DE19714558A1 - A new method for sequencing biopolymers using mass spectrometry - Google Patents
A new method for sequencing biopolymers using mass spectrometryInfo
- Publication number
- DE19714558A1 DE19714558A1 DE19714558A DE19714558A DE19714558A1 DE 19714558 A1 DE19714558 A1 DE 19714558A1 DE 19714558 A DE19714558 A DE 19714558A DE 19714558 A DE19714558 A DE 19714558A DE 19714558 A1 DE19714558 A1 DE 19714558A1
- Authority
- DE
- Germany
- Prior art keywords
- sequencing
- rna
- nucleic acids
- dna
- mass spectrometry
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6848—Methods of protein analysis involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6818—Sequencing of polypeptides
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6848—Methods of protein analysis involving mass spectrometry
- G01N33/6851—Methods of protein analysis involving laser desorption ionisation mass spectrometry
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Wood Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Optics & Photonics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
Abstract
Description
Die zunehmenden Aktivitäten in der Forschung von Nukleinsäuren, besonders von Ribonukleinsäuren sowie von Peptiden und Oligosacchariden in den letzten Jahren, erfordern eine schnelle Standard-Sequenziermethode, die auch Modifikationen detektieren kann Bisherige Methoden für die Sequenzierung von RNA beruhen auf zweidimensionalen chromatographischen Methoden1-3, Maxam-Gilbert-Sequenzierung4-7 oder Reverse Transkriptase Sanger Sequenzierung8,9. Neuere Entwicklungen benutzen Massenspektrometrie zur Primärstrukturbestimmung10. Eine Reihe von Arbeiten in den letzten Jahren haben sich mit dem physikalischen Abbau von Oligonukleotiden beschäftigt, wie z. B. Tandem Massenspektrometrie mit Elektrospray Ionisierung, ESI (CID, collision induced dissociation)11-13, enzymatische Reaktionen unter Verwendung von Exonukleasen10,14 oder Oligonukleotid- Aufbau mit Polymerasen15,16 und physikalische spontane Fragmentierung wie "nozzle skimmer dissociation" (NS) von ESI generierten Nukleinsäure Ionen17,18 oder spontane Dissoziation der Nukleinsäuren nach Infrarot-Laser Beschuß einer in einer Matrix kristallisierten Probe18-24 Diese Methoden versagen aber bei der Sequenzierung von RNA, da die Nukleotide Uridin (U, 306,17) und Cytidin (C, 305,18) fast gleiche Massen besitzen. Deshalb wurde argumentiert, daß die Sequenzierung von RNA durch Exonuklease Abbau (Verdau) und Detektion der erhaltenen Fragmente mit Massenspektrometrie nicht möglich sei25.The increasing activities in the research of nucleic acids, especially ribonucleic acids as well as peptides and oligosaccharides in recent years, require a fast standard sequencing method that can also detect modifications. Previous methods for sequencing RNA are based on two-dimensional chromatographic methods 1-3 , Maxam-Gilbert sequencing 4-7 or reverse transcriptase Sanger sequencing 8.9 . More recent developments use mass spectrometry to determine the primary structure 10 . A number of works in recent years have dealt with the physical degradation of oligonucleotides, such as. B. Tandem mass spectrometry with electrospray ionization, ESI (CID, collision induced dissociation) 11-13 , enzymatic reactions using exonucleases 10,14 or oligonucleotide construction with polymerases 15,16 and physical spontaneous fragmentation such as "nozzle skimmer dissociation" (NS ) nucleic acid ions generated by ESI 17,18 or spontaneous dissociation of the nucleic acids after infrared laser bombardment of a sample 18-24 crystallized in a matrix Cytidine (C, 305,18) have almost the same masses. It has therefore been argued that the sequencing of RNA by exonuclease degradation (digestion) and detection of the fragments obtained with mass spectrometry is not possible 25 .
Wir beschreiben hier eine Methode, mit der man RNA durch Exonukleaseverdau, Trennung und Detektion der erzeugten Fragmente mit Massenspektrometrie, sequenzieren kann. Die Methode kann besonders nützlich sein für die Primärstrukturbestimmung von RNA (oder auch DNA), die länger als 20 Basen ist oder modifizierten Nukleinsäuren, da die Auflösung von Massenspektrometern ein limitierender Faktor für die Sequenzanalyse längerer Nukleinsäurefragmente darstellt. Sie kann auch wertvoll bei der Bestimmung der Sekundärstruktur von Nukleinsäuren sein. Die Nukleinsäurefragmente werden durch unterschiedliche Massen, der beim Verdau von Exonukleasen (vornehmlich 5'→3'- Exonuklease aus Kalbsmilz und 3'→5'-Exonuklease aus Schlangengift von crotalus durissus) austretenden Nukleotide, massenspektrometrisch bestimmt. U und C werden aber durch unterschiedliche Peakintensitäten im Massenspektrum erkannt. Die Unterschiede in den Peakintensitäten werden durch unterschiedliche Geschwindigkeiten bei der Hydrolyse der Phosphodieseterbindungen durch das Enzym hervorgerufen. Dadurch werden Fragmente, die am 5'-Ende ein C enthalten durch 5'→3'-Phosphodiesterase weniger schnell abgebaut und liegen deshalb in viel größeren Konzentrationen vor als z. B. 5'-U enthaltende Fragmente. Die gleiche Beobachtung wird auch für 5'-A-Fragmente gemacht. Adenosin ist jedoch auch durch seine Masse von den anderen Nukleotiden leicht zu unterscheiden. Es ist möglich mehrere Nukleinsäuren gleichzeitig dieser Enzymkinetik zu unterwerfen, um die Sequenziergeschwindigkeit zu erhöhen. Auch der Einsatz von basenspezifischen Exo-/Endo nukleasen kann zur Sequenzanalyse und zur schnellen Erkennung und Bestimmung von Organismen, z. B. Viren herangezogen werden, deren RNA oder DNA einem "Fingerprinting" (Verdau von RNA oder DNA mit Exo-/Endonukleasen, die nicht an jedem Nukleotid basenspezifisch schneiden) oder "Footprinting" (Verdau von RNA oder DNA, die mit Nukleinsäure fremden Molekülen wechselwirken und der Hydrolyse mit Exo-/Endonukleasen ausgesetzt werden) unterworfen wird. Die Trennung und Detektion der erzeugten Fragmente durch Massenspektrometrie kann so z. B. zur Prävention von Seuchen oder zur Bestimmung von Organismen und biologischen Waffen eingesetzt werden. Finger- und Footprint sind genauer als bisherige Methoden: Es werden nach der Hydrolyse einer Phosphodiesterbindung beide Spaltfragmente detektiert, während herkömmliche Verfahren nur das markierte Fragment detektieren können. Eine Sekundärstrukturvorhersage von Nukleinsäuren ist schließlich dadurch möglich, daß die Enzyme oft bevorzugt an einzelsträngigen, linearen Bereichen schneiden. Somit können Domänen, Sekundär- und Tertiärstrukturen wie z. B. "Hairpins" oder "intrnal loops" an ihren doppelsträngigen Bereichen erkannt werden.We describe here a method by which RNA can be digested by exonuclease, separation and detecting the generated fragments with mass spectrometry. the Method can be particularly useful for determining the primary structure of RNA (or also DNA) that is longer than 20 bases or modified nucleic acids, as the dissolution of Mass spectrometers are a limiting factor for longer sequence analysis Represents nucleic acid fragments. They can also be valuable in determining who Be secondary structure of nucleic acids. The nucleic acid fragments are through different masses that occur during the digestion of exonucleases (mainly 5 '→ 3'- Exonuclease from calf's spleen and 3 '→ 5' exonuclease from snake venom from crotalus durissus) emerging nucleotides, determined by mass spectrometry. U and C are however through different peak intensities recognized in the mass spectrum. The differences in the Peak intensities are due to different rates in the hydrolysis of the Phosphodieseter bonds caused by the enzyme. This will remove fragments that contain a C at the 5 'end and are less rapidly degraded by 5' → 3'-phosphodiesterase are therefore in much larger concentrations than z. B. 5'-U containing fragments. the the same observation is made for 5 'A fragments. However, adenosine is also through its mass can be easily distinguished from the other nucleotides. It is possible several To subject nucleic acids to these enzyme kinetics at the same time in order to achieve the Increase sequencing speed. Also the use of base-specific exo / endo Nucleases can be used for sequence analysis and for the rapid recognition and determination of Organisms, e.g. B. Viruses are used whose RNA or DNA a "fingerprinting" (Digestion of RNA or DNA with exo / endonucleases that do not attach to any nucleotide base-specific cut) or "footprinting" (digestion of RNA or DNA, which with Foreign nucleic acid molecules interact and hydrolyze with exo- / endonucleases exposed). The separation and detection of the fragments generated by mass spectrometry, for. B. for the prevention of epidemics or for determination used by organisms and biological weapons. Fingerprint and footprint are more accurate than previous methods: after hydrolysis, a phosphodiester bond is formed both cleavage fragments are detected, while conventional methods only detect the labeled fragment can detect. A secondary structure prediction of nucleic acids is finally possible because the enzymes often preferentially on single-stranded, linear regions cut. Thus, domains, secondary and tertiary structures such as e.g. B. "Hairpins" or "intrnal loops" can be recognized by their double-stranded areas.
Diese Prinzipien lassen sich auch auf die Sequenzierung bzw. Sekundärstrukturbestimmung anderer Biopolymere anwenden, wie z. B. Peptide und Oligosaccharide.These principles can also be applied to sequencing or secondary structure determination apply other biopolymers, such as B. peptides and oligosaccharides.
Die Methode ist sowohl mit MALDI als auch mit DE-MALDI26,27 durchführbar. The method can be carried out with both MALDI and DE-MALDI 26,27 .
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
b) mit RNase CL3 (aus Hühnerleber)b) with RNase CL3 (from chicken liver)
Für alle Beispiele der massenspektrometrischen RNA Sequenzierungen gilt, falls nicht anders angegeben: Linear kontinuierliche MALDI-TOF Massenspektrometrie wurde mit einem Fisons VG TOF spec Massenspektrometer (8mer, 9mere RNA und DNA, 16mer, 22mer, 120mer) und DE-MALDI-TOF Messungen mit einem PerSeptive Biosysteins Voyager Massenspektrometer (16mer) durchgeführt, die einen UV Stickstofflaser mit einer Emissionsfrequenz von 337 nm enthalten. Die Laser Pulsbreite ist 4 ns. Die Spektren wurden im negativ Modus aufgenommen mit Ausnahme des 16mers und des 32mers. Diese wurden im positiv Modus gemessen. 2,4,6- Trihydroxyacetophenon/Ammoniumcitrat wurde in allen Sequenzierexperimenten als Matrix verwendet. Herstellung der Matrix: Lösung 1 (2,4,6-Trihydroxyacetophenon gesättigt in Ethanol:Wasser, 1 : 1) und Lösung 2 (0,1 M Ammoniumcitratin Wasser ∼ pH 5,5) werden im Verhältnis 2 : 1 gemischt. Enzyme wurden von Boehringer Mannheim bezogen: 5'→3' Phosphodiesterase aus Kalbsmilz: Das Enzym greift das Oligonukleotid am 5'-Ende an und hinterläßt 3' Nukleotide. 3'→5' Phosphodiesterase aus crotalus durissus: Das Enzym greift das Oligonukleotid am 3'-Ende an und hinterläßt 5' Nukleotide. RNase CL3 aus Hühnerleber: Das Enzym spaltet RNA bevorzugt an Cp/N-Bindungen und produziert Fragmente mit 3' endständigem Cytidinphosphat. Ap/N- und Gp/N-Bindungen werden viel langsamer hydrolysiert, Up/N-Bindungen sehr selten. RNase CL3/Pufferlösung (denaturierend): 2 µl RNase CL3 (0,2 U/µl) + 6 µl 8 M Harnstoff in Wasser resultieren in 8 µl 50 mU/µl Enzymlösung. 3'→5'-Phosphodiesternse/Pufferlösung: 2 µl (4 mU/µl) 3'→5'-Phosphodiesterase + 18 µl 0.1 M Ammoniumcitrat, pH 5,5 resultieren in 20 µl 0.2 mU/µl Enzymlösung. Sequenzen der untersuchten RNA-Stücke waren wie folgt 8mer: 5'-HO-CAUGUGAC-OH-3'; 9mer (RNA): 5'-HO-GCAUGUGAC-OH-3'; 9mer (DNA): 5'-HO-GTCACATGC-OH-3'; 16mer: 5'-HO-GCGUACAUCUUCCCCU-OH-3'; 22mer: 5'-HO- GCUCUUUUCU*UUUUUCUUUUCC-OH-3'; (U* = 13C markiertes Uridin an allen fünf Kohlenstoffatomen des Zuckerbausteins); 120mer (5s-ribosomale RNA): 5'- pUGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCG UAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU-OH-3'.Unless otherwise stated, the following applies to all examples of mass spectrometric RNA sequencing: Linear continuous MALDI-TOF mass spectrometry was carried out with a Fisons VG TOF spec mass spectrometer (8-mer, 9-mer RNA and DNA, 16-mer, 22-mer, 120-mer) and DE-MALDI-TOF measurements a PerSeptive Biosysteins Voyager mass spectrometer (16mer) containing a UV nitrogen laser with an emission frequency of 337 nm. The laser pulse width is 4 ns. The spectra were recorded in negative mode with the exception of the 16mers and 32mers. These were measured in positive mode. 2,4,6-trihydroxyacetophenone / ammonium citrate was used as a matrix in all sequencing experiments. Preparation of the matrix: Solution 1 (2,4,6-trihydroxyacetophenone saturated in ethanol: water, 1: 1) and solution 2 (0.1 M ammonium citrate in water ∼ pH 5.5) are mixed in a ratio of 2: 1. Enzymes were obtained from Boehringer Mannheim: 5 '→ 3' phosphodiesterase from calf's spleen: the enzyme attacks the oligonucleotide at the 5 'end and leaves 3' nucleotides behind. 3 '→ 5' phosphodiesterase from crotalus durissus: The enzyme attacks the oligonucleotide at the 3 'end and leaves 5' nucleotides behind. RNase CL3 from chicken liver: The enzyme cleaves RNA preferentially at Cp / N bonds and produces fragments with 3 'terminal cytidine phosphate. Ap / N and Gp / N bonds are hydrolyzed much more slowly, Up / N bonds are very rare. RNase CL3 / buffer solution (denaturing): 2 µl RNase CL3 (0.2 U / µl) + 6 µl 8 M urea in water result in 8 µl 50 mU / µl enzyme solution. 3 '→ 5' phosphodiesterase / buffer solution: 2 µl (4 mU / µl) 3 '→ 5'-phosphodiesterase + 18 µl 0.1 M ammonium citrate, pH 5.5 result in 20 µl 0.2 mU / µl enzyme solution. Sequences of the investigated RNA pieces were 8-mer as follows: 5'-HO-CAUGUGAC-OH-3 '; 9mer (RNA): 5'-HO-GCAUGUGAC-OH-3 '; 9mer (DNA): 5'-HO-GTCACATGC-OH-3 '; 16-mer: 5'-HO-GCGUACAUCUUCCCCU-OH-3 '; 22mer: 5'-HO-GCUCUUUUCU * UUUUUCUUUUCC-OH-3 '; (U * = 13 C labeled uridine on all five carbon atoms of the sugar building block); 120mer (5s ribosomal RNA): 5'- pUGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCG UAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCC-3AGGCAU-OH '.
In allen Experimenten wurden Proben von je 1 µl nach einer Inkubationszeit von 1, 3, 6, 10, 20 und 60 Minuten
genommen (es sind meist nicht alle Spektren gezeigt). Die Proben wurden mit der Matrix im Verhältnis 1 : 1
gemischt, auf die Probenplatte des Spektrometers pipettiert und ca. 20 Minuten an der Luft getrocknet. Die
Trocknungs- und Kristallisationszeit kann durch vorsichtiges Anfönen verkürzt werden. Der enzymatische Verdau
stoppt, wenn die Proben mit der Matrix vermischt werden.
In all experiments, samples of 1 µl each were taken after an incubation time of 1, 3, 6, 10, 20 and 60 minutes (mostly not all spectra are shown). The samples were mixed with the matrix in a ratio of 1: 1, pipetted onto the sample plate of the spectrometer and air-dried for about 20 minutes. The drying and crystallization time can be shortened by careful tinting. The enzymatic digestion stops when the samples are mixed with the matrix.
Inkubationstemperatur: 22°C
Inkubationzszeit: 6 Minuten
Incubation temperature: 22 ° C
Incubation time: 6 minutes
Inkubationstemperatur: 50°C
Inkubationszeit: 10 MinutenIncubation temperature: 50 ° C
Incubation time: 10 minutes
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
b) mit 3'→5' Phosphodiesterase (aus crotalus durissus)b) with 3 '→ 5' phosphodiesterase (from crotalus durissus)
Inkubationstemperatur: 22°C
Incubation temperature: 22 ° C
Inkubationstemperatur: 40°CIncubation temperature: 40 ° C
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
a) mit 5'→3' Phosphodiesterase (aus Kalbsmilz)a) with 5 '→ 3' phosphodiesterase (from calf's spleen)
b) mit 3'→5' Phosphodiesterase (aus crotalus durissus)b) with 3 '→ 5' phosphodiesterase (from crotalus durissus)
Inkubationstemperatur: 22°C
Incubation temperature: 22 ° C
Inkubationstemperatur: 40°CIncubation temperature: 40 ° C
Inkubationstemperatur: 22°C
Inkubationszeit: 20 Minuten Incubation temperature: 22 ° C
Incubation time: 20 minutes
Inkubationstemperatur: 50°C
Inkubationszeit: 15 MinutenIncubation temperature: 50 ° C
Incubation time: 15 minutes
Inkubationstemperatur: 50°C
Inkubationszeit: 1 Minute Incubation temperature: 50 ° C
Incubation time: 1 minute
Fragmente und Massen des Verdaus eines RNA 9mers (5'-HO-GCAUGUGAC-OH- 3') mit 3'→5'-Phosphodiesterase (aus crotalus durissus)Fragments and masses of the digestion of an RNA 9mer (5'-HO-GCAUGUGAC-OH- 3 ') with 3' → 5'-phosphodiesterase (from crotalus durissus)
Fragmente und Massen des Verdaus eines RNA 9mers (5'-HO-GCAUGUGAC-OH- 3') mit 3'→5'-Phosphodiesterase (aus crotalus durissus)Fragments and masses of the digestion of an RNA 9mer (5'-HO-GCAUGUGAC-OH- 3 ') with 3' → 5'-phosphodiesterase (from crotalus durissus)
Fragmente und Massen des Verdaus eines DNA 9mers (5'-HO-d(GTCACATGC)- OH-3') mit 3'→5'-Phosphodiesternse (aus crotalus durissus)Fragments and masses of the digestion of a DNA 9mer (5'-HO-d (GTCACATGC) - OH-3 ') with 3' → 5'-phosphodiester star (from crotalus durissus)
Fragmente und Massen des Verdaus eines DNA 9mers (5'-HO-d(GTCACATGC)- OH-3') mit 3'→5'-Phosphodiesternse (aus crotalus durissus)Fragments and masses of the digestion of a DNA 9mer (5'-HO-d (GTCACATGC) - OH-3 ') with 3' → 5'-phosphodiester star (from crotalus durissus)
DNA-AbgangsgruppenDNA leaving groups
DNA-AbgangsgruppenDNA leaving groups
RNA-AbgangsgruppenRNA leaving groups
RNA-AbgangsgruppenRNA leaving groups
Inkubationstemperatur: 40°CIncubation temperature: 40 ° C
Im folgenden werden die Vorteile der Methode nochmals aufgeführt:
The advantages of the method are listed again below:
- - Das Verfahren arbeitet elektrophoresefrei und ist damit sehr schnell.- The process works electrophoresis-free and is therefore very fast.
- - Es wird kein zusätzlicher Marker zur Detektion benötigt auch keine Radioaktivität. Damit entfallen alle Markierungsschritte.- No additional marker is required for detection and no radioactivity. In order to all marking steps are omitted.
- - Das Verfahren nutzt nicht nur die Bestimmung der Masse zur Dateninterpretation, sondern auch die Peakintensitäten. Damit sind auch Spektrometer mit geringer Auflösung, die auch leicht bedienbar sind, einsetzbar und das Verfahren wird kostengünstig.- The method not only uses the determination of the mass for data interpretation, but also the peak intensities. This also includes spectrometers with low resolution that too are easy to operate, deployable and the process becomes inexpensive.
- - Es ist keine genaue Massenbestimmung nötig. Deshalb können auch sehr lange Polymere sequenziert werden.- It is not necessary to determine the exact mass. Therefore, very long polymers can also be used sequenced.
- - Die Methode kann zur Sekundärstrukturvorhersage von Biopolymeren herangezogen werden.- The method can be used to predict the secondary structure of biopolymers will.
- - Das Verfahren kann zur Sequenzierung von modifizierten Bioploymeren dienen.- The method can be used for sequencing modified biopolymers.
- - Das Verfahren kann zur Bestimmung von Organismen dienen (Fingerprint/Footprint).- The method can be used to determine organisms (fingerprint / footprint).
- - Die Methode ist automatisierbar und parallelisierbar.- The method can be automated and parallelized.
Es wird ein neues Verfahren zur Sequenzierung von Biopolymeren mit Massenspektrometrie beschrieben. Die Sequenzierung von Bioploymeren ist entweder langwierig oder benötigt eine genaue Massenbestimmung von Fragmenten. Dies ist vor allem für lange Polymere schwierig. Die Geschwindigkeit der Hydrolyse von Phosphodiester-, Peptid- oder Glycosidbindungen mit Exo-/Endonukleasen, -peptidasen, -glycosidasen oder anderen hydrolytisch wirkenden Substanzen wird in unserem Verfahren zur Sequenzanalyse von Nukleinsäuren oder anderen Biopolymeren herangezogen. Trennung und Detektion der erzeugten Fragmente erfolgt mit Massenspektrometrie durch Bestimmung der Masse und unterschiedlichen Peakintensitäten. Der primäre Vorteil der Methode liegt darin, daß keine exakte Massenbestimmung mehr notwendig ist und auch Massenspetrometer mit geringer Auflösung verwendet werden können, Analyse und Trennung der Fragmente extrem schnell sind, da sie elektrophoresefrei sind und die Sequenz modifizierter Nukleinsäuren bestimmt werden kann. Weitere Vorteile sind, daß unmarkierte Nukleinsäuren eingesetzt werden können und keine Radioaktivität benötigt wird. Die Methode kann durch gleichzeitige Sequenzanalyse mehrerer Nukleinsäuren parallelisiert werden, wodurch die Sequenziergeschwindigkeit steigt. Die Methode kann weiterhin zur Erkennung und Bestimmung von Organismen herangezogen werden (Fingerprint, Footprint), wobei Finger- und Footprint genauer sind als bei bisherigen Methoden: Es werden nach der Hydrolyse einer Phosphodiesterbindung beide Spaltfragmente detektiert, während herkömmliche Verfahren nur ein markiertes Fragment detektieren können. Schließlich kann die Methode zur Aufklärung der Sekundärstruktur von Nukleinsäuren mit Massenspektrometrie beitragen. Diese Prinzipien lassen sich auch auf die Sequenzierung bzw. Sekundärstrukturbestimmung anderer Biopolymere anwenden, wie z. B. Peptide und Oligosaccharide. A new method for sequencing biopolymers using mass spectrometry is being used described. The sequencing of biopolymers is either tedious or requires one accurate mass determination of fragments. This is particularly difficult for long polymers. The rate of hydrolysis of phosphodiester, peptide or glycoside bonds with Exo- / endonucleases, -peptidases, -glycosidases or other hydrolytically acting Substances is used in our procedure for sequence analysis of nucleic acids or other Biopolymers used. Separation and detection of the generated fragments is carried out with Mass spectrometry by determining the mass and different peak intensities. Of the The primary advantage of the method is that it is no longer necessary to determine the exact mass and also low resolution mass spectrometers can be used for analysis and separation of the fragments are extremely fast since they are electrophoresis-free and the Sequence of modified nucleic acids can be determined. Other advantages are that unlabeled nucleic acids can be used and no radioactivity is required. The method can be parallelized by simultaneous sequence analysis of several nucleic acids which increases the sequencing speed. The method can still go to Recognition and identification of organisms are used (fingerprint, footprint), whereby the fingerprint and footprint are more precise than with previous methods: According to the Hydrolysis of a phosphodiester bond detected both cleavage fragments while conventional methods can only detect a labeled fragment. After all, the Method for elucidating the secondary structure of nucleic acids using mass spectrometry contribute. These principles can also be applied to sequencing or Apply secondary structure determination of other biopolymers, such as B. peptides and Oligosaccharides.
- (1) Sanger, F., Brownlee, G. G. and Barell, B. G., J. Mol. Biol., (1965) 13, 373.(1) Sanger, F., Brownlee, G. G. and Barell, B. G., J. Mol. Biol., (1965) 13, 373.
- (2) Brownlee, G. G. and Sanger, F., Eur. J. Biochem., (1969) 11, 395.(2) Brownlee, G. G. and Sanger, F., Eur. J. Biochem., (1969) 11, 395.
- (3) Silberklang, M., Gillum, A. M. and RajBhandary, U. L., in Methods in Enzymology. Wu, R. and Grossmann, L. (eds), Academic Press Inc., London and New York, (1979) 59, 58.(3) Silberklang, M., Gillum, A. M. and RajBhandary, U. L., in Methods in Enzymology. Wu, R. and Grossmann, L. (eds), Academic Press Inc., London and New York, (1979) 59, 58.
- (4) Maxam, A. M. and Gilbert, W., Proc. Natl. Acad. Sci. USA, (1977) 74, 560-564.(4) Maxam, A.M. and Gilbert, W., Proc. Natl. Acad. Sci. USA, (1977) 74: 560-564.
- (5) Stahl, D. A., Krupp, G. and Stackebrandt, E., in Nudeic Acids Sequencing, a practical aproach, Howe, C. J. and Ward, E. S. (eds), IRL Press at Oxford University Press, Oxford, New York, Tokyo, (1989) 137.(5) Stahl, D.A., Krupp, G. and Stackebrandt, E., in Nudeic Acids Sequencing, a practical aproach, Howe, C. J. and Ward, E. S. (eds), IRL Press at Oxford University Press, Oxford, New York, Tokyo, (1989) 137.
- (6) Waldmann, R., Gross, H. J. and Krupp, G., Nucleic Acids Res., (1987) 15, 7209.(6) Waldmann, R., Gross, H.J. and Krupp, G., Nucleic Acids Res., (1987) 15, 7209.
- (7) Zhang, Y., Liu, W. Feng, Y. and Wang, T. P., Anal. Biochem., (1987) 163, 513.(7) Zhang, Y., Liu, W. Feng, Y. and Wang, T.P., Anal. Biochem., (1987) 163, 513.
- (8) Sanger, F. Nicklen, S., Coulson, A. R., Proc. Natl. Acad. Sci. USA, (1977) 74, 5463-5467.(8) Sanger, F. Nicklen, S., Coulson, A. R., Proc. Natl. Acad. Sci. USA, (1977) 74: 5463-5467.
- (9) Hahn, C, S., Strauss, E., G. and Strauss, J., H. in Methods of Enzymology, 180, 121.(9) Hahn, C, S., Strauss, E., G. and Strauss, J., H. in Methods of Enzymology, 180, 121.
- (10) Pieles, U., Zürcher, W., Schär, M., Moser, H. E., Nucleic Acids Res., (1993) 21, 3191-3196.(10) Pieles, U., Zürcher, W., Schär, M., Moser, H. E., Nucleic Acids Res., (1993) 21, 3191-3196.
- (11) McLuckey, S. A., Habibi-Goudarzi, S., J. Am. Chem. Soc., (1993) 115, 12085-12095.(11) McLuckey, S.A., Habibi-Goudarzi, S., J. Am. Chem. Soc., (1993) 115, 12085-12095.
- (12) Wolter, M. A., Engels, J. W., Eur. Mass Spectrom., (1995) 1, 583-590.(12) Wolter, M.A., Engels, J.W., Eur. Mass Spectrom., (1995) 1, 583-590.
- (13) Ni, J., Pomerantz, S.C., Rozenski, J., Zhang, Y. and McCloskey, J. A., Anal. Chem., (1996) 68, 1989-1999.(13) Ni, J., Pomerantz, S.C., Rozenski, J., Zhang, Y. and McCloskey, J.A., Anal. Chem., (1996) 68, 1989-1999.
- (14) Limbach, P. A., McCloskey, J. A., Crain, P. F., Nucieic Acids Res. Symp. Ser., (1994) 31, 127-128.(14) Limbach, P.A., McCloskey, J.A., Crain, P.F., Nucieic Acids Res. Symp. Ser., (1994) 31, 127-128.
- (15) Roskey, M. T., Juhasz, P., Smirnov, I. P., Takach, E. J., Martin, S. A. and Haff, L. A., Proc. Natl. Acad. Sci. USA, (1996) 93, 4724-4729.(15) Roskey, M. T., Juhasz, P., Smirnov, I. P., Takach, E. J., Martin, S. A. and Haff, L. A., Proc. Natl. Acad. Sci. USA, (1996) 93, 4724-4729.
- (16) Köster, H., Tang, K., Fu, D.-J., Braun, A., van den Boom, D., Smith, C. L., Cotter, R. J. and Cantor, C.R., Nature Biotechnology, (1996) 14, 1123-1128.(16) Köster, H., Tang, K., Fu, D.-J., Braun, A., van den Boom, D., Smith, C. L., Cotter, R. J. and Cantor, C.R., Nature Biotechnology, (1996) 14, 1123-1128.
- (17) Loo, J. A., Udseth, H., R., Smith, R., D., Rapid Commun. Mass Spectrom. (1988) 2, 207-210.(17) Loo, J.A., Udseth, H., R., Smith, R., D., Rapid Commun. Mass Spectrom. (1988) 2, 207-210.
- (18) Little, D. P., Chorush, R. A., Speir, J. P., Senko, M. W., Kelleher, N. L., McLafferty, F. W., j. Am. Chem. Soc. (1994) 116, 4893-4897.(18) Little, D. P., Chorush, R. A., Speir, J. P., Senko, M. W., Kelleher, N. L., McLafferty, F. W., j. At the. Chem. Soc. (1994) 116: 4893-4897.
- (19) M. Karas, F. Hillenkamp, Anal. Chem., (1988) 60, 2299.(19) M. Karas, F. Hillenkamp, Anal. Chem., (1988) 60, 2299.
- (20) Little, D. P., Speir, J. P., Senko, M. W., O'Connor, P. B., McLafferty, F. W., Anal. Chem., (1994) 66, 2809-2815.(20) Little, D.P., Speir, J.P., Senko, M.W., O'Connor, P.B., McLafferty, F.W., Anal. Chem., (1994) 66, 2809-2815.
- (21) Nordhoff, E., Karas, M.,Cramer, R., Hahner, S., Hillenkamp, F., Kirpekar, F., Lezius, A., Muth, J., Meier, C., Engels, J. W., J. Mass Spectrom., (1995) 30, 99-112.(21) Nordhoff, E., Karas, M., Cramer, R., Hahner, S., Hillenkamp, F., Kirpekar, F., Lezius, A., Muth, J., Meier, C., Engels, J.W., J. Mass Spectrom., (1995) 30, 99-112.
- (22) Little, D. P., McLafferty, F. W., J. Am. Chem. Soc., (1995) 117, 6783-6784. (22) Little, D.P., McLafferty, F.W., J. Am. Chem. Soc., (1995) 117, 6783-6784.
- (23) Wu, K. J., Shaler, T. A. and Becker, H., Anal. Chem., (1994) 66, 1637-1645.(23) Wu, K. J., Shaler, T. A. and Becker, H., Anal. Chem., (1994) 66, 1637-1645.
- (24) Nordhoff, E., Cramer, R., Karas, M., Hillenkamp, F., Kirpekar, F., Kristiansen, K. and Roepstorff, P., Nucleic Acids Res., (1993) 21, 3347-3357.(24) Nordhoff, E., Cramer, R., Karas, M., Hillenkamp, F., Kirpekar, F., Kristiansen, K. and Roepstorff, P., Nucleic Acids Res., (1993) 21, 3347-3357.
- (25) Kirpekar, F., Nordhoff, E., Kristiansen, K., Roepstorff, P., Lezius, A., Hahner, S., Karas, M. and Hillenkamp, F., Nucleic Acids Research, (1994) 22, 3866.(25) Kirpekar, F., Nordhoff, E., Kristiansen, K., Roepstorff, P., Lezius, A., Hahner, S., Karas, M. and Hillenkamp, F., Nucleic Acids Research, (1994) 22, 3866.
- (26) Wiley, W.C., McLaren, I. H., Rev. Sci. Instrum., (1955) 26, 1150-1157.(26) Wiley, W.C., McLaren, I.H., Rev. Sci. Instrum., (1955) 26, 1150-1157.
- (27) Juhasz, P., Roskey, M. T., Smirnov, I. P., Haff, L. A., Vestal, M. L. and Martin, S. A., Anal. Chem., (1996) 68, 941-946.(27) Juhasz, P., Roskey, M. T., Smirnov, I. P., Haff, L. A., Vestal, M. L. and Martin, S. A., Anal. Chem., (1996) 68, 941-946.
Claims (8)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19714558A DE19714558A1 (en) | 1997-04-09 | 1997-04-09 | A new method for sequencing biopolymers using mass spectrometry |
PCT/DE1998/001016 WO1998045700A2 (en) | 1997-04-09 | 1998-04-08 | Method for the mass spectrometric sequencing of biopolymers |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19714558A DE19714558A1 (en) | 1997-04-09 | 1997-04-09 | A new method for sequencing biopolymers using mass spectrometry |
Publications (1)
Publication Number | Publication Date |
---|---|
DE19714558A1 true DE19714558A1 (en) | 1998-10-15 |
Family
ID=7825845
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DE19714558A Ceased DE19714558A1 (en) | 1997-04-09 | 1997-04-09 | A new method for sequencing biopolymers using mass spectrometry |
Country Status (2)
Country | Link |
---|---|
DE (1) | DE19714558A1 (en) |
WO (1) | WO1998045700A2 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001094910A2 (en) * | 2000-06-07 | 2001-12-13 | Basf Aktiengesellschaft | Method for the qualitative and quantitative analysis of complex mixtures of chemical compounds, using maldi-tof mass spectrometry |
WO2009095000A2 (en) * | 2008-01-31 | 2009-08-06 | Johann Wolfgang Goethe-Universität | Method for sequencing an rna molecule by means of mass spectrometry |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6994969B1 (en) | 1999-04-30 | 2006-02-07 | Methexis Genomics, N.V. | Diagnostic sequencing by a combination of specific cleavage and mass spectrometry |
WO2000071755A2 (en) * | 1999-05-25 | 2000-11-30 | Praelux Incorporated | Method for sequency and characterizing polymeric biomolecules using aptamers and a method for producing aptamers |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB8825290D0 (en) * | 1988-10-28 | 1988-11-30 | Hounsell E F | Characterisation of glycoproteins |
CA2158642A1 (en) * | 1993-03-19 | 1994-09-29 | Hubert Koster | Dna sequencing by mass spectrometry via exonuclease degradation |
WO1996036986A1 (en) * | 1995-05-19 | 1996-11-21 | Perseptive Biosystems, Inc. | Methods and apparatus for sequencing polymers with a statistical certainty using mass spectrometry |
AU2069597A (en) * | 1996-03-04 | 1997-09-22 | Genetrace Systems, Inc. | Methods of screening nucleic acids using mass spectrometry |
AU4042597A (en) * | 1996-07-19 | 1998-02-10 | Hybridon, Inc. | Method for sequencing nucleic acids using matrix-assisted laser desorption ionization time-of-flight mass spectrometry |
EP1164203B1 (en) * | 1996-11-06 | 2007-10-10 | Sequenom, Inc. | DNA Diagnostics based on mass spectrometry |
-
1997
- 1997-04-09 DE DE19714558A patent/DE19714558A1/en not_active Ceased
-
1998
- 1998-04-08 WO PCT/DE1998/001016 patent/WO1998045700A2/en active Application Filing
Non-Patent Citations (1)
Title |
---|
Nucleic Acids Research, Bd. 22, (1994), S. 3866-3870 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001094910A2 (en) * | 2000-06-07 | 2001-12-13 | Basf Aktiengesellschaft | Method for the qualitative and quantitative analysis of complex mixtures of chemical compounds, using maldi-tof mass spectrometry |
WO2001094910A3 (en) * | 2000-06-07 | 2003-10-02 | Basf Ag | Method for the qualitative and quantitative analysis of complex mixtures of chemical compounds, using maldi-tof mass spectrometry |
WO2009095000A2 (en) * | 2008-01-31 | 2009-08-06 | Johann Wolfgang Goethe-Universität | Method for sequencing an rna molecule by means of mass spectrometry |
WO2009095000A3 (en) * | 2008-01-31 | 2009-11-05 | Johann Wolfgang Goethe-Universität | Method for sequencing an rna molecule by means of mass spectrometry |
Also Published As
Publication number | Publication date |
---|---|
WO1998045700A3 (en) | 1999-03-11 |
WO1998045700A2 (en) | 1998-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Nordhoff et al. | Ion stability of nucleic acids in infrared matrix-assisted laser desorption/ionization mass spectrometry | |
DE69836013T2 (en) | MASS-MARKED HYBRIDIZING SOLUTIONS | |
DE69927343T2 (en) | METHOD AND MEANS FOR ANALYZING THE NUCLEOTIDE SEQUENCE OF NUCLEIC ACIDS | |
DE69735445T2 (en) | NON-VOLATILE, NON-VOLATILE MOLECULES FOR MASS MARKING | |
DE60220578T2 (en) | Method and reagents for analyzing the nucleotide sequence of nucleic acids | |
EP0765401B1 (en) | Primer extension mass spectroscopy nucleic acid sequencing method | |
EP0925373B1 (en) | Process for detecting nucleic acids by mass determination | |
US20050042625A1 (en) | Mass label linked hybridisation probes | |
AU2005233598B2 (en) | Method for De novo detection of sequences in nucleic acids:target sequencing by fragmentation | |
DE10108453A1 (en) | Mass spectrometric mutation analysis with photolytically cleavable primers | |
DE60020830T2 (en) | DIAGNOSTIC SEQUENCING THROUGH A COMBINATION OF SPECIFIC CLASSIFICATION AND MASS SPECTROMETRY | |
US6270976B1 (en) | Characterizing nucleic acid by mass spectrometry | |
Zhu et al. | Oligonucleotide sequencing by fragmentation in matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry | |
EP1038034B1 (en) | Method for identifying nucleic acids by electro-spray mass spectrometry | |
DE19714558A1 (en) | A new method for sequencing biopolymers using mass spectrometry | |
Wu et al. | Improved oligonucleotide sequencing by alkaline phosphatase and exonuclease digestions with mass spectrometry | |
AU746443B2 (en) | Characterising nucleic acid by mass spectrometry | |
Henry | Can MS really compete in the DNA world? | |
Alazard et al. | Sequencing of production-scale synthetic oligonucleotides by enriching for coupling failures using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry | |
DE19963536C2 (en) | Procedure for the analysis of nucleic acid sequences | |
US20230151406A1 (en) | Nucleic acid sequence detection by endonuclease digestion and mass spectrometry | |
Cantor et al. | The Future of DNA Sequencing: After the Human Genome Project | |
Edmonds et al. | Proceedings of the relevance of mass spectrometry to DNA sequence determination: Research needs for the Human Genome Program | |
Golovina et al. | Methods for modified nucleotide identification in ribosomal RNA | |
Frahm et al. | Nucleic Acid analysis by fourier transform ion cyclotron resonance mass spectrometry at the beginning of the twenty-first century |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
OP8 | Request for examination as to paragraph 44 patent law | ||
8122 | Nonbinding interest in granting licences declared | ||
8131 | Rejection |