequence analysis are disclosed wherein nucleic acids, the replicated from a nucleic acid molecule were obtained from a biological sample using one or more nucleases (deoxyribonucleases for DNA and Ribonucleases for RNA) are digested specifically. The fragments are on a solid carrier captured carrying the corresponding complementary sequences. The Hybridization events and actual molecular weights The captured target sequences provide information about mutations in the gene. The arrangement can be made point by point using Mass spectrometry are analyzed. Furthermore, the fragments produced ordered to provide the sequence of the larger target fragment.

In preferred embodiments includes the matrix 3-hydroxypicolinic acid.

Other Features and advantages of the methods provided here are with reference to the following figures, the detailed description and the claims further explained.

BRIEF DESCRIPTION OF THE FIGURES

1A Figure 15 is a diagram showing a method of performing mass spectrometric analysis on a target detection site (TDS) contained in a target nucleic acid molecule (T) obtained from a biological sample. A specific capture sequence (C) is attached to a solid support (SS) via a spacer (S). The capture sequence is chosen to specifically hybridize to a complementary sequence in the target nucleic acid molecule (T) known as the target capture site (TCS). The spacer (S) facilitates unhindered hybridization. A detection nucleic acid sequence (D) that is complementary to the TDS is then contacted with the TDS. Hybridization between D and TDS can be detected by mass spectrometry.

1B Figure 3 is a diagram showing a method of performing mass spectrometric analysis on at least one target detection site (here TDS 1 and TDS 2) via direct linkage to a solid support. The target sequence (T) containing the target detection site (TDS 1 and TDS 2) is immobilized on a solid support via the formation of a reversible or irreversible bond between a suitable functionality (L ') in the target nucleic acid molecule (T) and an appropriate functionality (L) is formed on the solid support. Detection nucleic acid sequences (here D1 and D2) that are complementary to a target detection site (TDS 1 or TDS 2) are then contacted with the TDS. The hybridization between TDS 1 and D1 and / or TDS 2 and D2 can be detected and distinguished on the basis of molecular weight differences.

1C Figure 3 is a diagram showing a method for detecting a wild-type (D ^WT ) and / or a mutant (D ^mut ) sequence in a target (T) nucleic acid molecule. As in 1A For example, a specific capture sequence (C) is attached to a solid support (SS) via a spacer (S). In addition, the capture sequence is chosen to specifically interact with a complementary sequence in the target sequence (T), the target capture site (TCS) to be detected by hybridization. If the target detection site (TDS) contains a mutation, X, the detection sites can be distinguished by wild-type mass spectrometry. Preferably, the detection nucleic acid molecule (D) is designed so that the mutation is in the middle of the molecule and therefore would not result in a stable hybrid if the wild-type detection oligonucleotide (D ^WT ) with the target detection sequence, e.g. B. as a control, is brought into contact. The mutation can also be detected if the mutated detection oligonucleotide (D ^mut ) with the appropriate base at the mutated position is used for hybridization. When a biological sample obtained from a nucleic acid molecule is heterozygous for the particular sequence (ie D ^WT and ^mut D contains), then ^WT D and D ^mut bound to the app and D ^mut so that they are detected simultaneously.

2 Figure 4 is a diagram showing a method in which multiple mutations are detected simultaneously in a target sequence, wherein the molecular weight differences between the detection oligonucleotides D1, D2 and D3 must be large enough for simultaneous detection (multiplexing) to be possible. This can be achieved either by the sequence itself (composition or length) or by inserting mass-modifying functionalities M1-M3 into the detection oligonucleotide.

3 Fig. 12 is a diagram showing another multiplex detection format. In this embodiment, discrimination is achieved by employing various specific capture sequences that are positionally immobilized on a flat surface (eg, a "chip array"). If there are different target sequences T1-Tn, their target capture sequences TCS1-TCSn interact with complementary immobilized capture sequences C1-Cn. The detection is achieved by using suitable detection oligonucleotides D1-Dn with different mass, the mass of which is distinguishable either by their sequences or by mass-modifying functionalities M1-Mn.

4 Figure 4 is a diagram showing a format in which a preconceived target capture sequence (TCS) has been introduced into the target sequence using nucleic acid (ie PCR) amplification. Only one strand is captured, the other is removed (eg, based on the interaction between biotin and streptavidin-coated magnetic beads). When the biotin is bound to primer 1, the other strand can be suitably labeled by a TCS. The detection is carried out, as described above, by the interaction of a specific detection oligonucleotide D with the corresponding target detection site TDS by means of mass spectrometry.

5 Figure 3 is a diagram showing how the amplification (here ligase chain reaction (LCR)) products can be prepared and detected by mass spectrometry. The mass discrimination can be achieved by the mass-modifying functionalities (M1 and M2) bound to the primers (P1 and P4, respectively). The detection by mass spectrometry can be achieved directly (ie without the use of immobilization and target capture sites (TCS)). Multiple LCR reactions can be performed in parallel by providing an ordered array of capture sequences (C). This format allows separation of the ligation products and point-by-point identification via mass spectrometry or multiplexing if the mass discrimination is sufficient.

6A Figure 13 is a diagram showing mass spectrometric analysis of a nucleic acid molecule that has been amplified by a transcription amplification process. An RNA sequence is captured via its TCS sequence so that the wild-type and mutant target detection sites can be detected as above using appropriate detection oligonucleotides (D).

6B Figure 3 is a diagram showing multiplexing for the detection of two different (mutated) sites in the same RNA in a concurrent manner using mass-modified detection oligonucleotides M1-D1 and M2-D2.

6C Figure 10 is a diagram of another multiplexing method for detecting specific mutations by employing mass-modified dideoxynucleoside or 3'-deoxynucleoside triphosphates and an RNA-dependent DNA polymerase. Alternatively, a DNA-dependent RNA polymerase and ribonucleotide phosphates can be used. This format allows the simultaneous detection of all four possible bases at the site of a mutation (X).

7A Figure 15 is a diagram showing a method of performing mass spectrometric analysis on a target detection site (TDS) contained in a target nucleic acid molecule (T) obtained from a biological sample. A specific capture sequence (C) is attached to a solid support (SS) via a spacer (S). The capture sequence is chosen to specifically hybridize to a complementary sequence in T known as the target capture sequence (TCS). A nucleic acid molecule that is complementary to a portion of the TDS is hybridized to the TDS 5 'from the site of a mutation (X) within the TDS. The addition of a full set of dideoxynucleoside or 3'-deoxynucleoside triphosphates (e.g., pppAdd pppTdd, pppCdd, and pppGdd) and a DNA-dependent DNA or RNA polymerase allows addition of only one dideoxynucleoside or 3 ' Deoxynucleoside triphosphate that is complementary to X.

7B Figure 3 is a diagram showing a method for performing mass spectrometric analysis for determining the presence of a mutation at a potential mutation site (M) within a nucleic acid molecule. This format allows the simultaneous analysis of the alleles (A) and (B) of a target double-stranded nucleic acid molecule so that a diagnosis of homozygous normal, homozygous mutant or heterozygous can be provided. Allele A and allele B are each hybridized with complementary oligonucleotides ((C) and (L)) that hybridize to A and B in a region that includes M. Each heteroduplex is then contacted with a single strand-specific endonuclease so that a mismatch at M indicative of the presence of a mutation results in cleavage of (C) and / or (D), which can then be detected by mass spectrometry.

8th Figure 3 is a diagram showing how both strands of target DNA can be prepared for detection using transcription vectors with two different promoters at opposite sites (e.g., the SP6 and T7 promoters). This format is particularly suitable for the detection of heterozygous target detection sites (TDS). By using SP6 or T7 RNA polymerase, both strands could be transcribed separately or simultaneously. The transcribed RNA molecules can be specifically captured and detected simultaneously using appropriate detectable oligonucleotides of distinguishable mass. This can be achieved either directly in solution or by parallel processing of many target sequences on an ordered array of specifically immobilized capture sequences.

9 is a diagram that shows how RNA, as in the 6 . 7 and 8th specifically, can be digested using one or more ribonucleases and how the fragments can be captured on a solid support carrying the corresponding complementary sequences. Hybridization events and the actual molecular weights of the captured target sequences provide information on whether and where mutations in the gene are present. The array can be analyzed point by point using mass spectrometry. DNA can also be cleaved using a nuclease cocktail that complies with restriction endonucleases. Mutations can be detected by different molecular weights of specific single fragments compared to the molecular weights of the wild-type fragments.

10A shows UV spectra resulting from the experiment described in Example 1 below. Panel i) shows the absorbance of the 26-mer before hybridization. Panel ii) shows the filtrate of centrifugation after hybridization. Panel iii) shows the results after the first wash with 50 mM ammonium citrate. Panel iv) shows the results after the second wash with 50 mM ammonium citrate.

10B shows a mass spectrum resulting from the experiment described in Example 1 below after three washing / centrifugation steps.

10C Figure 3 shows a mass spectrum resulting from the experiment described in Example 1 below and the successful desorption of the hybridized 26-mer from the beads according to the cal mentally in 1B shown format.

11 shows a mass spectrum resulting from the experiment described in Example 1 below and shows that an experiment as shown schematically in FIG 1B which demonstrates successful desorption of the hybridized 40-mer. The detection efficiency indicates that fragments much longer than 40-mers can also be desorbed.

12 Figure 4 shows a mass spectrum resulting from the experiment described in Example 2 below and showing successful desorption and discrimination of an 18-mer and a 19-mer by electron spray mass spectrometry, highlighting the mixture (top), peaks deriving from 18-mer (center ) and 19-m peak peaks (bottom).

13 Figure 3 is a graphical representation of the method for detecting cystic fibrosis mutation ΔF508 as described in Example 3.

14 is a mass spectrum of the DNA extension product of a homozygous normal for ΔF508 according to Example 3.

15 is a mass spectrum of the DNA extension product of a ΔF508 heterozygous mutant according to Example 3.

16 is a mass spectrum of the DNA extension product of a homozygous normal for ΔF508 according to Example 3.

17 is a mass spectrum of the DNA extension product of a ΔF508 homozygous mutant according to Example 3.

18 is a mass spectrum of the DNA extension product of a ΔF508 heterozygous mutant according to Example 3.

19 Figure 3 is a graphical representation of various methods for performing apolipoprotein E genotyping of Example 4.

20 shows the nucleic acid sequence of normal apolipoprotein E (encoded by the E3 allele, 20B ) and other isotypes encoded by the E2 and E4 alleles ( 20A ).

21A Figure 4 shows a composite restriction pattern for different genotypes of apolipoprotein E using the restriction endonuclease Cfol.

21B shows the restriction pattern obtained in a 3.5% MetPhor agarose gel for various apolipoprotein E genotypes.

21C shows the restriction pattern obtained in a 12% polyacrylamide gel for various apolipoprotein E genotypes.

22A Figure 9 is a graph showing the molecular weights of the 91, 83, 72, 48 and 35 base pair fragments obtained by restriction enzyme cleavage of apolipoprotein E alleles E2, E3 and E4.

22B is the mass spectrum of the restriction product of a homozygous E4 apolipoprotein E genotype.

23A is the mass spectrum of the restriction product of a homozygous E3 apolipoprotein E genotype.

23B is the mass spectrum of the restriction product of an E3 / E4 apolipoprotein E genotype.

24 is an autoradiogram according to Example 5 of a 7.5% polyacrylamide gel on which 10% (5 μl) of each amplified sample was applied: Sample M: pBR322, Alul-digested; Sample 1: HBV positive in serological analysis; Sample 2: also HBV positive; Sample 3: without serological analysis, but with increased transaminase level, indicating liver disease; Sample 4: HBV negative, containing HCV; Sample 5: HBV positive (-) negative control; (+) positive control. Staining was with ethidium bromide.

25A is a mass spectrum of Sample 1 that is HBV positive. The signal at 20754 Da represents the HBV-related amplification product (67 nucleotides, calculated mass: 20735 Da). The mass signal at 10390 Da represents the [M + 2H] ²⁺ molecular ion (calculated as 10378 Da).

25B is a mass spectrum of sample 3 which is HBV negative according to the nucleic acid assay (ie, PCR), serological, and dot blot-based assay. The amplified product is produced only in traces. Nevertheless, it is proven beyond doubt at 20751 Da (calculated mass: 20735 Da). The mass signal at 10397 Da represents the [M + 2H] ^{2 +} molecule (calculated: 10376 Da).

25C a mass spectrum of sample 4 which is HBV negative but HCV positive. No HBV-specific signals were observed.

26 Figure 12 shows a portion of the E. coli lacI gene with binding sites of the complementary oligonucleotides used in the ligase chain reaction (LCR) of Example 6. Here the wild-type sequence is shown. The mutant contains a point mutation at bp 191, which is also the ligation site (bold). The mutation is a C to T (or G to A) transition. This leads to a TG mismatch with oligo B (or an AC mismatch with oligo C).

27 is an ethidium bromide stained 7.15% polyacrylamide gel of Example 6. M: chain length standard (pUC19 DNA, MspI digested). Lane 1: LCR with wild type template. Lane 2: LCR with mutant template. Lane 3: (control) LCR without template. The ligation product (50 bp) was formed only in the positive reaction containing the wild type template.

28 is an HPLC chromatogram of two pooled positive LCRs.

29 shows an HPLC chromatogram under the same conditions but using mutant template. The small signal of the ligation product is due either to the template-free ligation of the starting materials or to a ligation on a (GT, AC) -mismatch. The "false positive" signal is significantly smaller than that in 28 shown signal of the ligation product with wild-type template. Analysis of ligation leads to "double peaks" since two of the oligonucleotides are 5'-phosphorylated.

30 In (b) the complex signal pattern obtained by MALDI-TOF-MS analysis of the Pfu DNA ligase solution according to Example 6 is shown. In (a) a MALDI-TOF spectrum of an unpurified LCR is shown. The mass signal 67569 Da probably represents the Pfu DNA ligase.

31 shows a MALDI-TOF spectrum of two pooled positive LCRs (a). The signal at 7523 Da represents unligated oligo A (calculated: 7521 Da), whereas the signal at 15449 Da represents the ligation product (calculated: 15450 Da). The signal at 3774 Da is the [M + 2H] ²⁺ signal of oligo A. The signals in the mass range below 2000 Da are due to the matrix ions. The spectrum corresponds to lane 1 in 27 and the chromatogram in 28 , In (b) a spectrum of two unified negative LCR (mutant template) is shown. The signal at 7517 Da represents Oligo A (calculated: 7521 Da).

32 shows a spectrum of two combined control reactions (with salmon sperm DNA as template). The signals in the mass range around 2000 Da are due to Tween 20; As expected, only Oligo A could be detected.

33 shows a spectrum of two unified positive LCRs (a). Purification was performed with a combination of ultrafiltration and streptavidin dynabeads as described in the text. The signal at 15448 Da represents the ligation product (calculated: 15450 Da). The signal at 7527 represents oligo A (calculated: 7521 Da). The signal at 3761 Da is the oligo A [M + 2H] ^{2 +} signal, whereas the signal at 5140 Da represents the [M + 3H] ²⁺ signal of the ligation product. In (b) a spectrum of two unified negative LCR (without template) is shown. The signal at 7514 Da represents Oligo A (calculated: 7521 Da).

34 Figure 3 is a schematic representation of the oligo base extension of the mutation detection primer as described in Example 7 using ddTTP (A) and ddCTP (B) in the reaction mixture, respectively. The theoretically calculated mass is given in brackets. The sequence shown is part of exon 10 of the CFTR gene, the most common cystic fibrosis mutation ΔF508, and the rarer mutations Δ1507 and Ile506Ser contains.

35 is a MALDI-TOF spectrum taken directly from precipitated oligo-base extended primers for mutation detection. The spectrum in (A) or (B) shows the annelierten primer (CF508) without further extension reaction. Panel C shows the wild-type MALDI-TOF spectrum using pppTdd in the extension reaction and D a heterozygous extension product bearing the 506S mutation using pppCdd as the terminator. Fields E and F show a heterozygote with the ΔF508 mutation with pppTdd and pppCdd as terminators in the extension reaction. Fields G and H represent a homozygous ΔF508 mutation with either pppTdd or pppCdd as terminators. The diagnostic template is shown below each spectrum and the observed / expected molecular masses are shown in brackets.

36 Figure 4 shows a portion of a pRFc1 DNA sequence used as a template for nucleic acid amplification according to Example 8 of unmodified and 7-deazapurine-containing 99-mer and 200-mer nucleic acids and the sequences of the 19-mer forward primer and the two 18 -mer reverse primer.

37 Figure 13 shows the portion of the nucleotide sequence of M13mp18 RFI DNA used in Example 8 for nucleic acid amplification of unmodified and 7-deazapurine-containing 103-mer nucleic acids. Also shown are the nucleotide sequences of the 17-mer primers used in the nucleic acid amplification reaction.

38 shows the result of polyacrylamide gel electrophoresis of the amplified products purified and concentrated for MALDI-TOF analysis described in Example 8. M: chain length marker, lane 1: 7 deazapurine-containing 99-mer amplification product, lane 2: unmodified 99-mer, lane 3: 7-deazapurine-containing 103-mer, and lane 4: unmodified 103-mer amplification product.

39 : An autoradiogram of polyacrylamide gel electrophoresis of nucleic acid (ie, PCR) reactions performed with the 5 '[ ³¹ P] labeled primers 1 and 4. Lanes 1 and 2: unmodified and 7-deazapurine modified 103-mer amplification product (53,321 and 23,520 pulses), lanes 3 and 4: unmodified and 7-deazapurine modified 200-mer (71,123 and 39,582 pulses), and lanes 5 and 6: unmodified and 7-deazapurine modified 99-mer (173216 and 94400 pulses).

40 : a) MALDI-TOF mass spectrum of the unmodified 103-mer amplification products (sum of twelve individually recorded spectra). The mean of the masses calculated for the two single strands (31768 u and 31759 u) is 31763 u. Mass resolution: 18. b) MALDI-TOF mass spectrum of the 7-deazapurine-containing 103-mer amplification product (sum of three singly recorded spectra). The mean of the masses calculated for the two single strands (31727 u and 31719 u) is 31723 u. Mass resolution: 67.

41 : a) MALDI-TOF mass spectrum of the unmodified 99-mer amplification product (sum of twenty singly recorded spectra). Values of the masses calculated for the two single strands: 30261 u and 30794 u. b) MALDI-TOF mass spectrum of the 7-deazapurine-containing 99-mer amplification product (sum of twelve individually recorded spectra). Values of the masses calculated for the two single strands: 30224 u and 30750 u.

42 : a) MALDI-TOF mass spectrum of the unmodified 200-mer amplification product (sum of 30 individually recorded spectra). The mean of the masses calculated for the two single strands (61873 u and 61595 u) is 61734 u. Mass resolution: 28. b) MALDI-TOF mass spectrum of the 7-deazapurine-containing 200-mer amplification product (sum of 30 singly recorded spectra). The mean of the masses calculated for the two single strands (61772 u and 61714 u) is 61643 u. Mass resolution: 39.

43 : a) MALDI-TOF mass spectrum of the 7-deazapurine-containing 100-mer amplification product with ribo-modified primers. The mean of the masses calculated for the two single strands (3052911 and 31095 u) is 30812 u. b) MALDI-TOF mass spectrum of the amplified product after hydrolytic primer cleavage. The mean of the masses calculated for the two single strands (25104 u and 25229 u) is 25167 u. The mean of the cleaved primers (5437 u and 5918 u) is 5677 u.

44A D shows the MALDI-TOF mass spectrum of the four sequencing ladders obtained from a 39-mer template (SEQ ID NO: 23) immobilized to streptavidin beads via 3-biotinylation were. A 14-mer primer (SEQ ID NO: 24) was used for sequencing according to Example 9.

45 Figure 4 shows a MALDI-TOF mass spectrum of solid phase sequencing of a 78-mer template (SEQ ID NO: 25) immobilized on streptavidin beads via a 3'-biotinylation. An 18-mer primer (SEQ ID NO: 26) and ddGTP were used for sequencing.

46 Figure 12 shows a scheme in which single stranded overhang duplex DNA probes capture specific DNA templates and also serve as primers for solid phase sequencing.

47A D shows MALDI-TOF mass spectra obtained from a sequencing reaction using a 5'-fluorescently labeled 23-member (SEQ ID NO: 29) hybridized to a 3'-biotinylated 15-mer (SEQ ID NO: 30), wherein 5-base overhang that captured a 15-mer template (SEQ ID NO: 31) as described in Example 9.

48 shows a stacked fluorogram thereof, from the in 47 described reaction, but which were applied to a conventional DNA sequencer.

49 Figure 4 shows a MALDI-TOF mass spectrum of the sequencing ladder using cycle sequencing as described in Example 1, consisting of a biological amplification product as template and a 12-mer (5'-TGC ACC TGA CTC-3 '(SEQ ID NO: 34 )) was prepared as a sequencing primer. Depurination-derived peaks and non-sequence related peaks are marked by an asterisk. The MALDI-TOF-MS measurements were taken on a reflectron TOF-MS. A.) sequencing ladder stopped with ddATP; B.) Sequencing ladder stopped with ddCTP; C.) Sequencing ladder stopped with ddGTP; D.) Sequencing ladder stopped with ddTTP.

50 shows a schematic representation of the in 49 generated sequencing ladder with the corresponding calculated molecular masses up to 40 bases after the primer. The following masses were used for the calculation: 3581.4 Da for the primer, 312.2 Da for 7-deaza-dATP, 304.2 Da for dTTP, 289.2 Da for dCTP and 328.2 Da for 7-deaza dGTP.

51 Figure 12 shows the sequence of the amplified 209 bp amplification product in the β-globin gene used as template for sequencing. The sequences of the corresponding amplification primer and the location of the 12-mer sequencing primer are also shown. This sequence represents a homozygous mutant at position 4 bases behind the primer. In the wild-type sequence, this T would be replaced by an A.

52 Figure 4 shows a sequence that is part of the intron 5 of the interferon receptor gene and carries the AluVpA polymorphism as further described in Example 11. The scheme represents the primer oligo base extension (PROBE) using ddGTP, ddCTP, and both for termination. The polymorphism detection primer (IFN) is underlined, the termination nucleotides are labeled in bold. Values for the theoretical mass of the alleles found in 28 independent individuals and a family of five members are given in the table. Both secondary site mutations found in most, but not all, of the 13 unit alleles are suggested.

53 Figure 9 shows the MALDI-TOF MS spectra recorded directly from precipitated extended cycle PROBE reaction products. Family study using the AluVpA polymorphism in intron 5 of the interferon α receptor gene (Example 11).

54 shows the mass spectra of PROBE products using ddC as the termination nucleotide in the reaction mixture. The allele with molecular weight of about 11650 Da from the DNA of the mother and of child 2 is an indication of a secondary site mutation in one of the repeat units.

55 Figure 4 shows a schematic representation of the PROBE method for detection of various alleles in the poly-T tract at the 3 'end of intron 8 of the CFTR gene with pppCdd as terminator (Example 11).

56 Figure 9 shows the MALDI-TOF-MS spectra taken directly from the precipitated extended PROBE reaction products. Detection of all three common alleles of the poly-T tract at the 3 'end of the intron 8 of the CFTR gene. (a) T5 / T9 heterozygote, (b) T7 / T9 heterozygous (Example 11).

57 Figure 4 shows a mass spectrum of cleavage of a 252-mer ApoE gene amplification product (ε3 / ε3 genotype) as described in Example 12, using a) only Cfol and b) Cfol plus Rsal. Asterisk: Depurination peaks.

58 Figure 10 shows a mass spectrum of the apoE gene amplification product (ε3 / ε3 genotype) digested by Cfol and purified by a) single and b) double ethanol / glycogen and c) double isopropyl alcohol / glycogen precipitation.

59 shows a mass spectrum of the Cfol / Rsal digestion products of the genotypes a) ε2 / ε3, b) ε3 / ε3, c) ε3 / ε4 and c) ε4 / ε4. The dashed lines are drawn by diagnostic fragments.

60 Figure 4 shows a scheme for the rapid identification of unknown ApoE genotypes following simultaneous cleavage of a 252-mer ApoE gene amplification product by the restriction enzymes Cfol and Rsal.

61 shows the multiplexing (codons 112 and 158) mass spectrum PROBE results for the genotypes a) ε2 / ε3, b) ε3 / ε3, c) ε3 / ε4 and c) ε4 / ε4. E: extension products; P: not extended primer. Top: Regions of codons 112 and 158 with polymorphic sites in bold and primer sequences underlined.

62 shows a mass spectrum of a TRAP assay for detecting telomerase activity (Example 13). The spectrum shows two of the primer signals of the amplified product of the TS primer at 5,497.3 Da (calc. 5523 Da) and the biotinylated bioCX primer at 7,537.6 Da (calc. 7,537 Da) and the first telomerase-specific test product with three Telomeric repeats at 12,775.8 Da (approx. 12,452 Da), its mass is larger due to the extendase activity of the Taq DNA polymerase by one dA nucleotide (12,765 Da).

63 shows the higher mass range of 62 ie, the peak at 12,775.6 Da represents the products with these telomere repeats. The peaks at 20,322.1 Da are the result of telomerase activity to form seven telomere repeats (reported 20,395 Da including extension by 1 dA). nucleotide). The peaks labeled 1, 2, 3, and 4 contain four telomere repeats at 14,674 Da and a secondary ion product.

64 Figure 9 shows a MALDI-TOF spectrum of the RT amplified product of human tyrosine hydroxylase mRNA indicating the presence of neuroblastoma cells (Example 14). The signal at 18,763.8 Da represents the non-biotinylated single-stranded 61-mer of the nested amplified product (calculated 18,758.2 Da).

65 (a) Figure 12 shows a schematic representation of a PROBE reaction for the RET proto-oncogene with a mixture of dATP, dCTP, dGTP and ddTTP (Example 15). B is biotin, by which the sense template strand is bound via streptavidin to a solid support.

65 (b) shows the expected PROBE products for ddT and ddA reactions for the wild-type, the C → T and the C → A antisense strand.

66 shows the PROBE product mass spectra for (a) negative control, (b) Heterozygous Patient 1 (Wt / C → T), and (c) Heterozygous Patient 2 (Wt / C → A), said average M _r values indicated are.

67 Figure 4 shows the MALDI-FTMS spectra for synthetic analogs, the ribo-split RET proto-oncogene amplification products of (a) wild type, (b) G → A and (c) G → T homozygotes and (d) wild-type / G → A -, (e) represent wild-type / G → T and (f) G → A / G → T heterozygotes, with the masses of the most abundant isotopic peaks indicated.

68 Figure 3 is a schematic representation of nucleic acid immobilization via covalent bifunctional trityl linkers.

69 Figure 3 is a schematic representation of nucleic acid immobilization via hydrophobic trityl linkers.

70 Figure 12 shows a MALDI-TOF mass spectrum of a supernatant of matrix-treated Dynabeads containing bound oligo (5'-iminobiotin TGCACCTGACTC, SEQ ID NO: 56). An internal standard (CTGTGGTCGTGC, SEQ ID NO: 57) was included in the matrix.

71 shows the MALDI-TOF mass spectrum of a supernatant of the matrix-treated Dynabeads, the bound oligo (5'-iminobiotin TGCACCTGACTC, SEQ ID NO: 56). An internal standard (CTGTGGTCGTGC, SEQ ID NO: 57) was included in the matrix.

72 schematically shows the steps involved in the loop primer oligo base extension (LoopProbe) reaction.

73A Figure 9 shows a MALDI-TOF mass spectrum of a supernatant after Cfol digestion of a stem loop. The 73B -D show MALDI-TOF mass spectra of different genotypes: HbA the wild-type genotype (74B), HbC a mutation of codon 6 of the β-globin gene causing sickle cell disease (74C) and HbS another mutation of codon 6 of the β-globin gene causing sickle cell disease (74D).

74 shows the nucleic acid sequence of the amplified region of CKR-5. The underlined sequence corresponds to the region homologous to the amplification primers. The dotted area corresponds to the 32 bp deletion.

75 shows the sense primer ckrT7f, designed to facilitate the binding of T7 RNA polymerase and to amplify the CKR-5 region to be analyzed, starting with a random sequence of 24 bases, the T7 Promoter sequence of 18 bases and the CKR-5 homologous sequence of 19 bases.

76 is a MALDI-TOF mass spectrum of the CKR-5 amplification product generated as described in Example 21 below.

77 Figure 4 shows positive ion UV-MALDI mass spectra of a synthetic RNA 25mer (5'-UCCGGUCUGAUGAGUCCGUGAGGAC-3 ', SEQ ID NO: 62) digested with selected RNAses. For each enzyme, 0.6 μl aliquots of the 4.5 μl assay containing a total of about 20 pmoles of RNA were fixed with 1.5 μl matrix (3-HPA) for analysis. Fragments with retained 5'-terminus are marked by different arrows specific for the different RNAs (Hahner et al. (1996), Proceedings of the 44th ASMS Conference on Mass Spectrometry and Allied Topics, p. 983).

78 is a study of the specificity of RNAses CL3 and Cusativin by positive ion UV-MALDI mass spectra of a synthetic RNA-20mer. Expected and / or observed cleavage sites are indicated by arrows. A, B, C indicate correct cleavage sites and corresponding individually cleaved fragments. Missing divisions are marked with a question mark (?), Non-specific divisions with an X.

79 shows the separation of a mixture of DNA molecules (12-mer, 5'-biot. 19-mer, 22-mer and 5'-biot. 27-mer) with streptavidin-coated magnetic beads. a) Positive ion UV-MALDI mass spectrum of 0.6 μl of a mixture containing approximately 2-4 pmoles of each species mixed with 1.5 μl matrix (3-HPA). b) Same as a) but incubation of the mixture with magnetic beads and subsequent release of the captured fragments.

80 : Elution of immobilized 5'-biotinylated 49-nt in vitro transcript from the streptavidin-coated magnetic beads. Positive UV-MALDI mass spectrum of the transcript before incubation with the magnetic beads (a). Spectra of the immobilized RNA transcript after elution with 95% formamide alone and (b) with various additives such as 10mM EDTA (c), 10mM CDTA (d) and 25% ammonium hydroxide (e); EDTA and CDTA were adjusted to pH 8 with 25% ammonium hydroxide.

81 : Positive UV-MALDI mass spectra of the 5'-biotinylated 49-nt in vitro transcript after RNAse U2 digestion for 15 minutes. a) Spectrum of the 25 μl assay containing approximately 100 pmol of the target RNA before separation; b) spectrum after isolation of the 5'-biotinylated fragments with magnetic beads. The captured fragments were released by a 95% formamide solution containing 10 mM CDTA. In both cases, 1 μl aliquots of the samples were mixed with 1.5 μl matrix (3-HPA).

82 schematically shows the parallel detection of putative mutations in the human β-globin gene at codons 5 and 6 and at codon 30 and in the IVS-1 donor site, respectively. 82A shows amplification of genomic DNA using primers β2 and β11. The location of the primers and identification labels as well as references to the wild-type and the mutant sequences are indicated. 82B shows the analysis of both sites in a simple primer reaction oligo base extension (PROBE) using the primers β-TAG1 (which binds upstream of codons 5 and 6) and β-TAG2 (which binds upstream of codon 30 and the IVS-1 donor site). The reaction products are captured using biotinylated capture primers bound to streptavidin-coated paramagnetic particles (cap-tag-1 and cap-tag-2, respectively) which have 6 bases at the 5 'end that are complementary to the 5' end of β-TAG1 and β-TAG2, respectively, and a portion that binds to a universal primer.

83 Figure 4 shows a mass spectrum of the PROBE products of a DNA sample from an individual as shown schematically in FIG 82 was analyzed.

84 shows a mass spectrum of the cap-tag-2 bound sequence.

85 Figure 4 shows a mass spectrum obtained by using the primers β-TAG1 and β-TAG2 in a sequencing reaction using ddATP for termination, following which, according to the method described in 82 has been separated.

86 Figure 4 shows a mass spectrum obtained by using the primers β-TAG1 and β-TAG2 in a sequencing reaction using ddATP for termination and then following the procedure described in 82 has been separated.

87A shows the wild-type sequence of a fragment of the chemokine receptor CKR-5 gene with the primers used for amplification (bold). The 32 base pair (bp) deletion in the CKR-5 allele is underlined and the stop nucleotides are italics. In 87B the wild-type strands are shown with and without an added adenosine, and their length and molecular masses are indicated. 87C gives the same for the 32 bp deletion. 87D shows the PROBE products for the wild-type gene and 87E shows the mutant allele.

88 Figure 4 shows the amplification products of various unrelated individuals analyzed by native polyacrylamide gel electrophoreses (15%) and silver staining. The band corresponding to a wild-type CKR-5 runs at 75 bp and the band of the gene with the deletion runs at 43 bp. Greater than 75 bp bands are due to non-specific amplification.

89A Figure 11 shows a spectrogram of DNA recovered from a heterozygous individual: the peak with a mass of 23319 Da corresponds to the wild-type CKR5 and the peaks with masses of 13137 Da and 13451 Da correspond to the deletion allele with and without an additional adenosine. 89B shows a spectrogram of DNA from the same individual as in 89A but the DNA was treated with T4 DNA polymerase to remove the added adenosine. The 89C and 89D are spectrograms obtained from homozygous individuals and in 89D the adenosine was removed. All peaks smaller than 13,000 Da are due to multiply charged molecules.

90A Figure 13 shows the mass spectrum of the results of a PROBE reaction performed on DNA recovered from a heterozygous individual. 90B shows a mass spectrum of the results of a PROBE reaction on a homozygous individual. The peaks with masses of 6604 Da and 6607 Da respectively correspond to the wild-type allele, and the peak with a mass of 6275 Da corresponds to the deletion allele. The primer is detected with a mass of 5673 and 5676 Da, respectively.

91 Figure 9 shows MALDI-TOF MS spectra of a thermocycling primer oligo base extension (tc-PROBE) reaction as described in Example 24 using three different templates and 5 different PROBE primers simultaneously in one reaction.

92 schematically shows a single-tube method for amplification and sequencing of exons 5-8 of the p53 gene as described in Example 25. The mass spectrum is the A reaction of the 93 ,

93 Figure 4 shows the superimposed plot of four separate reactions for sequencing a portion of exon 7 of the p53 gene as described in Example 25.

94 Figure 4 shows the mass spectrum obtained from the A reaction for sequencing a portion of exon 7 of the p53 gene as described in Example 25.

95 shows the mass spectrum of a p53 sequencing ladder, for which 5 nl of each reaction in wells transferred on a chip and measured by MALDI-TOF.

96A Figure 4 shows a MALDI-TOF mass spectrum of a synthetic 50-mer (15.34 kDa) mixed with 27-mer _nc (non-complementary, 8.30 kDa).

96B Figure 4 shows a MALDI-TOF mass spectrum of a synthetic 50-mer (15.34 kDa) mixed with a 27-mer _c (complementary, 8.34 kDa). The final concentration of each oligonucleotide was 10 μM. The signal at 23.68 kDa in 96B corresponds to WC-specific dsDNA.

97A Figure 9 shows a MALDI-TOF mass spectrum of Cfol / Rsal digestion products from a region of exon 4 of the apolipoprotein E gene (ε3 genotype) using the sample preparation as in 96 ,

97B is the same as 97A except that the samples were prepared for MALDI-TOF analysis at 4 ° C.

98 Figure 12 shows a MALDI-TOF mass spectrum of Cfal / Rsal co-digested products from a 252 base pair region of exon 4 of the apolipoprotein E gene (ε4 genotype), the samples prepared at 4 ° C.

99 Figure 4 shows the mass spectra obtained from a study in a small population of 15 patients with a 16-element array of diagnostic products transferred to a MALDI target using a needle microdosing device.

100 is a MALDI mass spectrum of an aliquot taken after T ₁ digestion of a synthetic 20-mer RNA.

DETAILED DESCRIPTION OF THE INVENTION

definitions

If Unless otherwise specified, all technical means used herein have been used and scientific terms have the same meaning as they are One skilled in the art will usually understand. If permitted is the subject of all parallel patent applications and of the patent Included herein in its entirety.

As As used herein, the term "biological sample" refers to any material, that was obtained from any living source (eg, human, Animal, plant, bacteria, fungi, protists, viruses). For the present Contains purposes the biological sample is typically a nucleic acid molecule. Examples for suitable include biological samples are u. a. but not limited to: solid materials (eg tissue, cell sediments, biopsies) and biological liquids (Urine, blood, saliva, amniotic fluid, mouthwash, cerebrospinal fluid and other body fluids).

As used herein, the phrase "chain extending Nucleotides "and" chain terminating Nucleotides "accordingly their meaning recognized in the art. For example for DNA chain-extending Nucleotides u. a. 2'-deoxyribonucleotides (eg dATP, dCTP, dGTP and dTTP) and chain terminating nucleotides are u. a. 2 ', 3'-dideoxyribonucleotides (eg, ddATP, ddCTP, ddGTP, ddTTP). For RNA are chain-extending Nucleotides u. a. Ribonucleotides (eg ATJP, CTP, GTP and UTP) and Chain-terminating nucleotides are u. a. 3'-deoxyribonucleotides (eg 3'dA, 3'dC, 3'dG and 3'dU). A complete sentence of chain-extending Nucleotides refers to dATP, dCTP, dGTP, dTTP. The term "nucleotide" is in the field Also well known.

As As used herein, nucleotides include nucleoside mono-, di- and triphosphates. Close nucleotides Furthermore modified nucleotides, such as phosphorothioate nucleotides and deazapurine nucleotides one. A complete one Set of chain lengthening Nucleotides refers to four different nucleotides attached to each of the four different bases that make up the DNA template.

As used herein, the superscritical 0-ii + 1 designates nucleotides, primers, or markers of distinguishable mass. In some cases, the superscript 0 may designate an unmodified species of a particular reactant, and the superscript i may designate the i-th mass-modified species of this reactant. For example, when more than one type of nucleic acid is determined simultaneously For example, i + 1 different mass-modified detector oligonucleotides (D ⁰ , D ¹ , ... D ⁱ ) can be used to distinguish each species of the mass-modified detector oligonucleotides (D) from the others by mass spectrometry.

As As used herein, "multiplexing" refers to the simultaneous detection of more than one analyte, such as more than one (mutant) Locus on a particular captured nucleic acid fragment (at one point an array).

As as used herein, the term "nucleic acid" refers to single-stranded and / or double-stranded polynucleotides, such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), as well as analogs or derivatives of either RNA or DNA. Also in the term "nucleic acid" are included Analogs of nucleic acids, such as peptide nucleic acids (PNA), phosphorothioate DNA and other such analogs and derivatives.

As As used herein, the term "conjugated" refers to a stable one Attachment, preferably an ionic or covalent attachment. Preferred types of conjugation are u. a .: streptavidin or Avidin-biotin interaction; hydrophobic interaction, magnetic Interaction (eg, using functionalized magnetic beads, such as DYNA-BEADS, which are streptavidin-coated magnetic beads sold by Dynal, Inc. Great Neck, NY and Oslo Norway become); polar interactions, such as wetting interactions between two polar surfaces or between oligo / polyethylene glycol; Formation of a covalent Bond, such as an amide bond, disulfide bond, thioether bond, or over Cross linking agent and over an acid labile or photolytically cleavable linker.

As used herein means equivalent when referring to two sequences of nucleic acids that the two sequences in question have the same sequence of amino acids or equivalent Encode proteins. If "equivalent" with reference used on two proteins or peptides, it means that the two proteins or peptides have essentially the same amino acid sequence exhibit, with exclusively conservative amino acid substitutions, through which the activity or function of the protein or peptide is not significantly altered.

If is "equivalent" to a property this property does not need to exist to the same extent to be [z. B. can two peptides a different measure of the same kind of enzymatic activity have], but the activities are preferably substantially the same. "Complementary" means in the Referring to two nucleotide sequences that the two sequences of nucleotides for hybridization, preferably less than 25%, more preferably less than 15%, still more preferably less than 5%, most preferably no mismatch between opposite lying nucleotides.

Preferably hybridize the two molecules under conditions of high stringency.

As used herein, stringency of hybridization in determining percent mismatches means conditions known to those skilled in the art, and typically corresponds to: 1) high stringency: 0.1X SSPE, 0.1% SDS, 65 ° C 2) mean stringency: 0.2 x SSPE, 0.1% SDS, 50 ° C 3) low stringency: 1.0 x SSPE, 0.1% SDS, 50 ° C

It It is understood that using an equivalent stringency other buffers, salts and temperatures can be achieved.

As used herein, a primer as specified in the claims refers to a primer suitable for mass spectrometric methods requiring immobilization, hybridization, strand displacement; Sequencing mass spectrometry refers to a nucleic acid that must have a sufficient mass, typically about 70 nucleotides or less than 70, and a sufficient size to be suitable for the mass spectrometric methods described herein that rely on mass spectrometric detection. These methods involve primers for the detection and sequencing of nucleic acids requiring a sufficient number of nucleotides to form a stable duplex, typically about 6-30, preferably about 10-25, more preferably about 12-20. Thus, for purposes herein, a primer is a sequence of nucleotides that are about 6-70 ahead preferably 12-70, more preferably more than about 14 up to an upper limit of 70 nucleotides, depending on the sequence and application of the primer. The present primers, for example, for mutational analyzes, are chosen to be upstream of the loci suitable for diagnosis such that, when performed using sequencing up to or through the site of interest, the resulting fragment has a mass which sufficient and not too large to be detected by mass spectrometry. For mass spectrometric methods, mass labels or modifications are preferably added at the 5 'end and the primer is otherwise unlabelled.

As As used herein, refers to "conditioning" a nucleic acid the modification of the phosphodiester skeleton of the nucleic acid molecule (eg. Cation exchange) with the purpose of peak broadening due a heterogeneity to prevent the bound per nucleotide unit cations. By Contacting a nucleic acid molecule with a Alkylating agents such as alkyl iodide, iodoacetamide, β-iodoethanol or 2,3-epoxy-1-propanol the monothiophosphodiester bonds of a nucleic acid molecule into a Phosphotriesterbindung be converted. Similarly, phosphodiester bonds using trialkylsilyl chlorides in uncharged derivatives being transformed. Next, the conditioning closes the Uptake of nucleotides, the sensitivity to a Depurination (fragmentation during Reduce MS), z. A purine analog, such as N7 or N9 deazapurine nucleotides or RNA building blocks or the use of oligonucleotide triesters or the incorporation of phosphorothioate functions which are alkylated, or the use of oligonucleotide mimetics, such as peptide nucleic acids (PNA).

As As used herein, substrate refers to an insoluble one Carrier, on which a sample corresponding to the materials described herein is deposited. examples for suitable substrates include pearls (e.g., silica gel, Glass with controlled pores, magnets, agarose gels and cross-linked Dextrose (i.e., Sepharose and Sephadex, cellulose and other materials, which the expert knows that they are solid carrier matrices serve. For example, you can Substrates of any of the following or combinations thereof silica gel, glass, magnet, polystyrene / 1% divinylbenzene resin, such as Wang resins containing Fmoc-amino acid 4- (hydroxymethyl) phenoxymethylcopoly (styrene-1% divinylbenzene (DVD)) Resin, chlorotrityl (2-chlorotrityl-chloride-copystyrene-DVB-resin) Resin, Merrifield (chloromethylated copolystyrene DVB) resin, Metal, plastic, cellulose, cross-linked dextrans, such as those sold under the trade name Sephadex (Pharmacia), and agarose gels, such as gels, sold under the trade name Sepharose (Pharmacia), which are argarose gels from Polysaccharide type with hydrogen bonds, and other such Resins and solid phase supports, which are known to a person skilled in the art. The carrier matrices can be in any shape or shape, including but not limited on: capillaries, flat straps such as glass fiber filters, glass surfaces, metal surfaces (steel, Gold, silver, aluminum, copper and silicon), plastic materials including Multiwell plates or membranes (eg made of polyethylene, polypropylene, Polyamide, polyvinylidene difluoride), pens (e.g., arrays of Pens for the combinatorial synthesis or analysis are suitable or beads in depressions of flat surfaces such as wafers (eg, silicon wafers) with or without plates and pearls.

As used herein, a selectively cleavable linker is a linker, which is cleaved under certain conditions, such as a photocleavable one Linker, a chemically cleavable linker and an enzymatically cleavable Linker (i.e., a restriction endonuclease site or a ribonucleotide / RNase digest). The linker is between the carrier and immobilized DNA.

Isolation of Nucleic Acid Molecules

Nucleic acid molecules can be made a particular biological sample using a series isolated by methods known in the art, being the particular one selected Insulation method for the particular biological sample is suitable. For example, freeze drying and alkaline lysis procedures useful be firm to nucleic acid molecules To obtain materials; Heat and alkaline lysis procedures can be useful to nucleic acid molecules from urine to obtain and Proteinase K extraction can be used to nucleic acid from blood (see, eg, Rolff et al. (1994) PCR: Clinical Diagnostics and Research, Springer).

In order to obtain a suitable amount of nucleic acid molecules to which mass spectrometry is to be performed, amplification may be required. Examples of suitable amplification methods that can be used herein include: cloning (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, Laboratory Press, 1989), polymerase chain reaction (PCR) (CR Newton and A. Graham, PCR , BIOS Publishers, 1994), ligase chain reaction (LCR) (see, for example, Weidmann et. al. (1994) PCR Methods Appl. Volume 3, pp. 57-64; F. Barany (1991) Proc. Natl. Acad. Sci. USA 88: 189-93), strand exchange amplification (SDA) (see, e.g., Walker et al (1994) Nucleic Acids Res. 22: 2670-77) and variations such as RT-PCR (see, e.g., Higuchi et (1993) Bio / Technology 11: 1026-1030), allele-specific amplification (ASA) and transcription-based methods.

Immobilization of Nucleic Acid Molecules to Solid carriers

Around To facilitate mass spectrometric analysis, a nucleic acid molecule having a nucleic acid sequence contains which is to be detected on an insoluble (ie solid) Carrier immobilized become. examples for suitable solid carriers are u. a. Pearls (eg silica gel, glass with controlled pores, Magnets, Sephadex / Sepharose, cellulose), capillaries, flat supports such as about glass fiber filters, glass surfaces, metal surfaces (Steel, gold, silver, aluminum, copper and silicon), plastic materials including multiwell plates or membranes (eg of polyethylene, polypropylene, polyamide, Polyvinylidene difluoride), pens (eg, arrays of pens used for combinatorial Synthesis or analysis are suitable or beads in wells flat surfaces such as wafers (eg, silicon wafers) with or without filter plates. Samples containing target nucleic acids can contain by any of numerous methods known to those skilled in the art are transferred to solid carriers become. For example, you can nucleic acid samples into individual wells of a substrate, e.g. B. a silicon chip transferred be manually or using a needle microdispenser, such as described herein. Alternatively, this may be a piezoelectric pipetting for transmission Small nanoliter samples can be used on substrate, resulting in the implementation of miniaturized high-throughput analysis on a chip.

The immobilization can be carried out, for example, on the basis of a hybridization between a capture nucleic acid sequence which is already immobilized on the support and a complementary nucleic acid sequence which is likewise contained in the nucleic acid molecule which contains the nucleic acid sequence to be detected. 1A ). Thus, the hybridization between the complementary nucleic acid molecules is not hindered by the carrier, the capture nucleic acid z. A spacer region of at least about five nucleotides in length between the solid support and the capture nucleic acid sequence. The formed duplex is split under the influence of the laser pulse and the desorption can be triggered. The nucleic acid molecule bound to the solid support may be by natural oligoribo- or oligodeoxyribonucleotides as well as analogs (eg, with thio-modified phosphodiester or phosphotriester backbone) or by use of oligonucleotide mimetics, such as PNA analogs (see, eg, Nielsen et al. (1991), Science 254: 1497) which make the base sequence less susceptible to enzymatic degradation and a bound capture base sequence.

left

A target detection site may be bound directly to a solid support via a reversible or irreversible bond between a suitable functionality (L ') in the target nucleic acid molecule (T) and a suitable functionality (L) in the capture molecule ( 1B ). A reversible linkage may be such that it is cleaved under the conditions of mass spectrometry (ie, a photocleavable bond such as a charge-transfer complex or a labile bond formed between relatively stable organic residues).

photocleavable Linkers are linkers that are cleaved upon exposure to light (See, e.g., Goldmacher et al., (1992) Bioconj. Chem., 3: 104-107), whereby the targeted agent released upon exposure to light becomes. Photocleavable linkers which cleave upon exposure to light are known (see, for example, Hazum et al (1981) in Pept. Proc. Eur. Pept. Symp., 16th, Brunfeldt, K (ed.), Pp. 105-110, which the use of a nitrobenzyl group as a photocleavable protecting group for cysteine describe; Yen et al. (1989) Macromol. Chem. 190: 69-82, which water-soluble photocleavable copolymers including hydroxypropyl methacrylamide copolymer, Glycine copolymer, fluorescein copolymer and methylrhodamine copolymer describes; Goldmacher et al. (1992) Biocon. Chem. 3: 104-107, which describes a crosslinking agent and reagent when exposed of near UV light (350 nm) is subject to photolytic degradation; and Senter et al. (1985) Photochem. Photobiol 42: 231-237, which Nitrobenzyloxycarbonyl chloride cross-linking reagents that photocleavable connections form), whereby the targeted agent upon exposure is released by light. In preferred embodiments, the nucleic acid is under Use of the photocleavable linker group which occurs during the Mass spectrometry is cleaved, immobilized. Here preferred photocleavable linkers are mentioned in the examples.

In addition, the linkage can be formed when L 'is a quaternary ammonium group where in this case, the surface of the solid support preferably carries negative charges which repel the negatively charged nucleic acid backbone, thus facilitating the desorption required for analysis by mass spectrometry. The desorption can be done either by the heat generated by the laser pulse and / or dependent on L 'by specific absorption of laser energy which is in resonance with the L' chromophore.

Consequently can the L-L'-chemistry be of the type of a disulfide bond (chemically cleavable, for example by Mercaptoethanol or dithioerythrol), a biotin / streptavidin system, a heterobifunctional Derivatives of a trityl ether group (see, for example, Köster et al., (1990) "A Versatile Acid-Labile Linker for Modification of Synthetic Biomolecules, Tetrahedron Letters 31: 7095), which under weakly acidic conditions as well as under the Conditions of mass spectrometry can be split, one Levulinyl group operating under near-neutral conditions with hydrazinium / acetate buffer an arginine / arginine or lysine / lysine bond, which are cleaved by an endopeptidase enzyme such as trypsin or a pyrophosphate bound by a pyrophosphatase can be cleaved or a ribonucleotide bond within the oligodeoxynucleotide sequence, for example, by a ribonuclease or alkali can be cleaved.

The functionalities L and L 'can too form a charge transfer complex and thereby the temporary Forming L-L'linkage. Because in many cases the "Charge transfer band" detected by UV / vis spectrometry can be used (see, for example, Organic Charge Transfer Complexes by R. Foster, Academic Press, 1969), the laser energy can be applied to the corresponding Charge transfer wavelength energy set be and thus a specific desorption of the solid carrier triggered become. A person skilled in the art will recognize that different combinations serve this purpose and that the donor functionality is either to the solid support or may be coupled to the nucleic acid molecule to be detected or vice versa.

at Yet another approach may be a reversible L-L'linkage homolytic formation of relatively stable radicals are generated. Under the influence of the laser pulse is desorption (as discussed above) and ionization at the site of the radical position. An expert will recognize that other organic radicals can be chosen, and that a laser wavelength chosen that can be the one for the homolytic cleavage of the bond between them requires dissociation energies (See, for example, Reactive Molecules by C. Wentrup, John Wiley & Sons, 1984).

An anchor function L 'can also be incorporated into a target capture sequence (TCS) using appropriate primers during an amplification process, such as PCR ( 4 ), LCR ( 5 ) or transcription amplification ( 6A ).

If exonuclease sequencing using MALDI-TOF MS carried out becomes, so is a single-stranded DNA molecule the above its 5'-end on a solid carrier immobilized in one direction with a 3 'processing exonuclease degraded and the molecular weight of the degraded nucleotide becomes sequential certainly. Reverse Sanger sequencing yields the nucleotide sequence the immobilized DNA. By adding a selectively fissile Linker can not only determine the mass of free nucleotides but can be removed by washing the nucleotides also the mass of the remaining fragment after the splitting of the DNA from the solid support determined by MALDI-TOF. Using selectively cleavable Linkers such as the photocleavable and provided herein chemically cleavable linker this cleavage can be chosen so that they are during the ionization and evaporation steps of the MALDI-TOF takes place. The same basic principle applies to a 5'-immobilized Strand of a double-stranded DNA degraded while he is present as a duplex. This is also true when a 5'-processing exonuclease is used and the DNA over the 3'-end to the immobilized solid support is.

As noted, at least three types of immobilization are provided here: 1) the target nucleic acid is amplified or recovered (the target sequence or surrounding DNA sequence must be known to make primers for amplification or insulation); 2) the primer nucleic acid is immobilized on the solid support and the target nucleic acid is hybridized thereto (this is to demonstrate the presence from or for sequencing a target sequence in a sample); or 3) a double-stranded one DNA (amplified or isolated) is made by linking with immobilized on a predetermined strand, the DNA is denatured, to eliminate the duplex and then becomes a high concentration at complementary It adds primer or DNA with identity upstream of the target site a strand exchange and the primer is attached to the immobilized strand hybridized.

In the embodiments, where the primer nucleic acid on the solid support immobilized and the target nucleic acid is hybridized thereto, allows incorporation of the cleavable linker that immobilizes the primer DNA at the 5 'end so that free 3'-OH for the nucleic acid synthesis (Extension) available and determines the sequence of the "hybridized" target DNA can be because the hybridized template removed by denaturation can be and the extended DNA products for the MALDI-TOF MS from the solid support can be split off. Likewise, in 3) the immobilized strand can be extended, when hybridized to the template and cleaved from the carrier become. Thus, you can by Sanger sequencing and the primer oligo base extension discussed above (PROBE) extension reactions using an immobilized Primers with known upstream DNA sequence, the complementary to an invariable region of a target sequence. The nucleic acid from the person is won and the DNA sequence of a variable Region (deletion, insertion, missense mutation, which genetic predispositions or cause disease or the presence of viral / bacterial or fungal DNA) is not only detected, but the actual Sequence and position of the mutation are also determined.

In other cases the target DNA must be immobilized and the primer hybridized. This requires the amplification of a longer DNA based on a known sequence and then the sequencing of the immobilized Fragments (i.e., the elongated Fragments are sent to the wearer hybridized but not immobilized as described above). In these cases it is not desirable to incorporate a linker since the MALDI-TOF spectrum hybridized DNA is from.

It it is not necessary to split off the immobilized template. Any linker that a person skilled in the art knows will accept nucleic acids solid carriers immobilized, can be used here to attach the nucleic acid to a solid carrier to link. The preferred linkers herein are the selectively cleavable linkers, especially those exemplified herein. Other Linkers are u. a. Acid-cleavable Linker such as bismaleimide ethoxypropane, acid labile trityl linker.

Acid-cleavable Linkers, photocleavable linkers and thermosensitive linkers may also be used be used, especially when it may be necessary to split off the targeted substance, making it easier for reactions accessible is. Acid-cleavable Linkers are u. a., but are not limited to; bismaleimideothoxy propane; Adipic linker (see, for example, Fattom et al., (1992) Infecion & Immun. 60: 584-589) and acid labile Transferrin conjugates containing a sufficient portion of the transferrin included, thus allowing entry into the intracellular transferrin circulation pathway allows is (see, for example, Welhöner et al. (1991) J. Biol. Chem. 266: 4309-4314).

Photocleavable linker

photocleavable Linkers are provided. In particular, photocleavable Linker provided in the form of their phosphoramidite derivatives, for Use in the solid phase synthesis of oligonucleotides. The Linkers contain O-nitrobenzyl groups and phosphate linkages, the one complete photolytic cleavage of the conjugates within minutes Allow UV irradiation. The UV wavelengths used are chosen that the oligonucleotides are not damaged by the irradiation and are preferably at about 350-380 nm, more preferably 365 nm. The photocleavable linkers provided herein have a comparable coupling efficiency to commonly used phosphoamidite monomers (see Sinha et al., (1983) Tetrahedron Lett. 24: 5843-5846; Sinha et al. (1984) Nucleic Acids Res. 12: 4539-4557; Beaucage et al. (1993) Tetrahedron 49: 6123-6194; and Matteucci et al. (1981) J. Am. Chem. Soc. 103: 3185-3191).

worin R²⁰ ω-(4,4'-Dimethoxytrityloxy)alkyl oder ω-Hydroxyalkyl ist; R²¹ ausgewählt ist aus Wasserstoff, Alkyl, Aryl, Alkoxycarbonyl, Aryloxycarbonyl und Carboxy; R²² Wasserstoff oder (Dialkylamino)(ω-cyanoalkoxy)P- ist; t 0–3 ist und R⁵⁰ Alkyl, Alkoxy, Aryl oder Aryloxy ist.In one embodiment, the photocleavable linkers have the formula I:

wherein R ^{20 is} ω- (4,4'-dimethoxytrityloxy) alkyl or ω-hydroxyalkyl; R ^{21 is} selected from hydrogen, alkyl, aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R ^{22 is} hydrogen or (dialkylamino) (ω-cyanoalkoxy) P-; t is 0-3 and R ^{50 is} alkyl, alkoxy, aryl or aryloxy.

worin R²⁰ ω-(4,4'-Dimethoxytrityloxy)alkyl, ω-Hydroxyalkyl oder Alkyl ist; R²¹ ausgewählt ist aus Wasserstoff, Alkyl, Aryl, Alkoxycarbonyl, Aryloxycarbonyl und Carboxy; R²² Wasserstoff oder (Dialkylamino)(ω-cyanoalkoxy)P- ist; und X²⁰ Wasserstoff, Alkyl oder OR²⁰ ist.In a preferred embodiment, the photocleavable linker formula II:

wherein R ^{20 is} ω- (4,4'-dimethoxytrityloxy) alkyl, ω-hydroxyalkyl or alkyl; R ^{21 is} selected from hydrogen, alkyl, aryl, alkoxycarbonyl, aryloxycarbonyl and carboxy; R ^{22 is} hydrogen or (dialkylamino) (ω-cyanoalkoxy) P-; and X ^{20 is} hydrogen, alkyl or OR ²⁰ .

In particularly preferred embodiments, R ^{20 is} 3- (4,4'-dimethoxytrityloxy) propyl, 3-hydroxypropyl or methyl; R ²¹ is selected from hydrogen, methyl and carboxy; R ²² is hydrogen or (diisopropylamino) (2-cyanoethoxy) P-; and X ²⁰ is hydrogen, methyl or OR ²⁰ .

In a further preferred embodiment, R ^{20 is} 3- (4,4'-dimethoxytrityloxy) propyl; R ²¹ is methyl; R ²² is (diisopropylamino) (2-cyanoethoxy) P-; and X ²⁰ is hydrogen. In another more preferred embodiment, R ^{20 is} methyl; R ²¹ is methyl, R ²² is (diisopropylamino) (2-cyanoethoxy) P-; and X ²⁰ is 3- (4,4'-dimethoxytrityloxy) propoxy.

worin R²³ Wasserstoff oder (Dialkylamino)(ω-cyanoalkoxy)P- ist; und R²⁴ ausgewählt ist aus ω-Hydroxyalkoxy, ω-(4,4'-Dimethoxytrityloxy)alkoxy, ω-Hydroxyalkyl und ω- (4,4'-Dimethoxytrityloxy)alkyl und unsubstituiert oder an der Alkyl- oder Alkoxykette- mit einer oder mehreren Alkylgruppen substituiert ist; r und s jeweils unabhängig 0–4 sind und R⁵⁰ Alkyl, Alkoxy, Aryl oder Aryloxy ist. In bestimmten Ausführungsformen ist R²⁴ ω-Hydroxyalkyl oder ω-(4,4'-Dimethoxytrityloxy)alkyl und an der Alkylkette mit einer Methylgruppe substituiert.In another embodiment, the photocleavable linker formula III:

wherein R ^{23 is} hydrogen or (dialkylamino) (ω-cyanoalkoxy) P-; and R ^{24 is} selected from ω-hydroxyalkoxy, ω- (4,4'-dimethoxytrityloxy) alkoxy, ω-hydroxyalkyl and ω- (4,4'-dimethoxytrityloxy) alkyl and unsubstituted or on the alkyl or alkoxy chain with one or more substituted by several alkyl groups; each of r and s is independently 0-4 and R ^{50 is} alkyl, alkoxy, aryl or aryloxy. In certain embodiments, R ^{24 is} ω-hydroxyalkyl or ω- (4,4'-dimethoxytrityloxy) alkyl and substituted on the alkyl chain with a methyl group.

In preferred embodiments, R ^{23 is} hydrogen or (diisopropylamino) (2-cyanoethoxy) P-; and R ²⁴ is selected from 3-hydroxypropoxy, 3- (4,4'-dimethoxytrityloxy) propoxy, 4-hydroxybutyl, 3-hydroxy-1-propyl, 1-hydroxy-2-propyl, 3-hydroxy-2-methyl 1-propyl, 2-hydroxyethyl, hydroxymethyl, 4- (4,4'-dimethoxytrityloxy) butyl, 3- (4,4'-dimethoxytrityloxy) -1-propyl, 2- (4,4'-dimethoxytrityloxy) ethyl, 1 - (4,4'-dimethoxytrityloxy) -2-propyl, 3- (4,4'-dimethoxytrityloxy) -2-methyl-1-propyl and 4,4'-dimethyloxytrityloxymethyl.

In more preferred embodiments, R ^{23 is} (diisopropylamino) (2-cyanoethoxy) P-; r and s are 0; and R ²⁴ is selected from 3- (4,4'-dimethoxytrityloxy) propoxy, 4- (4,4'-dimethoxytrityloxy) butyl, 3- (4,4'-dimethoxytrityloxy) propyl, 2- (4,4 ' -Dimethoxytrityloxy) ethyl, 1- (4,4'-dimethoxytrityloxy) -2-propyl, 3- (4,4'-dimethoxytrityloxy) -2-methyl-1-propyl and 4,4'-dimethyloxytrityloxymethyl. R ²⁴ is most preferably 3- (4,4'-dimethoxytrityloxy) propoxy.

Preparation of photocleavable left

A. Preparation of photocleavable linker of the formula I or II.

Photocleavable linkers of formula I or II may be prepared by the methods described below, by minor alterations of the methods, by selection of the appropriate starting materials or by any other methods known to those skilled in the art. Detailed procedure For the synthesis of photocleavable linkers of the formula II are provided in the examples.

In the photocleavable linkers of formula II wherein X ^{20 is} hydrogen, the linkers can be prepared in the following manner. Alkylation of 5-hydroxy-2-nitrobenzaldehyde with ω-hydroxyalkyl halide, e.g. 3-hydroxypropyl bromide, followed by protection of the resulting alcohol as e.g. B. Silyl ether gives a 5- (ω-silyloxyalkoxy) -2-nitrobenzaldehyde. Addition of an organometallic substance to the aldehyde yields a benzyl alcohol. Organometallic substances that may be used include trialkylaluminum (for linkers where R ^{21 is} alkyl) such as trimethylaluminum, borohydrides (for linkers where R ^{21 is} hydrogen) such as sodium borohydride or metal cyanides (for linkers where R ^{21 is} carboxy or alkoxycarbonyl) such as potassium cyanide. For metal cyanides, the reaction product, a cyanohydrin, would then be hydrolyzed under either acidic or basic conditions in the presence of either water or an alcohol to obtain the compounds of interest.

The silyl group on the side chain of the resulting benzyl alcohols can then be exchanged for a 4,4'-dimethoxytrityl group, by desilylation with e.g. B. Tetrabutylamoniumfluorid to obtain the corresponding alcohol and subsequent reaction with 4,4'-dimethoxytrityl chloride. Implementation with z. B. 2-Cyanoethyl diisopropylchlorophosphoramidite provides linkers in which R ^{22 is} (dialkylamino) (ω-cyanoalkoxy) P-.

One specific example of a synthesis of a photocleavable linker of the formula II is shown in the following scheme, which also shows the use of the linker in oligonucleotide synthesis. This scheme is intended to be illustrative only and not in any Way restrict the scope of the invention. Experimental details These synthetic transformations are provided in the examples.

In the synthesis of the linkers of formula II, wherein X ^{20 is} OR ²⁰ , 3,4-dihydroxyacetophenone is selectively attached to the 4-hydroxyl by reaction with e.g. As potassium carbonate and a silyl chloride protected. Instead of the acetophenone, benzoate esters, propiophenones, butyrophenones, etc. may be used. The resulting 4-silyloxy-3-hydroxyacetophenone is then alkylated on the 3-hydroxyl with an alkyl halide (for linkers in which R ^{20 is} alkyl) and desilylated with e.g. For example, tetrabutylammonium fluoride to obtain a 3-alkoxy-4-hydroxyacetophenone. This compound is then alkylated on the 4-hydroxyl by reaction with an ω-hydroxyalkyl halide, e.g. For example, 3-hydroxypropyl bromide to obtain a 4- (ω-hydroxyalkoxy) -3-alkoxyacetophenone. The side chain alcohol is then used as ester, e.g. As acetate protected. This compound is then nitrided at the 5-position, e.g. With concentrated nitric acid to obtain the corresponding 2-nitroacetophenones. The saponification of the side chain ester with z. As potassium carbonate and reduction of the ketone z. B. with sodium borohydride in any order gives a 2-nitro-4- (ω-hydroxyalkoxy) -5-alkoxybenzylalkohol.

Selective protection of the side chain alcohol as the corresponding 4,4'-dimethoxytrityl ether is then accomplished by reaction with 4,4'-dimethoxytrityl chloride. The further implementation with z. B. 2-Cyanoethyl-diisopropylchlorophosphoramidite provides linkers in which R ^{22 is} (dialkylamino) (ω-cyanoalkoxy) P-.

One specific example of the synthesis of a photocleavable linker of formula II is in shown in the scheme below. This scheme is only for illustration serve and in no way limit the scope of the invention. Full experimental procedures for the transformations shown can be found in the examples.

B. Preparation of photocleavable linker of formula III

photocleavable Linker of the formula III can produced by the methods described below, through small changes the method by selecting suitable starting materials or by other methods known to those skilled in the art.

In general, photocleavable linkers of the formula III are prepared from ω-hydroxyalkyl or alkoxyaryl compounds, in particular ω-hydroxyalkyl or -alkoxybenzenes. These compounds are commercially available or can be prepared from a ω-hydroxyalkyl halide (e.g., 3-hydroxypropyl bromide) and either phenyllithium (for the ω-hydroxyalkylbenzenes) or phenol (for the ω-hydroxyalkoxybenzenes). Acylation of the ω-hydroxyl group (eg, as an acetate ester) followed by Friedel-Craft acylation of the aromatic ring with a 2-nitrobenzoyl chloride affords a 4- (ω-acetoxyalkyl or alkoxy) -2-nitrobenzophenone. The reduction of the ketone with z. For example, sodium borohydride and the saponification of the side chain ester are carried out in any series to obtain a 2-nitrophenyl-4- (hydroxyalkyl or alkoxy) phenylmethanol. Protecting the terminal hydroxyl group as the corresponding 4,4'-dimethoxytrityl ether is achieved by reaction with 4,4'-dimethoxytrityl chloride. The benzylhydroxyl group is then reacted with e.g. 2-cyanoethyldiisopropylchlorophosphoamidite to form linkers of Formula II wherein R ^{23 is} (dialkylamino) (ω-cyanoalkoxy) P-.

Other photocleavable linkers of formula III can be prepared by: the ω-hydroxyalkyl or -alkoxybenzenes of the above synthesis by 2-phenyl-1-propanol or 2-phenylmethyl-1-propanol be replaced. These compounds are commercially available, you can but also by implementation of z. Phenylmagnesium bromide or benzylmagnesium bromide with the required oxirane (i.e., propylene oxide) in the presence catalytic copper ions are produced.

Chemically cleavable linker

A variety of chemically cleavable linkers can be used to introduce a cleavable linkage between the immobilized nucleic acid and the solid support. Acid-labile linkers are here preferably chemically cleavable linkers for mass spectrometry, in particular MALDI-TOF MS, since the acid-labile bond is cleaved during the conditioning of the nucleic acid upon addition of the 3-HPA matrix solution. The acid labile bond can be inserted as a separate linker group, e.g. B. the acid labile trityl groups (see 68 , Example 16) or it can be incorporated into a synthetic nucleic acid linker by incorporating one or more silyl internucleoside bridges using diisopropylsilyl to form diisopropylsilyl-linked oligonucleotide analogs. The diisopropylsilyl bridge replaces diphosphodiester bonds in the DNA backbone and, under mildly acidic conditions such as 1.5% trifluoroacetic acid (TFA) or 3-HPA / 1% TFA MALDI-TOF matrix solution, introduces one or more intrastrand breaks in the DNA molecule , Methods of preparing diisopropylsilyl-linked oligonucleotide precursors and analogs are known to those skilled in the art (see, for example, Saha et al., (1993) J. Org. Chem. 58: 7827-7831). These oligonucleotide analogs can be readily prepared using solid phase oligonucleotide synthesis methods using diisopropylsilyl-derivatized deoxyribonucleosides.

nucleic acid conditioning

In front mass spectrometric analysis may be useful to "condition" nucleic acid molecules, for example, around the for to reduce the evaporation necessary laser energy and / or to minimize fragmentation. The conditioning is preferably carried out, while a target detection site is immobilized. An example of conditioning is the modification of the phosphodiester backbone of the nucleic acid molecule (e.g. Cation exchange), which is useful may be a peak broadening due to heterogeneity of the pro Nucleotide unit to avoid bound cations. By contacting a nucleic acid molecule with a Alkylating agents such as alkyl iodide, iodoacetamide, β-iodoethanol or 2,3-epoxy-1-propanol can the monothiophosphodiester bonds of a nucleic acid molecule into a Phosphotriesterbindung be converted. Similarly, phosphodiester bonds a nucleic acid molecule in a Phosphotriesterbindung be converted. Similarly, phosphodiester bonds using trialkylsilyl chlorides in uncharged derivatives being transformed. Furthermore, the conditioning includes the installation of nucleotides showing sensitivity to depurination (Fragmentation during Reduce MS), z. A purine analog such as N7 or N9 desazapurine nucleotides or RNA building blocks or by using oligonucleotide triesters or incorporation of phosphorothioate functions, which are alkylated or by using oligonucleotide mimetics like PNA.

multiplex reactions

For certain applications, it may be useful to simultaneously designate more than one (mutated) locus on a particular captured nucleic acid fragment (on a point of an array), or it may be useful to perform parallel processing by applying oligonucleotide or oligonucleotide mimetics to various solid carriers are used. "Multiplexing" can be achieved by a variety of different methods, for example, multiple mutations can be simultaneously determined on a target sequence using appropriate detector (probe) molecules (eg, oligonucleotides or oligonucleotide mimetics.) The molecular weight differences between the detector oligonucleotides D1 , D2 and D3 must be sufficiently large so that simultaneous detection (multiplexing) is possible, either through the sequence itself (composition or length), or by inserting mass-modifying functionalities M1-M3 into the detector oligonucleotide (see 2 ).

Mass modification of nucleic acids

Bulk modifying groups may be attached, for example either to the 5 'end of the oligonucleotide (M ¹ ), to the nucleobase (or bases) (M ² , M ⁷ ), to the phosphate backbone (M ³ ) and to the 2' Position of the nucleoside (s) (M ⁴ , M ⁶ ) and / or to the terminal 3 'position (M ⁵ ). Examples of mass-modifying groups include, for example, a halogen, an azide or a group of the XR type, wherein X is a linking group and R is a mass-altering functionality. The mass-modifying functionality can thus be used to introduce defined mass increments into the oligonucleotide.

The mass-modifying functionality may be at different positions within the nucleotide group (see, eg, U.S. Patent No. 5,547,835 and International PCT Application No. WO 94/21822 ). For example, the mass-altering group M may be attached either to the nucleobase, M ² (in the case of the c ⁷ -desazanucleosides also to C-7, M ⁷ ), to the triphosphate group on the alpha-phosphate, M ³ , or to the 2 ' Position of the sugar ring of the nucleoside triphosphate, M ⁴ and M ⁶ . Inserted at the phosphodiester bond modifications (M ^4), such as with alpha-Thionukleosidtriphosphaten have the advantage that these modifications do not interfere with accurate Watson-Crick base pairing and also the single-step post-synthetic site-specific modification of the complete nucleic acid molecule z. Via alkylation reactions (see, e.g., Nakamaye et al., (1988) Nucl. Acids Res. 16: 9947-59). Particularly preferred mass-modifying functionalities are boron-modified nucleic acids, since they are better incorporated into nucleic acids by polymerases (see, for example, Porter et al., (1995) Biochemistry 34: 11963-11969, Hasan et al (1996) Nucleic Acids Res. 24: 2150-2157; Li et al. (1995) Nucl. Acids Res. 23: 4495-4501).

In addition, the mass-modifying functionality can be added such that the chain termination is affected, such as by attaching it to the 3 'position of the sugar ring in the nucleoside triphosphate, M ⁵ . It will be apparent to those skilled in the art that many combinations can be used in the methods provided herein. Also, those skilled in the art will recognize that chain extending nucleoside triphosphates may also be mass modified in a similar manner, with numerous variations and combinations of functionalities and attachment positions.

Without wishing to be bound by any theory, the mass modification M for X can be inserted into XR, as well as using oligo / polyethylene glycol derivatives for R. The mass-modifying increment in this case is 44, ie five different mass-modifying species can be generated by only M is varied from 0 to 4, giving mass units of 45 (m = 0), 89 (m = 1), 133 (m = 2), 177 (m = 3) and 221 (m = 4) to the nucleic acid molecule (for example, detector oligonucleotide (D) or nucleoside triphosphates ( 6 (C) ). The oligo / ethylene glycols may also be monoalkylated by a lower alkyl such as methyl, ethyl, propyl, isopropyl, t-butyl and the like. A selection of linking functionalities, X, is also illustrated. Other chemicals can be used in the mass-modified compounds (see, for example, those described in Oligonucleotides and Analogues, A Practical Approach, F. Eckstein, Eds., IRL Press, Oxford, 1991).

In yet another embodiment, various other mass-modifying functionalities R can be selected as oligo / polyethylene glycols and attached via suitable linking chemicals X. A simple mass modification can be achieved by exchanging H for halogens such as F, Cl, Br and / or I or pseudohalogens such as CN, SCN, NCS or different alkyl, aryl or aralkyl groups such as methyl, ethyl , Propyl, isopropyl, t-butyl, hexyl, phenyl, substituted phenyl, benzyl or functional groups such as CH ₂ F, CHF ₂ , CF ₃ , Si (CH ₃ ) ₃ , Si (CH ₃ ) ₂ (C ₂ H ₅ ), Si (CH ₃ ) (C ₂ H ₅ ) ₂ , Si (C ₂ H ₅ ) ₃ . Still another mass modification can be obtained by attaching homo- or heteropeptides via the nucleic acid molecule (eg, detector (D)) or nucleoside triphosphates. An example useful for generating mass modifying species with a mass increment of 57 is the attachment of oligoglycines, e.g. For example, mass modifications of 74 (r = 1, m = 0), 131 (r = 1, m = 1), 188 (r = 1, m = 2), 245 (r = 1, m = 3) are achieved. Simple oligoamides can be used, e.g. For example, mass modifications are 74 (r = 1, m = 0), 88 (r = 2, m = 0), 102 (r = 3, m = 0), 116 (r = 4, m = 0), etc. available. Variations to the additions described herein will be apparent to one skilled in the art.

Various mass-modified detection oligonucleotides can be used to simultaneously detect all possible variants / mutants ( 6B ). Alternatively, all 4 base permutations can be detected at the site of a mutation by designing and positioning a detection oligonucleotide to serve as a primer for a DNA / RNA polymerase, with different combinations of extending and terminating nucleoside triphosphates ( 6C ). For example, mass modifications may also be inserted during the amplification process.

3 Figure 4 shows another multiplex detection format in which differentiation is accomplished by employing various specific capture sequences that are positon-specifically immobilized on a flat surface (eg, a "chip array".) When different target sequences T1-Tn are present, so Their target capture sites TCS1-TCSn interact specifically with complementary immobilized capture sequences C1-Cn. Detection is achieved using detection oligonucleotides D1-Dn of appropriate mass difference, which are mass-modifying functionalities M1-Mn acts.

Mass spectrometric method for DNA

Available mass spectrometric Formats that can be used here are u. a. the ionization (I-) Techniques, such as matrix-assisted laser desorption ionization (MALDI), Electron Spray (ESI) (eg continuous or pulsed) and related methods (eg ion spray, thermospray, fast atom bombardment (FAB)) and Massive Cluster Bump (massive cluster impact, MCI); these ion sources can be used in conjunction with detection formats, including Linear Fields, Time of Flight (TOF), Single or Multiple Quadrupole, Single or multiple magnetic sector, Fourier transform ion cyclotron resonance (FTICR), ion traps, or combinations thereof obtain a hybrid detector (eg, ion trap time-of-flight). For ionization can numerous combinations of matrix / wavelength including manufacturing a frozen analyte (MALDI) or combinations of solvents (ESI).

Since a normal DNA molecule contains four nucleotide units (A, T, C, G) and their respective mass is unique (monoisotopic masses 313.06, 304.05, 289.05 and 329.05 Da, respectively) an exact mass determination defines or limits the possible base composition of this DNA. Only above 4900 Da does each unit molecular weight have at least one admissible composition; there is only one non-unique nominal molecular weight among all 5-mers, there are 20 of the 8-mers. For these and larger oligonucleotides, these mass overlaps may have mass accuracy of about 1/10 ⁵ (about 10 parts per million, ppm) available with high resolution FTICR MS. For the 25-mer A ₅ T ₂₀ , the 20 degenerate compositions decrease with a measurement of ± 0.5 Da to three (A ₅ T ₂₀ , T ₄ C ₁₂ G ₉ , AT ₃ C ₄ G ₁₆ ), if with a Accuracy of 2 ppm is measured. Given the compositional limitations (e.g., the presence or absence of one of the four bases in the strand), these can be further reduced (see below).

instruments with medium resolution, including, but not exclusively Krumm-field reflectron instruments or time-of-flight MS instruments with delayed extraction may as well to improved DNA detection for sequencing or diagnostics to lead. These are each capable of detecting a 9 Da (Δm (A-T)) shift in ≥30 mer strands, for example, by primer oligo base extension (PROBE) or Competitive oligonucleotide single base extension (COSBE) sequencing were generated or for direct detection small amplified products.

Sequencing by generation specific ending fragments

A accurate sequence determination of a relatively large target nucleic acid can can be achieved by generating specific ending fragments of the target nucleic acid The mass of each fragment is determined by mass spectrometry and the fragments are ordered to determine the sequence of the larger target nucleic acid. The specific-ending fragments are partially base-specific terminated fragments.

One method of preparing base-specific terminated fragments involves the use of a base-specific ribonuclease, for example, after a transcription reaction. Preferred base specific ribonucleases are selected from: T ₁ ribonuclease (G specific), U ₂ ribonuclease (A specific), PhyM ribonuclease (U specific) and ribonuclease A (U / C specific). Other efficient and base specific ribonucleases can be identified using the assay described in Example 21. Preferably, modified nucleotides are added for transcription reaction with unmodified nucleotides. Most preferably, the modified nucleotides and unmodified nucleotides are added to the transcription reaction at appropriate concentrations such that both units are incorporated at a preferred rate of about 1: 1. Alternatively, two separate transcriptions of the target DNA sequence, one with the modified and one with the unmodified nucleotides, can be made and the results compared. Preferred modified nucleotides include: boron- or bromine-modified nucleotides (Porter et al., (1995) Biochemistry 34: 11963-1196 Hasan et al., (1996) Nucl. Acids Res. 24: 2150-2157; Li et al. 1995) Nucleic Acids Res. 23: 4495-4501), α-thio-modified nucleotides and mass-modified nucleotides as described above.

Yet another method for generating base-specific terminated fragments comprises contacting a suitable amount of the target nucleic acid with a specific endonuclease. Preferably, the original 5 and / or 3 'end of the nucleic acid is labeled to order the fragments to facilitate. Labeling of the 3 'end is particularly preferred when analyzing in vitro nucleic acid transcripts so that the impact of 3' heterogeneity, premature termination, and nonspecific extension can be minimized. 5 'and 3' tags may be natural (eg, a 3 'poly A tail or 5' or 3 'heterogeneity) or artificial. Preferred 5 'and / or 3' labels are selected from the molecules described above for the mass modification.

The Methods provided herein are exemplified by the following examples 21 and 27 further illustrate that not as in any way restrictive to be understood. The remaining Examples are for illustrative purposes only.

EXAMPLE 1

MALDI-TOF desorption of oligonucleotides directly on solid carriers

1 g CPG (Controlled Pore Glass) was functionalized with 3- (triethoxysilyl) epoxypropane to form OH groups on the polymer surface. A standard oligonucleotide synthesis with 13 mg of the OH-CPG was performed in a DNA synthesizer (Milligen, Model 7500), with β-cyanoethyl phosphoramidites (Köster et al. (1994) Nucleic Acids Res. 12: 4539) and TAC-N protecting groups (Köster et al. (1991) Tetrahedron 37: 362) were used to synthesize a 3'-T ₅ -50-mer oligonucleotide sequence in which 50 nucleotides are complementary to a "hypothetical" 50-mer sequence ₅ serves as a spacer Removal of the protecting group with saturated ammonia in methanol at room temperature for 2 hours provided CPG containing about 10 pmol 55-mer / g CPG as determined by the DMT group This 55-mer served as a template for hybridizations with a 26-mer (with 5'-DMT group) and a 40-mer (without DMT group) .The reaction volume is 100 μl and contains about 1 nmol of CPG-bound 55-mer as template, an equimolar amount of oligonucleotide in solution (26-mer or 40-mer) in 20 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ and 25 mM NaCl. The mixture was heated at 65 ° C for 10 minutes and annealed for 30 'at 37 ° C. The oligonucleotide, which had not hydrided to the polymer-bound template, was removed by centrifugation and three subsequent wash / spin steps with 100 μl each of ice-cold 50 mM ammonium citrate. The beads were air dried and mixed with matrix solution (3-hydroxypicolinic acid / 10 mM ammonium citrate in acetonitrile / water 1: 1) and analyzed by MALDI-TOF mass spectrometry. The results are in the 10 and 11 shown.

EXAMPLE 2

Electron Spray (ES) Desorption and Distinction an 18-meter and a 19-meter

DNA fragments at a concentration of 50 pmol / μl in 2-propanol / 10 mM ammonium carbonate (1/9 v / v) were simultaneously determined by means of an electron spray mass spectrometer analyzed.

The successful desorption and differentiation of an 18-mer and a 19-mer by electron spray mass spectrometry is in 12 shown.

EXAMPLE 3

Detection of the cystic fibrosis mutation ΔF508 by Egg dideoxy extension and analysis by MALDI-TOF mass spectrometry (Competitive Oligonucleotide Single Base Extension = COSBE)

The principle of the COSBE process is in 13 where N is the normal or M is the mutant detection primer.

MATERIALS and METHODS

PCR amplification and strand immobilization. The amplification was done with Exon10-specific primers using standard PCR conditions (30 cycles: 1 'at 95 ° C, 1' at 55 ° C, 2 'at 72 ° C); of the reverse primer was in 5 'with Biotin labeled and column purified (Oligopurification Cartridge, Cruachem). After amplification the amplified products were isolated by column separation (Qiagen Quickspin) purified and streptavidin-coated magnetic beads (Dynabeads, Dynal, Norway) according to their Standard protocol immobilized; DNA was prepared using Denatured 0.1 M NaOH and 0.1 M NaOH, 1 x B + W buffer and TE buffer washed to remove the non-biotinylated sense strand.

COSBE conditions. The beads containing the ligated antisense strand were resuspended in 18 μl reaction mix 1 (2 μl 10X Taq buffer, 1 μl (1 unit) Taq polymerase, 2 μl 2 mM dGTP and 13 μl H ₂ O) and incubated at 80 C. for 5 'before adding reaction mix 2 (100 ng of each of the COSBE primers). The temperature was reduced to 60 ° C and the mixtures were incubated for a hybridization / extension period of 5 '; the beads were then washed in 25 mM triethylammonium acetate (TEAA) followed by 50 mM ammonium citrate.

Primer sequences. All primers were prepared on a Perseptive Biosystems Expedite 8900 DNA Synthesizer using conventional phosphoramidite chemistry (Sinha et al. (1984) Nucleic Acids Res. 12 4539). The COSBE primers (each containing a deliberate mismatch one base before the 3'-terminus) were those used in a previous ARMS study (Ferrie et al., (1992) Am. J. Hum. Genet. 251-262), with the exception that two bases were removed from the 5 'end of the normal:

Mass spectrometry. After washing, the beads were resuspended in 1 μl 18 Mohm / cm H ₂ O. In each case 300 μl of the matrix (Wu et al., (1993), Rapid Commun. Mass Spectrom., 7: 142-146) solution (0.7 M 3-hydroxypicolinic acid, 0.7 M dibasic ammonium citrate in 1: 1 H ₂ O) / CH ₃ CN) and the resuspended beads (Tang et al., 1995, Rapid Commun. Mass Spectrom., 8: 727-730) were mixed on a sample target and allowed to air dry. Up to 20 samples were spotted onto a probe target placed in the source area of an unmodified Thermo Bioanalysis (formerly Finnigan) Vision 2000 MALDI-TOF operating in reflectron mode at 5 and 20 kV at the target and conversion dynodes, respectively , The theoretical average molecular weights (M _r (calc.)) Were calculated from the atomic compositions. Dealer-provided software was used to determine the peak area centers using external calibration; 1.08 Da were subtracted from this to correct for mass of the charge-carrying proton, with the text M _r (exp.) Values obtained.

Scheme. After attachment to the bound template, the N and M primers (8508.6 and 9148.0, respectively) were used Da) dGTP offered; only primers with proper Watson-Crick base pairing at the variable position (V) are extended by the polymerase. If So V with the 3'-terminal Base of N pairs, N is extended to a 8837.9 Da product (N + 1). As well then, if V fits properly to the M-terminus, M is set to a 9477.3 Da M + 1 product extended.

Results

The 14 - 18 show the representative mass spectra of COSBE reaction products. Better results were obtained when the amplified products were purified before the biotinylated antisense strand was bound.

EXAMPLE 4

Distinction of human Apolipoprotein E isoforms by mass spectrometry

apolipoprotein E (Apo E), a protein component of lipoproteins, plays one essential role in lipid metabolism. For example, it is am Cholesterol transport, on the metabolism of lipoprotein particles, to immunoregulation and activation of several lipolytic Enzymes involved.

There are three common isoforms of human apo E (encoded by the alleles E2, E3 and E4). The most common is the E3 allele. It has been shown that the E2 allele reduces plasma cholesterol and therefore may have a protective effect against the development of atherosclerosis. The DNA encoding a portion of the E2 allele is shown in SEQ ID NO: 130. Finally, the E4 isoform was elevated with Cholesterol levels, which leads to a predisposition to atherosclerosis. Therefore, the identity of the Apo E allele of a particular individual is an important risk determinant for the development of cardiovascular disease.

As in 19 For example, a sample of a DNA encoding apolipoprotein E can be obtained from a subject and amplified (e.g., by PCR); and the amplified product can be digested using a suitable enzyme (e.g., Cfol). The resulting restriction digest can then be analyzed by a variety of means. As in 20 As shown, the three isotypes of apolipoprotein E (E2, E3 and E4) have different nucleic acid sequences and therefore also have distinguishable molecular weight values.

As in 21A -C, different Apolipoprotein E genotypes show different restriction patterns in a 3.5% MetPhor agarose gel or a 12% polyacrylamide gel as in the 22 and 23 As shown, the different apolipoprotein E genotypes can also be accurately and rapidly determined by mass spectrometry.

EXAMPLE 5

Detection of hepatitis B virus in serum samples

MATERIALS AND METHODS

sample preparation

The Phenol / chloroform extraction of viral DNA and final ethanol precipitation were according to standard protocols carried out.

First PCR

Each reaction was carried out with 5 μl of the DNA preparation from serum. 15 pmol of each primer and 2 units of Taq DNA polymerase (Perkin Elmer, Weiterstadt, Germany) were used. The final concentration of each dNTP was 200 μMM, the final volume of the reaction was 50 μL. 10x PCR buffer (Perkin Elmer, Weiterstadt, Germany) contained 100mM Tris-HCl, pH 8.3, 500mM KCl, 15mM MgCl 2, 0.01% gelatin (w / v). Primer sequences:

Nested PCR:

Each reaction was carried out either with 1 μl of the first reaction or with a 1:10 dilution of the first PCR as template. 100 pmoles of each primer, 2.5 μ Pfu (exo) DNA polymerase (Stratagene, Heidelberg, Germany), a final concentration of 200 μM of each dNTP and 5 μl of 10 × Pfu buffer (200 mM Tris-HCl, pH 8, 75, 100 mM KCl, 100 mM (NH ₄ ) ₂ SO ₄ , 1% Triton X-100, 1 mg / ml BSA (Stratagene, Heidelberg, Germany) were used in a final volume of 50 μl Thermocycler (OmniGene, MWG-Biotech, Ebersberg, Germany) using the following program: 92 ° C for 1 minute, 60 ° C for 1 minute and 72 ° C for 1 minute with 20 cycles Sequence of the oligodeoxynucleotides (HPLC purified obtained from MWG-Biotech, Ebersberg, Germany):

Purification of amplified products:

To record each spectrum, a PCR, 50 μl, (performed as described above) was used. The purification was carried out according to the following procedure: Ultrafiltration was carried out using Ultraf ree MC filtration units (Millipore, Eschborn, Germany) according to the manufacturer's protocol with a centrifugation at 8000 rpm for 20 minutes. 25 μl (10 μg / μl) streptavidin-Dynabeads (Dynal, Hamburg, Germany) were prepared according to the manufacturer's instructions and dissolved in 25 μl B / W buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl). This suspension was added to the PCR samples still in the filtration unit and the mixture was incubated with gentle shaking for 15 minutes at ambient temperature. The suspension was transferred to a 1.5 ml Eppendorf tube and the supernatant was removed using a magnetic particle collector, MPC (Dynal, Hamburg, Germany). The beads were washed twice with 50 μl of 0.7 M ammonium citrate solution, pH 8.0 (the supernatant was removed each time using the MPC). The cleavage from the beads can be achieved using formamide at 90 ° C. The supernatant was dried in a Speedvac for about one hour and resuspended in 4 μl of ultrapure water (MilliQ UF plus, Millipore, Eschborn, Germany). This preparation was used for MALDI-TOF MS analysis.

MALDI-TOF MS:

One half microliter of the sample was pipetted into the sample holder, then immediately with 0.5 μl Matrix solution (0.7 M3 hydroxypicolinic, 50% acetonitrile, 70 mM ammonium citrate). This mixture was dried at ambient temperature and placed in the mass spectrometer introduced. All spectra were recorded in positive ion mode using a Finnigan MAT Vision 2000 (Finnigan MAT, Bremen, Germany) with a reflectron (5 keV ion source, 20 keV post-acceleration) and a 337 nm nitrogen laser. The calibration was carried out with a mixture of a 40-mer and a 100-mer. each Sample was measured with different laser energies. In the negative samples, the amplified product was neither lower even with higher ones Laser energies detected. In the positive samples, the amplified Product at different points of the sample point and also with demonstrated different laser energies.

RESULTS

One nested PCR system was used to detect HBV DNA in blood samples used, where oligonucleotides were used, the c-range of the HBV genome are complementary (primer 1: starting at map position 1763, primer 2 starting at the Map position 2032 of the complementary strand) containing the HBV nucleocapsid antigen (HBVcAg). The DNA was prepared from patient serum according to standard protocols isolated. An initial PCR was performed with the DNA from these preparations performed using a first set of primers. If HBV DNA was present in the sample, a DNA fragment of 269 bp educated.

In the second reaction, primers were used which were complementary to a region within the PCR fragment formed in the first PCR. When HBV-related amplified products were present in the first PCR, a 67 bp DNA fragment was generated in this nested PCR (see 25A ). The use of a nested PCR system for detection provides high sensitivity and also serves as a specificity control for external PCR (Rolfs et al (1992) PCR: Clinical Diagnostics and Research, Springer, Heidelberg). Another advantage is that the amount of fragments generated in the second PCR is large enough to ensure unproblematic detection, even if purification losses can not be avoided.

The Samples were assayed using ultrafiltration on residual reptavidin Dynabeads cleaned. This cleaning was done since the shorter ones Primer fragments for steric reasons in higher Measure the beads were immobilized. The immobilization became direct performed on the ultrafiltration membrane due to substance losses to avoid nonspecific absorption to the membrane. To immobilization, the beads were washed with ammonium citrate, to carry out a cation exchange (Pieles et al. Nucl. Acids Res. 21: 3191-3196). The immobilized DNA was purified using 25% ammonia cleaved off from the beads, resulting in the cleavage of the DNA from the beads within a very short time, but not for introduction of sodium or other cations.

The Nested PCRs and MALDI-TOF analysis were performed without to know the results of the serological analysis. Due to the unknown virus titer was used undiluted as each sample of the first PCR Template or in a 1:10 dilution used.

Sample 1 was taken from a patient with chronic active HBV infection who was positive in the Hbs and Hbe antigen tests but negative in a dot blot analysis. Sample 2 was a serum sample of a patient with active HBV infection and massive viremia who was HBV positive in a dot blot analysis. Sample 3 was a denatured serum sample, therefore no serological analysis could be performed, a confirmed elevated level of transaminases indicated liver disease. In an autoradiogram analysis ( 24 ), the first PCR of this sample was negative. Nevertheless, there was some evidence of HBV infection. This sample is of interest for MALDI-TOF analysis because it shows that even small amounts of amplified products can be detected after the purification process. Sample 4 was from a patient who had been cured of HBV infection. Samples 5 and 6 were taken from patients with chronic active HBV infection.

24 shows the results of a PAGE analysis of the nested PCR reaction. An amplified product can be clearly seen in Samples 1, 2, 3, 5 and 6. In sample 4 no amplified product was formed, in fact it is HBV negative according to the serological analysis. The negative and positive controls are labeled + and - respectively. Amplification artifacts are visible in lanes 2, 5, 6, and + when undiluted template was used. These artifacts were not formed when the template was used in a 1:10 dilution. In Sample 3, the amplified product was barely detectable when the template was not diluted. The results of the PAGE analysis are consistent with the data obtained by serological analysis, except Sample 3, as discussed above.

25A Figure 3 shows a mass spectrum of a nested amplified product of sample number 1 which was generated and purified as described above. The signal at 20754 Da represents the single-stranded amplified product (calculated: 20735 Da as the average mass of both strands of the amplified product cleaved from the beads). The mass difference of calculated and obtained mass is 19 Da (0.09%). As in 25A No. 1 showed a large amount of amplified product, resulting in unequivocal detection.

25B shows a spectrum obtained from sample number 3. As in 24 However, the amount of amplified product formed in this section is significantly less than that of Sample No. 1. Nevertheless, the amplified product is clearly detected with a mass of 20751 Da (calculated 20735). The mass difference is 16 Da (0.08%). This in 25C Spectrum shown was obtained from sample number 4, which is HBV negative (as also in 24 shown). As expected, no signals corresponding to the amplified product could be detected. Alone 25 samples were analyzed by MALDI-TOF-MS, with amplified product detected in all HBV-positive samples but not in the HBV-negative samples. These results were confirmed in several independent experiments.

EXAMPLE 6

Analysis of ligase chain reaction products by MALDI-TOF mass spectrometry

MATERIALS AND METHODS

oligodeoxynucleotides

With the exception of the biotinylated oligonucleotide, all other oligonucleotides were assayed on a 0.2 μmol scale on a MilliGen 7500 DNA Synthesizer (Millipore, Redford, MA, USA) using the β-cyanoethyl phosphoramidite method (Sinha, ND et al Nucleic Acids Res. 12: 4539-4577). The oligodeoxynucleotides were RP-HPLC purified and the protecting groups were removed according to standard protocols. The biotinylated oligodeoxynucleotide was obtained (HPLC purified) from Biometra, Göttingen, Germany. Sequences and calculated masses of the oligonucleotides used:

5'-phosphorylation oligonucleotides A and D

This was with polynucleotide kinase (Boehringer, Mannheim, Germany) according to published procedures carried out, the 5'-phosphorylated Oligonucleotides were used unpurified for the LCR.

ligase chain reaction

The LCR was performed with Pfu DNA ligase and a ligase chain reaction kit (Stratagene, Heidelberg, Germany) containing two different pBluescript-KII Phagemide contained. One carries the wild-type form of the E. coli lacI gene and the other a mutant this gene with a single point mutation at bp 191 of the lacI gene.

The The following LCR conditions were used for each reaction: 100 pg of template DNA (0.74 fmol) with 500 pg of ultrasound-treated Salmon sperm DNA as a carrier, 25 ng (3.3 pmol) of each 5'-phosphorylated Oligonucleotide, 20 ng (2.5 pmoles) of each non-phosphorylated Oligonucleotide, 4 U Pfu DNA ligase in a final volume of 20 μl, buffered ss-50-mer (1 fmole) was used as the template, in this case Oligo C also biotinylated. All reactions were in one Thermocycler (OnmiGene, MWG-Biotech, Ebersberg, Germany) with performed the following program: 4 minutes 92 ° C, 2 minutes 60 ° C and 25 cycles of 20 seconds 92 ° C, 40 seconds 60 ° C. Except for the HPLC analysis, the biotinylated Ligationseduct C was used. In a control experiment biotinylated and non-biotinylated Oligonucleotides the same gel electrophoresis results. The reactions were analyzed on 7.5% polyacrylamide gels. Ligation product 1 (oligo A and B) calculated mass: 15450 Da, ligation product 2 (oligo C and D) calculated mass: 15387 Da.

SMART-HPLC

Ion exchange HPLC (IE-HPLC) was on the SMART system (Pharmacia, Freiburg, Germany) using a Pharmacia MonoQ, PC 1.6 / 5 column. The Eluents were Buffer A (25 mM Tris-HCl, 1 mM EDTA and 0.3 M NaCl at pH 8.0) and Buffer B (as A but 1 M NaCl). Starting from 100% A for 5 minutes at a flow rate of 50 μl / min a gradient from 0 to 70% B was created within 30 minutes, then increased to 100% B in 2 minutes and held at 100% B for 5 minutes. Two combined LCR volumes (40 μl), carried out with either wild-type or mutant template were injected.

Sample preparation for MALDI-TOF MS

manufacturing of Immobilized DNA: Two were taken to record each spectrum LCRs (performed as described above) and 1: 1 with 2 x B / W buffer (10mM Tris-HCl, pH 7.5, 1mM EDTA, 2M NaCl). To the samples were 5 μl Streptavidin-DynaBeads (Dynal, Hamburg, Germany) added and you left that Mix with gentle shaking for 15 Bind minutes at ambient temperature. The supernatant was used of a magnetic particle collector, MPC, (Dynal, Hamburg, Germany) were removed, and the beads were washed twice with 50 μl of 0.7 M ammonium citrate solution (pH 8.0) (the supernatant was removed each time using the MPC). The pearls were in 1 μl Ultra-pure water (MilliQ, Millipore, Redford, Mabelow) resuspended.

combination of Ultrafiltration and Streptavidin DynaBeads: To Include the Spectrum were two LCRs (performed as described above) combined, 1: 1 with 2 × B / W buffer dilute and with a 5000 NMW Ultrafree MC filter unit (Millipore, Eschborn, Germany) according to the manufacturer's instructions. To After concentration, the samples were washed with 300 μl of 1 × B / W buffer, and streptavidin-DynaBeads were added. The beads were washed once in the Ultrafree MC filtration unit 300 μl of 1 × B / W buffer washed and further processed as described above. The Beads were in 30 to 50 μl 1 × B / W buffer resuspended and transferred to a 15 ml Eppendorf tube. The supernatant was removed, and the beads were washed twice with 50 μl Washed with 0.7 M ammonium citrate (pH 8.0). Eventually the beads became one with 30 μl Washed acetone and in 1 ul resuspended in ultrapure water. The ligation mixture was after immobilization on beads as described below for MALDITOF MS Analysis used.

MALDI-TOF MS

A suspension of streptavidin-coated magnetic beads with the immobilized DNA was added Pipette the sample holder, then mix immediately with 0.5 μl matrix solution (0.7 M 3-hydroxypicolinic acid in 50% acetonitrile, 70 mM ammonium citrate). This mixture was dried at ambient temperature and introduced into the mass spectrometer. All spectra were recorded in positive-ion mode using a Finnigan MAT Vision 2000 (Finnigan MAT, Bremen, Germany) equipped with a reflectron (5 keV ion source, 20 keV post-acceleration) and a nitrogen laser (337 nm). For the analysis of Pfu DNA ligase, 0.5 μl of the solution on the sample holder was mixed with 1 μl of the matrix solution and prepared as described above. For the analysis of unpurified LCRs, 1 μl of an LCR was mixed with 1 μl of matrix solution.

RESULTS

The E. coli lacI gene served as a simple model system to test the suitability of MALDI-TOF-MS as a detection method for products made in ligase chain reactions. This template system contains an E. coli lacI wild-type gene in a pBluescript KII phagemid and an E. coli lacI gene carrying a single point mutation at bp 191 (C-to-T transition; SEQ ID NO: 131 ) in the same phagemid. Four different oligonucleotides were used, which were only ligated if the E. coli lacI wild-type gene was present ( 26 ).

The LCR conditions were optimized using Pfu DNA ligase to obtain at least 1 pmol of ligation product in each positive reaction. The ligation reactions were analyzed by polyacrylamide gel electrophoresis (PAGE) and HPLC on the SMART system ( 27 . 28 and 29 ). 27 Figure 4 shows a PAGE of a positive LCR with wild-type template (lane 1), a negative LCR with mutant template (1 and 2) and a negative control containing enzyme, oligonucleotides and no template, but salmon sperm DNA. Gel electrophoresis clearly shows that the ligation product (50 bp) was produced only in the wild-type template reaction, whereas neither the template bearing the point mutation nor the control reaction with salmon sperm DNA produced amplification products. In 28 HPLC was used to analyze two pooled wild-type LCRs that were run under the same conditions. The ligation product was clearly detected. 29 Figure 3 shows the results of HPLC analysis of two pooled mutant template negative LCRs. These chromatograms confirm the in 27 In summary, the results clearly show that the system only produces ligation products in a significant amount when the wildtype template is provided.

suitable Control runs have been performed, to the retention times of different, at the LCR experiments determine the connections involved. These contain the four Oligonucleotides (A, B, C and D), a synthetic ds-50-mer (with the same Sequence as the ligation product), the wild type template DNA, sonicated Salmon sperm DNA and Pfu DNA ligase in ligation buffer.

In order to test which purification method should be used before an LCR reaction can be analyzed by MALDI-TOF-MS, aliquots of an unpurified LCR ( 30A ) and aliquots of the enzyme stock solution ( 30B ) analyzed by MALDI-TOF-MS. It has been found that a suitable sample preparation is absolutely necessary since all signals in the unpurified LCR correspond to signals obtained in the MALDI-TOF-MS analysis of Pfu DNA ligase. The calculated mass values of Oligos A and the ligation product are 7521 Da and 15450 Da, respectively. The data in 30 show that the enzyme solution leads to mass signals that interfere with the expected signals of the ligation factors and products and therefore make a clear signal assignment impossible. In addition, the spectra showed signals from the detergent Tween 20, which is part of the enzyme storage buffer and adversely affects the crystallization behavior of the analyte / matrix mixture.

In a purification format, streptavidin-coated magnetic beads were used. As shown in a recent publication, the direct desorption of DNA immobilized by Watson-Crick base pairing to a complementary DNA fragment covalently bound to the beads is possible, and only the non-biotinized strand is desorbed (Tang et al. 1995) Nucleic Acids Res. 23: 3126-3131). This approach of using immobilized ds DNA ensures that only the non-biotinylated strand is desorbed. When non-immobilized ds DNA is analyzed, both strands are desorbed (Tang et al., (1994) Rapid Comm. Mass Spectrom., 7, 183-186), resulting in broad signals that depend on the mass difference of the two single strands. Therefore, when using this system for LCR only the unligated oligonucleotide A with a calculated mass of 7521 Da and the ligation product of oligo A and oligo B (calculated mass: 15450 Da) are desorbed when oligo C is biotinylated at the 5 'end and immobilized on streptavidin-coated beads. This leads to a simple and two rock-free identification of LCR reactants and products.

31A Figure 4 shows a MALDI-TOF mass spectrum obtained from two pooled LCRs (performed as described above) purified on streptavidin DynaBeads and desorbed directly from the beads, and shows that the purification method used was efficient (compared to 30 ). A signal representing the unligated oligo A and a signal corresponding to the ligation product could be detected. The correspondence between the calculated and experimentally found mass values is remarkable, allowing for unambiguous peak assignment and accurate detection of the ligation product. In contrast, in the spectrum obtained from two pooled LCRs with mutant template, no ligation product but only oligo A is detected in the spectrum ( 31B ). The specificity and selectivity of the LCR conditions and the sensitivity of MALDI-TOF detection are further demonstrated when the ligation reaction is performed in the absence of a specific template. 32 Figure 16 shows a spectrum obtained from two pooled LCRs using only salmon sperm DNA as a negative control; As expected, only Oligo A could be detected.

While the in 31A shown results with lane 1 of the gel in 27 can be correlated, that is in 31B shown spectrum equivalent to lane 2 in 27 , and finally the spectrum in 32 the railway 3 in 27 , The results are consistent with that in the 28 and 29 shown HPLC analysis. During gel electrophoresis ( 27 ) and HPLC ( 28 and 29 ) show either an excess or an almost equal amount of ligation product in comparison to the ligation factors, analysis by MALDI-TOF mass spectrometry gives a lesser signal to the ligation product ( 31A ).

The lower intensity of the ligation product signal could be due to different desorption / ionization efficiencies of the 24- and 50-mer. Since the T _m value of a duplex with 50 compared to 24 base pairs is significantly higher, could be 24-mer desorbed more. A decrease in signal intensity may also result from a higher degree of fragmentation in the case of longer oligonucleotides.

Regardless of purification with streptavidin-DynaBeads, shows 32 Traces of Tween 20 in the range around 2000 Da. Viscous consistency substances negatively affect the crystallization process and may therefore be detrimental to mass spectrometric analysis. Tween 20 and also glycerin, which are part of enzyme storage buffers, should therefore be completely removed prior to mass spectrometric analysis. For this reason, an improved purification process was investigated that involves an additional ultrafiltration step prior to treatment with DynaBeads. In fact, this sample purification led to a significant improvement in the performance of MALDI-TOF mass spectrometry.

33 shows spectra obtained from two unified positive ( 33A ) or negative ( 33B ) LCRs were obtained. The positive reaction was performed with a chemically synthesized single-stranded 50-mer template, with a sequence equivalent to the ligation product of oligos C and D. Oligo C was 5'-biotinylated. Therefore, the template was not detected. As expected, only the ligation product of oligos A and B (calculated mass 15450 Da) could be desorbed from the immobilized and ligated oligos C and D. This newly generated DNA fragment is indicated by the mass signal at 15448 Da in 33A played. Compared to 32A This spectrum clearly demonstrates that this method of sample preparation produces signals with improved resolution and intensity.

EXAMPLE 7

Mutation detection by solid-phase oligo-base extension of a primer and analysis by MALDI-TOF mass spectrometry (primer oligo base extension = PROBE)

Summary

The solid-phase oligo-base extension technique detects point mutations and small deletions as well as small insertions in amplified DNA. The method relies on the extension of a detection primer which hybridizes next to a variable nucleotide position to an affinity-captured amplified template using a DNA polymerase, a mixture of three dNTPs and the one missing dideoxynucleotide. The resulting products are determined and resolved by MALDI-TOF mass spectrometry without further labeling procedures. The goal of the following experiment was the Be mood of mutant and wild-type alleles in a fast and reliable manner.

Description of the experiment

at a single detection primer was used followed by the procedure from an oligonucleotide extension step to obtain products which are in length to some, for Distinguish mutant or wild type allele specific bases and which can be easily resolved by MALDI-TOF mass spectrometry. The Method is exemplified using exon 10 of the CFTR gene described. The exon 10 of this gene carries in many ethnic Groups most prevalent mutation (ΔF508) in the homozygous state to the clinical phenotype which leads to cystic fibrosis.

MATERIALS AND METHODS

Genomic DNA

genomic DNA was from healthy individuals, individuals who homozygous or heterozygous for the ΔF508 mutation and from an individual heterozygous for the 1506S mutation was won. Wild type and mutant alleles were replaced by standard sanger Sequencing confirmed.

PCR amplification of exon 10 of the CFTR gene

The Primer for the PCR amplification was CFEx10-F (5'-GCAAGTGAATCCTGAGCGTG-3 '(SEQ ID NO: 13), located in intron 9 and biotinylated) and CFEx10-R (5'-GTGTGAAGGGCGTG-3 '(SEQ ID NO: 14), which was in intron 10). The primers were in one concentration used of 8 pmol. Tag polymerase including 10x buffer was purchased from Boehringer Mannheim, and dNTPs were obtained from Pharmacia. The total reaction volume was 50 μl. The cycle conditions for the PCR was initially at 95 ° C for 5 min followed by 94 ° C for 1 min, 45 sec at 53 ° C and 30 sec at 72 ° C for 40 Cycles with a final Extension time of 5 min at 72 ° C.

Purification of the amplified products

The Amplification products were generated using the PCR purification kit purified by Qiagen (No. 28106) according to the manufacturer's instructions. Elution of the purified products from the column was done in 50 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 7.5).

Affinity capture and denaturation the double-stranded one DNA

10 μl aliquots of the purified amplified product were placed in a well of a Streptavidin-coated microtiter plate (No. 1645684, Boehringer-Mannheim, or No. 95029262, Labsystems). Subsequently were 10 μl Incubation buffer (80 mM sodium phosphate, 400 mM NaCl, 0.4% Tween 20, pH 7.5) and 30 l of water. After incubation for 1 times at room temperature, the wells were washed three times with 200 μl wash buffer (40 mM Tris, 1mM EDTA, 50mM NaCl, 0.1% Tween 20, pH 8.8). To the double-stranded To denature DNA, the wells were incubated for 3 min with 100 μl of a 50 mM NaOH solution and the wells were washed three times with 200 μl wash buffer.

Oligo base extension reaction

The annealing of 25 pmol of the detection primer (CF508: 5'-CTATATTCATCATAGGAAACACCA-3 '(SEQ ID NO: 15) was carried out in 50 μl of hybridization buffer (20 mM Tris, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgSO ₄ , 1% Triton X-100, pH 8) at 50 ° C. for 10 min The wells were washed three times with 200 μl wash buffer and once in 200 μl TE buffer. Sequence kits from USB (# 70770) and from dNTPs or ddNTPs from Pharmacia, total reaction volume was 45 μl and contained 21 μl of water, 6 μl of Sequenase buffer, 3 μl of 10 mM DTT solution, 4.5 μl 0.5mM from three dNTPs, 4.5μl 2mM missing ddNTP, 5.5μl glycerol enzyme dilution buffer, 0.25μl Sequenase 2.0, and 0.25 pyrophosphatase The reaction was pipetted onto ice then added for 15 min Room temperature and incubated for 5 min at 37 ° C. Then the wells were washed three times with 200 μl washing buffer and once with 60 μl of a 70 mM NH ₄ Citrate solution washed.

Denaturation and precipitation of the prolonged primer

The extended primer was denatured in 50 μl of 10% DMSO (dimethyl sulfoxide) in water at 80 ° C for 10 min. For precipitation, 10 μl of NH ₄ acetate (pH 6.5), 0.5 μl of glycogen (10 mg / ml water, Sigma No. G1765) and 100 μl absolute ethanol were added to the supernatant and incubated for 1 hour at room temperature. After centrifugation at 13,000 g for 10 min, the sediment was washed in 70% ethanol and resuspended in 1 μl 18 Mohm / cm H ₂ O water.

Sample preparation and analysis with MALDI-TOF spectrometry

Samples were prepared by placing 0.3 μl each of the matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic ammonium citrate in 1: 1 H ₂ O / CH ₃ CN) and the resuspended DNA / glycogen sediment on a sample target mixed and allowed to air dry. Up to 20 samples were spotted on a probe target placed in the source area of an unmodified Thermo Bioanalysis (formerly Finnigan) Vision 2000 MALDI-TOF operating in reflectron mode at 5 and 20 kV at the target and conversion dynodes, respectively , The theoretical average molecular weights (M _r (calc.)) Were calculated from the atomic compositions; the reported experimental M _r values M _r (exp.) are those of the single protonated form determined using external calibration.

RESULTS

The The aim of the experiment was a fast and reliable one Develop procedures that are independent of the exact stringencies for the Mutation detection is and to high quality and high throughput in the Diagnosis of genetic diseases leads. Therefore, became a special one Type of DNA sequencing (Oligo-base extension of a mutation detection primer) with the determination of the obtained mini-sequencing products by matrix-assisted laser desorption ionization (MAIDI) mass spectrometry (MS) combined. The time-of-flight (TOF) reflectron assembly was called potential Mass measuring system selected. To prove this hypothesis, the study was done with exon 10 of the CFTR gene performed in some mutations to the clinical phenotype of cystic fibrosis, the most common monogenic disease in the Caucasian population.

The schematic representation, as in 34 , shows the expected short sequencing products with the theoretically calculated molecular mass of the wild-type and various mutations of exon 10 of the CFTR gene (SEQ ID NO: 132). The short sequencing products were generated using either ddTTP ( 34A ; SEQ ID NO: 133-135) or ddCTP ( 34B ; SEQ ID NO: 136-139) to introduce a definitive, sequence-related stop into the nascent DNA strand. The MALDI-TOF-MS spectra of healthy mutation-heterozygous individuals homozygous for the mutation are in 35 shown. All samples were confirmed by standard Sanger sequencing, which showed no discrepancy to the mass spectrometric analysis. The accuracy of the experimental measurements of the various molecular masses were within the range of minus 21.8 and plus 87.1 daltons (Da) in the expected range. In any case, this allows a definitive interpretation of the results. Another advantage of this approach is the unambiguous detection of the ΔI507 mutation. In the ddTTP reaction, the wild type allele would be detected, whereas in the ddCTP reaction the three base pair deletion would be revealed.

The described method is best for detecting single point mutations or micro lesions suitable for DNA. The careful Selecting the mutation detection primer opens the window for multiplexing and leads at a high throughput, including high quality at the genetic diagnosis, without affecting the comparable allele-specific Procedure necessary exact stringencies are required. by virtue of The uniqueness of the genetic information is the oligo-base extension a mutation detection primer for each disease gene or each polymorphic region applicable in the genome, such as a variable Number of tandem repeats (VNTR) or other single nucleotide polymorphisms (eg, apolipoprotein E gene), as also described herein.

EXAMPLE 8

proof of polymerase chain reaction products containing 7-deazapurine units, with matrix-based Laser desorption / ionization-time of flight (MALDI-TOF) mass spectrometry

MATERIALS AND METHODS

Nukleinsäreamplifikationen

The following oligodeoxynucleotide primers were either according to standard Phosphoramidite chemistry (Sinha, N.D., et al. (1983) Tetrahedron Let. Vol. 24 pp. 5843-5846; Sinha, N.D., et al. (1984) Nucleic Acids Res. Vol. 12 pp. 4539-4557) a MilliGen 7500 DNA synthesizer (Millipore, Redford, MA, USA) in 200 nmol scale or from MWG Biotech (Ebersberg, Germany, Primer 3) and Biometra (Goettingen, Germany, primers 6-7) based.

The 99-mer (SEQ ID NO: 141) and the 200-mer DNA strand (SEQ ID NO: 140; modified and unmodified) and the ribo and 7-deaza modified 100-mer were isolated from pRFc1 DNA (SEQ. ID. 10 ng, kindly provided by S. Feyerabend, University of Hamburg) in 100 μl reaction volume, which contains 10 mmol / l KCl, 10 mmol / l (NH ₄ ) 2SO ₄ , 20 mmol / l Tris-HCl (pH 8, 8), 2 mmol / l MgSO ₄ , (exo (-) Pseudococcus furiosus (Pfu) buffer, Pharmacia, Freiburg, Germany), 0.2 mmol / l of each dNTP (Pharmacia, Freiburg, Germany), 1 μmol / l each primer and 1 unit of exo (-) Pfu DNA polymerase (Stratagene, Heidelberg, Germany). Primers 1 and 2 were used for the 99-mer, primers 1 and 3 for the 200-mer, and primers 6 and 7 for the 100-mer. To obtain 7-deazapurine-modified nucleic acids, dATP and dGTP were replaced by 7-deaza-dATP and 7-deaza-dGTP during the PCR amplification. The reaction was carried out in a thermocycler (OmniGene, MWG-Biotech, Ebersberg, Germany) using the cycle: denaturation at 95 ° C for 1 mm, annealing at 51 ° C for 1 min, and extension at 72 ° C for 1 min. For all PCRs, the number of reaction cycles was 30. After the last cycle, the reaction was allowed to continue for a further 10 minutes at 72 ° C.

The 103-mer DNA strands (modified and unmodified, SEQ ID NO: 245) were prepared from M13mp18 RFI DNA (100 ng, Pharmacia, Freiburg, Germany) in 100 μl reaction volume amplified using primers 4 and 5, all others Concentrations unchanged remained. The reaction was performed using the cycle: denature at 95 ° C for 1 mm, Hybridize at 40 ° C for 1 min and extension at 72 ° C for 1 min carried out. After 30 cycles for which were unmodified or 40 cycles for the modified 103-mer the samples for a further 10 min at 72 ° C incubated.

Synthesis of 5 '- [ ³² -P] -labeled PCR primers

Primers 1 and 4 were labeled 5 '- [ ³² -P] using T4 polynucleotide kinase (Epicenter Technologies) and (γ- ³² P) ATP (BLU / NGG / 502A, Dupont, Germany) according to the manufacturer's protocols were used. The reactions were carried out by replacing 10% of primers 1 and 4 in the PCR under otherwise unchanged reaction conditions by the labeled primers. The amplified DNAs were separated by gel electrophoresis on a 10% polyacrylamide gel. The respective bands were excised and counted on a Packard TRI-CARS 460C liquid scintillation system (Packard, CT, USA).

Primer cleavage of the ribo-modified PCR product

The Amplified DNA was prepared using Ultrafree-MC filter units (30,000 NMWL), then it was dissolved in 100 μl of 0.2 M NaOH and for 25 minutes to 95 ° C heated. The solution was then acidified with HCl (1 mol / L) and continued for MALDI-TOF analysis cleaned, using ultrafree MC filter units (10,000 NMWL) as used below.

Purification of amplified products

All Samples were prepared using Ultrafree-MC units, 30,000 NMWL, (Millipore, Eschborn, Germany) according to the manufacturer's description cleaned and concentrated. After lyophilization, the amplified products in 5 μl (3 μl for the 200-mer) dissolved in ultrapure water. This analyte solution was directly for uses the MALDI-TOF measurements.

MALDI-TOF MS

Aliquots of 0.5 μl of the analyte solution and 0.5 μl of matrix solution (0.7 mol / l 3-HPA and 0.07 mol / l ammonium citrate in acetonitrile / water (1: 1, v / v)) were placed on a flat mixed metallic sample carrier. After drying at ambient temperature, the sample was placed in the mass spectrometer for analysis. The MALDI-TOF mass spectrometer used was a Finnigan MAT Vision 2000 (Finnigan MAT, Bremen, Germany). The spectra were recorded in positive-ion reflector mode with a 5 keV ion source and 20 keV post-acceleration. The instrument was equipped with a nitrogen laser (wavelength 337 nm). The system vacuum was 3-4 x 10 ^-8 hPa in the analyzer area and 1-4 x 10 ^-7 hPa in the source area. The spectra of the modified and unmodified DNA samples were obtained with the same relative laser power; external calibration was performed with a mixture of synthetic oligodeoxynucleotides (7-mer to 50-mer).

RESULTS AND DISCUSSION

Enzymatic synthesis of 7-deazapurine nucleotide-containing nucleic acids by PCR

• ¹ „s" und "a" beschreiben "Sense-" und "Antisense-" Stränge des doppelsträngigen Amplifikationsprodukts.
• ² gibt die relative Modifikation als Prozentsatz der 7-Deazapurin-modifizierten Nukleotide an der Gesamtmenge der Purin-Nukleotide an.

To demonstrate the applicability of MALDI-TOF MS for rapid gel-free analysis of short amplified products and to study the effect of 7-deazapurine modification of nucleic acids under MALDI-TOF conditions, two different primer-template systems were used to synthesize the DNA fragments used. The sequences are in the 36 and 37 shown. While two single strands of the 103-mer amplification product had nearly equal masses (Δm = 8 u), the two single strands of the 99-mer differed by 526 u. Considering that 7-deazapurine nucleotide building blocks for chemical DNA synthesis are about 160 times more expensive than regular nucleotide building blocks (product information, Glen Research Corporation, Sterling, VA) and that their use in standard β-cyano-phosphoramidite chemistry is not For example, if the product is simple (product information, Glen Research Corporation, Sterling, VA, Schneider et al., 1995, Nucl. Acids Res. 23: 1570), the cost of 7-deazapurine modified primers would be very high. Therefore, to improve the applicability and increase the scope of the procedure, all PCRs were performed using unmodified oligonucleotide primers which are available by default. Replacement of dATP and dGTP by c ⁷ -dATP and c ⁷ -dGTP in the polymerase chain reaction resulted in products containing approximately 80% 7-deazapurine modified nucleosides for the 99-mer and 103-mer and about 90% for the 200- contained. Table II shows the base composition of all PCR products. Table II Base Composition of 99-mer, 103-mer and 200-mer PCR Amplification Product (unmodified and 7-deazapurine-modified) DNA fragments ¹ C T A G c ⁷ -Deaza-A c ⁷ -Deaza-6 rel. Mod.2 200-mer s 54 34 56 56 modified 200-mer s 54 34 6 5 50 51 90% 200-mer a 56 56 34 54 modified 200-mer a 56 56 3 4 31 50 92% 103-mer s 28 23 24 28 modified 103-mer s 28 23 6 5 18 23 79% 103-mer a 28 24 23 28 modified 103-mer a 28 24 7 4 16 24 78% 99-mer s 34 21 24 20 modified 99-mer s 34 21 6 5 18 15 75% 99-mer a 20 24 21 34 modified 99-mer a 20 24 3 4 18 30 87%

• ¹ "s" and "a" describe "sense" and "antisense" strands of the double-stranded amplification product.
• Figure ² indicates the relative modification as a percentage of the 7-deazapurine-modified nucleotides to the total amount of purine nucleotides.

It remained to be determined whether an 80-90% 7-deazapurine modification was sufficient for accurate mass spectrometric detection. Therefore, it was important to determine if all purine nucleotides could be replaced during the enzymatic amplification step. This was not trivial since it had been shown that c ⁷ -dATP can not fully replace dATP in PCR if Taq DNA polymerase is employed (Seela, F. and A. Roelling (1992), Nucleic Acids Res. 20 , 55-61). Fortunately, it was found that exo (-) - Pfu DNA polymerase could indeed accept c ⁷ -dATP and c ⁷ -dGTP in the absence of unmodified purine nucleoside triphosphates. The incorporation was less efficient, resulting in a lower amplification product yield ( 38 ).

To confirm these results, the amplifications were repeated with [ ³² P] -labeled primers. The autoradiogram ( 39 ) shows significantly lower yields for the modified PCR products. The bands were cut from the gel and counted. For all amplification products, the yield of the modified nucleic acids was about 50%, based on the corresponding unmodified amplification product. Further experiments showed that also exo (-) DeepVent and Vent DNA polymerase were able to incorporate c ⁷ -dATP and c ⁷ -dGTP during the PCR. However, it was found that overall performance was best for the exo (-) Pfu DNA polymerase, which gave the fewest byproducts during amplification. Using all three polymerases, it was found that those PCRs employing c ⁷ -dATP and c ⁷ -dGTP in place of their isosteres showed fewer side reactions and gave a cleaner PCR product. The reduced incidence of amplification byproducts can be explained by the reduction of primer mismatches due to a Ling template synthesized during the PCR. For DNA duplexes containing 7-deazapurine, a lower melting point has been described (Mizusawa, S., et al. (1986), Nucleic Acids Res. 14 1319-1324). In addition to the three polymerases described above (exo (-) DeepVent DNA polymerase, 5Vent DNA polymerase, and exo (-) Pfu DNA polymerase), it is believed that other polymerases, such as the large Klenow fragment E. coli DNA polymerase, Sequenase, Taq DNA polymerase and U AmpliTaq DNA polymerase. If RNA is the template, then RNA polymerases such as SP6 or T7 RNA polymerase must also be used.

MALDI-TOF mass spectrometry of modified and unmodified amplification products

The 99-mer, 103-mer and 200-mer amplification products were analyzed by MALDI-TOF-MS analy Siert. Based on previous experiments, it has been known that the degree of depurination depends on the laser energy used for the desorption and ionization of the analyte. Since the effect of 7-deazapurine modification on fragmentation due to depurination should be investigated, all spectra were measured at the same relative laser energy.

The 40a and 40b show the mass spectra of the modified and unmodified 103-mer nucleic acids. In the case of the modified 103-mer fragmentation causes a broad (M + H) ⁺ signal. The maximum of the peak is shifted to lower masses so that the assigned mass is more representative of an average of the (M + H) ⁺ signal and the signals of fragmented ions than the (M + H) ⁺ signal itself. Although the modified 103-mer still contains about 20% A and G from the oligonucleotide primers, it shows less fragmentation, which is characterized by much narrower and more symmetrical signals. In particular, the leakage of the lower mass side peaks due to depurination is significantly reduced. Therefore, the difference between the measured and the calculated mass is greatly reduced although it is still below the expected mass. For the unmodified sample, a (M + H) ⁺ signal of 31670 was observed, representing a difference of 97μ or 0.3% to the calculated mass. In the case of the modified sample, on the other hand, this mass difference decreased to 10 μ or 0.03% (31,713 μ found, 31,723 μ calculated). These observations are confirmed by a significant increase in the mass resolution of the (M + H) ⁺ signal of the two signal strands (n / Δm = 67, as opposed to 18 for the unmodified sample, with Δm = full width at half maximum, fwhm). Due to the small mass difference between the two single strands (8 u) their individual signals were not resolved.

With the results of the 99 base pair DNA fragments, the effects of increased mass dissolution for 7-deazapurine-containing DNA become even more pronounced. The two single strands in the unmodified sample were not resolved, although the mass difference between the two strands of the 526 u amplification product was very high due to unequal distribution of purines and pyrimidines ( 41a ). In contrast, the modified DNA showed distinct peaks for the two single strands ( 41b ), which shows even more clearly the superiority of this approach of determining molecular weights over gel electrophoretic methods. Although no baseline resolution was obtained, the individual masses could be assigned with an accuracy of 0.1%: Δm = 27 u for the lighter (over mass 30224 u) and Δm = 14 u for the heavier strand (over mass = 30750 u). Again, it was found that the full width at half maximum was substantially reduced for the 7-deazapurine-containing sample.

In the case of the 99-mer and the 103-mer, the 7-deazapurine-containing nucleic acids appear to give higher sensitivity although they still contain about 20% unmodified purine nucleotides. In order to obtain a comparable signal-to-noise ratio at similar intensities for the (M + H) ⁺ signals, the unmodified 99-mer required 20 laser bursts, as opposed to 12 laser bursts for the modified and 103-mer Twelve strokes were required for the unmodified probe, as opposed to three bursts for the 7-deazapurine nucleoside-containing amplification product.

Comparing the spectra of the modified and the unmodified 200-mer amplicon, an improved mass resolution for the 7-deazapurine-containing sample as well as improved signal intensities was again found ( 42A and 42B ). While the signal of the single strands predominates in the spectrum of the modified sample, the DNA double strand and dimers of the single strands gave the strongest signal for the unmodified sample.

Complete 7-deazapurine modification of nucleic acids can be achieved either by using modified primers in the PCR or by cleaving the unmodified primers from the partially modified amplification product. Since there are disadvantages associated with modified primers as described above, a 100-mer was synthesized using primers with a ribo-modification. The primers were cleaved hydrolytically with NaOH according to a procedure previously developed in our laboratory (Koester, H., et al., Z. Physiol. Chem., 359, 1570-1589). The 43A and 43B show the spectra of the amplified product before and after primer cleavage. 43b shows that the hydrolysis was successful: The hydrolyzed amplification product as well as the two liberated primers could be detected along with a small signal of residual uncleaved 100-mer. This approach is particularly useful for MALDI-TOF analysis of very short PCR products because the proportion of unmodified purines derived from the primer increases with decreasing length of the amplified sequence.

The remarkable properties of 7-deazapurine-modified nucleic acids can be achieved either by more effective desorption and / or ionization, by increased ion stability and / or by a lower denaturation energy of the double-stranded purine-modified nucleic acid can be explained. Replacement of the N-7 with a methyl group results in loss of an acceptor for hydrogen bonding, thereby affecting the ability of the nucleic acid to form secondary structures due to non-Watson-Crick base pairing (Seela, F., and A. Kehne (1987 ), Biochemistry 26, 2232-2238). In addition, the aromatic system of 7-deazapurine has a lower electron density, which weakens Watson-Crick base pairing, resulting in a reduced melting point of the duplex (Mizusawa, S. et al. (1986), Nucleic Acids Res. 14, 1319- 1324). This effect can reduce the energy needed to denature the duplex in the MALDI process. These aspects, as well as the loss of a site presumably carrying a positive charge on the N-7 nitrogen atom, render the 7-deazapurine modified nucleic acid less polar and can improve the desorption efficiency.

by virtue of the absence of N-7 as the proton acceptor and the lower one Polarization of the C-N bond in 7-deazapurine nucleosides becomes the Depurination according to the the hydrolysis in solution prevented established mechanisms. Although a direct correlation of reactions in solution and is problematic in the gas phase, is due to depurination the modified nucleic acids to expect a reduced fragmentation in the MALDI method. Depurination can either be accompanied by a loss of charge which reduces the overall yield of charged species will or can charged fragmentation products are generated, reducing the intensity of the signal for the unfragmented molecular ion is reduced.

The observation of increased sensitivity and reduced peak leakage of the (M + H) ⁺ signals on the lower mass side due to reduced fragmentation of the 7-deazapurine-containing samples indicates that the N-7 atom is indeed responsible for the mechanism of depurination essential in the MALDI-TOF process. Thus, 7-deazapurine-containing nucleic acids show markedly enhanced ion stability and sensitivity under MALDI-TOF conditions and therefore provide higher mass accuracy and mass resolution.

EXAMPLE 9

Solid phase sequencing and mass spectrometry proof

MATERIALS AND METHODS

Oligonucleotides were purchased from Operon Technologies (Alameda, CA) in unpurified form. The sequencing reactions were performed on a solid surface using sequencing kit reagents for Sequenase Version 2.0 (Amersham, Arlington Heights, Illinois). Sequencing of a 39-mer Target Sequencing Complex:

Around To perform the solid-phase DNA sequencing, the template strand DNA 11683 was replaced by terminal Deoxynucleotidyl transferase 3'-biotinylated. A 30 μl reaction, the 60th pmol DNA11683, 1.3 nmol biotin-14-dATP (GIBCO BRL, Grand Island, NY), 30 units Terminal Transferase (Amersham, Arlington Heights, Illinois) and 1X reaction buffer (relative to the enzyme) was incubated at 37 ° C for 1 hour. The reaction was by heat inactivation of the terminal transferase at 70 ° C for 10 min completed. The resulting product was passed through a TE-10 centrifugation column (Clontech) desalted. More than one molecule of biotin-14-dATP could to the 3'-end of the DNA116S3 added become. The biotinylated DNA11683 was probed with 0.3 mg Dynal streptvidin beads in 30 μl 1 × binding and wash buffer incubated at ambient temperature for 30 min. The pearls were washed twice with TE and dissolved in 30 μl TE, a 10 μl aliquot (containing 0.1 mg beads) was for Sequencing reactions used.

The 0.1 mg beads from the previous step were resuspended in a volume of 10 μl containing 2 μl of 5 × Sequenase buffer (200 mM Tris-HCl, pH 7.5, 100 mM MgCl ₂ and 250 mM NaCl) from the Sequenasekit and 5 pmol of the corresponding primer PNA 16 / DNA contained. The addition mixture was on Heated to 70 ° C and then allowed to cool slowly to room temperature over a period of 20-30 min. Then 1 μl of 0.1 M dithiothreitol solution, 1 μl of Mn buffer (0.15 M sodium isocitrate and 0.1 M MgCl ₂ ) and 2 μl of diluted Sequenase (3.25 units) were added. The reaction mixture was divided into four 3 μl aliquots and mixed with the termination mixtures (each containing 3 μl of the appropriate termination mixture: 32 μM c7-dATP, 32 μM dCTP, 32 μl of c7-dGTP, 32 μM dTTP and 3.2 μM one the four ddTNPs in 50 mM NaCl). The reaction mixtures were incubated for 2 min at 37 ° C. After completion of the extension, the beads were precipitated and the supernatant was removed. The beads were washed twice, resuspended in TE and left at 4 ° C. Sequencing of a 78-mer Target Sequencing Complex:

The target TNR · PLASM2 was biotinylated and sequenced using similar procedures as described in the previous section (sequencing a 39-mer target). Sequencing of a 15-mer target with partial duplex probe Sequencing Complex:

CM1B3B was immobilized on Dynabeads M280 with streptavidin (Dynal, Norway), adding 60 pmol of CM1B3B with 0.3 magnetic beads in 30 μl of 1 M NaCl and TE (1 × binding and washing buffer) were incubated at room temperature for 30 minutes.

The Beads were washed twice with TE and dissolved in 30 μl TE 10 or 20 μl aliquot (containing 0.1 or 0.2 mg beads) was used for sequencing reactions used.

The duplex was prepared by annealing a corresponding aliquot of beads from the previous step with 10 pmol DF11a5F (or 20 pmol DF11a5F for 0.2 mg beads) in a volume of 9 μl containing 2 μl of 5x Sequenase buffer (200 mM Tris -HCl, pH 7.5, 100 mM MgCl ₂ and 250 mM NaCl) from the sequenase kit. The addition mixture was heated to 65 ° C and allowed to cool slowly to 37 ° C over a period of 20-30 minutes. The duplex primer was then mixed with 10 pmol TS10 (20 pmol TS10 for 0.2 mg beads) in a volume of 1 μl, and the resulting mixture was further incubated at 37 ° C for 5 min, at room temperature for 5-10 min. Then, 1 μl of 0.1 M dithiothreitol solution, 1 μl of Mn buffer (0.15 M sodium isocitrate and 0.1 M MnCl ₂ ) and 2 μl of diluted Sequenase (3.25 units) were added. The reaction mixture was divided into four aliquots each containing 3 μl and the termination mixtures (each containing 4 μl of the appropriate termination mixture: 16 μM dATP, 16 μM dCTP, 16 μM dGTP 16 μM dTTP and 1.6 μM of one of the four ddNTPs in 50 mM NaCl). The reaction mixtures were incubated at room temperature for 5 minutes and at 37 ° C. for 5 minutes. After completion of the extension, the beads were precipitated and the supernatant was removed. The beads were resuspended in 20 μl of TE and stored at 4 ° C. A 2 μl aliquot (of 20 μl) was removed from each tube and mixed with 8 μl of formamide, the resulting samples were denatured at 90-95 ° C for 5 min, and 2 μl (out of a total of 10 μl) were assayed for ALF DNA Sequencer (Pharmacia, Piscataway, NJ) using a 10% polyacrylamide gel with 7M urea and 0.6X TBE. The remaining aliquot was used for MALDI-TOF-MS analysis.

MALDI sample preparation and instruments

Prior to MALDI analysis, the magnetic beads loaded with the sequencing ladder were washed twice using 50 mM ammonium citrate and resuspended in 0.5 μl of pure water. The Suspen The sample was then loaded onto the sample target of the mass spectrometer and 0.5 μl of saturated matrix solution (3-hydroxypicolinic acid (HPA): ammonium citrate 10: 1 molar ratio in 50% acetonitrile) was added. The mixture was allowed to dry before the mass spectrometric analysis.

The Reflectron TOF MS mass spectrometer (Vision 2000, Finnigan MAT, Bremen, Germany) was for used the analysis. 5 kV were applied to the ion source, and 20 kV were for the post-acceleration applied. All spectra were in positive-ion mode recorded, and a nitrogen laser was used. Usually every spectrum was over averaged over 100 shocks, and a standard 25-point smoothing was used.

RESULTS AND DISCUSSION

conventional Solid phase sequencing

at usual Sequencing method, a primer is hybridized directly to the template and then extended and terminated in a Sanger dideoxy sequencing. Usually a biotinylated primer is used, and the sequencing ladders are captured by streptavidin-coated magnetic beads. After this The products are washed using EDTA and formamide eluted from the beads. earlier Findings indicated that only the attached strand of the double strand is desorbed and that the immobilized strand on the beads remains. Therefore, it is advantageous to immobilize the template and to extend the primer. After the sequencing reaction and washing, the beads can be immobilized Template and the hybridized sequencing ladder directly to the mass spectrometer target loaded and mixed with matrix. At the MALDI only the annealed sequencing ladder desorbs and ionizes, and the immobilized Die remains on the target.

TABELLE III (Fortsetzung) A-Reaktion C-Reaktion G-Reaktion T-Reaktion 1. 2. 4223.8 4223.8 4223.8 4223.8 3. 4521.1 4. 4809.2 5. 5133.4 6. 5434.6 7. 5737.8 8. 6051.1 _{9 .} 6379.2 10. 6704.4 11. 6995.6 12. 7284.8 13. 7574.0 14. 7878.2 15. 8207.4 16. 8495.6 17. 8808.8 18. 9097.0 19. 9386.2 20. 9699.4 21. 10027.6 22. 10355.8 23. 10644.0 24. 10933.2 25. 11246.4 26. 11574.6 27. 11886.8 A 39-mer template (SEQ ID NO: 23) was first biotinylated at the 3 'end by adding biotin-14-dATP with terminal transferase. More than one biotin-14-dATP molecule could be added by the enzyme. Since the template was immobilized and remained on the beads during MALDI, the mass spectra are not affected by the number of biotin-14-dATP. A 14-mer primer (SEQ ID NO: 24) was used for solid-phase sequencing to generate the following DNA fragments 3-27 (SEQ ID NO: 142-166). The MALDI-TOF mass spectra of the four sequencing ladders are in 44 and the expected theoretical values are shown in Table III. TABLE III

TABLE III (continued) A reaction C-reaction G-Reaction T reaction 1. Second 4223.8 4223.8 4223.8 4223.8 Third 4521.1 4th 4809.2 5th 5133.4 6th 5434.6 7th 5737.8 8th. 6051.1 _{9 .} 6379.2 10th 6704.4 11th 6995.6 12th 7284.8 13th 7574.0 14th 7878.2 15th 8207.4 16th 8495.6 17th 8808.8 18th 9097.0 19th 9386.2 20th 9699.4 21st 10027.6 22nd 10355.8 23rd 10644.0 24th 10933.2 25th 11246.4 26th 11574.6 27th 11886.8

The Sequencing reaction resulted to a relatively homogeneous ladder, and the full-length sequence was easily determined. A peak around 5150 appeared in all reactions and was not identified. One possible explanation is that a small proportion of the matrix is a kind of secondary structure formed, such as a loop, which hindered the sequenase extension. The false figure is of little importance, since the intensity of these peaks was much lower than that of the sequencing ladders. Although in the Sequencing reaction 7-deazapurines were used, which are the N-glycosidic Stabilizing binding and could prevent depurination were Nevertheless, small base losses observed because the primer is not through 7-Deazapurine was substituted. The full-length conductor with ddA at the 3'-end appeared in the A reaction with an apparent mass of 11899.8. A more intense Peak at 12333 appeared in all four reactions and is likely to the addition of a additional Nucleotides due to the Sequenase enzyme.

TABELLE IV (Fortsetzung) ddATP ddCTP ddGTP ddTTP 1. 5491.6 5491.6 5491.6 5491.6 2. 5764.8 3. 6078.0 4. 6407.2 5. 6696.4 6. 7009.6 7. 7338.8 8. 7628.0 9. 7941.2 10. 8270.4 11. 8559.6 12. 8872.8 13. 9202.0 14. 9491.2 15. 9804.4 16. 10133.6 17. 10422.88 18. 10736.0 19. 11065.2 20. 11354.4 21. 11667.6 22. 11996.8 23. 12286.0 24. 12599.2 25. 12928.4 26. 13232.6 27. 13521.8 28. 13835.0 29. 14124.2 30. 14453.4 31. 14742.6 32. 15046.8 33. 15360.0 34. 15673.2 35. 15962.4 36. 16251.6 37. 16580.8 38. 16894.0 39. 17207.2 40. 17511.4 41. 17800.6 42. 18189.8 43. 18379.0 44. 18683.2 45. 19012.4 46. 19341.6 47. 19645.8 48. 19935.0 49. 20248.2 50. 20577.4 51. 20890.6 52. 21194.4 53. 21484.0 54. 21788.2 55. 22092.4 The same technique could be used to sequence longer DNA fragments. A 78-mer template containing a CTG repeat (SEQ ID NO: 25) was 3'-biotinylated by adding biotin-14-dATP with terminal transferase. An 18-mer primer (SEQ ID NO: 26) was hybridized just outside the CTG repeat so that the repeat could be sequenced immediately after primer extension. The four reactions were washed and analyzed as usual by MALDI-TOF-MS. An example of the G reaction is in 45 (SEQ ID NO: 167-220), and the expected sequencing ladder is shown in Table IV with the theoretical mass values for each conductor component. All sequencing peaks were well resolved, except for the last component, (theoretic value 20577.4) which was not from the background could be different. Two adjacent sequencing peaks (one 62-mer and one 63-mer) were also separated, suggesting that this sequencing analysis could be applied to longer templates. Again, in this spectrum, the addition of an additional nucleotide by the Sequenase enzyme was observed. This addition is not template-specific and appeared in all four reactions, making it easy to identify. Compared with the primer peaks, the sequencing peaks were at a much lower intensity in the case of the long template. TABLE IV

TABLE IV (continued) ddATP ddCTP ddGTP ddTTP 1. 5491.6 5491.6 5491.6 5491.6 Second 5764.8 Third 6078.0 4th 6407.2 5th 6696.4 6th 7009.6 7th 7338.8 8th. 7628.0 9th 7941.2 10th 8270.4 11th 8559.6 12th 8872.8 13th 9202.0 14th 9491.2 15th 9804.4 16th 10133.6 17th 10422.88 18th 10736.0 19th 11065.2 20th 11354.4 21st 11667.6 22nd 11996.8 23rd 12286.0 24th 12599.2 25th 12928.4 26th 13232.6 27th 13521.8 28th 13835.0 29th 14124.2 30th 14453.4 31st 14742.6 32nd 15046.8 33rd 15360.0 34th 15673.2 35th 15962.4 36th 16251.6 37th 16580.8 38th 16894.0 39th 17207.2 40th 17511.4 41st 17800.6 42nd 18189.8 43rd 18379.0 44th 18683.2 45th 19012.4 46th 19341.6 47th 19645.8 48th 19935.0 49th 20248.2 50th 20577.4 51st 20890.6 52nd 21194.4 53rd 21484.0 54th 21788.2 55th 22092.4

Sequencing using of duplex DNA probes for capture and priming

Single-stranded overhang duplex DNA probes have been shown to capture specific DNA templates and also serve as primers for solid-phase sequencing. The scheme is in 46 shown.

Stacking interactions between a duplex probe and a single-stranded template allow only a 5'-overhang for capture to be sufficient. Based on this format, a 5'-fluorescently labeled 23-mer (5'-GAT GAT CCG ACG CATACC AGC TC-3 ') (SEQ ID NO: 29) was ligated to a 3'-biotinylated 18-mer (5'-GTG ATG CGT CGG ATC ATC-3 ') (SEQ ID NO: 30) hybridized leaving a 5 base overhang. A 15-mer template (5'-TCG GTT CCA AGA GCT-3 ') (SEQ ID NO: 31) was captured by the duplex and sequencing reactions were performed by extension of the 5-base overhang. The MALDI-TOF mass spectra of the reactions are in 47A -D shown. All sequencing peaks were resolved, albeit at relatively low intensities. The last peak in each reaction is due to nonspecific addition of a nucleotide to the full-length extension product by the Sequenase enzyme. For comparison, the same products were applied to a conventional DNA sequencer, and the stacking fluorogram of the results is in 48 shown. As can be seen from the figure, the mass spectra had the same pattern as the fluorogram, with the sequencing peaks at much lower intensities compared to the 23-mer primer.

EXAMPLE 10

Thermo Sequenase cycle sequencing

MATERIALS AND METHODS

PCR amplification. Human leukocyte genomic DNA was used for PCR amplification. The PCR primers for amplification of a 209 bp fragment of the β-globin gene were the β2 forward primer (5'-CAT TTG CTT CTG ACA CAA CTG-3 ', SEQ ID NO: 32) and the β11- Reverse primer (5'-CTT CTC TGT CTC CAC ATG C-3 ', SEQ ID NO: 33). Taq polymerase and 10x buffer were purchased from Boehringer Mannheim (Germany) and dNTPs from Pharmacia (Freiburg, Germany). The total reaction volume was 50 μl, including 8 pmol of each primer with approximately 200 ng of genomic DNA used as template and a final dNTP concentration of 200 μM. PCR conditions were: 5 min at 94 ° C, followed by 40 cycles of 30 sec at 94 ° C, 45 sec at 53 ° C, 30 sec at 72 ° C and a final extension time of 2 min at 72 ° C. The generated amplification product was purified and concentrated (2x) with the Qiagen "Qiaquick" PCR purification kit (# 28106) and stored in H ₂ O.

Cycle sequencing. Sequencing ladders were prepared by primer extension with ThermoSequenase ^™ DNA polymerase (Amersham LIFE Science, # E79000Y) under the following conditions: 7 pmol HPLC-purified primer (Cod5 12-mer: 5'-TGC ACC TGA CTC-3 ', SEQ ID No. 34) were added to 6 μl of the purified and concentrated amplification product (ie 12 μl of the original amplification product), 2.5 units of Thermo Sequenase and 2.5 ml of Thermo Sequenase reaction buffer in a total volume of 25 μl. Final nucleotide concentrations were 30 μM of the corresponding ddNTP (ddATP, ddCTP, ddGTP or ddTTP, Pharmacia Biotech, # 27-2045-01) and 210 μM of each dNTP (7-deaza-dATP, dCTP, 7-deaza-GTP, dTTP Pharmacia Biotech).

Cycle conditions were: denature for 4 min at 94 ° C followed by 35 cycles of 30 sec 94 ° C, 30 sec at 38 ° C, 30 sec at 55 ° C and a final extension of 2 min at 72 ° C.

Sample preparation and analysis by MALDI-TOF MS. After completion of the cycle program, the reaction volume was increased to 50 μl by addition of 25 μl H ₂ O. Desalting was achieved by shaking 30 μl of ammonium-saturated DOWEX (Fluka # 44485) cation exchange bead with 50 μl of the analyte for 2 min at room temperature. The protonated Dowex beads were pretreated with 2M NH ₄ OH to convert to ammonium form, then washed with H ₂ O until the supernatant was neutral, and finally added to 10 mM ammonium citrate for use. After cation exchange, the DNA was purified by ethanol precipitation and concentrated by adding 5 μl 3 M ammonium acetate (pH 6.5), 0.5 μl glycogen (10 mg / ml, Sigma) and 110 μl absolute ethanol to the analyte and 1 hour was incubated at room temperature. After centrifugation at 20,000 × g for 12 minutes, the sediment was washed in 70% ethanol and resuspended in 1 μl of 18 MOhm / cm H ₂ O water.

For MALDI-TOF-MS analysis, 0.35 μl of the resuspended DNA was mixed with 0.35-1.3 μl of matrix solution (0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) on a stainless steel sample target and allowed to dry before running the spectrum using a reflectron mode Thermo Bioanalysis Vision 2000-MALDI-TOF at 5 and 20 kV at the target and conversion dynode, respectively has been recorded. The external calibration formed from eight peaks (3000-18000 Da) was used for all spectra.

RESULTS

49 Figure 3 shows a MALDI-TOF mass spectrum of the sequencing ladder generated from a biological amplification product as template and a 12-mer (5'-TGC ACC TGA CTC-3 ', SEQ ID NO: 34) sequencing primer. The peaks due to depurinations and those not related to the sequence are marked with an asterisk. The MALDI-TOF MS measurements were taken on a reflectron TOF MS. A.) sequencing ladder stopped with ddATP; B.) sequencing ladder stopped with ddCTP; C.) sequencing ladder stopped with ddGTP; D.) Sequencer stopped with ddTTP. 50 shows a schematic representation of the in 49 prepared sequencing ladder with the corresponding calculated molecular masses up to 40 bases after the primer (SEQ ID Nos. 221-260). The following masses were used for the calculation: 3581.4 Da for the primer, 312.2 Da for 7-deaza-dATP, 304.2 Da for dTTP, 289.2 Da for dCTP and 328.2 Da for 7-Deaza dGTP.

51 Figure 4 shows the sequence of the amplified 209 bp amplification product in the β-globin gene (SEQ ID NO: 261) used as a template for sequencing. The sequences of the corresponding amplification primer and the location of the 12-mer sequencing primer are also shown. This sequence represents a homozygous mutant at position 4 bases behind the primer. In the wild-type sequence, this T would be replaced by an A.

EXAMPLE 11

Microsatellite analysis using of primer oligo base extension (PROBE) and MALDI-TOF mass spectrometry

SUMMARY

The Method uses a single detection primer followed by an oligonucleotide extension step to obtain products which are in their length to differentiate a number of bases specific to the number of repeat units or for secondary site mutations within of the repeated range, easily by MALDI-TOF mass spectrometry disbanded can be. The method is performed using the AluVpA polymorphism in intron 5 of the interferon α receptor gene, located on human chromosome 21 and the poly-T tract the splice acceptor site intron 8 of the CFTR gene located on the human chromosome 7, demonstrated as a model system.

MATERIALS AND METHODS

Genomic DNA was obtained from 18 unrelated individuals and from a family with mother, father and three children. The repeated region was determined conventionally by denaturing gel electrophoresis, and the results obtained were determined by standard Sanger sequencing approved.

The Primer for PCR amplification (8 pmol each) was IFNAR-1VS5-5 ': (5'-TGC TTA CTT AAC CCA GTG TG-3 ', SEQ ID No. 35) and IFNAR-1VS5-3'.2: (5'-CAC ACT ATG TAA TAC TAT GC-3 ', SEQ ID No. 36) for part of the intron 5 of the interferon α-receptor gene and CFEx9-F: (5'-GAA AAT ATC TGA CAA ACT CAT C-3 ', SEQ ID NO: 37) (5'-biotinylated) and CFEx9-R: (5'-CAT GGA CAC CAA ATT AAG TTC-3 ', SEQ ID NO: 38) for the CFTR exon 9 with flanking intron sequences of the CFTR gene. Taq polymerase, including 10 × buffer, was by Boehringer-Mannheim and the dNTPs were obtained from Pharmacia. The total reaction volume was 50 μl. PCR conditions were at 94 ° C for 5 min, followed by 40 cycles: 1 min at 94 ° C, 45 sec at 53 ° C and 30 sec at 72 ° C, as well as a final one Extension period of 5 min at 72 ° C.

The Amplification products were generated using the PCR purification kit from Qiagen (No. 28106) according to the manufacturer's instructions cleaned. The purified products were removed from the column in 50 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5).

A) The primer oligo base extension (thermocycling process CyclePROBE) was incubated with 5 pmol of the appropriate detection primer (IFN: 5'-TGA GAC TCT GTC TC-3 ', SEQ ID NO. 39) in a total volume of 25 μl, including 1 pmol of purified template, 2 units of thermosequenase (Amersham Life Science, cat. No. E79000Y), 2.5 μl thermosequenase buffer, 25 μmol each Deoxynucleotide (7-deaza-dATP, dTTP and in some experiments additionally dCTP) and 100 μmol dideoxyguanine and in some experiments in addition ddCTP performed. Cycle conditions: initial Denaturation at 94 ° C for 5 minutes, followed by 30 cycles of 30 sec at 44 ° C hybridization temperature and 1 min at 55 ° C Extension temperature.

Primer oligo base extension (isothermal Method)

10 μl aliquots of the purified double-stranded Amplification product (~ 3 pmoles) were transformed into a streptavidin-coated Well transferred to a microtiter plate (~ 16 pmole capacity per 50 μl volume; No. 1645684, Boehringer-Mannheim) from the addition of 10 μl Incubation buffer (80 mM sodium phosphate, 400 mM NaCl, 0.4% Tween 20, pH 7.5) and 30 μl Water. After one hour Incubation at room temperature, the wells were washed three times with 200 ul wash buffer A (40mM Tris, 1mM EDTA, 50mM NaCl, 0.1% Tween 20, pH 8.8) and with 100 μl 50 mM NaOH for 3 min to denature the double-stranded DNA. Subsequently the wells were washed three times with 200 μl 70 mM ammonium citrate solution washed.

The annealing of 100 pmol detection primer (CFpT: 5'-TTC CCC AAA TCC CTG-3 ', SEQ ID No. 40) was carried out in 50 μl hybridization buffer (50 mM ammonium phosphate buffer, pH 7.0 and 100 mM ammonium chloride). for 2 min at 65 ° C, 10 min at 37 ° C and 10 min at room temperature. The wells were washed three times with 200 μl Wash Buffer B (40 mM Tris, 1 mM EDTA, 50 mM NH ₄ Cl, 0.1% Tween 20, pH 8.8) and once in 200 μl TE buffer. The extension reaction was performed using some components of the DNA sequencing kit from USB (# 70770) and dNTPs or ddNTPs from Pharmacia. The total reaction volume was 45 μl, containing 21 μl of water, 6 μl of Sequenase buffer, 3 μl of 100 mM DTT solution, 50 μl of 7-deaza-dATP, 20 μmol ddCTP, 5.5 μl of glycerol enzyme dilution buffer, 0.25 μl of Sequenase 2.0 and 0.25 μl of pyrophosphatase. The reaction was pipetted on ice and incubated at room temperature for 15 min and at 37 ° C for 5 min. The wells were finally washed three times with 200 μl washing buffer B.

Of the extended Primer was run through 10 minutes Heat in 50 μl a 50 mM ammonium hydroxide solution at 80 ° C denatured by the template strand.

For precipitation, 10 μl of 3 M NH ₄ acetate (pH 6.5), 0.5 μl of glycogen (10 mg / ml water, Sigma Cat. No. G1765) and 110 μl of absolute ethanol were added to the supernatant and incubated for 1 hour at room temperature incubated. After centrifugation at 13,000 g for 10 minutes, the sediment was washed in 70% ethanol and resuspended in 1 μl of water with 18 MOhm / cm H ₂ O water.

Samples were prepared by mixing 0.6 μl matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) with 0.3 μl of the resuspended DNA / glycogen sediment on a sample target and allow to dry in air. Up to 20 samples were spotted onto a sample target for introduction into the source region of a Thermo-Bioanalysis (formerly Finnigan) Vision 2000 MALDITOF instrument operating in 5 and 20 kV reflectron mode at the target and conversion dynodes, respectively; applied. The theoretical average molecular weight (M _r (calc.)) Was calculated from the atomic compositions, the recorded experimental M _r values (M _r (exp.)) are those of the single-protonated form determined using external calibration.

RESULTS

The The aim of the experiments was a fast and reliable procedure for the exact determination of the number of repeat units in microsatellites or the length to develop a mononucleotide section that has the potential owns, secondary site mutations within the polymorphic region. Therefore, one became certain type of DNA sequencing (primer oligo bases extension, SAMPLE) with evaluation of the resulting products by matrix-assisted laser desorption / ionization (MALDI) mass spectrometry (MS) combined. The time of flight (TOF) -reflector arrangement was considered possible Mass measurement system selected. As an initial Aptitude test was initially carried out a study on the AIuVpA repeat polymorphism, the is in intron 5 of the human interferon-α receptor gene (cyclePROBE reaction) and second, at the poly-T tract, located in intron 8 of the human CFTR gene is located (isothermal PROBE reaction).

In 52 the cyclePROBE experiment for the AluVpA repeat polymorphism is shown schematically. The extension of the antisense strand (SEQ ID NO: 262) was performed with the sense strand which served as a template. The detection primer is underlined. In a family study, a co-dominant segregation of the various alleles was demonstrated by the electrophoresis method as well as by the cyclePROBE method and subsequent mass spectrometry analysis ( 53 ). The maternal and pediatric 2 alleles, in which direct electrophoresis of the amplified product revealed that one of the two copies had 13 repeat units, instead exhibited only 11 units according to cycle PROB, using ddG as the terminator. Replacement of ddG by ddC resulted in another unexpected short allele with a molecular mass of about 11,650 in the DNA of the mother and of child 2 (FIG. 54 ). Sequence analysis confirmed the presence of two secondary site mutations in the allele with 13 repeat units. The first is a C to T transition in the third repeat unit, and the second mutation is a T to G transversion in the ninth repeat unit. Examination of 28 unrelated individuals using cyclePROBE revealed that the 13-unit allele is spliced into a normal allele and a truncated allele. A statistical evaluation shows that the polymorphism is in a Hardy-Weinberg equilibrium in both methods, but when using cyclePROBE as a detection method, the polymorphism information content is increased to 0.734.

PROBE was also used as an isothermal method to detect the 3 common alleles at the splice acceptor site of intron 8 of the CFTR gene (SEQ ID NO: 263). 55 shows a schematic representation of the expected diagnostic products (SEQ ID NO: 264-266) with the theoretical mass values. The reaction was also carried out in the antisense direction.

56 shows that all three common alleles (T5, T7, and T9, respectively) at this locus could be reliably revealed by this method. The 56 shows that the mass accuracy and precision with the reflectron runtime used in this study was in the range of 0-0.4%, the relative standard deviation being 0.13%. This is far better than the single-base accuracy for the <90-mer diagnostic products generated in the IFNAR system. Such high analytical sensitivity is sufficient to detect single or multiple insertion / deletion mutations in the repeat unit or its flanking regions, which would produce> 1% mass deviations in a 90-mer. This is analogous to polyT tract analysis in 56 , Other mutations (ie, an A to T or a T to A mutation in the A3T repeat of the IFNAR gene) that do not cause early product termination are absent in any dNTP / ddNTP combination with PROBE and low power MS Devices detectable; a 9-Da shift in a 90-mer corresponds to a 0.03% mass deviation. It has been demonstrated that the accuracy and precision required to detect such small mass deviations can be achieved with more powerful equipment such as Fourier transform (FT) MS, which achieves single Da accuracy up to 100 microns. It has also been shown that point mutations in products of comparable size can be localized to the base by tandem FTMS, where a fragment with mass variation can be isolated within the device and dissociated to produce sequence-specific fragments. The combination of PROBE with more powerful equipment will thus have an analysis sensitivity that can otherwise only be achieved by cumbersome sequencing of the entire repeat range.

EXAMPLE 12

Improved genotype determination of apolipoprotein E using primer oligo base extension (PROBE) and MALDI-TOF mass spectrometry

MATERIALS AND METHODS

PCR amplification.

human genomic leukocyte DNA from 100 anonymous individuals previously published investigation (Braun, A. et al., (1992) Human Genet. 89, 401-406) was used conventional method screened for apolipoprotein E genotypes. PCR primer for amplification of a section of exon 4 of the apo E gene have been correspondingly the published Sequence (Das, HK et al., (1985) J. Biol. Chem. 260: 6240-6247) (Forward primer, apo-E-F: 5'-GGC ACG GCT GTC CAA GGA G-3 ', SEQ ID NO: 41; Reverse primer apo-E-R: 5'-AGG CCG CGC TCG GCG CCC TC-3 ', SEQ ID NO: 42). Taq polymerase and 10x buffer were from Boehringer-Mannheim (Germany), and the dNTPs from Pharmacia (Freiburg, Germany). The total reaction volume was 50 μl, including 8 pmol of each primer and 10% DMSO (dimethyl sulfoxide, Sigma) at about 200 ng genomic DNA that was used as a template. The solutions were heated to 80 ° C, before adding 1 E polymerase; the PCR conditions were: 2 min at 94 ° C, followed by 40 cycles 30 sec at 94 ° C, 45 sec at 63 ° C, 30 sec at 72 ° C and a final one Extension period of 2 min at 72 ° C.

Restriction enzyme digestion and polyacrylamide electrophoresis

Cfol and RsaI and reaction buffer L were purchased from Boehringer-Mannheim and Hhal from Pharmacia (Freiburg, Germany). For one Digest with Cfol alone and for a concurrent Cfol / Rsal digest was amplified 20 μl Products with 15 μl Water and 4 μl buffer L diluted by Boehringer-Mannheim; to Add 10 units of the appropriate restriction enzyme (s) Restriction enzymes, the samples were incubated for 60 min at 37 ° C. The procedure for a simultaneous Hhal / Rsal digestion first required one Digestion by Rsal in buffer L for one hour, and the subsequent one Addition of NaCl (50 mM final concentration) and HHI and further incubation for one Hour. 20 μl of the restriction digests were on a 12% Polyacrylamide gel as described elsewhere (Hixson (1990) J. Lipid Res. 31 545-548), analyzed. The recognition sequences of Rsal and Cfol (Hhal) are GT / AC or GCG / C, the masses of expected digestion fragments the amplified 252-mer product with Cfol alone and from the concomitant Double digest with Cfol (or Hhal) and Rsal are given in Table V.

Thermo-PROBE

The PCR amplification was performed as described above, wherein however, the products are used to remove unincorporated primers cleaned by Qiagen's "Qiaquick" kit were. Multiplex Thermo-PROBE was carried out with 35 μl amplified product and in each case 8 pmol of the detection primer for codon 112 (5'-GCG GAC ATG GAG GAC GTG-3 ', SEQ ID Nos. 43) and 158 (5'-GAT GCC GAT GAC CTG CAG AAG-3 ', SEQ ID No. 44) in 20 μl, including ~ 1 pmol of purified biotinylated antisense template immobilized on streptavidin-coated magnetic beads, 2.5 units of thermosequenase, 2 μl thermosequenase buffer, 50 μM each dNTPs and 200 μM ddXTP, where the base identity from N and X as explained in the text is. Cycle conditions were: denaturation (94 ° C, 30 sec), followed by 30 cycles at 94 ° C (10 min) and 60 ° C (45 sec).

Sample preparation and analysis by MALDI-TOF-MS

For the precipitation (Stults et al., 1991, Rapid Commun. Mass Spectrom., 5: 359-363) of both digests and the PROBE products, 5 μl 3 M ammonium acetate (pH 6.5), 0.5 μl glycogen ( 10 mg / ml, Sigma) and 110 μl of absolute ethanol was added to 50 μl of the analyte solutions and stored at room temperature for 1 hour. After centrifugation at 13,000 × g for 10 minutes, the sediment was washed in 70% ethanol and washed in 1 μl of water with 18 MOhm / cm H ₂ O. If indicated in the text, additional desalting was accomplished by shaking 10-20 μl of ammonium-saturated DOWEX (Fluka # 44485) cation exchange beads in 40 μl of analyte. The protonated beads were pretreated with three 5-minute centrifugation decant steps in 2 M NH ₄ OH followed by H ₂ O and 10 mM ammonium citrate.

0.35 μl of resuspended DNA was loaded onto a stainless steel sample target with 0.35-1.3 μl of matrix solution (1993) Rapid Commun. Mass Spectrom., 7: 142-146), (0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) and allowed to air dry before spectral analysis using a Thermo-Bioanalysis Vision 2000 MALDI-TOF operated in reflectron mode at 5 and 20 kV at the target and conversion dynodes, respectively. The theoretical average molecular weights (M _r (calc.)) Of the fragments were calculated from the atomic compositions; the mass of a proton (1.08 Da) is subtracted from the raw data values as a neutral basis when recording the experimental molecular masses (M _r (exp.)). All spectra were subjected to an external calibration, which was formed from eight peaks (3000 to 18,000 Da).

RESULTS

Digest with Cfol alone

The secondary representation in 57a shows an electrophoretic separation of a ε3 / ε3 genotype after digestion of the 252 bp amplified apo E product with Cfol, on a 12% polyacrylamide gel. Comparison of the electrophoresis bands with a molecular weight ladder shows that the cleavage pattern is predominantly as expected for the ε3 / ε3 genotype (Table V). Differences are that a weak band of about 25 bp was not expected, and that the smallest fragments were not observed. The accompanying mass spectrum of precipitated digestion products shows a similar pattern, albeit at a higher resolution. The comparison with Table V shows that the observed masses are consistent with those of single-stranded DNA; It is known that under normal MALDI conditions, short ds DNA segments denature upon ionization by the combination of an acidic matrix environment (3-HPA, pK _a 3) and the absorption of heat energy via interactions with the 3,3-HPA absorbing at 337 nm (Tang, K. et al., 1994, Rapid Commun Mass Spectrom., 8: 183-186).

The approximately 25-mers that are not resolved by electrophoresis are separated by MS into three single-stranded fragments; the largest of them (7427 Da) may represent a doubly charged ion of the 14.8 kDa fragments (m = 14850, z = 2, m / z = 7425) the 6715 and 7153 Da fragments may be from PCR artifacts or primers Impurities come from; all three peaks are not observed when the amplified products are purified before cleavage with Qiagen purification kits. The 8871 Da 3'-terminal 29-mer sense strand fragment mentioned in Table V is not observed; the species found at 9186 Da corresponds to the addition of an additional base (9187-8871 = 316, corresponding to A) by the Taq polymerase in the PCR amplification (Hu, G. et al. (1993), DNA and Cell Biol. 12: 763-779). The individual single strands of each <35 bases (11 kDa) double strand are resolved as single peaks; however, the 48-base single strands (M _r (calc.)) 14845 and 14858) are observed as unresolved single peak at 14850 Da. Its separation into individual peaks would require a mass resolution (m / ⌂m, ratio of the mass to the peak width at half height) of 14850/13 = 1140, which is almost an order of magnitude higher than that of the standard reflectron used in this study. Flight time equipment is routine; the resolution of such small mass differences with high power devices, such as Fourier transform MS, which provides up to three orders of magnitude higher resolution in this mass range, has been demonstrated. The 91-mer single strands (M _r (calc.) 27849 and 28436) are also not resolved, although a resolution of only <50 is required. The dramatic decrease in peak quality at higher masses is due to metastable fragmentation (ie depurination), which results from excess internal energy absorbed during and after laser irradiation.

Simultaneous digestion with Cfol and Rsal

• ^aCfol-invariante Fragment-Massen: 1848, 2177, 2186, 2435, 4924, 5004, 5412, 5750, 8871, 9628 Da.
• ^bCfol-invariante Fragment-Massen: 1848, 2177, 2186, 2436, 4924, 5004, 5412, 5750,6745, 7510, 8871, 9628, 16240, 17175 Da.

Tabelle VI ddT M_r(ber.) ddT M_r(exp.) ddC M₅(ber.) ddC M_r(exp.) e2/e2 85918, 6768 -- ^a86536, ^b7387 -- 2/e3 ^a5918, ^b6768, ^b7965 5919, 6769, 7967 ^a6536, ^b6753, ^b7387 6542, 6752, 7393 2/e4 ^a5918, ^b6768, ^b7965 ^a8970 - ^a5903, ^b6536, ^b6753, ^a7387 - e3/e3 ^a5918, ^b7965 5918, 7966 ^a6536, ^b6753 6542, 6756 3/e4 ^a5918, ^b7965, ^a8970 5914,7959, 8965 ^a5903, ^b6536 ^b6753 5898, 6533, 6747 e4/e4 ^b7965, ^a8970 7966, 8969 ^a5903, ^b6753 5900, 6752

• ^avon Codon 112-Nachweisprimer (unverlängert 5629,7 Da).
• ^bvon Codon 158-Nachweisprimer (unverlängert 6480,3 Da).
• Gestrichelte Linien: Dieser Genotyp war aus dem analysierten Pool von 100 Patienten nicht erhältlich.

57b (Secondary panel) shows gel electrophoresis separation of ε3 / ε3 double digestion products on a 12% polyacrylamide gel, with bands consistent with 24, 31, 36, 48 and 55 base pair dsDNA but not with smaller fragments. Although more peaks are generated as with Cfol alone (Table V), the corresponding mass spectrum still easier to interpret and reproducible because all fragments containing <60 bases, a size range that is much better suited for MALDI-MS as reliably accurate M _r Values (eg 0.1%) are desired. For fragments in this mass range, the mass measurement accuracy using external calibration is -0.1% (ie, ≥ ± 10 Da at 10 kDa). Significant depurination (indicated by asterisks in the figure) is observed for all peaks above 10 kDa, but even the largest peak at 17171 Da is clearly separated from its depurination peak, so that an exact Mr can be measured. Although the molar concentrations of the digestion products should be identical, some neglect of ≤ 11 base fragments is observed, presumably due to their loss in the ethanol / glycogen precipitation step. The quality of MS results from double digestion with Cfol (or Hhal) and Rsal is better than with Cfol (or Hhal) alone, because the smaller fragments generated are well suited for higher mass accuracy measurements, and none of the genotypes have the potential for dimer peaks to overlap with high mass diagnostic peaks. Since the Rsal / Cfol and Rsal / Hhal cleavages generate the same restriction fragments, but the former can occur simultaneously because their buffer conditions are the same, this enzyme mixture was used for all subsequent genotype determinations by restriction digest protocols. Table V Mass and Copy Number of Expected Restriction Digest Products Table Va Cfol Digest ^a (+) (-) e2 / e2 e2 / e2 e2 / e2 e2 / e2 e2 / e2 e2 / e2 5781, 5999 - - 1 - 1 2 10752, 10921 - 1 1 2 2 2 14845, 14858 - 1 1 2 2 2 22102, 22440 - - 1 - 1 2 25575, 25763 2 1 1 - - - 27849, 28436 2 2 1 2 1 - Table Vb Cfol / Rsal digest (+) (-) e2 / e2 e2 / e3 e2 / e4 e3 / e3 e3 / e4 e4 / e4 3428, 4025 - 1 1 2 2 2 5283, 5880 - - 1 - 1 2 5781, 5999 - - 1 - 1 2 11279, 11627 2 2 1 2 1 - 14845, 14858 - 1 1 2 2 2 18269, 18848 2 2 1 - - -

• ^a Cfol invariant fragment masses: 1848, 2177, 2186, 2435, 4924, 5004, 5412, 5750, 8871, 9628 Da.
• ^b Cfol invariant fragment masses: 1848, 2177, 2186, 2436, 4924, 5004, 5412, 5750, 6745, 7510, 8871, 9628, 16240, 17175 Da.

Table VI ddT M _r (comp.) ddT M _r (exp.) ddC M ₅ (comp.) ddC M _r (exp.) e2 / e2 85918, 6768 - ^a 86536, ^b 7387 - 2 / e3 ^a 5918, ^b 6768, ^b 7965 5919, 6769, 7967 ^a 6536, ^b 6753, ^b 7387 6542, 6752, 7393 2 / e4 ^a 5918, ^b 6768, ^b 7965 ^a 8970 - ^a 5903, ^b 6536, ^b 6753, ^a 7387 - e3 / e3 ^a 5918, ^b 7965 5918, 7966 ^a 6536, ^b 6753 6542, 6756 3 / e4 ^a 5918, ^b 7965, ^a 8970 5914, 7959, 8965 ^a 5903, ^b 6536 ^b 6753 5898, 6533, 6747 e4 / e4 ^b 7965, ^a 8970 7966, 8969 ^a 5903, ^b 6753 5900, 6752

• ^a from codon 112 detection primer (undiluted 5629.7 Da).
• ^b codon 158 of detection primer (unextended 6480.3 Da).
• Dashed lines: This genotype was not available from the analyzed pool of 100 patients.

58a Figure c shows the ApoE-ε3 / ε3 genotype after digestion with Cfol and a variety of precipitation schemes; Aliquots of the same volume were each used by the same amplification product. The sample with a single precipitation ( 58a ) was treated from an ammonium acetate / ethanol / glycogen solution, results in a mass spectrum, which is characterized in particular at high mass by broad peaks. The masses for intense peaks at 5.4, 10.7 and 14.9 kDa are higher by 26 Da (0.5%), 61 Da (0.6%) and 45 Da (0.3%) respectively expected values; the resolution (the ratio of peak width at half of its total intensity to the measured mass of the peak) is -50 and decreases with increasing mass. These observations are consistent with a high degree of adduction of nonvolatile cations; for the 10.8 kDa fragment, the observed mass shift corresponds to a ratio of adducted to non-adducted molecular ions that is greater than the unit ratio.

MS peaks of a sample that has been redissolved and precipitated a second time are much sharper ( 58b ), where the resolution values are almost twice those of the corresponding peaks 58a , The mass accuracy values are also considerably improved; each is within 0.07% of its calculated value, close to the independently determined device limits for DNA measurement using 3-HPA as a matrix. Single (not shown) and double precipitations ( 58C with isopropyl alcohol (IPA) instead of ethanol results in a resolution and mass accuracy values corresponding to those of the corresponding ethanol precipitates, however, high levels of dimerization are observed, which in turn potentially interferes with the measurements when these dimers react with the "diagnostic" monomers present in the solution overlap higher mass. EtOH / ammonium acetate precipitation with glycogen as a precipitation aid results in nearly quantitative recovery of fragments except the 7-mers, and serves as a simultaneous concentration and desalting step prior to MS detection. Precipitation from the same EtOH / ammonium acetate solutions without glycogen results in a much lower yield, especially at low mass.

The results show that to obtain accurate (M _r (exp.) Values after IPA and EtOH precipitations, a second precipitation is required to obtain high mass accuracy and resolution.

The relationship of Matrix: Digestion product also affects the quality of the spectra; a strong suppression of fragments of higher Mass (not shown) obtained at a 1: 1 volume ratio of Matrix: digestion product (redissolved in 1 μl) is observed by using a 3-5-fold volume excess attenuated at matrix.

Apa E genotype determination by enzymatic digestion. The codon 112 and 158 polymorphisms are within the Cfol (but not the Rsal) recognition sequences. In the amplified 252 bp product examined here, invariant sites (ie those that are cleaved in all genotypes) produce sections after bases 31, 47, 138, 156, 239 and 246. The cleavage site behind base 66 is present only at ε4, whereas the one behind Base 204 is present in ε3 and ε4; the ε2 genotype is not cleaved at any of these sites. These differences in the restriction pattern can be shown as variations in the mass spectra. 59 shows mass spectra of several ApoE genotypes, obtained from a pool of 100 patients Genet. 89: 401-406). (Brown, A. et al., (1992) Hum. Genet. Vertical, dashed lines are drawn through those masses corresponding to the diagnostic fragments expected in Table V; other labeled fragments are invariant. Note, with respect to Table V, that a fragment is considered "invariant" only if it occurs for a particular allele in duplicate copies; To meet this requirement, such a fragment must be generated in each of the ε2, ε3 and ε4 alleles.

The spectrum in 59a contains all expected invariant fragments above 3 kDa, as well as diagnostic peaks at 3428 and 4021 (both weak), 11276 and 11627 (both intense), 14845, 18271 and 18865 Da. The spectrum in 59b is nearly identical, except that the peak pair is not detected at 18 kDa and that the relative peak intensities, most notably the 11-18 kDa fragments, are different. The spectrum in 59c also has no 18 kDa fragments, but instead new low intensity peaks between 5-6 kDa. The intensity ratios for fragments over 9 kDa are similar to those of the 59b except for a relatively lower 11 kDa fragment pair: 59d which in turn has the accumulation of 5-6 kDa peaks is the only spectrum without 11 kDa fragments and, like the previous two, has no 18 kDa fragment.

Despite the myriad peaks in each spectrum, each genotype can be identified by the presence or absence of only a few diagnostic peaks of Table Vb. Because of the limited resolution of the MALDI-TOF devices used, the most difficult to differentiate genotypes are those based on the presence or absence of the four diagnostic fragments between 5.2 and 6.0 kDa that are characteristic of the ε4 allele these fragments almost overlap with some invariant peaks. It has been found here that the 5283 Da diagnostic fragment overlaps a depurination peak of the invariant 5412 Da fragment, and that the 5781 Da diagnostic peak can not usually be completely separated from the invariant 5750 Da fragment. The distinction between ε2 / ε4 and ε2 / ε3 or between ε3 / ε4 and ε3 / ε3 all) is thus based on the presence or absence of the 5880 and 5999 Da fragments. These are each in the 59c and 59d but not in 59a or 59b , available.

The genotype of each patient in 59 can be faster based on the flowchart in 60 determine. The spectrum of 59a according to the intense peak pair at 11 kDa excludes the possibility of a homozygous ε4, but does not distinguish between the other five genotypes. Similarly, the presence of the unresolved 14.8 kDa fragments does not match a homozygous ε2, but leaves four possibilities (ε2 / ε3, ε2 / ε4, ε3 / ε3, ε3 / ε4). Of these, only ε2 / ε3 and ε2 / ε4 correspond to the 18 kDa peaks; the lack of peaks at 5283, 5879, 5779 and 5998 shows that the sample is in 59a ε2 / ε3. With the same procedure, the genotypes of the 59b Identify -d as ε3 / ε3, ε3 / ε4 or ε4 / ε4. So far all allelic identifications made by this method were consistent with those of conventional methods and in many cases were easier to interpret. The association can be further secured by ensuring that the ratios of the fragment intensities match the copy numbers in Table V. The 14.8 kDa fragments, for example, have a lower intensity than those at 16-17 kDa in 59a However, the show 59b -D the opposite. This is expected because the 14.8 kDa fragments are duplicated in the latter three genotypes, but the former is an ε2-containing heterozygote, so that half of the amplified products do not contribute to the 14.8 kDa signal. The comparison of the intensity of the 11 kDa fragment with that at 9.6 and 14.8 kDa shows that this fragment in the 59a and d is in two, two, one or no copy. These data confirm that MALDI can be done semi-quantitatively under these conditions.

ApoE genotype determination by primer oligo base extension (SAMPLE).

The PROBE reaction was also used as a means of simultaneous detection of the codon 112 and 158 polymorphisms. A detection primer becomes a single-stranded one PCR-amplified template hybridizes so that its 3'-terminus is direct located behind the variable position. The extension of this primer by a DNA polymerase in the presence of three dNTPs and one ddXTP (which is not available as dNTP) leads to products whose length and Mass of the identity depend on the polymorphic base. Unlike standard Sanger sequencing, for a given base-specific tube -99% dXTP and -1% ddXTP, contains contains the PROBE mixture is 100% of a specific ddXTP combined with the other three dNTPs. With PROBE this will be a complete demolition all Detection primer achieved after the first base has been reached, which complements the ddXTP is.

In the ε2 / ε3 genotype, the PROBE reaction (mixture of ddTTP, dATP, dCTP and dGTP) causes a M _r (exp.) Shift of the codon 112 primer to 5919 Da and the codon 158 primer to 6769 and 7967 Da (Table VI); a pair of extension products result from the single codon 158 primer, since the ε2 / ε3 genotype is heterozygous at this point. Three extension products (one from codon 158, two from 112) are also observed in heterozygous ε3 / ε4 ( 61c and Table VI), whereas only two products (one from each primer) in the homozygous alleles of the 61b (ε3 / ε3) and 59d (ε4 / ε4) are observed. According to Table VI, all available alleles give rise to all expected ddT reaction product masses within 0.1% of the theoretical mass, and are therefore unequivocally characterized by these data alone. Further configuration of the allele identities can be obtained by repeating the reaction with ddCTP (plus dATP, dTTP, dGTP); these results, which are also summarized in Table VI, unequivocally confirm the ddT results.

Suitability of the procedures. The comparison of 59 (Restriction digest) and 61 (PROBE) shows that the PROBE method provides much easier interpretable spectra for the multiplex analysis of the codon 112 and 158 polymorphisms than the restriction digest analysis. While digests produce up to -25 peaks per mass spectrum, and in some cases diagnostic fragments that overlap with invariant fragments, the PROBE reaction produces only at most two peaks per detection primer (ie, polymorphism). Automatic peak detection, spectral analysis, and allele identification would be clearly more targeted for the latter method. Spectra for a highly multiplexed PROBE in which multiple polymorphic sites are determined from the same or different amplified products from a tube are also potentially easy to analyze. Underlining its flexibility, the PROBE data analysis can be simplified by deliberate pre-selection of primer lengths, which can be designed so that no primer or product can overlap in mass.

Although PROBE is the method of choice for large-scale clinical studies of well-characterized polymorphism sites, restriction digest analysis as described herein is ideally suited for screening for novel mutations. The identity of both polymorphisms discussed in this study affects the fragment pattern; if this is the only information used, MS detection is a faster alternative compared to the conventional electrophoretic separation of restriction fragment length polymorphism products. Accurately measuring the M _r values of the fragments can also provide information about sites that are far removed from the enzyme recognition site, as other single point mutations necessarily alter the mass of each single strand of the double stranded fragment containing the mutation. The amplified 252 bp product could also contain allelic variants which include, for example, the previously described substitutions Gly127-Asp (Weisgraber, KH et al. (1984), J. Clin. Invest. 73: 1024-1033), Arg136 Ser (FIG. Wardell, MR et al., (1987) J. Clin Invest 80: 483-490), Arg142-Cys (Horie, Y. et al., (1992) J. Biol. Chem. 267: 1962-1968). Arg145-Cys (Rall, SC Jr et al., (1982), Proc Natl. Acad Sci., USA 79: 4696-4700), Lys146-Glu (Mann, WA et al., (1995) J. Clin Invest. 96: 1100-1107) or Lys146-Gln (Smit, M. et al., (1990) J. Lipid Res. 31: 45-53). The G → A base substitution encoding the amino acid substitution Gly127-Asp would cause a -16 Da shift in the sense strand, and a +15 Da shift (C → T) in the antisense strand, but no change in the restriction pattern. Such a small change would be virtually invisible in electrophoresis; the substitution could be determined with exact mass determination; the invariant 55-mer fragment at 16240 (Sense) and 17175 Da would be shifted to 16224 and 17190 Da, respectively. Achieving the mass accuracy that is required with the use of conventional MALDI-TOF devices to detect such small mass deviations, even with internal calibration, is not routinely done because smaller unresolved adducts and / or poorly defined peaks limit the ability to accurately quantitate. By means of high performance electron spray ionization Fourier transform (ESI-FTMS) single-Da accuracy is found in synthetic oligonucleotides (Little, DP, et al., (1995), Proc. Natl. Acad, Sci., USA 92: 2318- 2322) up to 100-mer (Little, DP, et al., (1994) J. Am. Chem. Soc. 116: 4893-4897), and similar results are recent with up to 25-mers using MALDI-FTMS has been achieved (Li, Y. et al., (1996) Anal. Chem. 68: 2090-2096).

EXAMPLE 13

Method for mass spectrometry Detection of DNA fragments associated with telomerase activity

INTRODUCTION

One Quarter of all deaths in the United States is based on malignant tumors (R.K. Jain, (1996) Science 271: 1079-1080). For diagnostic and therapeutic purposes, there is a strong interest in reliable and sensitive procedures for tumor cell determination.

Malignant Cells can be over differentiate different properties of normal cells. One of those is the immortalization of malignant cells, which is an uncontrolled Cell proliferation allows. Normal diploid mammalian cells go through a limited number of population doublings in Culture before they age. It is assumed that the number of population doubles at every cell division in connection with a shortening of the Chromosome ends, the so-called telomeres. The reason for this shortening based on the characteristics of conventional semi-conservative Replication machinery. DNA polymerases work only in the 5'-to-3 'direction, and require one RNA primers.

you assumes that immortalization with the expression of active telomerase accompanied. Telomerase is a ribonucleoprotein that is repetitive renewal catalyzed by matrices. This activity can be in a native protein extract Telomerase-containing cells with a special PCR system (N.W. Kim et al. (1994), Science 266: 2011-2015) Using the Telomere Repeat Amplification Protocol (TRAP) is known to be detected. The test, as used here, relies on the telomerase-specific extension of a substrate primer (TS) and subsequent amplification of the telomerase-specific Extension products with a PCR step in which a second primer which is complementary to the repeat structure (bioCX). The characteristic ladder fragments of these tests are usually through Use of gel electrophoresis and labeling or staining systems demonstrated. These methods can be replaced by MALDI-TOF mass spectrometry, resulting in a faster, accurate and automatic detection leads.

MATERIALS AND METHODS

preparation of cells

1 × 10 ⁶ cultured telomerase-positive cells were sedimented, once with PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ .7H ₂ O, 1.4 mM KH ₂ PO ₄ in sterile DEPC water). The prepared cells can be stored at -75 ° C. Tissue samples must be homogenized prior to extraction according to procedures known in the art.

Telomerase extraction

The sediment was dissolved in 200 μl of CHAPS lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM MgCl ₂ , 1 mM EGTA, 0.1 mM benzamidine, 5 mM β-mercaptoethanol, 0.5% CHAPS, 10% Glycerin) and incubated on ice for 30 min. The sample was centrifuged for 30 minutes at 4 ° C and 12,000 x g. The supernatant was transferred to a fresh tube and stored at -75 ° C until use.

TRAP assay

2 μl telomerase extract was added to a mixture of 10X-TRAP buffer (200 mM Tris-HCl, pH 8.3, 15 mM MgCl ₂ , 630 mM KCl, 0.05% Tween 20, 10 mM EGTA), 50 × dNTP mixture (each 2.5 mM dATP, dTTP, dGTP and dCTP), 10 pmol TS primer and 50 pmol of bio CX primer added in a final volume of 50 μl. The mixture was incubated at 30 ° C for 10 minutes and 94 ° C for 5 minutes, 2 units of Taq polymerase were added, and PCR was performed with 30 cycles of 94 ° C for 30 seconds, 50 ° C for 30 seconds, and 72 ° C carried out for 45 sec.

Cleaning the TRAP test products

For each 50 μl streptavidin M-280 Dynabeads were to be purified for TRAP assay (10 mg / ml) twice with 1 x BW buffer (5mM Tris-HCl, pH 7.5, 0.5mM EDTA, 1M NaCl). To the PCR mixture were 50 μl 2 × BW buffer added and the beads were resuspended in this mixture. The beads were shaken gently for 15 minutes at ambient temperature incubated. The supernatant was removed, and the beads were washed twice with 1 x BW buffer washed. The beads were washed with 50 μl of 25% ammonium hydroxide and 10 min at 60 ° C. incubated. The supernatant was stored, the procedure repeated, both supernatants were combined and with 300 μl Ethanol (100%). After 30 min, the DNA was at 13,000 rpm for 12 min sedimented, the sediment was dried in air and in 600 nl ultrapure water resuspended.

MALDI-TOF-MS of TRAP test products

300 nl samples were mixed with 500 nl saturated matrix solution (3-HPA: ammonium citrate = 10: 1 molar ratio in 50% aqueous acetonitrile), dried at ambient temperature and poured into the mass spectrometer (Vision 2000, Finigan MAT). All spectra were recorded in reflector mode using external calibration.

Sequences and masses

• bioCX: d (bio-CCC TTA CCC TTA CCC TTA CCC TAA; SEQ ID NO. 45), mass: 7540 Da.
• TS: d (AAT CCG TGC AGC AGA GTT, SEQ ID NO: 46), mass: 5523 Da. Telomer Repeat Structure: (TTAGGG), mass of a repeat: 1909.2

amplification:

• TS, extended by three telomere repeats (first amplification product): 12452 Da (N3)
• TS, extended by four telomere repeats: 14361 Da (N4)
• TS, extended through seven telomere repeats: 20088 Da (N7)

RESULTS

The 62 shows a portion of a TRAP test MALDI-TOF mass spectrum. The primers TS and bioCX are assigned at 5497 and 7537 Da (calculated 5523 and 7540 Da). The asterisked signal represents the n-1 primer product of chemical DNA synthesis. The first telomerase-specific TRAP test product is assigned at 12775 Da. This product represents a 40-mer that contains three telomere repeats. Because of the primer sequences, this is the first expected amplification product of a positive TRAP assay. The product is extended by an additional nucleotide due to the extendase activity of the Taq DNA polymerase (calculated non-extended product: 12452 Da to A extended product: 12765 Da). The signal at 6389 Da represents the doubly charged ion of this product (calculated 6387 Da). 63 shows a section of higher masses of the same spectrum as in 62 Therefore, the signal at 12775 Da is identical to that in 62 , The TRAP test product with seven telomere repeats, which is also a 64-mer extended by an additional nucleotide, is detected at 20,322 Da (calculated: 20,395 Da). The signals labeled 1, 2, 3 and 4 can not be resolved from the baseline. This region consists of: 1. signal from dimeric n-1 primer, 2. second TRAP test amplification product containing 4 telomere repeats, thus representing a 46-mer (calculated: 14341 Da / 14674 Da Extendase-extended product ) and third dimer primer ion and also all their corresponding depurination signals. A gap is observed between the signals of the second and fifth extension products. This signal gap corresponds to the reduced band intensities observed in some cases for the third and fourth extension products in autoradiographic analyzes of TRAP assays (NW Kim et al (1994), Science 266: 2013).

The aforementioned problems arising from the dimeric primer and related Signals can be caused be overcome by using an ultrafiltration step, in which a molecular weight exclusion membrane for primer removal before the MALDI-TOF-MS analysis is used. This allows a unambiguous assignment of the second amplification product

EXAMPLE 14

Method for detecting neuroblastoma-specific, nested RT-amplified Products using MALDI-TOF mass spectrometry

INTRODUCTION

The Neuroblastoma is predominantly a tumor of early childhood, with 66% of the Cases children affect the younger than 5 years old. The most common Symptoms are those due to tumor mass, bone pain or those caused by excessive catecholamine secretion be caused. In rare cases, a neuroblastoma can be identified prenatally (Jennings, R.W., et al., 1993, J. Ped. Surgery 28: 1168-1174). About 70% of all patients with neuroblastoma are diagnosed a metastatic disease. The prognosis depends on Age at diagnosis, clinical condition and other parameters.

For diagnostic purposes There is a big one Interest in reliable and sensitive methods for tumor cell detection e.g. B. in the monitoring autologous bone marrow transplantation or follow-up therapy.

There the catecholamine synthesis is a characteristic property of Neuroblastoma cells and bone marrow cells lack this activity (H. Naito et al., 1991, Eur. J. Cancer 27: 762-765), neuroblastoma cells or Metastases in the bone marrow are identified by human Tyrosine 3-hydroxylase (E.C. 1.14,16.2, hTH), which are the first step catalyze the biosynthesis of catecholamines.

The Expression of htH can be achieved with a reverse transcription (RT) polymerase chain reaction (PCR) can be detected, and the amplified product can by MALDI-TOF mass spectrometry are analyzed.

MATERIALS AND METHODS

Cell or tissue treatment

Cultured cells were pelleted (10 min 8000 U / min) and twice with PBS (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na ₂ HPO ₄ · 7 H ₂ O, 1.4 mM KH ₂ PO ₄ in sterile PEPC water). The sediment was resuspended in 1 ml lysis / binding buffer (100 mM Tris-HCl, pH 8.0, 500 mM LiCl, 10 mM EDTA, 1% Li-dodecyl sulfate, 5 mM DTT) until the solution became viscous. The viscosity was lowered by a DNA shearing step with a 1 ml syringe. The lysate can be stored at -75 ° C or processed immediately. Solid tissues (eg patient samples) must be homogenized prior to lysis.

Preparation of magnetic oligo-dT (25) beads

100 μl beads per 1 × 10 ⁶ cells were separated from the storage buffer and washed twice with 200 μl lysis / binding buffer.

Isolation of polyA ⁺ RNA

The Cell lysate was prepared Beads added and incubated for 5 min at ambient temperature. The Beads were 2-5 min magnetically separated and washed twice with 0.5 ml LDS (1.0 mM Tris-HCl, pH 8.0, 0.15 M LiCl, 1 mM EDTA, 0.1% LiDS).

Solid-phase first strand cDNA synthesis

The polyA ⁺ RNA-containing beads were resuspended in 20 μl of reverse transcription mix (50 mM Tris-HCl, pH 8.3, 8 mM MgCl ₂ , 30 mM KCl, 10 mM DTT, 1.7 mM dNTPs, 3 E AMV reverse transcriptase) and incubated for 1 hour at 45 ° C (with a resuspension step every 10 mm). The beads were separated from the reverse transcription mixture, resuspended in 50 μl elution buffer (2 mM EDTA pH 8.0) and heated at 95 ° C for 1 min to elute the RNA. The beads with the first-strand cDNA can be prepared for further processing in TB (0.089 M Tris base, 0.089 M boric acid, 0.2 mM EDTA, pH 8.0), TE (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) or 70% ethanol.

Nested polymerase chain reaction

The beads with the first-strand cDNA were washed twice with 1 × PCR buffer (20 mM Tris-HCl, pH 8.75, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgSO ₄ , 0.1%. Triton-X-100, 0.1 mg bovine serum albumin) and in PCR mix (each with 100 pmol of the outer primer, 2.5 U Pfu (exo) DNA polymerase, 200 uM dNTPs and PCR buffer in one Final volume of 50 μl). The mixture was incubated for 1 min at 72 ° C and amplified for 30 cycles by PCR. For the nested reaction: 1 μl of the first PCR was added as template to a PCR mix d (as above, but instead of the outer primer with more internal primers) and subjected to the following temperature program: 94 ° C. for 1 min, 65 ° for 1 min C and 1 min 72 ° C for 20 cycles.

Purification of the nested amplified Products

The primers and low molecular weight reaction by-products were removed with a 10,000 Da exclusion ultrafiltration unit. The ultrafiltration was carried out at 7500 × g for 25 minutes. For each PCR to be purified, 50 μl of streptavidin M-280 Dynabeads (10 mg / ml) were washed twice with 1 x BW buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) which was added to the ultrafiltration membrane and incubated with gentle shaking for 15 minutes at ambient temperature. The supernatant was removed, and the Beads were washed twice with 1 x BW buffer. The beads were mixed with 50 μl of 25% ammonium hydroxide and incubated at ambient temperature for 10 minutes. The supernatant was saved, the procedure repeated, both supernatants were pooled and 300 μl ethanol (100%) added. After 30 minutes, the DNA was sedimented for 12 minutes at 13,000 rpm, the sediment was air dried and resuspended in 600 μl ultrapure water.

MALDI-TOF-MS of the nested amplified Products

Geschachtelte Primer:

Masse des biotinylierten, einzelsträngigen Amplifikationsprodukts: 19253,6 Da
Masse des nicht-biotinylierten, einzelsträngigen Amplifikationsprodukts: 18758,2 Da300 nl of sample was mixed with 500 nl of saturated matrix solution (3-HPA: ammonium citrate = 10: 1 molar ratio in 50% aqueous acetonitrile), dried at ambient temperature and introduced into the mass spectrometer (Vision 2000, Finigan MAT). All spectra were recorded in reflector mode using external calibration. Outer primer

Nested primers:

Mass of biotinylated single-stranded amplification product: 19253.6 Da
Mass of non-biotinylated single-stranded amplification product: 18758.2 Da

Results

A MALDI-TOF mass spectrum of a human tyrosine 3-hydroxylase (hTH) -specific nested amplified product (61-mer) is described in U.S. Pat 64 shown. The signal at 18763 Da corresponds to a non-biotinylated strand of the amplified product (calculated: 18758.2 Da, mass error: 0.02 Da). The signals below 10,000 and above 35,000 Da are based on multiply charged or dimerically amplified product ions.

The product was recovered from a solid phase cDNA derived from a reverse transcription reaction of 1 x 10 ⁶ cells of a neuroblastoma cell line (LAN-1) as described above. The cDNA first strand was subjected to a first PCR using outer primers (hTH1 and hTH2), an aliquot of this PCR was used as a template in a second PCR using nested primers (biohTH and hTH6). The nested amplified product was purified and analyzed by MALDI-TOF-MS:
The spectrum in 64 shows the possibility of neuroblastoma cell determination by nested RT-PCR and analysis by MALDI-TOF-MS.

EXAMPLE 15

Quick detection of the mutation of the codon 634 of the RET proto-oncogene using mass spectrometry

MATERIALS AND METHODS

SAMPLE

The identity of codon 634 in each of the three alleles was confirmed by Rsal enzyme digestion, single-stranded conformation polymorphism or Sanger sequencing. The exon 11 of the RET gene was PCR amplified from genomic DNA (40 cycles) using Taq polymerase (Boehringer-Mannheim) with each 8 pmol of the 5'-biotinylated forward primer (5'-biotin-CAT GAG GCA GAG CAT ACG CA 3 'SEQ ID NO: 51) and the unmodified reverse primer (5'-GAC AGC AGC ACC GAG ACG AT). 3 ', SEQ ID NO: 52) were used per tube; the amplified products were purified with the QIAquick kit from Qiagen to remove unincorporated primers. 15 μl of the amplified product were immobilized on 10 μl (10 mg / ml) Dynal streptavidin-coated magnetic beads, denatured according to the manufacturer's protocol, and the supernatant containing the antisense strand was discarded, the PROBE reaction was monitored by ThermoSequenase ( TS) DNA polymerase (Amersham) and Pharmacia dNTP / ddNTPs. 8 pmole extension primer (5'-CGG CTG CGA TCA CCG TGC GG-3 ', SEQ ID NO: 53) was added to 13 μl H ₂ O, 2 μl TS buffer, 2 μl 2mM ddATP (or ddTTP) and 2 μl 0 , 5 mM dGTP / dCTP / dTTP (or dGTP / dCTP / dATP) was added, and the mixture was heated at 94 ° C for 30 sec, followed by 30 cycles of 10 sec at 94 ° C and 45 sec at 50 ° C; after a 5 minute incubation at 95 ° C, the supernatant was decanted and the products were desalted by ethanol precipitation with the addition of 0.5 μl of 10 mg / ml glycogen. The resulting sediment was washed in 70% ethanol, dried in air and suspended in 1 μl H ₂ O. 300 μl thereof was mixed with the MALDI matrix (0.7 M 3-hydroxypicolinic acid, 0.07 M ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) on a stainless steel sample holder and dried in air. The mass spectra were recorded with a Thermo Bioanalysis Vision 2000 MALDI-TOF operating in reflectron mode at 5 and 20 kV at the target and conversion dynodes, respectively. The described experimental masses (M _r (exp.)) Are those of neutral molecules as measured by external calibration.

Direct measurement of diagnostic Products

The PCR amplification conditions for a 44 bp region containing codon 634 were the same as above, but Pfu polymerase was used; the forward primer contained a ribonucleotide at the 3'-terminus (forward, 5'-GAT CCA CTG TGC GAC GAG C, (SEQ ID NO: 54) ribo; reverse, 5'-GCG (3CT GCG ATC ACC GTG C ( SEQ ID NO: 55). After immobilization of the product and washing, 80 μl of 12.5% NH ₄ OH was added and heated at 80 ° C overnight to cleave the primers from the 44-mer (sense strand), wherein an obtained 25-mer. the supernatant was pipetted off while hot, dried, resuspended in 50 ul H ₂ O, precipitated, resuspended, and measured as above by means of MALDI-TOF. the MALDI-FTMS spectra of the synthetic 25-mer Analogs were recorded as previously described (Li, Y., et al., (1996), Anal Chem. 68: 2090-2096.) In summary, 1-10 pmoles of DNA were mixed 1: 1 with matrix on a direct insertion probe into the external ion source (positive ion mode), ionized by irradiation with a laser pulse of 337 nm wavelength and by means of high-frequency only quadrupole stabs transferred into a magnetic field of 6.5 Tesla, where they were caught by shock. After a 15 sec delay, the ions were excited with a broadband chirp pulse and detected using 256K data points, producing time domain signals of 5 seconds duration. The recorded (neutral) masses are those of the most frequent isotopic peak after subtraction of the mass of the charge-carrying proton (1.01 Da).

Results

The first illustrated scheme uses the in 65 schematically shown PROBE reaction. A 20-mer primer is designed to specifically bind to an area on the complementary template that is downstream of the mutation site; when annealed to the matrix labeled with biotin and immobilized on streptavidin-coated magnetic beads, the PROBE primer is incubated with a mixture of the three deoxynucleotide triphosphates (dNTPs), a di-dNTP (ddNTP) and a DNA polymerase ( 65 ). The primer is extended by a series of bases specific for the identity of the variable base in codon 634; for any reaction mixture (eg, ddA + dT + dC + dG), three extension products representing the three alleles are possible ( 65 ).

For the negative control ( 66 ), the probe reaction with ddATP + dNTPs (N = T, C, G) causes a M _r (exp.) shift of the primer from 6135 to 6726 Da (Δm + 591). The lack of a peak at 6432 excludes a CA mutation ( 65 ); the mass of the single observed peak corresponds more to extension by C-ddA (M _r (calc.) 6721, + 0.07% error) than T-ddA (M _r (calc.) 6736, -0.15% error ) or as A ₃ TC ₂ G, what is expected for a C → A mutant. Combining the ddA and ddT reaction data reveals that the negative control at codon 634 is homozygous normal as expected.

The ddA response for patient 1 also gives a single peak (M _r (exp.) 6731) between the expected values for the wild type and the C →→ T mutation ( 65b ). However, the ddT reaction results in two clearly resolved peaks, which are consistent with a heterozygous wild type (M _r (exp.) 8249, + 0.04% ground fault) / C → T mutant (M _r (exp.) 6428 Da + 0.08% mass error). For patient 2, the ddA product pair represents the 66c a heterozygous C → A (M _r (exp) 6431, -0.06% mass error) / normal (M _r (exp.) 6719, -0.03% mass error) allele. The ddT reaction confirms this, where the only peak measured at 8264 Da is consistent with the unresolved wild-type and C → A alleles. The value of the double experiments is from a comparison of the 66a and 66b visible; while for patient 1 the peak at 6726 from the ddA reaction represents only one species, a similar peak in patient 1 is actually an unresolved pair of peaks whose masses differ by 15 Da.

An alternative scheme for the detection of point mutations is the differentiation of the alleles by direct measurement of the diagnostic product masses. A 44-mer containing the RET634 site was generated by PCR and the 19-mer sense primer was removed by NH ₄ OH cleavage on a ribonucleotide at its 3'-terminus.

67 Figure 13 shows a series of MALDI-FTMS spectra of synthetic analogs of short amplified products containing the RET634 mutant site. The 67a -C and 67d -F are homozygous or heterozygous genotypes. An internal calibration was performed using the most abundant isotopic peak for the wild type allele; the application of this (external) calibration to the other five spectra each gave a mass accuracy of better than 20 ppm. The differentiation of alleles by mass alone is clear, even for mixtures of heterozygotes whose components are around 16.00 ( 67d ), 2501 ( 67e ) or 9.01 Da ( 65f ). The value of high performance MS is clear when the detection of small DNA mass shifts is the basis for the diagnosis of the presence or absence of a mutation. The recent reintroduction of a delayed extraction (DB) technique has improved the performance of MALDI-TOF with short DNAs (Roskey, MT et al. (1996), Anal. Chem. 68: 941-946); a resolving power (RP) of> 10 ³ has been reported for a mixed-base 50-mer and a pair of 31-mer with a C or a T (Δm 15 Da) at a variable position has been resolved almost to baseline. Thus, DE-TOF-MS has demonstrated the RP necessary to separate the individual components of heterozygotes. However, even with DB, the accuracy of DNA mass determination with TOF is usually 0.1% (8 Da at 8 kDa) with external calibration, which is high enough to make incorrect diagnoses. Despite the possibility of space-charge-induced frequency shifts (Marshall, AG et al., (1991) Anal. Chem., 63: 215A-229A), MALDI-FTMS mass errors are rarely as much as 0.005% (0.4 Da at 8 kDa), an internal Calibration is unnecessary.

The here presented method for DNA point mutations can not only be used for the analysis of single-base mutations, for .... As well the less demanding detection of single or multiple base insertions or deletions and for the quantification of tandem repeats with two, three or four Use bases. The PROBE reaction gives products that analysis by ESI or MALDI devices with relatively low power accessible are; is the direct measurement of short amplified product masses an even more direct measure for proof of mutation, and is likely to increase with More interested in high performance MS available with FTMS.

EXAMPLE 16

Immobilization of the nucleic acids solid carriers over one Acid-labile covalent bifunctional trityl linker

Amino-linked DNA was prepared and purified according to standard procedures. A part (10 eq.) Was evaporated in a Speedvac to dryness and in anhydrous DMF / pyridine (9: 1, 0.1 ml). This was the chlorotrityl choride resin (1 eq. 1.05 μmol / mg Loading) and the mixture was shaken for 24 hours. The Loading was checked by a resin sample was taken, this detrityliert with 80% AcOH and the absorbance was measured at 260 nm. The loading was about 150 pmol / mg resin.

In 80% acetic acid is the half-life of the cleavage is considerably less than 5 min - in comparison to beginnings trityl ether-based with half-lives of 105 and 39 min for para- or meta-substituted bifunctional dimethoxytrityl linkers. Preliminary results have also shown that the hydroxypicolinic acid matrix is sufficient to cleave the DNA from the Chlortritylharz.

EXAMPLE 17

Immobilization of nucleic acids solid carriers over hydrophobic Trityl linker

Of the Primer contained a 5'-dimethoxytrityl group, routinely under Using a trityl-on-DNA synthesis was attached.

Cl8 beads from an oligo-cleaning cartridge (0.2 mg) were in a with Acetonitrile washed filter tip was added, and then was the DNA solution (50 ng in 25 μl) rinsed through. This was then quenched with 5% acetonitrile in ammonium citrate buffer (70 mM, 250 μl) washed. To remove the DNA from Cl8, the beads were washed with 40% acetonitrile in water (10 μl) and washed in a Speedvac to about 2 μl concentrated. The sample was then subjected to a MALDI.

The Results showed that acetonitrile / water in amounts of about> 30% for dissociation sufficient hydrophobic interaction. As used in MALDI Matrix contains 50% acetonitrile, Can the DNA from the carrier solved and successfully detected with MALDI-TOF-MS (where the trityl group during the MALDI method is removed).

69 is a schematic representation of nucleic acid immobilization by means of hydrophobic trityl linkers.

EXAMPLE 18

Immobilization of nucleic acids solid carriers via streptavidin-iminobiotin

Experimental procedure

2-iminobiotin-N-hydroxy-succinimide ester (Sigma) was awarded a 3'- or 5'-amino linker to the oligonucleotides conjugated, with the conditions proposed by the manufacturer were complied with. Termination of the reaction was by MALDI-TOF-MS analysis approved, and the product was purified by reverse phase HPLC.

For each reaction, 0.1 mg of streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin from Dynal) was incubated with 80 pmoles of the appropriate oligonucleotide in the presence of 1 M NaCl and 50 mM ammonium carbonate (pH 9.5) for 1 hour at room temperature. The beads with bound oligonucleotides were washed twice with 50 mM ammonium carbonate (pH 9.5). Then the beads were incubated in 2 μl 3-HPA matrix at room temperature for 2 min. An aliquot of 0.5 μl of 50 mM ammonium citrate was added to the beads. After a 5 minute incubation at room temperature, 1 μl of 3-HPA matrix was added and 0.5 μl supernatant was used for the MALDI-TOF MS. To maximize recovery of the bound iminobiotin oligos, the beads from the above treatment were again incubated with 2 μl of 3-HPA matrix and 0.5 μl supernatant was used for MALDI-TOF MS. In the case of the matrix alone and in the treatment with biotin only, iminobiotin oligo was quantitatively released from the streptavidin beads, as in US Pat 70 and 71 is shown.

EXAMPLE 19

Mutation analysis using of loop primer oligo base extension

MATERIALS AND METHODS

genomic DNA. Genomic DNA was obtained from healthy individuals and from patients, the sickle cell anemia suffer, receive. The wild-type sequences and the mutated sequences were on conventional Way by standard Sanger sequencing assessed.

PCR amplification. PCR amplifications of a portion of β-globin were performed and optimized to use the reaction product without further purification step for capture with streptavidin-coated beads. Target amplifications for LOOP-PROBE reactions were performed with loop cod5 d (GAG TCA GGT GCG CCA TGC CTC AAA CAG ACA CCA TGG CGC, SEQ ID NO: 58) as forward primer and β-11 bio (TCT CTG TCT CCA CAT GCC CAG, SEQ ID NO: 59) as a biotinylated reverse primer. The underlined nucleotide in the loop-cod5 primer is mutated to form an invariant Cfol restriction site in the Amplicon and the italic nucleotides are complementary to a portion of the amplified product. The total PCR volume was 50 μl including 200 ng of genomic DNA, 1 E Taq polymerase (Boehringer-Mannheim, cat. No. 1596594), 1.5 mM MgCl ₂ , 0.2 mM dNTPs (Boehringer-Mannheim, cat. No 1277 49) and 10 pmol of each primer. A specific fragment of the β-globin gene was amplified using the following cycling conditions: 94 ° C for 5 minutes followed by 40 cycles of: 94 ° C for 30 seconds, 56 ° C for 30 seconds, 72 ° C for 30 seconds, and one final extension for 2 minutes at 72 ° C.

Capture and denature the biotinylated templates. 10 μl of paramagnetic streptavidin-coated beads treated with 5 × binding solution (5 M NH ₄ Cl, 0.3 M NH ₄ OH) (10 mg / ml; Dynal, Dynabeads M-280 streptavidin Cat. No. 112.06) became 40 μl of PCR volume (10 μl of the amplified product was saved for verification by electrophoresis). After a 30 minute incubation at 37 ° C, the supernatant was discarded. The trapped templates were denatured with 50 μl of 100 mM NaOH for 5 min at ambient temperature, then washed once with 50 μl of 50 mM NH ₄ OH and three times with 100 μl of 10 mM Tris-Cl, pH 8.0. The single-stranded DNA served as templates for the PROBE reactions.

Primer oligo base Extensions (PROBE) reaction. The PROBE reactions were carried out with Sequenase 2.0 (USB Cat. No. E70775Z, including Buffer) as the enzyme and dNTPs and ddNTPs purchased from Boehringer-Mannheim (Cat. Nos. 1277049 and 1008382). The relation between the dNTPs (dCTP, dGTP, dTTP) and ddATP were 1: 1 and that of each Nucleotide total concentration was 50 μM. After adding of 5 μl 1-fold Sequenase buffer, the beads were 5 min at 65 ° C and 10 min incubated at 37 ° C. While At that time, the partially self-complementary primers annealed to the destination. The enzyme reaction started after addition of 0.5 μl of 100 mM Dithiothreitol (DTT), 3.5 μl dNTP / ddNTP solution and 0.5 μl Sequenase (0.8 U) and was at 37 ° C for 10 min incubated. Subsequently once in 1X TE buffer (10mM Tris, 1mM EDTA, pH 8.0).

Cfol restriction. Restriction enzyme digestion was used in a total volume of 5 μl using of 10 E Cfol in 1-fold Buffer L, purchased from Boehringer-Mannheim was performed. The Incubation time at 37 ° C was 20 minutes.

Conditioning of the diagnostic Products for mass spectrometric analysis

After restriction digestion, the supernatant was dissolved in 45 μl H ₂ O, 10 μl 3 M NH ₄ acetate (pH 6.5), 0.5 μl glycogen (10 mg / ml in water, Sigma, Cat. No. G1765) and 110 ul absolute ethanol for 1 hour at room temperature precipitated. After 10 minutes centrifugation at 13,000 x g the pellet was washed in 70% ethanol and resuspended in 2 .mu.l 18 Mohm / cm H ₂ O resuspended. The beads were washed in 100 μl of 0.7 M NH ₄ citrate and then in 100 μl of 0.05 M NH ₄ citrate. The diagnostic products were obtained by heating the beads in 2 μl of 50 mM NH ₄ OH at 80 ° C for 2 minutes.

Sample preparation and analysis by means of MALDI-TOF mass spectrometry.

The same preparation was prepared by mixing 0.6 μl matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) with 0.3 μl of the resuspended DNA / glycogen Sediment or supernatant after heating the beads in 50 mM NH ₄ OH on a sample target and allowed to air dry. The sample target was automatically placed in the source area of an unmodified Perspective Voyager MALDI-TOF instrument operating in the 5 and 20 kV delayed extraction linear mode at the target and conversion dynode, respectively. The theoretical molecular masses (M _r (calc.)) Were calculated from the atomic compositions. The recorded experimental values (M _r (exp.)) Are those of the singly protonated form.

RESULTS

The LOOP PROBE was tested for the most common mutation of codon 6 of the human β-globin gene; which causes sickle cell anemia. The individual steps of the process are shown schematically in 72 shown. For the analysis of codon 6, part of the β-globin gene was amplified by PCR using the reverse biotinylated primer β11 bio and the primer loop-cod5 modified to introduce a Cfol recognition site ( 72a ). The amplified product is 192 bp long. After PCR, the amplification product was bound to streptavidin-coated paramagnetic particles as described above. The single strand was isolated by denaturing the double-stranded amplified product ( 72b ) Isolated. The intramolecular attachment of the complementary 3'-end was done by a short heat-denaturation step and incubation at 37 ° C. The 3'-end of the antisense se-stranges is now partially double-stranded ( 72c ). To analyze the DNA downstream of the self-annealed 3 'end of the antisense strand, the primer oligo base extension (PROBE) was amplified using ddATP, dCTP, dGTP, dTTP ( 72d ) carried out. This produces products of different lengths that are specific to the genotype of the individual being analyzed. Prior to determining the length of these diagnostic products, the DNA was incubated with Cfol restriction endonuclease, which cleaves 5 'of the extended product. This step frees the stem loop from the template DNA, whereas the extended product remains bound to the template. The extended products are then denatured by heating from the template strand and analyzed by MALDI-TOF mass spectrometry.

Since the MALDI-TOF analyzes were performed on a non-calibrated instrument, the mass deviation between the observed and expected values was about 0.6% higher than theoretically calculated. However, the results obtained were conclusive and reproducible in repeated experiments. In all supernatants analyzed, the stem-loop could be detected after restriction digestion. Regardless of genotype, the stem-loop had molecular masses of about 8150 Da (expected 8111 Da) in all analyzes. An example is in 73a shown. The second peak in this figure with a mass of 4076 Da is a doubly charged ion of the stem loop. The 73b to 73d show the analyzes of the different genotypes, as shown in the corresponding sub-charts. HbA is the wild-type genotype and HbC and HbS are two different mutations in codon 6 of the β-globin gene that cause sickle cell disease. In the wild-type situation, a single peak with a molecular mass of 4247 Da and another with 6696 Da are detected ( 73b ). The latter corresponds to the biotinylated PCR primer (β-11-bio) not used in the PCR reaction, which was also removed in some experiments. The former corresponds to the diagnostic product for HbA. Analysis of the two individual DNA molecules with HbS property as well as compound heterozygosity (HbS / HbC) for sickle cell disorder also give unequivocally expected results ( 73c and 73d ).

The LOOP SAMPLE is therefore a powerful means of detection Mutations, especially predominant disease causing Mutations or general polymorphisms. The technique eliminated a specific reagent for mutation detection and thus simplifies the procedure and does it for you Automation accessible. The analyzed specific prolonged Product is cleaved from the primer and is therefore compared to the conventional one Procedure shorter. The addition efficiency is also opposite to Addition of an added primer is higher and should therefore be more product produce. The procedure is with the multiplexing and different Detection schemes (eg, single base extension, oligo base extension, and Sequencing) compatible. The extension of the LoopPrimers can For example, to produce short diagnostic Sequenzierleitern in strong polymorphic regions, for example HLA typing or resistance and species typing (eg Mycobacterium tuberculosis).

EXAMPLE 20

T7 RNA polymerase-dependent amplification of CKR-5 and detection by MALDI-MS

MATERIALS AND METHODS

genomic DNA. Human genomic DNA was obtained from healthy individuals.

PCR amplification and purification. PCR amplification of part of the CKR5 gene was performed with ckrT7f as sense primer d (ACC TAG CGT TCA GTT CGA CTG AGA TAA TAC GAC TCA CTA TAG CAG CTC TCA TTT TCC ATA C , SEQ ID NO: 60). The underlined sequence corresponds to the CKR-5 homologous sequence, the bolded sequence corresponds to the T7 RNA polymerase promoter sequence, and the italicized sequence was chosen at random. ckr5r was used as antisense primer d (AAC TAA GCC ATG TGC ACA ACA, SEQ ID NO: 61). Purification of the amplified product and removal of unincorporated nucleotides was done with the QIAquick Purification Kit (Qiagen, Cat. No. 28104). The final PCR volume of 50 μl contained 200 ng of genomic DNA, 1 U Taq polymerase (Boehringer-Mannheim, cat. No. 1596594), 1.5 mM MgCl ₂ , 0.2 mM dNTPs (Bochringer-Mannheim, cat No. 1277049) and 10 pmol each primer. The specific fragment of the CKR-5 gene was amplified under the following amplification conditions: 94 ° C for 5 minutes, followed by 40 cycles of 45 seconds at 94 ° C, 45 seconds at 52 ° C, 5 seconds at 72 ° C, and a final extension of 5 min at 72 ° C.

T7 RNA polymerase-conditions. One third of the purified DNA (about 60 ng) was used in the T7 RNA polymerase reaction (Boehringer-Mannheim, cat. No. 881767). The reaction was for for about 2 hours at 37 ° C according to the manufacturer's conditions using the enclosed buffer. The final reaction volume was 20 μl, 0.7 μl RNasin (33 U / μl) was added. After the extension reaction, the enzyme was inactivated by incubation for 5 min at 65 ° C.

DNA digestion and conditioning of the diagnostic Products for the mass spectrometry analysis

The template DNA was cleaved by addition of RNase-free DNase I (Boehringer-Mannheim, Cat. No. 776758) to the inactivated T7 mixture and incubation for 20 minutes at room temperature. The precipitation was carried out by adding 1 μl glycogen (10 mg / ml, Sigma, Cat. No. G1765), 1/10 volume 3 M NH ₂ acetate (pH 6.5) and 3 volumes of absolute ethanol and incubating for 1 hour at room temperature. After centrifugation at 13,000 g for 10 minutes, the sediment was washed with 70% ethanol and resuspended in 3 μl of 18 MOhm / cm H ₂ O. 1 μl was assayed on an agarose gel.

Sample preparation and analysis by MALDI-TOF mass spectrometry

The sample preparation was performed by adding 0.6 μl of matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) with 0.3 μl of resuspended DNA / glycogen mixed with a sample target and allowed to air dry. The sample target was placed in the source region of an unmodified Finnigan VISION 2000 MALDI-TOF instrument operated at 5 kV in reflectron mode. The theoretical molecular mass was calculated from the atomic composition; the recorded experimental values are those of the simply protonated form.

RESULTS

The chemokine receptor CKR-5 has been identified as the major coreceptor in HIV-1 (see e.g. WO 96/39437 of Human Genome Sciences; Cohen, J. et al. Science 275: 1261). A mutant allele characterized by a 32bp deletion is found in 16% of the HIV seronegative population, whereas the frequency of this allele is 35% lower in the HIV-1 seropositive population. It is believed that individuals homozygous for this allele are resistant to HIV-1. T7 RNA polymerase-dependent amplification was applied to this specific region of the chemokine receptor CKR-5 (FIG. 74 ) to identify. Human genomic DNA was amplified by conventional PCR. The sense primer was modified to contain a random sequence of 24 bases that facilitated binding of the polymerase and the T7 RNA polymerase promoter sequence ( 75 ). The putative start of transcription occurs at the first base 5 'of the promoter sequence. ckr5r was used as an antisense primer. The PCR conditions are listed above. The amplified product derived from the wild-type alleles is 75 bp in length. The primers and nucleotides were separated from the amplification product using Qiagen QIAquick Purification Kit. One third of the purified product was subjected to in vitro transcription with T7 RNA polymerase. To circumvent an influence of the template DNA, this was cleaved with RNase-free DNase I. The RNA was precipitated and at this step the degraded DNA also remains in the supernatant. Part of the dissolved RNA was analyzed on an agarose gel and the remainder of the sample was prepared for MALDI-TOF analysis. The expected calculated mass of the product is 24560 Da. A dominant peak corresponding to an approximate mass of 25378.5 Da can be observed. Since the peak is very broad, accurate molecular weight determination was not possible. The peak does not correspond to the remaining DNA template. First, the template DNA is cleaved and second, the DNA strands have a mass of 23036.0 and 23174 Da, respectively.

This Example shows that the T7 RNA polymerase efficiently amplifies target DNA can. The generated RNA can be detected by mass spectrometry become. Together with modified (eg 3'-deoxy) ribonucleotides that are specific incorporated by RNA polymerase but can not be extended further this method is used to determine the sequence of a template DNA become.

EXAMPLE 21

MALDI mass spectrometry of RNA endonuclease cleavage

MATERIALS

Synthetic RNA samples (Sample A: 5'-UCCGGUCUGAUGAGUCCGUGAGGAC-3 '(SEQ ID NO: 62); Sample B: 5'-GUCACUACAGGUGAGCUCCA-3' (SEQ ID NO: 63) Sample C: 5'-CCAUGCGAGAGUAAGUAGUA-3 ' (SEQ ID NO: 64)) were obtained from DNA Technology (Aahus, Denmark) and denatured Purified polyacrylamide gel (Shaler, TA et al., (1996) Anal. Chem. 63: 576-579). RNases T ₁ (Eurogentec), U ₂ (Calbiochem), A (Boehringer-Mannheim) and PhyM (Pharmacia) were used without additional purification. Streptavidin-coated magnetic beads (Dynabeads M-280 streptavidin, Dynal) were suspended as a suspension of 6-7 x 10 ⁸ beads / ml (10 mg / ml) dissolved in phosphate buffered saline (PBS) containing 0.1% BSA and 0.02 % NaN ₃ provided. 3-hydroxypicolinic acid (3-HPA) (Aldrich) was purified by a separate desalting step prior to use, as described in more detail elsewhere (Little, DP et al., (1995) Proc Natl Acad Sci., USA 92: 2318 -2322).

METHODS

In vitro transcription reaction. The 5'-biotinylated 49 nt in vitro transcript (SEQ ID NO: 65):
AGGCCUGCGGCAAGACGGAAAGACCAUGGUCCCUNAUCUGCCGCAGGAUC was prepared by transcription of the plasmid pUTMS2 (linearized with the restriction enzyme BamHI) with T7 RNA polymerase (Promega). For the transcription reaction, 3 μl template DNA and 50 μl T7 RNA polymerase were added in a 50 μl volume of 1 U / μl RNA Guard (Rnax inhibitor, Pharmacia), 0.5 mM dNTPs, 1.0 mM 5 -Biotin-ApG dinucleotide, 40 mM Tris-HCl (pH 8.0), 6 mM MgCl ₂ , 2 mM spermidine and 10 mM DTT. Incubation was at 37 ° C for 1 hour, then another aliquot of 50 units of T7 RNA polymerase was added and incubation continued for an additional 1 hour. The mixture was adjusted to 2 M NH ₄ acetate and the RNA was precipitated by adding one volume of ethanol and one volume of isopropanol. The precipitated DNA was recovered by centrifugation at 20,000 xg for 9 minutes at 4 ° C, the sediment was washed with 70% ethanol, dried and redissolved in 8M urea. Further purification was by electrophoresis through a denaturing polyacrylamide gel as described elsewhere (Shaler, TA et al., (1996) Anal. Chem. 68: 576-579). The ratio of 5'-biotinylated to non-biotinylated transcripts was about 3: 1.

Ribonuclease test. For the partial digestion with selected RNases different enzyme concentrations and test conditions were used as summarized in Table VII. The solvents for each enzyme were selected according to the manufacturer's instructions. The concentrations of the synthetic RNA samples and the in vitro transcript were adjusted to 5-10 x 10 ^-6 M. TABLE VII Overview and Test Conditions of RNases RNase source Concentration [Units Rnase / μg RNA] conditions Incubation time (maximum number of fragments) references T ₁ Aspergillus oryzae 0.2 20mM Tris-HCl, pH 5.7, 37 ° C 5 min Danis-Keller, H. et al. (1977), Nucl. Acids Res. 4: 2527-2537 U ₂ Ustilago Sphaerogena 0.01 20mM DAC, pH 5.0, 50 ° C 15 minutes Danis-Keller, H. et al. (1977), Nucl. Acids Res. 4: 2527-2537 PhyM Physarum polycephalum 20 20mM DAC, pH 5.0, 50 ° C 15 minutes Danis-Keller, H. et al. (1980), Nucl. Acids Res. 8: 3133-3142 A Bovine pancreas 4 × 10 ^-9 10 mM Tris-HCl, pH 7.5, 37 ° C 30 min Breslow, R. and R. Xu. (1993) Proc. Natl. Acad. Sci. USA 90: 1201-1207 CL ₃ chicken liver 0.01 10 mM Tris-HCl, pH 6.5, 37 ° C 30 min Boguski et al. (1980) J. Biol. Chem. 255: 2160-2163 cusativin Cucumis sativus L. 0.05 ng 10 mM Tris-HCl, pH 6.5, 37 ° C 30 min Rojo, MA et al. (1994) Plants 194: 328-338

The Reaction became too selected Times stopped by 0.6 μl aliquots of the test mixed with 1.5 μl of 3-HPA solution were. The solvent was subsequently in a cold air stream for the MALDI-MS analysis evaporates.

Limited alkaline hydrolysis was performed by mixing equal volumes (2.0 μl) of 25% ammonium hydroxide and RNA sample (5-10 x 10 ^-6 M) at 60 ° C. At certain times, 1 μl aliquots were removed and dried in a cold air stream. It has been found that it is important for these samples to first dry the cleavage products in a cold air stream before adding 1.5 μl of the matrix solution and 0.7 μl of NH ₄ ⁺ -loaded cation-exchanged polymer beads.

The Reaction became too selected Times stopped by 0.6 μl aliquots of the test mixed with 1.5 μl 3HPA solution were. The solvent was subsequently in a cold air stream for the MALDI-MS analysis evaporates.

Limited alkaline hydrolysis was performed by mixing equal volumes (2.0 μl) of 25% ammonium hydroxide and RNA sample (5-10 x 10 ^-6 M) at 60 ° C. At certain times, 1 μl aliquots were removed and dried in a cold air stream. It turned out that it is important for these samples to first dry the cleavage products in a cold air stream before 1.5 μl of the Matrix solution and 0.7 ul of a suspension of NH ₄ ⁺ -loaded cation-exchanged polymer beads were added.

Separation of the 5'-biotinylated fragments. Streptavidin-coated magnetic beads were used to separate 5'-biotinylated fragments of the in vitro transcript after partial RNase digestion. The biotin moiety in the sample was introduced during the transcription reaction started by the 5'-biotin pApG dinucleotide. Before use, the beads were washed twice with 2X binding and washing buffer (b & w) (20mM Tris-HCl, 2mM EDTA, 2M NaCl, pH 8.2) and 10mg / ml in 2x b & w buffer resuspended. About 25 pmol of the in vitro RNA transcript was cleaved with RNase U2 according to the protocol described above. Cleavage was performed by adding 3 μl of 95% formamide containing 10 mM trans-1,2-diaminocyclohexane-N, N, N ', N'-tetraacetic acid (CDTA) at 90 ° C for 5 mm, and subsequent cooling on ice, finished. Subsequently, capture of the biotinylated fragments was achieved by incubation of 6 μl of the digest with 6 μl of the bead suspensions and 3 μl of the b & w buffer at room temperature for 15 minutes. Given a binding capacity of the beads of 200 pmol of biotinylated oligonucleotide per mg of beads as indicated by the manufacturer, a nearly 2-fold excess of oligonucleotide was used to ensure complete loading of the beads. The supernatant was removed and the beads were washed twice with 6 μl H ₂ O. The CDTA and 95% formamide at 90 ° C for 5 min. After evaporation of the solvent and formamide, ≤ 2.5 pmoles of the fragments were resuspended in 2 μl H ₂ O and assayed by MALDI-MS as described above.

Sample preparation for MALDI-MS. 3-hydroxypicolinic acid (3-HPA) was dissolved in ultrapure water at a concentration of about 300 mM. Metal cations were exchanged for NH ₄ ⁺ as described in detail above (Little, DP et al., (1995) Proc Natl Acad Sci., USA 92: 2318-2322). Aliquots of 0.6 μl of the analyte solution were mixed with 1.5 μl of 3-HPA on a flat inert metal substrate. The remaining alkali cations present in the sample solution as well as on the substrate surface were removed by the addition of 0.7 μl of the solution of NH ₄ ⁺ -loaded cation exchange polymer beads. During evaporation of the solvent, the beads accumulated in the center of the preparation, were not used for analysis, and were easily removed with a pipette tip.

Device. A prototype of the Vision 2000 (ThermoBioanalysis, Hemel, Hempstead UK) reflectron time-of-flight mass spectrometer was used for mass spectrometry. Ions were generated by irradiation with a triple-frequency ND: YAG laser (355 nm, 5 ns, Spektrum GmbH, Berlin, Germany) and accelerated to 10 keV. Delayed ion extraction was used to record the spectra shown, as it was found that this significantly enhanced the signal-to-noise ratio and / or signal intensity. The equivalent flight path length of the system is 1.7 m, the base pressure is 10 ^-4 Pa. The ions were detected with a separate secondary electron dynode multiplier (R 2362, Hamamatsu Photonics) equipped with a conversion dynode for effective detection of high mass ions. The total impact energy of the ions on the conversion dynode was adjusted to values in the range of 16 to 25 keV depending on the mass to be detected. The pre-amplified output of the SEM was digitized with a LeCroy 9450 transient recorder (LeCroy, Chestnut Ridge, NY, USA) at a sampling frequency of up to 400 MHz. For storage and further evaluation, the data was transferred to a PC equipped with specially prepared software (ULISSES). All spectra shown were taken in positive ion mode. Between 20 and 30 single spectra were averaged for each spectrum.

RESULTS

Specificity of RNases. For the combination of base-specific RNA cleavage with MALDI-MS, reaction conditions are required that are optimized in such a way that the activity and specificity of the selected enzymes are retained on the one hand, while being guided by the general conditions for MAIDs on the other hand. Predominantly, this leads to incompatibility since the alkali ion buffers commonly used in the described reaction, such as Na phosphate, Na citrate or Na acetate, and EDTA interfere with MALDI sample preparation; they probably interfere with matrix crystallization and / or analyte incorporation. Tris-HCl or ammonium salt buffer, on the other hand, are MALDI compatible (Shaler, TA et al., (1996) Anal. Chem. 68: 576-579). Alkaline salts in the sample also cause the formation of a heterogeneous mixture of multiple analyte salts, a problem that increases with increasing number of phosphate groups. These mixtures result in a loss of mass resolution and accuracy as well as a poorer signal-to-noise ratio (Little, DP et al., (1995) Proc. Natl. Acad Sci., USA 92: 2315-2322; Nordhoff E., Cramer, R., Karas, M., Hillenkamp, F., Kirpekar, F., Kristiansen, K. and Roepstorff, P. (1993), Nucleic Acids Res. 21: 3347-3357). The RNase digestions were therefore carried out under conditions that compared to those in the litera conditions are somewhat modified. These are summarized in Table VII above. For RNase T ₁ , A, CL ₃ and Cusativin Tris-HCl (pH 6-7.5) was used as buffer. 20 mM DAC provides a pH of 5, which is recommended for maximal activity of RNases U2 and PhyM. It has been found that a concentration of these compounds of 10-20 mM does not significantly affect the MALDI analysis. To investigate the specificity of the selected ribonucleases under these conditions, three synthetic 20-25 mer RNA molecules with different nucleotide sequences were digested.

The MALDI-MS spectra of 77 show five different cleavage patterns (A-E) of a 25 nt RNA, which were obtained after partial digestion with the RNases T ₁ , U ₂ , PhyM, A and alkaline hydrolysis. These spectra were recorded from aliquots taken from the assay after empirically determined incubation times that were chosen to optimally cover the sequence. Since the resulting samples were not fractionated prior to mass spectrometry analysis, they contained all fragments generated at this time by the corresponding RNases. In practice, the uniformity of the cleavages can be influenced by preferential attack on specific phosphodiester bonds (Donis-Keller, H., Maxam, AM and Gilbert, W. (1977), Nucleic Acids Res. 4: 1951-1978; Donis Cell, H. (1980), Nucleic Acids Res. 8: 3133-3124). The majority of the expected fragments are actually observed in the spectra. It is also noteworthy that for the reaction protocols that have been used, correct assignment of all fragment masses is possible only if one assumes a 2 ', 3'-cyclic phosphate group. It is well known that such cyclic phosphates are intermediates of the cleavage reaction and are hydrolyzed in a second independent and slower reaction step involving the enzyme (Richards, FM and Wycoff, HW in The Enzymes Vol. 4, 3rd ed. (Boyer, PD) 746-806 (1971, Academic Press, New York), Heinemann, U. and W. Saenger (1985) Pure Appl Chem 57: 417-422, Ikehara, M. et al. 1987), Pure Appl Chem 59: 965-968, Vreslow, R. and Xu, R. (1993), Proc Natl Acad Sci USA 90: 1201-1207). In some cases, different fragments have equal masses or differ only by 1 dalton. In these cases, the mass peaks can not be uniquely assigned to one or the other fragment. Therefore, digestion of two additional different 20 nt RNA samples was performed (Hahner, S., Kirpekar, F., Nordoff, E., Kristiansen, K., Roepstorff P. and Hillenkamp, F., (1996) Proceedings of the 44 ^th ASMS Conference on Mass Spectrometry, Portland, Oregon) to dispel these doubts. For all the samples tested, the selected ribonucleases appear to cleave exclusively at the particular nucleotides resulting in fragments resulting from single and multiple cleavages.

In 77 For example, those peaks that indicate fragments with the original 5 'terminus are marked with arrows. All non-labeled peaks can be assigned internal sequences or those with remaining 3'-terminus. For a complete sequence, all possible fragments carrying exclusively either the 5 'or 3' terminus of the original RNA would suffice. In practice, the 5 'fragments are better suited for this purpose, as the spectra obtained after incubation of all three synthetic RNA samples contain almost the entire set of original 5' ions for all different RNases (Hahner, et al. S., Kirpekar, F., Nordoff E., Kristiansen, K., Roepstorff and Hillenkamp, F. (1996) Proceedings of the 44 ^th ASMS Conference at Mass Spectrometry, Portland, Oregon). Inner fragments are slightly less abundant and fragments containing the original 3'-terminus appear to be suppressed in the spectra. In accordance with the observations described in the literature (Gupta, RC and Randerath, K. (1977) Nucleic Acids Res. 4: 1957-1978), cleavages close to the 3 'terminus were performed in partial digests of the RNA-25mer RNase T ₁ and U _{2 are} partially suppressed (even if they are inside or have the original 5 'terminus). Fragments from these cleavages appear in the mass spectra as weak and poorly resolved signals.

For larger RNA molecules, it is known that the secondary structure affects the uniformity of enzymatic cleavage (Donis-Keller, H. Maxam, AM and Gilbert, W. (1977), Nucleic Acids Res. 8, 3133-3142). This can be mastered in principle by changing reaction conditions. In the test solutions of 5-7 M urea, the activity of RNases, such as T _2, U _2, A, ₃ and Cl PhyM condition known (Donis-Keller, H remains: Maxam, AM and Gilbert, W. (1977), Nucleic Acids Res. 4: 2527-2537); Boguski, MS Hieter, PA and Levy, C.C. (1980) J. Biol. Chem., 255: 2160-2163; (Doni-Keller, H. (1980), Nucleic Acids Res. 8, 3133-3142), where the RNA is sufficiently denatured. The UV-MALDI analysis with 3-HPA as a matrix is not possible at such high urea concentrations in the sample. The MALDI analysis of the samples was still possible up to a concentration of 2 M urea in the reaction buffer, although significant changes in matrix crystallization were observed. The spectra of the RNA-20mer (Sample B) digested in the presence of 2 M urea were still similar to those obtained under the conditions listed in Table VII.

Cleavage with RNases that recognize only one nucleobase is desirable to reduce the complexity of fragmentation patterns and thus facilitate the mapping of the corresponding nucleobase. The RNases CL ₃ and cursavitin are enzymes that have been reported to cleave at cytidic acid residues. With restricted RNase-CL ₃ and cursive-in digestion of the RNA 20-mer (sample B) under non-denaturing conditions, fragments corresponding to the cleavages at the cytidyl residues were actually observed ( 78 ). This corresponds approximately to the data described so far (Boguski, MS, Hieter, PA and Levy, CC (1980), J. Biol. Chem. 255: 2160-2163; Rojo, MA, Arias, FL, Iglesias, R., Ferreras, JM, Munoz, R., Escarmis, C., Soriano, F., Llopez-Fando, Mendez, E., and Girbes, T. (1994), Planta 194: 328-338). The degradation pattern in 78 shows, however, that not every cytidine residue is recognized, especially adjacent C residues. It is also described that RNase CL ₃ is sensitive to the influence of secondary structure (Boguski, MS, Mieter, PA and Levy, CC (1980), J. Biol. Chem. 255: 2160-2163), but for RNA the size used in this study would be such an influence to neglect. Therefore, unrecognized cleavage sites in this case can be attributed to a lack of specificity of this enzyme. To confirm these data, a further RNase CL was performed ₃ -Verdau with the RNA 20-mer (Sample C). As a result of the sequence of this analyte, all three linkages containing cytidylic acid were readily hydrolyzed, but additional cleavage of uridylic acid residues was also observed. Since altered reaction conditions, such as elevated temperatures (90 ° C), different enzyme-to-substrate ratios, and the addition of 2 M urea did not cause digestion of the expected specificity, application of this enzyme for sequencing was not considered. The introduction of a novel cytidine-specific ribonuclease, Cusativin, isolated from dry seeds of Cucumis sativus L., looked promising for RNA sequencing (Rojo, MA, Arias, FJ, Iglesias, R., Ferraras, JM, Munoz, R , Escarmis, C., Soriano, F., Llopez-Fando, J., Mendez, E., and Girbes, T. (1994), Planta 194: 328-338). As in 78 Not all cytidine residues were hydrolyzed and additional cleavages occurred at the recommended enzyme concentration of uridyl acid residues. Therefore, the RNases CL ₃ and Cusativin do not give the desired sequence information for the mapping of cytidine residues, and their use was not further considered. However, the discrimination of pyrimidine residues can be accomplished using RNases with multiple specificities, such as Physarum polycephalum RNase (cleaves ApN, UpN) and pancreatic RNase A (cleaves UpN, CpN) (see 77 ). All 5'-terminal fragments generated by the monospecific RNase U ₂ and in the spectrum of 77C were also in the spectrum of RNase-PhyM digestion ( 77D ) recognizable. Five of the six uridyl cleavage sites could thus be uniformly identified by this indirect method. In a next step, the knowledge of the uridine cleavage sites was used to identify the cleavage sites of the cytidic acid residues in the spectrum, which was taken after incubation with RNase A ( 77E ), again using only ions with the original 5'-terminus. Two of the four expected cleavage sites were identified in this way. Some limitations are evident from these spectra when only the fragments containing the original 5 'terminus are used for sequence determination. The first two nucleotides usually evade analysis because their signals are lost in the low mass matrix background. For this reason, the corresponding fragments are absent in the spectra of U- and C-specific cleavages. Large fragments with cleavage sites near the 3'-terminus are often difficult to identify, especially when digested with the RNases T ₁ and U ₂ because of their low yield (see above) and the often strong nearby signal of the undigested transcript. Accordingly, the cleavages at position 22 and 23 do not appear in the spectrum of the G-specific RNase T ( 77A ) and cleavage site 24 can not be identified from the spectra of the U ₂ and PhyM digests ( 77 C and D). Sites 16 and 17 with two adjacent cytidylic acids can be found in the RNase-A spectrum of 77E also can not be determined. These observations indicate that determination of exclusively 5 'terminus fragments may not always be sufficient, and that the information contained in the internal fragments may be necessary for complete sequence analysis.

Finally, limited alkaline hydrolysis provided a continuum of fragments ( 77B ) which can be used to complete the sequence data. Again, the spectrum is dominated by fragment ions containing the 5'-terminus, although the hydrolysis should be the same for all phosphodiester bonds. As can be seen from the enzymatic cleavages, correct mass assignments suggest that all fragments have a 2 ', 3'-cyclic phosphate. The distribution of the peaks is therefore similar to that obtained after a 3 'exonuclease digestion (Pieles, U., Zurcher, W., Schar, M. and Moser, HE (1993), Nucleic Acids Res. 21: 3191- 3196;.. Nordhoff, E. et al (1993), Book of Abstracts, 13 ^th Internat Conf Mass Spectrom Budapest, p 218;.. Kirpekar, F., Nordhoff, E., Kristiansen, K., Roepstorff, P , Lezius, A., Hahner, S., Karas, M. and Hillenkamp, F. (1994), Nucleic Acids Res. 22, 3866-3870). Basically, alkaline hydrolysis alone could therefore be used for complete sequencing. However, this is only possible for relatively small oligoribonucleotides, since larger fragment ions, which differ in mass only by a few mass units, are not resolved in the spectra the mass and mass of larger ions can not be resolved with the required accuracy of better than 1 Da, even if the peaks are partially or completely dissolved. The interpretation of the spectra, in particular from digestion of unknown RNA samples, is greatly simplified if only the fragments containing the original 5 'terminus are separated before mass spectrometric analysis. A procedure for this approach is described in the following section.

Separation of the 5'-biotinylated fragments. Streptavidin-coated magnetic beads (Dynal) were screened for extraction of fragments containing the original 5'-terminus from the digests. The key features that need to be checked for this solid phase approach are the selective immobilization and efficient elution of the biotinylated species. In previous experiments, a 5'-biotinylated DNA (19 nt) and streptavidin were incubated and analyzed by standard preparation using MALDI. Despite the high affinity of the streptavidin-biotin interaction, the intact complex was not found in the MALDI spectra. Instead, signals of the monomeric subunit of streptavidin and the biotinylated DNA were detected. It is not known if the complex dissociates in the acid matrix solution (pKa 3) or during the MALDI desorption process. Surprisingly, the same results are not observed when streptavidin is immobilized on a solid surface such as magnetic beads. A mixture of two 5'-biotinylated DNA samples (19 nt and 27 nt) and two unlabeled DNA sequences (12 nt and 22 nt) was incubated with the beads. The beads were extracted and washed thoroughly before incubation in the 3-HPA-MALDI matrix. From these samples no analyte signals could be obtained. To examine whether the biotinylated species had bound to the beads, elution of the extracted and washed beads was performed by heating in the presence of 95% formamide at 90 ° C. This method is expected to denature streptavidin, breaking the streptavidin / biotin complex. 79B shows the expected signals of the two biotinylated species, which proves; that the detachment of the bound molecules in the MALDI process is the problem and not the binding of the beads; 79A shows a spectrum of the same sample according to standard preparation, which shows signals of all four analytes as a reference. Complete removal of the formamide after elution and prior to mass spectrometry analysis was found to be important, otherwise the crystallization of the matrix is impaired. The mass resolution and the signal-to-noise ratio in the spectrum of 79B are comparable to those of the comparative spectrum. These results confirm the specificity of the streptavidin-biotin interaction, as little or no signals of the non-biotinylated analyte were detected after incubation with the Dynal beads. Increased suppression of nonspecific binding was observed by addition of the detergent Tween 20 to the binding buffer (Tong, X. and Smith, L.M. (1992) Anal. Chem. 64, 2672-2677). Although this effect could be confirmed in this study, peak broadening affected the quality of the spectra due to the residual amount of detergent. The necessity of an elution step as a prerequisite for the detection of trapped biotinylated species can be attributed to a stabilizing effect of the complex by immobilization of the streptavidin to the magnetic beads.

For the practical application of this solid phase method of sequencing, maximum efficiency of binding and elution of the biotinylated species is of paramount importance. Among a variety of conditions studied so far, the addition of salts such as EDTA gave the best results in the case of DNA sequencing by giving the buffer ionic strength (Tong, X. and Smith, LM (1992), Anal. Chem. 2672-2677). To investigate such an effect on the solid phase method, several salt additives were tested for the binding and elution of the 5'-biotinylated RNA in vitro transcript (49 nt). The results are in 80 shown. Evaluation of the relative intensity, signal-to-noise ratio and resolution of the corresponding signals revealed that a 95% formamide solution containing 10 mM CDTA ( 80D ) is most effective for binding / elution. Since CDTA functions as a chelator for divalent cations, the formation of a correct secondary and tertiary structure of the RNA is prevented. Improved sensitivity and spectral resolution has been demonstrated under these conditions for the analysis of RNA samples by electron spray mass spectrometry (Limbach, PA, Crain, PF and McCloskey, JA (1995), J. Am. Soc. Mass. Spectrom , 27-39). In fact, the improvement in MALDI analysis is not very significant compared to the spectrum obtained for the solution containing only formamide ( 81b ), but the reproducibility for good quality spectra for the CDTA / formamide solution has been significantly improved. In addition to improved binding / elution, this additive can also enhance incorporation of the analyte into the matrix crystals. Unfortunately, striking signal broadening was observed on the high mass side with formamide solutions containing EDTA, CDTA or 25% ammonium hydroxide. Since this effect is most noticeable with 25% ammonium hydroxide and this agent was also used to adjust the optimal pH value in EDTA and CDTA, a strong NH ₃ can be assumed -Adduktionenbildung.

The utility of streptavidin-coated magnetic beads separation for RNA sequencing was demonstrated for the RNase U ₂ cleavage of the 5'-biotinylated RNA in vitro transcript (49 nt) ( 81 ). The entire fragment pattern obtained after incubation with RNase 132 is in spectrum 81A shown. The separation of the biotinylated fragments reduces the complexity of the spectrum ( 81B ), since only 5'-terminal fragments are captured by the beads. The signals in the spectrum are broadened and the increased number of signals in the low mass range indicates that even after stringent washing of the beads, some amount of buffer and detergent used for binding and elution remains. Further improvements of the method are therefore needed. Another possible strategy for using the magnetic beads is immobilization of the target RNA prior to RNase cleavage by elution of the remaining fragments for further analysis. Cleavage of the RNA was hindered in this case, as evidenced by a prolonged reaction time for cleavage under otherwise identical reaction conditions.

EXAMPLE 22

Parallel DNA sequencing mutation analysis and microsatellite analysis using primers with labels and mass spectrometry detection

This Example describes the specific capture of DNA products, which are generated in the DNA analysis. The capture is through a specific label (5 to 8 nucleotides long) at the 5 'end of the analyte which binds to a complementary sequence. The capture sequence can be replaced by a partially double-stranded oligonucleotide, the to a solid support is bound to be provided. Another DNA analysis (eg. Sequencing, mutation, diagnosis, microsatellite analysis) carried out in parallel wherein, for example, a conventional tube or a microtiter plate (MTP) is used. The products are then specifically captured and by means of the complementary Identification sequence sorted on the tag oligonucleotide. The capture oligonucleotide can via a chemical or biological bond to a solid support (e.g. B silicon chip). The identification of the sample becomes provided by the predefined position of the major oligonucleotide. Purification, conditioning and analysis by mass spectrometry take place on a solid support. This procedure was used to capture specific primers with a 6-base labeling sequence applied.

MATERIALS AND METHODS

Genomic DNA.

genomic DNA was obtained from healthy individuals.

PCR amplification

PCR amplification of a portion of the β-globin gene was performed using β-2d (CATTTGCTTCTGACACAACT, SEQ ID NO: 66) as the forward primer and β11d (TCTCTGTCTCCACATGCCCAG, SEQ ID NO: 67) as the reverse primer , The total PCR volume was 50 μl, including 200 ng of genomic DNA; 1 E Taq polymerase (Boehringer-Mannheim, Cat. No. 159594); 1.5 mM MgCl ₂ , 0.2 mM dNTPs (Boehringer-Mannheim, cat. No. 1277049) and 10 pmoles of each primer. A specific fragment of the β-globin gene was amplified using the following cycling conditions: 94 ° C for 5 min, followed by 40 cycles of 30 sec at 94 ° C, 45 sec at 53 ° C, 30 sec at 72 ° C and a final extension of 2 min at 72 ° C. Purification of the amplified product and removal of unincorporated nucleotides was done with the QIAquick Purification Kit (Qiagen, Cat. 28104). One fifth of the purified product was used for primer oligo base extension (PROBE) or for sequencing reactions.

Primer oligo-base extension (PROBE) and sequencing reactions

The detection of the putative mutations in the human β-globin gene at codons 5 and 6 and at codon 30 or in the IVS-1 donor site was performed in parallel ( 82A ). β-TAG1 (GTCGTCCCATGGTGCACCTGACTC, SEQ ID NO: 68) served as a primer to analyze codons 5 and 6 and β-TAG2 (CGCTGTGGTGAGGCCCTGGGCA, SEQ ID NO: 69) for codons 30 and IVS-1 donor site analyzes. The primer oligo base extension (PROBE) reaction was performed by cycling using the following conditions: the final reaction volume was 20 μl, β-TAG1 primer (5 pmol), β-TAG2 primer (5 pmol), dCTP, dGTP, dTTP (final concentrations 25 μM each), ddATP (final concentration 100 μM) (the dNTPs and ddNTPs were purchased from Boehringer-Mannheim, cat. Nos. 1277049 and 1008382), 2 μl 10 × ThermoSequence buffer and 25 E ThermoSequenase (Amersham, Cat. No. E79000Y). The cycle program was as follows: 5 minutes at 94 ° C, 30 seconds at 53 ° C, 30 seconds at 72 ° C, and a final extension step at 72 ° C for 8 minutes. The sequencing was carried out under the same conditions except that the reaction volume was 25 μl and the concentration of nucleotides for ddNTP was 250 μM.

Capture by means of the TAG sequence and Sample Preparation

Capture oligonucleotides cap-tag1 d (GACGACGACTGCTACCTGACTCCA, SEQ ID NO: 70 and cap-tag2d (ACAGCGGACTGCTACCTGACTCCA, SEQ ID NO: 71, respectively) were hybridized to equimolar amounts of uni-as d (TGGAGTCAGGTAGCAGTC, SEQ ID NO: 72 ( 82A ). Each oligonucleotide had a concentration of 10 pmol / μl in ddH ₂ O and was incubated for 2 min at 80 ° C and 5 min at 37 ° C. This solution was stored at -20 ° C and aliquots were removed. Ten pmol annealed capture oligonucleotides were bound by incubation for 30 min at 37 ° C to 10 μl of streptavidin-coated paramagnetic beads (10 mg / ml, Dynal, Dynabeads M-280 streptavidin Cat. No. 112.06). The beads were captured and the PROBE or sequencing reaction was added to the capture oligonucleotides. To facilitate the binding of β-TAG1 or β-TAG2, the reaction was incubated at 25 ° C for 5 minutes and at 16 ° C for 30 minutes. The beads were washed twice with ice-cold 0.7 M NH ₄ citrate to wash away unspecifically bound extension products and primers. The bound products were dissolved by addition of 1 μl of DDH ₂ O and incubation for 2 min at 65 ° C. and cooling on ice. 0.3 μl of the sample was mixed with 0.3 μl of matrix solution (saturated 3-hydroxypicolinic acid, 10% molar ratio ammonium citrate in acetonitrile / water (50/50, v / v)) and allowed to air dry automatically introduced into the source region of an unmodified Perspective Voyager MALDI-TOF, which was operated in linear mode with delayed extraction with 5 and 20 kV on the target and the conversion dynode. theoretical average molecular mass (M _r (calc.)) were calculated from the atomic compositions, the experimental M _r (exp.) values described were those of the singly protonated form.

RESULTS

Specific capture of a mixture of extension products by a short complementary sequence was used to isolate sequencing and primer oligo base extension (PROBE) products. This method was used to detect putative mutations in the human β-globin gene in codons 5 and 6 and in codon 30 and the IVS-1 donor site, respectively ( 82A ). Genomic DNA was amplified with primers β2 and β11. The amplification product was purified and the nucleotides were separated. One fifth of the purified product was used for analyzes by primer oligo base extension. To study both sides in a single reaction, primers β-TAG1 and β-TAG2 were used. β-TAG1 binds upstream of codons 5 and 6 and β-TAG2 upstream of codon 30 and the IVS-1 donor site. Extension of these primers was by cycling in the presence of ddATP and dCTP, dGTP and dTTP, resulting in specific products depending on the phenotype of the individual. The reactions were then mixed with the capture oligonucleotides. The capture oligonucleotides comprise the biotinylated capture primer cap-tag1 and cap-tag2, respectively. They have 6 bases at the 5 'end which are complementary to the 5' end of β-TAG1 and β-TAG2, respectively. You can therefore specifically capture these primers and the extended products. By attaching a universal oligonucleotide (uni-as) to the capture oligonucleotide, the capture primer is converted to a partially double-stranded molecule in which only the capture sequence remains single-stranded ( 82 ). This molecule is then bound to streptavidin-coated paramagnetic particles to which the PROBE or sequencing reaction is added. The mixture was washed to bind only the specifically hybridized oligonucleotides. The captured oligonucleotides are dissolved and analyzed by mass spectrometry.

The PROBE products of an individual ( 83 ) show a small peak with a molecular mass of 7282.8 Da. This corresponds to the non-extended β-TAG1, which has a calculated mass of 7287.8 Da. The peak at 8498.6 Da corresponds to a 4-base extended product. This corresponds to the wild-type situation. The calculated mass of this product is 8500.6 Da. There is no significant peak indicating a heterozygous situation. In addition, only β-TAG1 and not β-TAG2 were captured, indicating the high specificity of this method.

Analyzes of what bound to cap-tag2 ( 84 ), show only one predominant peak with a molecular mass of 9331.5 Da. This corresponds to an extension of 8 nucleotides. This indicates a homozygous wild-type situation where the calculated mass of the expected product is 9355 Da. There is no significant amount of non-extended primer and only β-TAG2 was captured.

To prove that this approach is also suitable for capturing specific sequence products, the two same primers β-TAG1 and β-TAG2 were used. The primers were mixed, used in a sequencing reaction and then sorted using the procedure outlined above. With these primers, two different termination reactions were carried out by means of ddATP and ddCTP ( 85 respectively. 86 ). All peaks observed in the spectrograms correspond to the calculated masses in a wild-type situation.

As As shown above, the parallel analysis is different Mutations (eg different PROBE primers) possible. The described method is also suitable for capturing specific Sequencing products. The capture can be used to separate different Sequencing primer from a reaction tube / well, for isolation specific multiplex amplified products, PROBE products, etc. be used. conventional Methods, such as cycle sequencing, and in use Volumes can be used become. A universal chip design allows the use of different Applications. This process can also be automated for high throughput become.

EXAMPLE 23

Deletion detection by mass spectrometry

For the mass spectrometric Detection of a deletion in a gene can be different formats use. For example, the molecular weight of a double-stranded amplification product can be determined or one or both strands of the double-stranded product can be isolated, and the mass can, as in the previous examples be measured.

As described herein may alternatively be a specific enzyme reaction carried out be, and the mass of the corresponding product can by mass spectrometry be determined. The deletion size can up to several ten bases in length what is still the simultaneous detection of wild type and of the mutant allele. By simultaneous detection of specific products can be identify in a single reaction, whether the individual is for a specific Allele or for a specific mutation is homozygous or heterozygous.

MATERIALS AND METHODS

Genomic DNA

genomic Leukocyte DNA was obtained from unrelated healthy individuals.

PCR amplification

The PCR amplification of the target DNA was established and optimized so that the reaction products could be used without further purification step to capture with streptavidin coated beads. The primers for the target amplification and for the PROBE reactions were as follows:
CKRΔ-F: d (CAG CTC TCA TTT TCC ATA C, SEQ ID NO: 73) and CKRΔ-R bio: d (AGC CCC AAG ATG ACT ATC, SEQ ID NO: 74). CKR-5 was amplified with the following program: 94 ° C for 2 minutes, 52 ° C for 45 seconds, 72 ° C for 5 seconds, and a final 5 minutes extension at 72 ° C. The final volume was 50 μL, including 200 ng of genomic DNA, 1 U Taq polymerase (Boehringer-Mannheim, cat. No. 1596594), 1.5 mM MgCl ₂ , 0.2 mM DNTPS (Boehringer-Mannheim, cat. No. 1277049), 10 pmol unmodified forward primer and 8 pmol biotinylated reverse primer.

Capture and denature the biotinylated matrices

10 μl of paramagnetic beads coated with streptavidin (10 mg / ml; Dynal, Dynabeads M-280 streptavidin, cat. No. 112.06) in 5 × binding solution (5 M NH ₄ Cl, 0.3 M NH ₄ OH) became 45 μl PCR reaction (5 μl PCR reaction was saved for electrophoresis). After binding by incubation for 30 min at 37 ° C, the supernatant was discarded. The trapped templates were denatured with 50 μl of 100 mM NaOH for 5 min at ambient temperature, washed once with 50 μl of 50 mM NH ₄ OH and three times with 100 μl of 10 mM Tris / Cl, pH 8.0. The single-stranded DNA served as a template for PROBE reactions.

Primer oligo base Extensions (PROBE) reaction

The PROBE reaction was performed with Sequenase 2.0 (USB Cat. No. E70775Z, including buffer). dATP / dGTP and ddTTP were purchased from Boehringer-Mannheim (Cat. Nos. 1277049 and 1008382). d (CAG CTC TCA TTT TCC ATA C (SEQ ID NO: 73) was used as a PROBE primer ( 87 ) used. The following solutions were added to the beads: 3.0 μl H ₂ O, 1.0 μl reaction buffer, 1.0 μl PROBE primer (10 pmol) and at 65 ° C for 5 min, followed by 10 min at 37 ° C, incubated. Then 0.5 μl DTT, 3.5 μl dNTPs / ddNTP, 50 μM each, and 0.5 μl Sequenase (0.8 U) were added and incubated at 37 ° C for 10 min.

T4 treatment of DNA

to Preparation of blunt-ended DNA became the amplification products with T4 DNA polymerase (Boehringer-Mannheim Cat. No. 1004786). The reactions were made according to the manufacturer's protocol for 20 min at 11 ° C carried out.

Direct sizing of the extended ones Products

to Determination of the size of the amplified Product became MALDI-TOF on one strand of the amplification product applied. The samples were transferred to the Beaded and conditioned as described below and denatured.

DNA conditioning

After the PROBE reaction, the supernatant was discarded and the beads were washed first in 50 μl of 700 mM NH ₄ citrate and second in 50 μl of 50 mM NH ₄ citrate. The generated diagnostic products were removed from the template by heating the beads for 2 min at 80 ° C in 2 μl H ₂ O. The supernatant was used for MALDI-TOF analysis.

Sample preparation and analysis by means of MALDI-TOF mass spectrometry

spectrometry

Sample preparation was carried out by mixing 0.6 μl of matrix solution (0.7 M 3-hydroxypicolinic acid, 0.07 M dibasic citrate in 1: 1 H ₂ O: CH ₃ CN) with 0.3 μl of diagnostic SAMPLE. Products in water on a sample target and allowed to dry in air. Up to 100 samples were spotted onto a sample target for insertion into the source area of an unmodified Perspective Voyager MALDI-TOF instrument operating in the delayed extraction linear mode and 5 and 30 kV at the target and conversion dynodes, respectively. Theoretical average molecular masses (M _r (calc.)) Of the analytes were calculated from the atomic compositions, the recorded experimental M _r (exp.) Values were those of the monoprotic form, which were determined by internal calibration with primers in the case of the PROBE. Reactions were determined.

conventional analyzes

The usual Analyzes were performed by native polyacrylamide gel electrophoresis according to standard protocols. The diagnostic products were tested before applying to the gels denatured with formamide and stained with ethidium bromide or silver.

RESULTS

The CKR-5 status of the 10 randomly selected DNA samples from healthy individuals was analyzed. Leukocyte DNA was amplified by PCR and an aliquot of the amplified product was purified by standard polyacrylamide gel electrophoresis and silver staining of the DNA ( 88 ) analyzed. Four samples showed two bands possibly indicating heterozygosity for CKR-5, whereas the other six samples showed a band corresponding to a homozygous gene ( 88 ). In the case where two bands were observed, they correspond to the expected size of 75 bp for the wild type gene and 43 bp for the deletion allele ( 87 ). Where one band was observed, the size was about 75 bp, indicating a homozygous wild-type CKR-5 allele. A DNA sample derived from a suspected heterozygous individual and one from a homozygous individual were used for all further analyzes. To determine the molecular mass of the amplified product, the DNA of a matrix-assisted La ser-desorption / ionization coupled with time-of-flight analysis (MALDI-TOF). Double-stranded DNA bound to streptavidin-coated paramagnetic particles was denatured and the strand delivered to the supernatant was analyzed. The 89A shows a spectrogram of a DNA sample prepared according to the result obtained from polyacrylamide gel electrophoresis ( 88 ) was considered heterozygous. The calculated mass of the sense strand for a wild type gene is 23036 Da and that of the sense strand carrying the deletion allele 13143 ( 87 and Table VI). Since many thermostable polymerases unspecifically attach adenosine to the 3 'end of the product, these masses were also calculated. They are 23349 and 13456 Da. The masses of the observed peaks ( 89A ) are 23119 Da, which corresponds to the calculated mass of a wild-type DNA strand with added adenosine (23349 Da). Since no peak with a mass of about 23036 Da was observed, the polymerase must have qualitatively added adenosine. Two very close peaks have a mass of 13451 and 13137 Da. This corresponds to the calculated masses of the 32 bp allele allele. The peak for the higher mass corresponds to the product with attached adenosine, and the peak for the lower mass corresponds to that without nonspecific adenosine. Both peaks are approximately equal, indicating that about half of the product had adenosine added. The peak with a mass of 11,682 Da is a doubly charged molecule of DNA, corresponding to 23,319 Da (2 × 11,682 Da = 23,364 Da). The peaks with masses of 6732 and 6575 Da are doubly charged molecules of the DNA with masses of 13,451 and 13,137 Da, and the 7794 Da peak corresponds to the triply charged molecule of 23,319 Da. Multi-charged molecules are routinely identified by calculation. Amplified DNA derived from a homozygous individual is shown in the spectrogram ( 89C ) has a peak with a mass of 23,349.6 and a much smaller peak with a mass of 23,039.9 Da. The higher mass peak corresponds to the DNA resulting from a wild type all-added adenosine having a calculated mass of 23,349 Da. The lower mass peak corresponds to the same product without adenosine. Three further peaks with a mass of 11,686, 7804,6 and 5852,5 Da correspond to double, triple and quadruple charged molecules.

The nonspecifically added adenine can be removed from the amplified DNA by treating the DNA with T4 DNA polymerase. DNA derived from a heterozygous and a homozygous individual was analyzed after T4 DNA polymerase treatment. 89B shows the heterozygous DNA-derived spectrogram. The peak corresponding to the wild-type strand has a mass of 23008 Da, indicating that the attached adenine had been completely removed. The same is observed for the strand with a mass of 13140 Da.

The other three peaks are multiply charged molecules of the output peaks. The mass spectrograph for the homozygous DNA shows a peak of mass 23,004 Da, which corresponds to the wild-type DNA strand without added adenine. All other peaks are from multiply charged molecules of this DNA. The amplified products can be analyzed by direct determination of their masses, as described above, or by measuring the masses of products derived from the amplified product in a further reaction. In this primer oligo base extension (PROBE) reaction, a primer that can be internal, as in nested PCR, or identical to one of the PCR primers, is only extended by a few bases before the termination Nucleotide is incorporated. Depending on the extension length, the genotype can be determined. CKRΔ-F was used as a PROBE primer and dATP / dGTP and ddTP as nucleotides. The primer extension is in the case of a wild type template AGT and in the case of deletion AT ( 87 ). The corresponding masses are 6604 Da for the wild type and 6275 Da for the deletion. PROBE was used on two standard DNAs. The spectrogram ( 90A ) shows peaks with masses of 6604 Da corresponding to the wild-type DNA and with 6275 Da corresponding to the CKR-5 deletion allele (Table VIII). The peak at a mass of 5673 Da corresponds to CKRΔ-F (calculated mass 5674 Da). Further samples were analyzed in an analogous way ( 90B ). The identification clearly gives homozygous DNA since the peak with a mass of 6607 Da corresponds to the wild-type allele and the peak with a mass of 5677 Da corresponds to the non-extended primer. No further peaks were observed.

The example shows that the deletion analysis can be performed by mass spectrometry. As shown here, the deletion can be analyzed by direct detection of the single-stranded amplified products, or by analysis of specific generated diagnostic products (PROBE). As shown in Example 26 below, amplified double-stranded DNA products can also be analyzed. size calculated mass measured mass Wild type without A 23036 23039/23009/23004 Wild type with A 23349 23319/23350 Deletion without A 13143 13137/13139 Deletion with A 13456 13451 SAMPLE wildtype 6604 6604/6608 deletion 6275 6275

All Masses are given in Dalton.

EXAMPLE 24

Pentaplex tc-PROBE

SUMMARY

Of the Multiplexed operation of the thermocycling primer oligo base extension (tcPROBE) was done with five polymorphic Represent in three different apolipoprotein genes that are thought to be involved in the pathogenesis of arteriosclerosis. The apolipoprotein A-IV gene (Codons 347 and 360), the apolipoprotein E gene (codons 112 and 158) and the apolipoprotein B gene (codon 3500) were examined. All mass spectra were in regards to the five polymorphic passages easy to interpret.

MATERIALS AND METHODS

PCR amplification

Human genomic leukocyte DNA was used for the PCR. Listed below are the primers used for the separate amplification of portions of the Apo A-IV, Apo E and Apo B genes:

Taq polymerase and 10x buffer were purchased from Boehringer-Mannheim (Germany) and dNTPs from Pharmacia (Freiburg, Germany). The total volume of the PCR reaction was 50 μl, including 10 pmol of each primer and 10% DMSO (dimethyl sulfoxide, Sigma) (no DMSO for the PCR of the apo B gene), with approximately 200 mg of genomic DNA as template and a dNTP final concentration of 200 μM were used. The solutions were heated to 80 ° C before adding 1 E Taq polymerase; the PCR conditions were; 5 min at 95 ° C, then 2 cycles of 30 sec at 94 ° C, 30 sec at 62 ° C, 30 sec at 72 ° C, 2 cycles of 30 sec at 94 ° C, 30 sec at 58 ° C, 30 sec at 72 ° C, 35 cycles at 30 sec at 94 ° C, 30 sec at 56 ° C, 30 sec at 72 ° C, and a final extension time of 2 min at 72 ° C. To remove unincorporated primers and nucleotides, the amplified products were purified with the "QIAquick" kit (Qiagen, Germany), with the purified products in 50 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 80 ) were eluted.

Binding of the amplified Products on pearls

10 μl of each purified amplified product were added to 5 μl DynaBeads (Dynal, M-280 streptavidin). connected, and according to the Dynal protocol denatured. For the pentaplex-tc-PROBE reaction was amplified the three different ones Products (bound to the beads) summarized.

Tc-PROBE

For the PROBE reaction, the following primers were used:

The tc-PROBE was carried out in a final volume of 25 μl, in which 10 pmol of each of the above-mentioned primers, 2.5 U thermoquenase (Amersham), 2.5 μl thermoquenase buffer and 50 μM dTTP (final concentrations) and 200 μM ddA / C / GTP were included. The tubes containing the mixture were placed in a thermocycler and subjected to the following cycling conditions: Denaturation (94 ° C): the supernatant was carefully removed from the beads and 'desalted' by ethanol precipitation to give non-volatile cations, such as Na exchange ⁺ and K ⁺ for NH ₄ ⁺ , which evaporated during the ionization process; 5 μl 3 M ammonium acetate (pH 6.5), 0.5 μl glycogen (10 mg / ml, Sigma), 25 μl H ₂ O and 110 μl absolute ethanol were added to 25 μl of PROBE supernatant and incubated for 1 hour at 4 ° C incubated. After centrifugation at 13,000 × g for 10 minutes, the sediment was washed in 70% ethanol and resuspended in 1 μl of 18 MOhm / cm H ₂ O. A 0.35 μl aliquot of the resuspended DNA was mixed with 0.35 μl of matrix solution (0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium citrate in 1: 1 H ₂ O: CH ₃ CN). on a stainless steel sample target and allowed to air dry before recording the spectrum on the Thermo-Bioanalysis Version 2000 MALDI-TOF instrument operating in 5 and 20 kV reflectron mode at the target and conversion dynodes, respectively has been. The theoretical average molecular masses (M _r (calc.) Of the fragments were calculated from the atomic compositions.) An external calibration was performed with a synthetic (ATCG) _n oligonucleotide (3.6-1.8 kDa) Positive ion spectra from 1 to 37,500 were recorded.

RESULTS

Table VIII shows the calculated molecular weights of all possible extension products, including the mass of the primer itself. 91 shows a corresponding MALDI-TOF-MS spectrum of a tc-PROBE with simultaneous use of three different matrices and 5 different PROBE primers in one reaction. Comparison of the observed and calculated masses (see Table VIII) allows rapid genetic profiling of various polymorphic sites in an individual DNA sample. In the 91 The sample shown is homozygous for threonine and glutamine at position 347 and 360 in the apolipoprotein A-IV gene, carries the epsilon-3 allele homozygous in the apolipoprotein E gene and is also at codon 3500 for arginine in the apolipoprotein B gene homozygous. TABLE VIII

EXAMPLE 25

Sequencing of exons 5 to 8 of the p53 gene by mass spectrometry

MATERIALS AND METHODS

Thirty-five cycles of PCR reactions were performed in a 96 well microtiter plate, each well containing a total volume of 50 μl, including 200 ng genomic DNA, 1 unit Taq DNA polymerase, 1.5 mM MgCl ₂ , 0.2 mM dNTPx, 10 pmol of the forward primer and 6 or 8 of the biotinylated reverse primer. The sequences of the PCR primers prepared according to standard chemistry (ND Sinha, J. Biernat, H. Kter, Tetrahed., Lett. 24: 5843-5846 (1983)) are as follows:

To each well of the 96-well microtiter plate containing crude purified amplified product was added 0.1 mg of paramagnetic streptavidin beads (Dynal) in 10 μl of 5X binding solution (5M NH ₄ OH) and incubated at 37 ° C for 30 min incubated.

Subsequently, the beads were treated with 0.1 M NaOH at room temperature for 5 min, and then washed once for 5 min at room temperature with 50 mM NH ₄ OH and then once with 50 mM Tris-HCl.

Four dideoxy termination reactions were performed in separate wells of the microtiter plate. A total of 84 reactions (21 primer x 4 reactions / primer) can be performed in a single microtiter plate. To each well containing immobilized single-stranded template was added a total volume of 10 μl of reaction mixture containing 1X reaction buffer, 10 pmol sequencing primer, 250 mM dNTPs, 25 mM ddNTPs and 1 ~ 2 units thermosequenase (Amersham). The sequencing reactions were performed with a thermal cycler under non-cycling conditions: 1 min at 80 ° C, 1 min at 50 ° C, 0.1 ° C / sec increasing from 50 ° C to 72 ° C, and 5 min 72 ° C. The beads were then washed with 0.7 M ammonium citrate followed by 0.05 M ammonium citrate. The sequencing products were then removed from the beads by heating the beads in 2 μl of 50 mM NH ₄ OH for 2 min at 80 ° C. The supernatant was used for MALDI-TOF MS analysis.

The Matrix was prepared as described by Kter et al. described (Kter, H. et al. Nature Biotechnol, 14: 1123-1128 (1996)). This saturated matrix solution was then diluted 1.52 times with pure water before being used. 0.3 μl of diluted Matrix solution were then diluted 1.52 times with pure water before use. 0.3 μl of the diluted matrix solution applied to the sample target and allowed to crystallize, then were 0.3 μl of the aqueous Analytes added. A Perseptive Voyager DE mass spectrometer was for the experiments were used and the samples became common analyzed in manual mode. The goal and the center plate were after every laser shot for Held at +18.2 kV for 200 nanoseconds, and then the target voltage increased to +20 kV. The ion guide wire in the Pipe was held at about 2 volts. Usually were for each sample 250 laser shots accumulated. The original spectrum was at a 500 MHz digitizing frequency recorded, and the final spectrum was through a 455 point average smoothed (Savitsky and Golay (1964), Analytical Chemistry 36: 1627). A standard calibration The mass spectrometer was used to identify each peak and used to assign the sequences. To recalibrate each Spectrum became the theoretical mass values of two sequencing peaks Little, T.L. Cornish, M.J. O'Donnel, A. Braun, R.J. Cotter, H. Kter, Anal. Chem., Submitted).

RESULTS

deviations The p53 gene has been considered a crucial step in the development of many human Cancer diseases (Greenblatt et al. (1994) Cancer Res 54, 4855-4878; C.C. Harns (1996), J. Cancer 73 261-269; and D. Sidransky and M. Hollstein (1996), Annu. Res. Med. 47: 285-301). Mutations can be considered molecular indicators for the clonality or as early Markers for a relapse in a patient with a previously identified mutation in a primary tumor (Hainaut et al., 1997, Nucleic Acids Res. 25: 151-157). The Cancer prognosis may vary depending on the type of p53 mutations present (H.S.Goh et al., 1995, Cancer Res. 55: 5217-5221). Since the discovery of the p53 gene became more discovered as 6000 different mutations. The exons were 5-8 Selected as sequencing targets, where most mutations accumulate (Hainaut et al., (1997) Nucleic Acids Res. 25: 151-157).

96 Figure 3 shows schematically the single tube method for target amplification and sequencing performed as described in detail in Materials and Methods. Each of exons 5-8 of the p53 gene was amplified by PCR using flanking primers in the intron region; the downstream primer was biotinylated. The amplifications of the various exons were optimized for use of the same cycing profile and the products were used without further purification. The PCR reactions were performed in a 96-well microtiter plate and the product produced in a well was used as template for a sequencing reaction. Streptavidin-coated magnetic beads were added to the same microtiter plate and the amplified products were immobilized. The beads were then treated with NaOH to generate immobilized single-stranded DNA as a sequencing template. The beads were washed extensively with Tris buffer as residual base would reduce the activity of the sequencing enzyme.

All in all 21 primers were selected around the exons 5-8 of the p53 gene by primer walking. The nucleotide at the 3'-end of all Primer is at a location where there is no known mutation exist. Four termination reactions were performed separately, which a total of 84 sequencing reactions on the same PCR microtiter plate revealed. For the sequencing was used non-cycling conditions since Streptavidin coated beads have a high repetitive effect Temperature can not stand. The sequencing reactions were designed so that the mt-terminated fragments are less than 70 Nucleotides had a size range the for MALDI-TOF-MS easy accessible and yet is long enough to enter the next primer binding site to sequence into. Thermoquenase was the enzyme of choice since it was able to reproducibly produce a high yield of sequencing products in the desired Generate mass range. After the sequencing reactions were washed the beads with ammonium ion buffers to all other cations to replace. The sequence ladders were then passed through by the beads Heat in ammonium hydroxide solution or just removed in water.

A sub-microliter aliquot of each of the 84 sequencing reactions was added to an MS sample holder preloaded with matrix. 94 shows an example of sequencing data generated with a primer; four spectra are superimposed.

All Sequencing peaks were in the mass range for reading in the next Sequencing primer required, well resolved. Sometimes Double charged peaks were observed, which easily identified could be by adding the mass to that of an simply charged one Ions was correlated. False crashes caused by early Termination of enzyme extension can be induced in nearby the primer site can be observed. Because the mass resolution high is enough, can the Peaks of false crashes can be readily distinguished from true sequencing peaks by: the mass difference of the neighboring peaks is calculated and the four spectra are compared. In addition, provided mt primer detectable data about the area of the downstream located primer binding site, so that the area of the wrong aborts was covered.

Under Use of optimized amplification, sequencing and conditioning procedures the exons became 5-8 of the p53 gene was successfully sequenced. The correct wild-type sequence data were from all exons with a mass resolution of about 300 to 800 over the entire mass range obtained. The total mass accuracy is 0.05% or better. The average amount of each on an MS sample holder applied sequencing fragment becomes 50 fmol or less estimated.

This example demonstrates the feasibility of sequencing exons of a human gene by MALDI-TOF-MS. Compared to automatic gel-based fluorescence DNA sequencing, read lengths are shorter. A microchip technology can be used which allows parallel processing. The sequencing products generated in the microtiter plate can be transferred directly to a microchip, which serves as a starting platform for the MALDI-TOF-MS analysis. Robot-operated serial and parallel nanoliter dosing systems are used to accommodate arrays of 100-1000 DNA samples on <1 inch ² flat or geometrically altered surface (eg, wells) chips for rapid mass spectrometry analysis.

94 Figure 4 shows an MS spectrum obtained on a chip where the sample was transferred from a microtiter plate with a pen device. The estimated amount of each applied termination product is 5 fmoles or less, which is in the amount range used in conventional Sanger sequencing with radioactive or fluorescent detection (0.5-1 fmol per fragment). Applying low volumes of MALDI samples has the advantages of miniaturization (reduced reagent consumption), improved reproducibility and automatic signal acquisition.

EXAMPLE 26

Direct detection of synthetic and biologically generated double-stranded DNA by MALDI-TOF-MS

introduction

typically, gives the matrix-supported Laser desorption ionization (Karas et al., (1989) Int. J. Mass Spectrom. Ion Processes 92, 231) Time of flight mass spectrometry (MALDI-TOFMS) of DNA molecules that in solution double stranded (ds) are molecular ions that are the two single-stranded components represent (Tang et al., 1994, Rapid Commun. Mass Spectrom. 8: 183, Tang et al. (1995), Nucleic Acids Res. 23: 3126; Renner et al. (1995), Rapid Commun. Mass Spectrom. 9: 537; Liu et al. (1995), Anal. Chem. 67: 3482; Siegert et al. (1996), Anal. Biochem. 243: 55 and Doktycz et al. (1995) Anal. Biochem. 230: 205); this has been observed in several reports associated with biologically generated DNA from a polymerase chain reaction (PCR) amplification employ (Tang et al., 1994, Rapid Commun. Mass Spectrom., 8: 183, Liu et al. (1995), Anal. Chem. 67: 3482; Siegert et al. (1996), Anal. Biochem. 243: 55 and Doktycz et al. (1995), Anal. Biochem. 230: 205). It is not clear if the duplex because of the decreased pH is destabilized in the matrix environment or because of the absorption of the double strand during desorption / ionization / acceleration with an energy that is sufficient to overcome the attractive van der Waals and stacking stabilization forces (Cantor and Shimmel, Biophysical Chemistry Part 1: The Conformation of Biomolecules, W.H. Freeman, New York (1980) 176). When the analyte is present in high concentrations, so the formation is non-specific Gas phase DNA multimers as in proteins (Kares et al., (1989) Int. J. Mass. Spectrom. Ion Processes 92: 231); Lecchi and Pannell (Lecchi et al., (1995) J. Am. Soc. Mass. Spectrom. 6: 972) have provided strong evidence that a specific Watson Crick (WC) base pairing in the gas phase is maintained. They discovered these specific dimers when using 6-aza-2-thiothymine as a matrix, but did not observe it with a 3-hydroxypicolinic acid (3-DPA) - or 2,4,6-hydroxyacetophenone MatriX. As described below, is when using a low acceleration voltage of the ions and by preparing samples for MALDI analysis at lower Temperatures, a routine proof possible from dsDNA.

MATERIALS AND METHODS

Synthetic DNA. Oligonucleotides were synthesized on a Perspective Expedite DNA Synthesizer (Sinha et al., 1984, Nucleic Acids Res. 12, 4539) and purified in house by reverse phase HPLC. The sequences were: 50-mer (15337 Da): 5'-TTG CGT ACA CAC TGG CCG TCG TTT TAC AAC GTC GTG ACT GGG AAA ACC CT-3 '(SEQ ID NO: 109); 27-mer _c (complementary, 8343 Da): 5'-GTA AAA CGA CGG CCA GTG TGT ACG CAA-3 '(SEQ ID NO: 110); 27-mer _nc (non-complementary, 8293 Da): 5'-TAC TGG AAG GCG ATC TCA GCA ATC AGC-3 '(SEQ ID NO: 111). 100 μM stock solutions were diluted to 20, 10, 5 and 2.5 μM using 18 MOhm / cm H ₂ O. In each case 2 μl of the equimolar solutions of the 50-mer and either of the 27-mer _c or the 27-mer _nc were mixed and allowed to anneal for 10 minutes at room temperature. 0.5 μl of these mixtures were mixed directly on a sample target with 1 μl matrix (0.7 M 3-HPA, 0.07 M ammonium citrate in 50% acetonitrile) and allowed to air dry.

biological DNA. It was an enzymatic cleavage of human genomic Leukocyte DNA performed. The PCR primers (forward, 5'-GGC ACG OCT GTC CAA GGA G-3 (SEQ ID NO: 112); Backward, 5'-AGG CCG CGC TCG GCG CCC TC-3 '(SEQ ID No. 113)) for amplifying a part of exon 4 of the apolipoprotein E gene the published Sequence (Das et al., (1985) J. Biol. Chem. 260: 6240). Taq polymerase and 10x buffer were from Boehringer-Mannheim (Germany) and the dNTPs from Pharmacia (Freiburg, Germany). The total reaction volume was 50 μl, including 20 pmoles of each primer and 10% DMSO (dimethylsulfoxide, Sigma) with approximately 200 ng of genomic DNA as Die. The solutions were prior to the addition of IU polymerase at 80 ° C heated. PCR conditions were: 2 min at 94 ° C followed by 40 cycles with 30 sec at 94 ° C, 45 sec at 63 ° C, 30 sec at 72 ° C, and a final one Extension time of 2 min at 72 ° C. There were no quantitative data to determine the final yield but it was estimated that -2pmol for the enzymatic Digest available were.

Cfol and Rsal and reaction buffer L were purchased from Boehringer Mannheim. 20 μl of the amplified products were diluted with 15 μl of water and 4 μl of buffer L; after addition of 10 units of restriction enzymes, the samples were incubated at 37 ° C for 60 min. For the precipitation of the digestion products, 5 μl 3 M ammonium acetate (pH 6.5), 5 μl glycogen (Braun et al. (1997), Clin. Chem. 43, 1151) (10 mg / ml, Sigma) and 110 μl absolute ethanol added to 50 .mu.l of the analyte solutions and ge for 1 hour at room temperature outsourced. After centrifugation at 13,000 × g for 10 minutes, the sediment was washed in 70% ethanol and resuspended in 1 μl of 18 MOhm / cm H ₂ O.

Sample preparation and analysis by MALDI-TOF-MS. 0.35 μl of the resuspended DNA was mixed with 0.35-1.3 μl matrix solution (0.7 M 3-hydroxypicolinic acid (3-HPA), 0.07 M ammonium citrate in 1: 1 H ₂ O: CH ₃ CN) ( Wu et al., 1993, Rapid Commun. Mass Spectrom., 7142) on a stainless steel sample target and prior to taking the spectrum with a Thermo Bioanalysis Vision 2000 MALDI-TOF device operating in positive ion reflectron mode at 5 and 20 kV was operated at the target and conversion dynodes, respectively, dried in air. The theoretical average molecular weights (M _r (calc.)) Of the fragments were calculated from the atomic compositions; the mass of a proton (1.08 Da) was subtracted from the raw data values in recording experimental molecular masses (M _r (exp)) as a neutral basis. The external calibration obtained from eight peaks (2000-18,000) was used for all spectra.

Results and discussion

96A is a MALDI-TOF mass spectrum of a mixture of the synthetic 50-mer with the (non-complementary) 27-mer _nc (each 10 μM, the highest final concentration used in this study); the laser energy was set just above the threshold irradiation for ionization. The peaks at 8.30 and 15.34 kDa illustrate singly charged ions resulting from the 27-mer and 50-mer single strands, respectively. Poorly resolved weak signals at -16.6 and -30.7 kDa represent homodimers of the 27- and 50-mer, respectively; that at 23.6 kDa is consistent with a heterodimer containing a 27-mer and a 50-mer strand. Thus, less intense dimer ions were observed, representing all possible combinations of the two non-complementary oligonucleotides (27 + 27, 27 + 50, 50 + 50). Increasing the irradiance even to a point where the depurination peaks dominated the spectrum gave slightly higher intensities for these dimer peaks. Note that hybridization was performed at room temperature and with a very low salt concentration, ie under conditions where non-specific hybridization can occur.

96 shows a MALDI-TOF spectrum of the same 50-mer mixed with the (complementary) 27-mer _c ; the final concentration of each oligonucleotide was again 10 μM. Using the same laser energy as in 96A Again, intense signals at 88.34 and 15.34 kDa were observed, corresponding to the single-stranded 27 and 50-mer, respectively. Homodimer peaks (27 + 27; 50 + 50) were barely noticeable in background noise; however, the single (23.68 kDa) and double (11.84 kDa) charged heterodimer peaks (27 + 50) predominated. Although the 23.68 kDa dimer peak could be detected from all irradiation positions, its intensity in relation to the monomer peaks varied slightly from point to point. Repetition of the experiment with single oligonucleotide concentrations of 5, 2.5 and 1.25 μM resulted in decreasing amounts of the 27- / 50-mer Watson-Crick dimer peak relative to the 27- and 50-mer single-stranded peaks. At the lowest concentrations, the observation of the dimer was "crystal-dependent," ie, the irradiation of some crystals produced a significant 27- / 50-mer dimer signal, whereas other crystals reproducibly gave only a very weak or no signal Incorporation of dsDNA into the matrix crystals or the efficiency with which this interaction is maintained during the ionization / desorption process depends on the microscopic properties of the crystals, and / or that strong concentration gradients of the duplex are present in the sample.

• ^aDas ε3-Allel hat keine 17/19- oder 19/19-Paare; das ε4-Allel enthält kein 36/38-Paar.
• ^b(+) Sense-Strang, (–) Antisense-Strang.

The spectra in 96 thus provide strong evidence that specific WC-base paired dsDNA can be observed using weak laser conditions with higher oligonucleotide concentrations in this mass range - the first time that this is described using a 3-HPA matrix. The assay was extended to a complex mixture of dsDNA derived from an enzymatic digest (Rsal / Cfol) of a region of exon 4 of the apolipoprotein E gene (Das et al. (1985) J. Biol. Chem. 6240, the expected fragment masses are given in Table IX. Table IX Cfol / Rsal digestion products of exon 4 of the ApoE gene Bases ^b ssDNA (There) dsDNA (Da) - (+) (-) (+) (-) 11 13 3428 4025 7453 16 5004 4924 9928 18 5412 5750 11162 17 19 5283 5880 11163 19 5999 5781 11780 24 22 7,510 6745 14225 31 29 9628 9185 18813 36 38 11279 11627 22906 48 14845 14858 29703 55 53 17175 16240 33415

• ^a The ε3 allele has no 17/19 or 19/19 pairs; the ε4 allele does not contain a 36/38 pair.
• ^b (+) sense strand, (-) antisense strand.

After the digestion step, the samples were purified and concentrated by ethanol precipitation and resuspended in 1 μl H ₂ O before mixing at room temperature with the matrix on the sample target. About 20 peaks with masses in the range of 3.4-17.2 kDa were resolved in the MALDI spectrum of the products ( 97A ), all consistent with denatured single-stranded double-stranded components (Table IX). Many such analyzes of similar biological products over a period of months also yielded negligible dsDNA spectra, consistent with previous reports (Tang et al., 1994, Rapid Commun. Mass Spectrom., 8: 183, Liu et al., 1995), Anal Chem 67: 3482, Siegert et al (1996), Anal Biochem 243: 55, and Doktycz et al (1995) Anal Biochem 230: 205); in contrast, intact duplexes were prepared under similar conditions for the synthetic DNA ( 96A ). The strand concentration that was available after the biological reactions is difficult to estimate, but it is probably much lower than that at which dimerization of synthetic samples was present. Additionally, maintaining specific hybrids within the synthetic bicomponent mixture may be kinetically favored over the much more complex mixture of 20 single-stranded DNA components from the cleavage.

The Effect of a lower temperature on the maintenance of dsDNA was examined. An aliquot of the digested DNA solution, the Matrix, pipette, pipette tips and the stainless steel sample target were placed in a "cold chamber" at 4 ° C for 15 min stored; as with normal preparations The matrix and then the analyte were applied to the target in a punctiform manner and allowed to co-crystallize under drying in the air. The crystallization for the Mixtures of 300 nl 3-HPA (50% acetonitrile) with 300 nl of analyte required ~ 1 min at room temperature, but 15 min at lower temperature. Sample points prepared in the cold chamber environment contained usually a high proportion of large ones transparent crystals.

MALDI-TOF analysis of a reduced temperature ApoE digestion aliquot revealed the spectrum in 97B , The low mass range seemed to be in 97A However, over 8 kDa drastic differences were observed. In 97A Only signals consistent with the single strands (Table IX) were observed, and samples prepared in the cold chamber were analyzed 97B however, did not give signals for the same masses, except below 8 kDa. Even more noticeable were the extra high-mass peaks in 97B ; these clearly represent dimer peaks containing lower mass components. As with synthetic DNA, it was important to determine whether these are non-specific heterodimers, specific WC heterodimers, or non-specific homodimers. Consider first the 33.35 kDa fragment. Ignoring the unlikely possibility that the high-mass fragment is a trimer or a higher multimer, it may contain as dimer only the ssDNA components of the highest mass, ie> 16 kDa. Homodimerization of the 15.24 and 17.18 kDa fragments would give 32.49 and 34.35 kDa peaks, respectively; correspond en Mass errors for these incorrect assignments, in relation to the observed 33.35 kDa would be -2.6% and + 3.0%, respectively. A much better match is achieved when this peak is from a heterodimer of the two single-stranded fragments of highest mass; their added mass (16.24 + 17.18 = 33.42 kDa) differed by 0.2% from the observed dimer mass 33.35 kDa, an acceptable mass error for MALDI-TOF analysis of large DNA fragments by external calibration , The 29.66 kDa fragment was correspondingly measured only 0.13% lower than the 29.70 kDa expected for a 48-mer heterodimer; the sum of other possible homodimers or heterodimers was not within a reasonable range of this mass. Similar arguments could be advanced for the 22.89 and 18.83 kDa fragments, which are 36- / 38-mer and 31- / 29-heterodimers respectively; the signal at 14.86 kDa corresponds to the singly charged single-stranded and doubly charged double-stranded 48-mer. The agreement of the masses in 97B above 15 kDa with that of dsDNA expected in this cleavage and the absence of homodimers and nonspecific heterodimers at random masses showed that the base pairings were indeed very specific and provided further evidence that gas-phase WC interactions can be maintained in MALDI-generated ions.

98 Figure 9 shows a MALDI-TOF spectrum of an ε4 allele which, unlike the ε3 allele, was expected not to give a 36- / 38-mer pair in Cfol / Rsal cleavage. The ε3 and ε4 mass spectra were similar except that the abundant 22.89 kDa fragment in 97B in 98 was not available; With this information alone (Table IX), the ε3 and ε4 alleles could be easily distinguished, demonstrating genotype determination by direct measurement of dsDNA by MALDI-TOF-MS. Accordingly, dsDNA could be ionized, converted into the gas phase and detected by MALDI-TOF-MS. The acceleration voltage commonly set on our equipment was only -5 kV, corresponding to 1.5 kV / mn up to -2 mm from the sample target, with the electric field strength decreasing rapidly with the distance from the sample target. Most previous work used an acceleration of at least 20 kV (Lecchi et al., (1995), J. Am. Soc. Mass. Spectrom. 6, 972); with one exception, a 27-mer dsDNA was detected using a frozen matrix solution and 100V acceleration (Nelson et al., 1990, Rapid Commun. Mass Spectrom., 4: 348). Without wishing to be bound by theory, the MALDI-induced "denaturation" of the dsDNA may be due to gas-phase collision activation, which disrupts WC pairing using high acceleration fields, analogous to the denaturation assumed for the first step in fragmentation used for sequencing the single-stranded components of the dsDNA using electron spray ionization (McLafferty et al., 1996, Int. Mass Spectrom., Ion Processes). It appears that the high salt conditions (typically> 10 mM NaCl or KCl) necessary to stabilize WC-paired dsDNA in solution are unsuitable for MALDI analysis (Nordhoff et al., 1993, Nucleic Acids Res : 3347); lowering the concentration of such non-volatile cations is necessary to avoid cation-adducted MALDI signals, but destabilizes the duplexes in solution. The low pH conditions of the matrix environment should also destabilize the duplex. As in the 97B and 98 As shown, keeping and producing even low concentrations of the biological samples at reduced temperature should at least partially offset these denaturing effects, especially for longer strands where the melting temperatures are higher due to a wider hydrogen bonding network. The conditions used here are regarded as very non-stringent addition conditions.

The low mass tails on high mass dsDNA peaks (e.g. 97B , 232 kDa) are consistent with depurination, which is greater than the sum of depurinations from each of the combined single strands. Although depurination in solution is an acid catalyzed reaction, the weakly acidic conditions in the 3-HPA matrix do not induce significant depurination; only a few depurination peaks were involved in the molecular ion signals from a mixed base 50-mer measured by De-MALDI-TOF (Juhaz et al., (1996), Anal. Chem 68: 941). Depurination from the single-stranded components of the gas-phase dsDNA is observed, although these bases are expected to be hydrogen bonded to the complementary base of the companion strand, suggesting that the covalent bonds are broken before the strand is denatured.

EXAMPLE 27

Efficiency and specificity test for specifics ribonucleases

Aliquots taken at regular intervals during cleavage of the selected synthetic 20- to 25-mers were analyzed by mass spectrometry. Three of the RNases were found to be efficient and specific. These include: the G-specific T ₁ , the A-specific U ₂ and the A / U specific phyM. The ribonucleases considered to be C-specific were less reliable, e.g. For example, they did not cleave at each C or split unpredictably into U. The three promising RNases cleaved at all predetermined positions and the sequence was completely covered. The presence of cleavage products containing one or more non-cleavage sites (short incubation times) also allowed for the sequencing of cleavage products. An example of the MALDI spectrum of an aliquot taken after T1 cleavage of a 20-mer synthetic RNA [SEQ ID NO: 114] is in U.S.P. 100 shown.

EXAMPLE 28

Immobilization of amplified DNA targets on silicon wafers

Production of the silicon surface

Silicon wafer were washed with ethanol, over Flamed the Bunsen burner and 3 hours in an anhydrous solution of 25% by volume of 3-aminopropyltriethoxysilane immersed in toluene. The silane solution was then removed, and the wafers were washed three times with toluene and three times washed with dimethyl sulfoxide (DMSO). The wafers were then in an anhydrous 10 mM solution of N-succinimidyl (4-iodoacetyl) aminobenzoate (SIAB) (Pierce Chemical, Rockford, IL) in anhydrous DMSO. After the reaction, the SIAB solution was removed and the wafers were washed three times with DMSO. In all cases, the iodoacetamido-functionalized Wafer directly used to minimize the hydrolysis of the labile iodoacetamido functionality. All Further manipulations on the wafer were done in the dark, as the Iodoacetamido functionality is sensitive to light.

Immobilization of the amplified thiol-containing nucleic acids

The SIAB-conjugated silicon wafers became more specific for analysis free thiol-containing DNA fragments of a particular amplified DNA target sequence used. A 23-mer oligodeoxynucleotide containing a 5'-disulfide contained [purchased from Operon Technologies; SEQ ID NO: 117] and to 3 'range of a 112 bp human genomic DNA template was complementary [Genebank accession number: Z52259, SEQ ID NO: 118] was used as a primer along with a commercial available 49-mer primer that has been purchased to a portion of the 5'-end of the genomic DNA from Operon Technologies; SEQ ID NO: 119] was complementary, in PCR reactions used to amplify a 135 bp DNA product, which contained a 5'-disulfide bond, the only one strand of DNA duplex [SEQ ID NO: 120].

The PCR amplification reactions were performed with the Amplitaq Gold Kit [Perkin Elmer catalog no. N808-0249]. It was short 200 ng 112 bp human genomic DNA template with 10 μM of the 23-mer primer and 8 μM of the commercially available 49-mer primers, 10 mM dNTPs, 1 unit of Amplitaq Gold DNA polymerase in Buffer provided by the manufacturer incubated, and the PCR was performed in a thermocycler.

The 5'-disulfide bond of the resulting amplified product was completely reduced by 10 mM tris (2-carboxyethyl) phosphine (TCEP) (Pierce Chemical, Rockford, IL) to form a free 5'-thiol group. The disulfide reduction of the modified oligonucleotide was recorded by observing a shift in retention time in reverse phase FPLC. It was found that the disulfide had been completely reduced to a free thiol after five hours in the presence of 10 mM TCEP. Immediately after the disulfide cleavage, the modified oligonucleotide was incubated with the iodoacetamido-functionalized wafers and conjugated to the surface of the silicon wafer via the SIAB linker. To ensure complete thiol deprotonation, the coupling reaction was carried out at pH 8.0. With 10 mM TCEP for cleavage of the disulfide and the other reaction conditions described above, it was possible to reproducibly obtain a surface density of 250 fmol per mm ^{2 of} the surface.

Hybridization and MALDI-TOF mass spectrometry

Of the with the 135 bp thiol-containing DNA conjugated silicon wafer was with a complementary 12-mer oligonucleotide [SEQ ID NO: 121] and specifically hybridized DNA fragments were detected by MALDI-TOF-MS analysis. The mass spectrum gave a signal with an observed experimental mass-to-charge ratio of 3618.33; the theoretical mass-to-charge ratio of the 12-mer oligomer sequence is 3622.4 Da.

specific DNA target molecules, the one 5'-disulfide bond can contain thus be amplified. The molecules are at a high density to a SIAB-derivatized Silicon wafer immobilized, using the methods described here can be used, and specific complementary oligonucleotides can be used these target molecules hybridized and detected by MALDI-TOF-MS analysis become.

EXAMPLE 29

Use of high-density nucleic acid immobilization for generating nucleic acid assemblies

Under Using the high-density attachment method described in Example 28, was an arrangement of for the MALDI-TOF mass spectrometry analysis accessible DNA oligomers a silicon wafer with a variety of places, eg. B. depressions or spots, on its surface generated. To prepare the device, an oligonucleotide primer, containing free thiol only at the selected sites of the wafer [see z. Example 28] immobilized. Each location of the arrangement contained one of three different oligomers. To prove that the different immobilized oligomers detected separately and can be distinguished were three specific oligonucleotides of different lengths, the to one of the three oligomers were complementary to the arrangement hybridized to the wafer and analyzed by MALDI-TOF mass spectrometry.

oligodeoxynucleotides

Three Sets of complementary oligodeoxynucleotide pairs were synthesized using one element of the complementary oligonucleotide pair contains a 3 'or 5' disulfide bond [available from Operon Technologies or oligos, etc.]. For example, oligomer 1 contains [d (CTGATGCGTCGGATCATCTTTTTT-SS), SEQ ID NO: 122] a 3'-disulfide bond, whereas oligomer 2 [d (SS CCTCTTGGGAACTGTGTAGTATT) is a disulfide derivative of SEQ ID NO: 117] and oligomer 3 [d (SS-GAATTCGAGCTCGGTACCCGG), a 5'-disulfide derivative of SEQ ID NO: 115] each contain a 5'-disulfide bond.

The Oligonucleotides that are complementary to the oligomers 1-3 are designed to be of different lengths so that she while the MALDI-TOF analysis easily distinguished from each other. It became for example a 23-mer oligonucleotide [SEQ ID NO: 123] complementary to a Section of Oligomer 1, a 12-mer oligonucleotide [SEQ ID NO: 121] became complementary to a portion of the oligomer 2, and a 21-mer [SEQ ID NO: 116] became complementary to a segment of the oligomer 3 synthesized. In addition, a fourth 29-mer Oligonucleotide [SEQ ID NO: 124] synthesized that does not belong to any of the three oligomers complementary was. This fourth oligonucleotide was used as a negative control.

Silicon surface chemistry and DNA immobilization

(a) 4x4 (16-digit) arrangement

A 2 × 2 cm ² silicon wafer with 256 individual wells or worlds in the form of a 16 × 16 well array was purchased from a commercial supplier [Accelerator Technology Corp., College Station, Texas). The wells measured 800 × 800 μm ² , were 120 μm deep; and had 1,125 distance. The silicon wafer was reacted with 3-aminopropyltriethoxysilane to form a uniform layer of primary amines on the surface and then exposed to the heterobifunctional crosslinker SIAB, resulting in surface iodoacetamido functionalities [see, e.g. Example 28].

to Preparation of Oligomers for the coupling to different locations of the silicon arrangement became the disulfide bond of each oligomer is completely filled with 10 mM TCEP as in Example 28 was reduced and the DNA was in a final concentration of 10 μM in a solution of 100 mM phosphate buffer, pH 8.0. Immediately after The reduction of the disulfide bond was the free thiol group of Oligomers to the iodoacetamido functionality at 16 sites on the wafer coupled, using the test coupling conditions, which were essentially as in Example 28. To the separate coupling at 76 individual locations on the wafer the entire surface the wafer was not rinsed with an oligonucleotide solution, but instead became a ~ 30 nl aliquot of a predetermined modified oligomer parallel to each of the 16 locations (i.e., pits) of the 256 wells placed on the wafer so that using a robotic stylus device a 4 × 4 arrangement immobilized DNA was prepared.

The Robotic pen device consists of 16 probes, which are in one Probe block and mounted on an X, Y, Z robot table are. The robot table was a bridge system, the placement of sample inserts under the robot arms enabled. The bridge unit itself consists of X and Y arms that move 250 and 400 mm, respectively and from brushless linear servomotors with position feedback, which are of linear-optical Code translators was provided. An adjusting screw-driven Z axis (50 mm vertical movement) is on the xy axis rail of the bridge unit Attached and powered by an in-line rotary servo motor with position feedback controlled by a motor-mounted rotary optical code converter. The work surface of the system is equipped with a pull-out device plate, which five microtiter plates keeps (mostly 2 plates with washing solution and 3 sample plates for a maximum 1152 different oligonucleotide solutions) and up to ten 20 x 20 mm wafers. The wafers are placed exactly in the plate against two stop pins and safely held by vacuum. The whole system is for safety from a plexiglass case surrounded and on a steel girder frame for heat and vibration damping attached. Motion control is accomplished by use of a commercial motion control device, which is a 3-axis servo controller and connected to a Computer is connected; the programming code for specific Applications are written on demand.

to Generation of a DNA array was a pin device with components, having solid pin elements in 16 wells of a multi-well DNA source plate, the solutions oligomers 1-3 contained, submerged, so that the distal ends of the pins wetted were, the robot structure moves the pin components to the silicon wafer and the sample is surface-contacted punctual applied. One of the modified oligonucleotides 1-3 was covalently attached to each of 16 separate wells of the 256 wells on the silicon wafer immobilized, creating a 4 × 4 array of immobilized DNA was generated.

at the implementation the hybridization reaction, the three complementary oligonucleotides and the negative control oligonucleotide in a final concentration of 10 μM for each Oligonucleotide in 1 ml of TE buffer [10 mM TrisHCl, pH 8.0, 1 mM EDTA), which was enriched with 1 M NaCl, mixed, and the solution became 10 minutes at 65 ° C heated. Immediately afterwards, the entire surface of the Silicon wafer with 800 μl the heated oligonucleotide solution rinsed. The complementary ones Oligonucleotides were hybridized to the immobilized oligomers, by incubating the silicon assembly for 1 hour at room temperature followed by incubation at 4 ° C for at least 10 min. alternative can the oligonucleotide solution are added to the wafer, which is then heated and for hybridization cooling down is left.

The hybridized array was then treated with a solution of 50 mM ammonium citrate buffer washed to cation exchange to sodium and potassium ions on DNA backbone (Pieles et al., 1993, Nucleic Acids Res. 21: 3191-3196). A 6-nl aliquot of a matrix solution of 3-hydroxypicolinic acid [0.7 M 3-hydroxypicolinic acid-10% Ammonium citrate in 50% acetonitrile; see Wu et al. (1993), Rapid. Commun. Mass Spectrom. 7, 142-146] was added in rows to each position of the arrangement, wherein a serial piezoelectric robot distributor (i.e., a piezoelectric Pipette system) was used.

The piezoelectric pipette system is built on a system which is obtained from Microdrop GmbH, Norderstedt, Germany, and contains a piezoelectric element drive that generates a pulsed signal sent to a piezoelectric element attached to a glass capillary, the solution to be distributed contains is attached and surrounds this; a pressure transducer for recording (by negative pressure) or emptying (by positive pressure) the capillary; an xyz robot table and robot drive, with the the capillary to fill, Emptying, distributing and cleaning is maneuvered, a stroboscope and a drive pulsed at the frequency of the piezoelectric element so that viewing the "suspended" droplet properties allows becomes; separate levels for Sources, and identification plates or sample targets (i.e., Si chip); a camera attached to the robotic arm, with which the loading of the Label plate monitors becomes; as well as a data terminal containing the printing unit, the xyz robot and controls the piezoelectric drive.

you let the 3-HPA solution dry at ambient temperature, and then with the piezoelectric Pipette to each site a 6 nl aliquot of water added to the to resuspend dried matrix-DNA complex, leaving the matrix-DNA complex when drying at ambient temperature a uniform crystalline surface at the bottom surface every job is training.

MALDI-TOF-MS analysis

The MALDI-TOF-MS analysis was performed serially at each of the 16 sites in the 6 shown and carried out essentially in Example 28 described hybridization arrangement. The resulting mass spectrum of the oligonucleotides, which hybridized specifically to each of the 16 sites of DNA hybridization, yielded at each site a specific signal reflecting the observed mass-to-charge experimental ratio corresponding to the specific complementary nucleotide sequence.

For example at the sites where only oligomer 1 is conjugated gave the Mass spectrum a dominant signal with one observed experimental mass-to-charge ratio of 7072.4, which is about equal to that of the 23-meter; the theoretical mass-to-charge ratio of the 23-mers is 7072.6 There. Specific hybridization of the 12-mer oligonucleotide the arrangement, with an observed experimental mass-to-charge ratio of 3618.33 Da (theoretically 3622.4 Da) was only in such places which were conjugated to oligomer 2, whereas a Specific hybridization of MJM6 (observed experimental Mass-to-charge ratio of 6415.4) has been demonstrated only at such locations of the arrangement, which were conjugated to oligomer 3 [theoretically 6407.2 Da].

None The location of this array gave a signal from the negative control 29-mer oligonucleotide (theoretical Mass-to-charge ratio from 8974.8), indicating that specific target DNA molecules are linked to oligomers can be hybridized, which are covalently immobilized to specific locations on the surface of the silicon assembly are, and a variety of hybridization tests can be used individually MALDI-TOF-MS analysis monitored become.

(b) 8x8 (64-digit) arrangement

A 2 × 2 cm ² silicon wafer with 256 individual wells or wells in the form of a 16 × 16 well array was purchased from a commercial supplier [Accelerator Technology Corp. College Station, Texas]. The holes measured 800 × 800 μm ² , were 120 μm deep and had a distance of 1.125. The silicon wafer was reacted with 3-aminopropyltriethoxysilane to produce a uniform layer of primary amines on the surface and then exposed to the heterobifunctional crosslinker SIAB, resulting in surface iodoacetamido functionalities as described above.

to Making an assembly of 64 elements became a pin device according to the above-described Method used. The pen device was in 16 wells one Dipped 384 well DNA source plate containing solutions of oligomers 1-3, transported to the silicon wafer, and the sample was made by surface contact punctual applied. Subsequently the device was in washing solution dipped, then dipped in the same 16 wells of the source plate and 2.25 mm from the initial one Set of 16 spots spotted on the target dotted; the entire cycle was repeated, leaving a 2 × 2 array of each pin and thus an 8 × 8 array of dots (2 × 2 elements / pin × 16 pins = 64 total dotted elements) was generated.

The Oligomers 1-3 immobilized to the 64 sites were hybridized to the complementary oligonucleotides and examined by MALDI-TOF-MS analysis. As for the 16-digit arrangement observed, at all points of the DNA arrangement was a specific Hybridization of the complementary Oligonucleotide to each of the immobilized thiol-containing oligomers observed.

EXAMPLE 30

renewal hybridized DNA primers immobilized on a silicon wafer DNA templates are bound

The SIAB-derivatized silicon wafers can also be used for primer extension reactions the immobilized DNA template are used, wherein substantially the methods described in Example 7 are used.

A 27-mer oligonucleotide [SEQ ID NO: 125] containing a free 3'-thiol group was added to a SIAB-derivatized silicon wafer as described above, e.g. As described in Example 28, coupled. A 12-mer oligonucleotide primer [SEQ ID NO: 126] was hybridized to the immobilized oligonucleotide and the primer was cloned with a commercially available kit [e.g. Sequenase or ThermoSequenase, US. Biochemical Corp.). The addition of Sequenase DNA polymerase or ThermoSequenase DNA polymerase in the presence of three deoxyribonucleoside triphosphates (dNTPs; dATP, dGTP, dCTP) and dideoxyribonucleoside thymidine triphosphate (ddTTP) in buffer according to the manufacturer's instructions gave a 3-base extension of the still attached to the silicon wafer 12-mer primer. The wafer was then cured by MALDI-TOF-Mas spectrophotometry as described above. The mass spectrum results clearly distinguish the 15-mer [SEQ ID NO: 127] from the original 12-mer extender, thus demonstrating that a specific extension is performed on the surface of a silicon wafer and detected by MALDI-TOF-MS analysis can be.

EXAMPLE 31

Influence of linker length on polymerase extension hybridized DNA primer, bound to DNA matrices immobilized on a silicon wafer

The Effect of the distance between the SIAB-conjugated silicon surface and the duplex DNA immobilized by hybridization of the target DNA to the Oligomer template was formed, and the selection of the enzyme were examined.

Two SIAB-derivatized silicon wafers were conjugated to the 3'-end of two oligonucleotides of the identical DNA sequence containing free thiol, except that a 3-base poly-dT spacer sequence was inserted at the 3'-end:

das zu Abschnitten der Nukleotidsequenzen komplementär ist, die beiden Oligonukleotiden gemeinsam sind, indem bei 75°C inkubiert wurde und der Silizium-Wafer langsam abgekühlt wurde. Die Wafer wurden dann durch MALDI-TOF-Massenspektrometrie wie vorstehend beschrieben analysiert.These oligonucleotides were synthesized and processed via the SIAB crosslinker [see, for example, US Pat. Example 28] each separately immobilized on the surface of a silicon wafer. Each wafer was incubated with a 12 mer oligonucleotide:

which is complementary to portions of the nucleotide sequences that are common to both oligonucleotides, incubated at 75 ° C and the silicon wafer slowly cooled. The wafers were then analyzed by MALDI-TOF mass spectrometry as described above.

As described in Example 30 above, became a specific 3 base extension of the bound 12-mer oligonucleotide with the oligomer primer, if a 9-base spacer was between the duplex and the surface [SEQ ID NO: 125]. Similar Results were observed when the DNA spacer length between the SIAB unit and the DNA duplex was 0, 3.6 and 12. The extension reaction can also with a variety of DNA polymerases, such as Sequenase and ThermoSequenase (US Biochemical) become. The SIAB linker can be coupled directly to the DNA template or it may include a linker sequence encoding primer extension the hybridized DNA is not affected.

EXAMPLE 32

Spectroscopy mutant detection in the ApoE gene

These Example describes the hybridization of an immobilized template, primer extension and mass spectrometry for detection of wild-type and the mutant apolipoprotein E gene for diagnostic purposes. This Example shows that immobilized DNA molecules that have a specific sequence contain, by primer extension, non-labeled allele-specific Primer and analysis of extension products by mass spectrometry can be detected and distinguished.

A 50-base long synthetic complementary to the coding sequence of allele 3 of the wild-type apolipoprotein E gene:
5'-GCCTGGTACACTGCCAGGCGCTTCTGCAGGTCATCGGCATCGCGGAGGAG-3 '[SEQ ID NO: 280] or to the mutant apolipoprotein E gene having a G → A transition at codon 158 complementary:
5'-GCCTGGTACACTGCCAGGCACTTCTGCAGGTCATCGGCATCGCGGAGGAG-3 '[SEQ ID NO: 281]

DNA template the one free 3'-thiol group was added to separate SIAB-derivatized silicon wafers as in Example 28 is coupled.

A 21-mer oligonucleotide primer:
5'-GAT GCC GAT GAC CTG CAG AAG-3 '[SEQ ID NO: 282] was hybridized to each of the immobilized templates and the primer was amplified with a commercially available kit [e.g. Sequenase or ThermoSequenase, US. Biochemical Corp.]. The addition of Sequenase DNA polymerase or ThermoSequenase DNA polymerase in the presence of three deoxyribonucleoside triphosphates (dNTPs; dATP, dGTP, dCTP) and dideoxyribonucleoside cytosine triphosphate (ddCTP) in buffer according to the manufacturer's instructions gave a single base extension to the immobilized template encoding the wild-type apolipoprotein E gene, bound 21-mer primer and a three-base extension of the 21-mer primer bound to the immobilized template encoding the mutant form of the apolipoprotein E gene.

The Wafers were analyzed by mass spectrometry as described herein. The wild type apolipoprotein E sequence gives a mass spectrum this is the single base extension (22-mer) primer with a mass-to-charge ratio of 6771.17. Since (the theoretical mass-to-charge ratio is 6753.5 Da) of the original 21-mer primer with a mass-to-charge ratio of 6499.64 Da distinguishes. The mutant apolipoprotein E sequence gives a mass spectrum that the primer with the three-base extension (24-mer) with a mass-to-charge ratio of 7386.9 (the theoretical mass-to-charge ratio is 7386,9) from the original one 21-mer primer with a mass-to-charge ratio of 649964 There is a difference.

EXAMPLE 33

Detection of double-stranded nucleic acid molecules via strand exchange and hybridization to an immobilized complementary nucleic acid

This Example describes the immobilization of a 24-mer primer and the specific hybridization of a strand of a duplex DNA molecule, thereby the amplification of a selected one Target molecule in a solution phase and the proof of the double-stranded molecule allows become. This method is suitable for the detection of single base changes and in particular, for screening genomic libraries of double-stranded fragments.

One 24-mer DNA primer CTGATGCGTC GGATCATCTT TTTT, SEQ ID NO: 122, the a free 3'-thiol group was added to a SIAB-derivatized silicon wafer as in Example 29 described coupled.

A synthetic 18-mer oligonucleotide:
5'-CTGATGCGTCGGATCATC-3 '[SEQ ID NO: 286] was probed with a 12-mer 5'-GATGATCCGACG-3' [SEQ ID NO: 285], the sequence of which is complementary to a 12-base portion of the 18-mer Oligonucleotide was premixed. The oligonucleotide mixture was heated to 75 ° C and slowly cooled to room temperature to facilitate the formation of a duplex molecule:

The specific hybridization of the 12-mer strand of the duplex molecule of the immobilized 24-mer primer was carried out by 1 M of the duplex molecule under the hybridization conditions described in Example 30 were mixed.

The Wafers were analyzed by mass spectrometry as described above analyzed. Specific hybridization was in a mass spectrum of the 12-meter with a mass-to-charge ratio of 3682.78 Since proven.

EXAMPLE 34

1- (2-Nitro-5- (3-O-4,4'-dimethoxytritylpropoxy) phenyl) -1-O - ((2-cyanoethoxy) diisopropylaminophosphino) ethane

A. 2-nitro-5- (3-hydroxypropoxy) benzaldehyde

3-Bromo-1-propanol (3.34 g, 24 mmol) was added overnight (15 h) in 80 mL of anhydrous acetonitrile with 5-hydroxy-2-nitrobenzaldehyde (3.34 g, 20 mmol), K ₂ CO ₃ (3.5 g) and KI (100 mg) left to reflux. The reaction mixture was cooled to room temperature and 150 ml of methylene chloride were added ben. The mixture was filtered and the solid residue was washed with methylene chloride. The combined organic solution was evaporated to dryness and dissolved in 100 ml of methylene chloride. The resulting solution was washed with saturated NaCl solution and dried over sodium sulfide. 4.31 g (96%) of the desired product were obtained after removal of the solvent in vacuo.
R _f = 0.33 (dichloromethane / methanol, 95/5).
UV (methanol) maximum: 313.240 (shoulder); 215 nm; Minimum: 266 nm.
¹ H-NMR. (DMSO-d ₆ ) δ 10.28 (s, 1H), 8.17 (d, 1H), 7.35 (d, 1H), 7.22 (s, 1H), 4.22 (t, 2H ), 3.54 (t, 2H), 1.90 (m, 2H).
¹³ CNMR (DMSO-d ₆ ) δ 189.9, 153.0, 141.6, 134.3, 127.3, 118.4, 114.0, 66.2, 56.9, 31.7.

For example, 2-nitro-5- (3-O-tert-butyldimethylsilylpropoxy) benzaldehyde

2-Nitro-5- (3-hydroxypropoxy) benzaldehyde (1 g, 4.44 mmol) was dissolved in 50 ml of anhydrous acetonitrile. To this solution was added 1 ml of triethylamine, 200 mg of imidazole and 0.8 g (5.3 mmol) of tBDMSCl. The mixture was stirred for 4 hours at room temperature. Methanol (1 ml) was added to stop the reaction. The solvent was removed in vacuo and the solid residue was dissolved in 100 ml of methylene chloride. The resulting solution was washed with saturated sodium bicarbonate solution and then with water. The organic phase was dried over sodium sulfate and the solvent was removed in vacuo. The crude mixture was subjected to rapid column chromatography with methylene chloride to give 1.44 g (96%) of 2-nitro-5- (3-O-tert-butyldimethylsilylpropoxy) benzaldehyde.
R _f = 0.67 (hexane / ethyl acetate, 5/1).
UV (methanol), maximum: 317, 243, 215 nm: minimum: 235, 267 nm.
¹ H-NMR (DMSO-d ₆₎ δ 10.28 (s, 1H), 8.14 (d, 1H), 7.32 (d, 1H), 7.20 (s, 1H), 4.20 (t, 2H), 3.75 (t, 2H), 1.90 (m, 2H), 0.85 (s, 9H), 0.02 (s, 6H).
¹³ C-NMR (DMSO-d ₆ ) δ 189.6, 162.7, 141.5, 134.0, 127.1, 118.2, 113.8, 65.4, 58.5, 31.2 , 25.5, -3.1, -5.7.

C. 1- (2-nitro-5- (3-O-tert-butyldimethylsilylpropoxy) phenyl) ethanol

High-vacuum dried 2-nitro-5- (3-O-tert-butyldimethylsilylpropoxy) benzaldehyde (1.02 g, 3 mmol) was dissolved in 50 ml of anhydrous methylene chloride. 2M trimethylaluminum in toluene (3 ml) was added dropwise over 10 minutes and the reaction mixture was left at room temperature. The stirring was continued for 10 minutes, and the mixture was poured into 10 ml of ice-cold water. The emulsion was separated from the water phase and dried over 100 g of sodium sulfate to remove residual water. The solvent was removed in vacuo and the mixture was applied to a silica gel column with a methanol gradient in methylene chloride. 0.94 g (86%) of the desired product was isolated.
R _f = 0.375 (hexane / ethyl acetate, 5/1).
UV (methanol), maximum: 306, 233, 206 nm: minimum: 255, 220 nm.
¹ H-NMR (DMSO-d ₆ ) δ 8.00 (d, 1H), 7.36 (s, 1H), 7.00 (d, 1H), 5.49 (b, OH), 5.31 (q, 1H), 4.19 (m, 2H), 3.77 (t, 2H), 1.95 (m, 2H), 1.37 (d, 3H), 0.86 (s, 9H) , 0.04 (s, 6H).
¹³ C-NMR (DMSO-d ₆ ) δ 162.6, 146.2, 139.6, 126.9, 112.9, 112.5, 64.8, 63.9, 58.7, 31.5 , 25.6, 24.9, -3.4, -5.8.

D. 1- (2-nitro-5- (3-hydroxypropoxy) phenyl) ethanol

1- (2-Nitro-5- (3-O-tert-butyldimethylsilylpropoxy) phenyl) ethanol (0.89 g, 2.5 mmol) was dissolved in 30 mL of THF and 0.5 mmol of nBu ₄ NF was added Stirring added. The mixture was stirred at room temperature for 5 hours and the solvent was removed in vacuo. The residual residue was applied to a silica gel column with a methanol gradient in methylene chloride. 1- (2-nitro-5- (3-hydroxypropoxy) phenyl) ethanol (0.6 g, (99%)) was obtained.
R _f = 0.17 (dichloromethane / methanol, 95/5).
UV (methanol), maximum: 304, 232, 210 nm: minimum: 255, 219 nm.
¹ H-NMR (DMSO-d ₆ ) δ 8.00 (d, 1H), 7.33 (s, 1H), 7.00 (d, 1H), 5.50 (d, OH), 5.28 (t, OH), 4.59 (t, 1H), 4.17 (t, 2H), 3.57 (m, 2H), 1.89 (m, 2H), 1.36 (d, 2H) ,
¹³ C-NMR (DMSO-d ₆ ) δ 162.8, 146.3, 139.7, 127.1, 113.1, 112.6, 65.5, 64.0, 57.0, 31.8 , 25.0.

E. 1- (2-nitro-5- (3-O-4,4'-dimethoxytritylpropoxy) phenyl) ethanol

1- (2-nitro-5- (3-hydroxypropoxy) phenyl) ethanol (0.482 g, 2 mmol) was co-evaporated twice with anhydrous pyridine and dissolved in anhydrous pyridine. The solution was cooled in an ice-water bath, and 750 mg (2.2 mmol) of DMTCl was added. The reaction mixture was stirred at room temperature overnight, and 0.5 ml of methanol was added to terminate the reaction. The solvent was removed in vacuo and the residue was evaporated twice with toluene to remove pyridine traces. The final residue was applied to a silica gel column with a methanol gradient in methylene chloride containing triethylamine drops to give 0.96 g (89%) of the desired product 1- (2-nitro-5- (3-O 4,4'-dimethoxytritylpropoxy) phenyl) ethanol.
R _f = 0.50 (dichloromethane / methanol, 99/1).
UV (methanol), maximum: 350 (shoulder), 305, 283, 276 (shoulder), 233, 208 nm; Minimum: 290, 258, 220 nm.
¹ H-NMR (DMSO-d ₆ ) δ 8.00 (d, 1H), 6.82-7.42 (ArH), 5.52 (d, OH), 5.32 (m, 1H), 4 , 23 (t, 2H), 3.71 (s, 6H), 3.17 (t, 2H), 2.00 (m, 2H), 1.37 (d, 3H).
¹³ C-NMR (DMSO-d ₆ ) δ 162.5, 157.9, 157.7, 146.1, 144.9, 140.1, 139.7, 135.7, 129.5, 128.8 , 127.6, 127.5, 127.3, 126.9, 126.4, 113.0, 112.8, 112.6, 85.2, 65.3, 63.9, 59.0, 54 , 8, 28.9, 24.9.

F. 1- (2-nitro-5- (3-O-4,4'-dimethoxytrilylpropoxy) phenyl) -1-O - ((2-cyanoethoxy) diisopropylaminophosphino) ethane

1- (2-nitro-5- (3-O-4,4'-dimethoxytritylpropoxy) phenyl) ethanol (400 mg, 0.74 mmol) was dried under high vacuum and dissolved in 20 mL of anhydrous methylene chloride. To this solution was added 0.5 ml of N, N-diisopropylethylamine and 0.3 ml (1.34 mmol) of 2-cyanoethyl-N, N-diisopropylchlorophosphoramidite. The reaction mixture was stirred at room temperature for 30 minutes and 0.5 ml of methanol was added to stop the reaction. The mixture was washed with saturated sodium bicarbonate solution and dried over sodium sulfate. The solvent was removed in vacuo. A rapid silica gel column with 1% methanol in methylene chloride containing triethylamine drops gave 510 mg (93%) of the desired phosphoramidite.
R _f = 0.87 (dichloromethane / methanol, 99/1)

EXAMPLE 35

1- (4- (3-O-4,4'-Dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) -1-O - ((2-cyanoethoxy) -diisopropylaminophosphino) ethane

A. 4 (3-hydroxypropoxy) -3-methoxyacetophenone

3-Bromo-1-propanol (53 mL, 33 mmol) was added overnight (15 h) in 100 mL of anhydrous acetonitrile with 4-hydroxy-3-methoxyacetophenone (5 g, 30 mmol), K ₂ CO ₃ (5 g) and Keep AI at reflux. After cooling to room temperature, the reaction mixture was admixed with 150 ml of methylene chloride. The mixture was filtered and the solid residue was washed with methylene chloride. The combined organic solution was evaporated to dryness and dissolved in 100 ml of methylene chloride. The resulting solution was washed with saturated NaCl solution and dried over sodium sulfate. 6.5 g (96.4%) of the desired product were obtained after removal of the solvent in vacuo.
R _f = 0.41 (dichloromethane / methanol, 95/5).
UV (methanol) maximum: 304, 273, 227, 210 nm; Minimum: 291, 244, 214 nm.
¹ H-NMR (DMSO-d ₆₎ δ 7.64 (d, 1H), 7.46 (s, 1H), 7.04 (d, 1H), 4.58 (b, OH), 4.12 (t, 2H), 3.80 (s, 3H), 3.56 (t, 2H), 2.54 (s, 3H), 1.88 (m, 2H).
¹³ C-NMR (DMSO-d ₆ ) δ 196.3, 152.5, 148.6, 129.7, 123.1, 111.5, 110.3, 65.4, 57.2, 55.5 , 31.9, 26.3.

B. 4. (3-Acetoxypropoxy) -3-methoxyacetophenone

4- (3-Hydroxypropoxy) -3-methoxyacetophenone (3.5 g, 15.6 mmol) was dried and dissolved in 80 mL of anhydrous acetonitrile. To this mixture was added 6 ml of triethylamine and 6 ml of acetic anhydride. After 4 hours, 6 ml of methanol was added and the solvent was removed in vacuo. The residue was dissolved in 100 ml of dichloromethane and the solution was washed with dilute sodium bicarbonate solution and then with water. The organic phase was dried over sodium sulfate and the solvent was removed. The solid residue was applied to a silica gel column with methylene chloride to give 4.1 g of 4- (3-acetoxypropoxy) -3-methoxyacetophenone (98.6%).
R _f 0.22 (dichloromethane / methanol, 99/1).
UV (methanol), maximum: 303, 273, 227, 210 nm; Minimum: 290, 243, 214 nm.
¹ H-NMR (DMSO-d ₆₎ δ 7.62 (d, 1H), 7.45 (s, 1H), 7.08 (4, 1H), 4.12 (m, 4H), 3.82 (s, 3H), 2.54 (s, 3H), 2.04 (m, 2H), 2.00 (s, 3H).
¹³ C-NMR (DMSO-d ₆ ) δ 196.3, 170.4, 152.2, 148.6, 130.0, 123.0, 111.8, 110.4, 65.2, 60.8 , 55.5, 27.9, 26.3, 20.7.

C. 4- (3-Acetoxypropoxy) -3-methoxy-6-nitroacetophenone

4- (3-Acetoxypropoxy) -3-methoxyacetophenone (3.99 g, 15 mmol) was added portionwise to 15 ml of 70% HNO ₃ in a water bath and the reaction temperature was maintained at room temperature. The reaction mixture was left at room temperature for 30 minutes, and 30 g of ice pieces were added. This mixture was extracted with 100 ml of dichloromethane and the organic phase was washed with saturated sodium bicarbonate solution. The solution was dried over sodium sulfate and the solvent was removed in vacuo. The crude mixture was applied to a silica gel column with a methanol gradient in methylene chloride to give 3.8 g (81.5%) of the desired product 4- (3-acetoxypropoxy) -3-methoxy-6-nitroacetophenone and O, 38 g (8%) of the ipso-substituted product 5- (3-acetopropoxy) -4-methoxy-1,2-dinitrobenzene were obtained.

Ipso-substituted by-product 5- (3-acetopropoxy) -4-methoxy-1,2-dinitrobenzene:
R _f = 0.47 (dichloromethane / methanol, 99/1).
UV (methanol), maximum: 334, 330, 270, 240, 212 nm; Minimum: 310, 282, 263, 223 nm.
¹ H-NMR _(CDCl3) δ 7.36 (s, 1H), 7.34 (s, 1H), 4.28 (t, 2H), 4.18 (t, 2H), 4.02 (s 3H), 2.20 (m, 2H), 2.08 (s, 3H).
¹³ C-NMR _(CDCl3) δ 170.9, 152.2, 151.1, 117.6, 111.2, 107.9, 107.1, 66.7, 60.6, 56.9, 28 , 2, 20,9.

Desired product 4- (3-acetoxypropoxy) -3-methoxy-6-nitroacetophenone:
R _f = 0.29 (dichloromethane / methanol, 99/1).
UV (methanol), maximum: 344, 300, 246, 213 nm; Minimum: 320, 270, 227 nm.
¹ H-NMR _(CDCl3) δ 37.62 (s, 1H), 6.74 (s, 1H), 4.28 (t, 2H), 4.20 (t, 2H), 3.96 (s , 3H), 2.48 (8, 3H), 2.20 (m, 2H), 2.08 (s, 3H).
¹³ C-NMR _(CDCl3) δ 200.0, 171.0, 154.3, 148.8, 138.3, 133.0, 108.8, 108.0, 66.1, 60.8, 56 , 6, 30.4, 28.2, 20.9.

D. 1- (4- (3-Hydroxypropoxy) -3-methoxy-6-nitrophenyl) ethanol

4- (3-Acetoxypropoxy) -3-methoxy-6-nitroacetophenone (3.73 g, 12 mmol) was added to 150 ml of ethanol and 6.5 g of K ₂ CO ₃ . The mixture was stirred at room temperature for 4 hours and DSC with 5% methanol in dichloromethane showed completion of the reaction. To this same reaction mixture was added 3.5 g of NaHB ₄ , and the mixture was stirred for 2 hours at room temperature. Acetone (10 ml) was added and reacted with the remaining NaBH ₄ . The solvent was removed in vacuo and the residue was taken up in 50 g of silica gel. The silica gel mixture was applied to the top of a silica gel column with 5% methanol in methylene chloride to give 3.15 g (97%) of the desired product 1- (4- (3-hydroxypropoxy) -3-methoxy-6-nitrophenyl ) ethanol.

Intermediate 4- (3-hydroxypropoxy) -3-methoxy-6-nitroacetophenone after cleavage of the protecting group:
R _f = 0.60 (dichloromethane / methanol, 95/5).
Final product: 1- (4- (3-hydroxypropoxy) -3-methoxy-6-nitrophenyl) ethanol
R _f = 0.50 (dichloromethane / methanol, 95/5).
UV (methanol), maximum: 344, 300, 243, 219 nm; Minimum: 317, 264, 233 nm.
¹ H-NMR (DMSO-d ₆₎ δ 7.54 (s, 1H), 7.36 (s, 1H), 5.47 (d, OH), 5.27 (m, 1H), 4.55 (t, OH), 4.05 (t, 2H), 3.90 (s, 3H), 3.55 (q, 2H), 1.88 (m, 2H), 1.37 (d, 3H) ,
¹³ C-NMR (DMSO-d ₆ ) δ 153.4, 146.4, 138.8, 137.9, 109.0, 108.1, 68.5, 65.9, 57.2, 56.0 , 31.9, 29.6.

E. 1- (4- (3-O-4,4'-Dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) ethanol

1- (4- (3-Hydroxypropoxy) -3-methoxy-6-nitrophenyl) ethanol (0.325 g, 1.2 mmol) was co-evaporated twice with anhydrous pyridine and dissolved in 15 ml of pyridine. The solution was cooled in an ice-water bath and 450 mg (1.33 mmol) of DMTCI was added. The reaction mixture was stirred at room temperature overnight, and 0.5 ml of methanol was added to stop the reaction. The solvent was removed in vacuo and the residue co-evaporated twice with toluene to remove the pyridine traces. The final residue was applied to a silica gel column with a methanol gradient in methylene chloride containing triethylamine drop to give 605 mg (88%) of the desired product 1- (4- (3-O-4,4'-dimethoxytritylpropoxy ) -3-methoxy-6-nitrophenyl) ethanol.
R _f = 0.50 (dichloromethane / methanol, 95/5).
UV (methanol), maximum, 354, 302, 282, 274, 233, 209 nm; Minimum: 322, 292, 263, 222 nm.
¹ H-NMR (DMSO-d ₆ ) δ 7.54 (s, 1H), 6.8-7.4 (ArH), 5.48 (d, OH), 5.27 (m, 1H), 4 , 16 (t, 2H), 3.85 (s, 3H), 3.72 (s, 6H), 3.15 (t, 2H), 1.98 (t, 2H), 1.37 (d, 3H).
¹³ C-NMR (DMSO-d ₆ ) 157.8, 153.3, 146.1, 144.9, 138.7, 137.8, 135.7, 129.4, 128.7, 127.5, 127.4, 126.3, 112.9, 112.6, 108.9, 108.2, 85.1, 65.7, 63.7, 59.2, 55.8, 54.8, 29, 0, 25.0.

F. 1- (4- (3-O-4,4'-dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) -1-O - ((2-cyanoethoxy) -diisopropylaminophosphino) ethane

1- (4- (3-O-4,4'-dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) ethanol (200 mg, 3.5 mmol) was dried under high vacuum and dissolved in 15 ml of anhydrous methylene chloride. To this solution was added 0.5 ml of N, N-diisopropylethylamine and 0.2 ml (0.89 mmol) of 2-cyanoethyl-N, N-diisopropylchlorophosphoramidite. The reaction mixture was stirred at room temperature for 30 minutes, and 0.5 ml of methanol was added to the reaction to terminate the reaction. The mixture was washed with saturated sodium bicarbonate solution and dried over sodium sulfate. The solvent was removed in vacuo and a rapid silica gel column containing 1% methanol in methylene chloride containing triethylamine drop gave 247 mg (91.3%) of the desired phosphoramidite 1- (4- (3-O-4,4'- Dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) -1-O - ((2-cyanoethoxy) diisopropylaminophosphino) ethane.
R _f = 087 (dichloromethane / methanol, 99/1).

EXAMPLE 36

Oligonucleotide Synthesis

The Oligonucleotide conjugates containing photocleavable linkers were used by solid-phase nucleic acid synthesis (see Sinha et al., (1983) Tetrahedron Lett. 24: 5843-5846; Sinha et al. (1984), Nucleic Acids Res. 12: 4539-4557; Beaucage et al. (1993) Tetrahedron 49, 6123-6194 and Matteuci et al. (1981) J. Am. Chem. Soc. 103: 3185-3191) Standard conditions produced. For the installation of photocleavable Unit and the 5'-terminal Amino group was added as well a longer one Coupling duration used. The coupling efficiency was measured the extinction of the released DMT cation, and the Results showed comparable coupling efficiency of phosphoramidite 1- (2-nitro-5- (3-O-4,4'-dimethoxytritylpropoxy) phenyl-1-O- ((2-cyanoethoxy) -diisopropylaminophosphino) ethane or 1- (4- (3-O-4,4'-dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) -1-O - ((2-cyanoethoxy) -diisopropylaminophosphino) ethane with those more ordinary Nucleoside phosphoramidites. The cleavage of the base protection group and release of the conjugates from the solid support was done with concentrated Anmmonium over Night at 55 ° C. Cleavage of the base protecting group from other conjugates was done by rapid cleavage with AMA reagents. The cleaning of the MMT-on conjugates were made by HPLC (Trityl-On) using 0.1 M triethylammonium acetate, pH 7.0, and an acetonitrile gradient (5% to 25% in 20 minutes) has been. The collected MMT- or DMT-protected conjugate was concentrated, with 80% aqueous acetic acid (40 min, 0 ° C) detritylated, desalted and stored at -20 ° C.

EXAMPLE 37

Photolysis study

In a typical case, 2 nmoles of oligonucleotide conjugate containing photocleavable linker were irradiated in 200 μl of distilled water with a boring UV lamp (Blak Ray XX-15 UV lamp, Ultraviolet products, San Gabriel, CA) from a distance of 10 cm (Emission peak 365 nm, lamp intensity = 1.1 mW / cm ² at 31 cm distance). The resulting mixture was analyzed by HPLC (trityl-off) using 0.1 M triethylammonium acetate, pH 7.0, and an acetonitrile gradient. The analysis showed that the conjugate was cleaved from the linker by UV irradiation within minutes.

Claims (18)

A method for determining the order of base-specific ending nucleic acid fragments of a target nucleic acid molecule comprising the steps of: a) obtaining a nucleic acid molecule comprising the target nucleic acid sequence and, at one end, a label; b) generating partial base-specific ending nucleic acid fragments from the target nucleic acid using an endonuclease; and c) analyzing the fragments by mass spectrometry format to obtain mass spectrometric data, using the data; and d) determining the order of base-specific ending nucleic acid fragments in the target nucleic acid acid molecule. The method of claim 1, wherein the nuclease is a Restriction enzyme is at least one restriction site in the target nucleic acid can recognize and split. The method of claim 1, wherein the target nucleic acid is a deoxyribonucleic acid and the nuclease is a deoxyribonuclease. The method of claim 1, wherein the target nucleic acid is a ribonucleic acid and the nuclease is a ribonucease. The method of claim 4, wherein the ribonuclease selected is selected from the group consisting of: the G-specific T1 ribonuclease, the A-specific U2 ribonuclease, the A / U specific PhyM ribonuclease, the U / C specific ribonuclease A, the C-specific chicken liver ribonuclease and Crisavitin. The method of claim 1, wherein in step b) produced base-specific ending nucleic acid fragments nucleotides with modified Include mass. The method of claim 1 wherein the label is a 3 'mark comprises. The method of claim 1 wherein the label is a 5 'mark comprises. A method according to claim 7 or 8, wherein the label a non-natural one Mark is. The method of claim 9, wherein the non-natural label selected is selected from the group consisting of: an affinity tag and a mass tag. The method of claim 10, wherein the affinity tag the immobilization of the nucleic acid on a solid support facilitated. The method of claim 11, wherein the affinity tag Biotin is or a nucleic acid sequence that is capable of attaching to a capture nucleic acid sequence attached to a solid carrier is bound to bind. A method according to any one of claims 1-12, wherein a nucleic acid has a selectively cleavable linker is immobilized on a solid support. The method of claim 13, wherein the linker is thermal cleavable, enzymatically cleavable, photocleavable or chemically cleavable is. The method of claim 13, wherein the linker is a Trityl linker is. The method of claim 13, wherein the linker is selected from the group consisting of 1- (2-nitro-5- (3-O-4,4'-dimethoxytritylpropoxy) phenyl) -1-O - ((2-cyanoethoxy) -diisopropylaminophosphine) ethane and 1- (4- (3-O-4,4'-dimethoxytritylpropoxy) -3-methoxy-6-nitrophenyl) -1-O- ((2-cyanoethoxy) -diisopropylaminophosphine) ethane. The method of claim 1, wherein the labeled Fragments of the non-labeled Fragments are separated before the fragments by mass spectrometry to be analyzed. The method of claim 1, wherein the labeled Fragments of the non-labeled Fragments are separated, the labeled fragments by mass spectrometry Format are analyzed, and the order of the marked fragments is determined.