DE102004026120A1 - Addressable molecular probe arrangement - Google Patents

Abstract

A molecular probe assembly comprising a position element (19), which comprises a recognition motif (14); a hook element (20), which a loop-like Area (1), wherein the loop-like area (1) is a target molecule-specific Body covers and the loop-like Area (1) through a double-stranded polynucleotide stem area (2, 3, 4) is stabilized, wherein one strand (2) of the stem area (2, 3, 4) into an element (17) which is complementary to at least one of the recognition motif (14) of the position element (19), extends. Such molecular probe arrangements are for the in in vitro diagnosis, in particular sepsis, usable.

Description

The The invention relates to a novel molecular probe arrangement, in particular an addressable molecular probe assembly, like hairpin-shaped probes or addressable two-part molecular hooks (AZMHs) according to claim 1, a method for the detection of target molecules using the AZMHs according to the invention according to claims 24 and 25, the use of AZMHs according to the invention according to claim 35, as well as a kit with the AZMHs according to the invention according to claim 43rd

Especially the invention relates to addressable two-part molecular hooks, and their application on a solid support.

μM

= mikromolar

1F1L1Q

= 1 Teil FDNA, 1 Teil Loop, 1 Teil QDNA

1F2L3Q

= 1 Teil FDNA, 2 Teile Loop, 3 Teile QDNA

AZMH

= Adressierbare zweiteilige Molekülsonde

AZMHs

= Adressierbare zweiteilige Molekülsonden

AC

= Adresskomplement

AS

= Adresssequenz

AS1

= Adresssequenz 1

ASn

= Adresssequenz n

BHQ

= Schwarzlochquencher

BODIPY

= 4,4-Difluoro-5,7-dimethyl-4-bor-3,4-diaza-s-indacenpropionsäure

cDNA

= complementary DNA (komplementäre DNA)

DABCYL

= 4-(4'-Dimethylaminophenylazo)-benzoesäure

DNA

= Desoxyribonukleinsäure

F

= Fluoreszenzreporter

F1

= Fluorophor 1

F2

= Fluorophor 2

FAM

= 6-Darboxyfluorescein

FDNA

= Fluorophor-tragende Oligonucleotidsequenz

FRET

= Fluoreszenz-Resonanz-Energieübertragung

L

= Loop (Schleife)

LDNA

=Loop oligonucleotide sequence (Schleifen-Oligonukleotidsequenz)

M

= Lumineszenzreporter

MB

= molekularer Beacon

MBs

= molekulare Beacons

MCS

= Multiklonierungsstelle

Me

= Metal

mM

= millimolar

NASBA

= Verstärkung auf Nukleinsäuresequenzbasis

nm

= Nanometer

P

= Protein

PCR

= polymerase chain reaction (Polymerase Kettenreaktion)

Q

= Quencher (Fluoreszenzlöscher)

QDNA

= Quencher-tragende Oligonucleotidsequenz

qPCR

= quantitative PCR

qRT-PCR

= quantitative reverse Transkiptase-PCR

R

= radioaktiver Reporter

RNA

= Ribonukleinsäure

S/N

= signal/noise (Signal-Rausch-Verhältnis)

SIRS

= Systemic Inflammatory Response Syndrome

TAMRA

= Tetramethylrhodamin

TMB

= dreiteiliger molekularer Beacon

TMBs

= dreiteilige molekulare Beacons

The abbreviations used in the description for the purposes of the present invention are defined as follows:

uM

= micromolar

1F1L1Q

= 1 part FDNA, 1 part loop, 1 part QDNA

1F2L3Q

= 1 part FDNA, 2 parts loop, 3 parts QDNA

AZMH

= Addressable two-part molecular probe

AZMHs

= Addressable two-part molecular probes

AC

= Address complement

AS

= Address sequence

AS1

= Address sequence 1

AS n

= Address sequence n

BHQ

= Black hole quencher

BODIPY

= 4,4-difluoro-5,7-dimethyl-4-boro-3,4-diaza-s-indacenepropionic acid

cDNA

= complementary DNA (complementary DNA)

DABCYL

= 4- (4'-dimethylaminophenylazo) benzoic acid

DNA

= Deoxyribonucleic acid

F

= Fluorescent reporter

F1

= Fluorophore 1

F2

= Fluorophore 2

FAM

= 6-Darboxyfluorescein

fDNA

= Fluorophore-bearing oligonucleotide sequence

FRET

= Fluorescence resonance energy transfer

L

= Loop

LDNA

= Loop oligonucleotide sequence (loop oligonucleotide sequence)

M

= Luminescence reporter

MB

= molecular beacon

MBs

= molecular beacons

MCS

= Multicloning site

me

= Metal

mM

= millimolar

NASBA

= Nucleic acid sequence based amplification

nm

= Nanometer

P

= Protein

PCR

= polymerase chain reaction

Q

= Quencher (fluorescence quencher)

QDNA

= Quencher-bearing oligonucleotide sequence

qPCR

= quantitative PCR

qRT-PCR

= quantitative reverse transcriptase PCR

R

= radioactive reporter

RNA

= Ribonucleic acid

S / N

= signal / noise (signal-to-noise ratio)

SIRS

= Systemic Inflammatory Response Syndrome

TAMRA

= Tetramethylrhodamine

TMB

= tripartite molecular beacon

TMBs

= three-part molecular beacons

• 1) Haarnadelförmige Strukturen unterscheiden hinsichtlich der thermodynamischen Hybridisierung besser zwischen ähnlichen Sequenzen als lineare Strukturen.
• 2) Um den Markierungsschritt von zu untersuchenden Proben und den Trennungsschritt zwischen gebundenen und ungebundenen Strukturen zu eliminieren.

Double-labeled hairpin DNA probes have been developed to exploit the following two advantages:

• 1) Hairpin-shaped structures distinguish between similar sequences in terms of thermodynamic hybridization better than linear structures.
• 2) To eliminate the labeling step of samples to be examined and the separation step between bound and unbound structures.

To today, two major forms of double-labeled hairpin-shaped probes have been identified described in the literature: molecular beacons (MBs) and tripartite ones molecular beacons (TMBs).

The MB technology (schematic in 1 ) has been developed to alleviate some of the problems associated with using linear DNA hybridization probes. Molecular beacons were first described in 1996 [1]. Classic MBs ( 1A ) consist of a target-specific sequence (about 15-20 bases) ( 1 ) flanked by shorter (about 5-7 bases) self-complementary sequences ( 2 and 3 ), the former ( 1 ) are completely dissimilar. Furthermore, the structure consists of a fluorophore ( 5 ) (eg FAM, TAMRA) at its 5 'end and a fluorescence quencher (eg DABCYL, BHQ) at its 3' end ( 5 ). In the absence of a target molecule ( 6 ) close ( 4 ) the above self-complementary sequences ( 2 and 3 ); in the formed hairpin-loop stem conformation ( 1A "Closed state"), the fluorophore ( 5 ) in close proximity to the quencher ( 5 ) brought. This leads to the quenching of a fluorescence signals after exposure to light of suitable wavelength. In the presence of a target nucleic acid ( 6 ) occurs via its hybridization ( 7 ) with the complementary loop sequence ( 1 ) a thermodynamically much more favorable conformational change. This leads in the root area ( 2 and 3 ) to a dissociation and separation of the fluorophore ( 5 ) of the quencher ( 5 ), which allows fluorescence emission ( 1A : "Open state").

Regarding the Immobilization of MBs on solid surfaces, e.g. in DNA microarray format, eliminate the properties of this class of probes the need that analyzed nucleic acid samples prior to hybridization to the immobilized polynucleotides highlighting systematic errors in terms of installation efficiency, Purification yield and hybridization effect after fluorophore labeling be reduced. Furthermore, since a free MB probe internally quenched is no special removal step for the probe is required and this therefore provides an ideal "signal gain" assay with low Endbackground. This allows the additional application format (e.g. quantitative real-time PCR) not just a homogeneous implementation of the Assays, but also a track of nucleic acid binding progress Real time. Another major advantage of MBs is that they recognize target sequences with a greater degree of specificity as linear probes [2-4]. MBs can due to competition between the unimolecular hairpin-forming reaction with bimolecular probe-target hybridization already between targets which differ only in a single nucleotide differ. For suitably prepared probes, the former occurs at higher temperatures on as the latter and this difference in the case of the appropriate / not matching probe pair is larger than the difference in the melting temperature corresponding linearerer Oligonucleotide probe pairs [5].

Several Modifications of the classic MB form have been described, such as For example, two fluorophores bound together at the 5 'end, and a quencher at the 3'-end (Wavelength shift: [6]); a fluorophore at each 5 'and 3' end (no quencher) (resonance energy transfer [7] in particular FRET: [8]); a metal ion at each 5 'and 3' end (luminescence probes: [7, 9]).

Attach the classical MBs (= threefold modified oligonucleotides) to diverse solid support surfaces (e.g. Fiber optics: [10]; Glass beads: [11]; solid silica surfaces: [12]; Agarose film: [13]) were obtained by modification of classical MBs realized with a linker attached to its trunk [12] is to the quencher [11] or the fluorophore [10]. MB, which at its 5'-end to a solid support is bound, which sprinkles with gold and a fluorophore at the 3'-end and the quencher [14] were also described.

Indeed There are important disadvantages associated with this technology are. Triple modifications (i.e., fluorophore, quencher, linker) are for classic MBs that are to be immobilized required and lead to a complex synthesis, increased Cleaning and quality control steps, which again lead to exorbitant costs. A new MB needs for each additional to be distinguished target molecule be synthesized.

In addition, solid support assays with MBs modified by the introduction of a suitable linker / spacer and directly spiked directly as folded molecules or molecules to be refolded after the immobilization process have been found to be difficult, mainly with respect to the initial background level after immobilization and therefore low dynamic range of the resulting data. Obviously, the reasons for this are the strict conformational requirements for MB molecules and, accordingly, the sensitivity of the folding processes to steric and / or electrostatic hindrances emanating from the solid support [15, 16]. High ionic strength / high salinity of the spotting buffer can partially improve the last hindrance type [13]. However, under these conditions, the possibility of probe-dimer formation [17] increases sharply, especially during spot maturation, with dramatically increased local concentrations due to the microscopic spot volume and its rapid drying. This leads to problems with the arrangement of MBs, increased background and reduced immobilization efficiency. In particular, attachment of MBs to a solid support by means of chemical reactions produces partially bound structures which can not hybridize to the target sequences. These problems therefore require a search for optimized compositions of spotting buffers and corresponding post-spotting surface treatments as well as further modifications of the linker / spacer portion of the MBs [12, 18, 19]. Finally, spotted MBs show reduced sensitivity and specificity in comparison to their counterparts in solution [12]. Frutos et al. introduced a bimolecular linear probe system in 2001 in an attempt to solve the immobilization problems underlying MB. [20] However, this system was developed solely for the analysis of SNP and the author relied on linear probes in which a single mismatch was inserted. Several problems related to this technology have been described [20]. First of all, every duplex shape (artificial Mismatch / mach and artificial mismatch / mismatch) on the array can be optimized for stability. Second, this system is highly dependent on the identity of the mismatch base and its nearest neighbor, and will crucially affect the results. Finally, linear probes are less sensitive and therefore discriminative than hairpin probes [5].

To solve some of the problems described above, in particular with regard to the modification of the MBs with the aim of matching new target molecules and their immobilization methods, Nutiu and Li introduced another class of MBs called three-part molecular beacons (TMBs) (TMBs) ( 1B ). TMBs ( 1B ) comprise three oligonucleotide sequences which form a classical "stem and hairpin" structure ( 1 . 2 and 3 ) and by two extra double-stranded structures ( 9 . 11 and 10 . 12 ) flanked. The two are formed by different oligonucleotides of equal length, the FDNA ( 8th ) or QDNA ( 9 ), each being complementary to a corresponding extended arm of the trunk of the formed hairpin structure ( 1B ). The FDNA structure carries the fluorophore ( 5 ) and the QDNA structure the quencher ( 5 ). The complementary parts of these three different oligonucleotides form the entire TMB structure by base pairing. The mode of action of the TMBs is identical to that of conventional MBs, ie, binding to the target molecule causes a conformational change that results in solution of the beacon strain and spatial separation of the fluorophore from the quencher, resulting in fluorescence.

Compared With classic MBs, TMBs can be easily modified to fit new target molecules (i.e., it must be for a change in (any) new) target molecules) only the central (s) Parts) are redesigned and synthesized). By the separate strands, to which either the fluorophore or the quencher is coupled, can these unchanged stay and thus can Stock solutions produced, resulting in a more cost-efficient production leads. Furthermore, TMBs today are the more flexible way to change the fluorophores, so that multiplexing experiments are simplified, however, the choice of possible Fluorophores or quenchers due to orientation and position of the quencher on the QDNA is restricted (e.g., BODIPY630 / 650 chemistry does not permit the Coupling to the QDNA).

These TMB structure, however, still has significant disadvantages.

experiments in solution have shown that TMBs due to obvious structural Characteristics [18, 19] have a lower specificity than classical MBs.

to Emergence of the FRET is the extension of the Foester radius [21] of the Fluorophore / quencher pair (usually 1-10 nm), given the fact that this pair is theoretically through three DNA double helices is separated, compared to this is Pair at the MB separated by one, the radius being 2.3 each nm is.

in the There are difficulties associated with the above problems with the formation of a base pair at the outer ends of the TMB strain (in the direction of F and QDNA), due to a lack of space effect (overcrowding effect) and due to the stacking forces of bases at the site, where all three DNA duplexes forming the TMB meet and be transformed into each other [18, 19]. This enlarges the Distance from fluorophore and quencher even further and requires one Optimization of suitable conditions for TMB folding; additionally wins the problem of optimized TMB design is very important.

The possibility the binding of TMBs to solid surfaces by means of the middle part has already been mentioned [19]. The immobilization of TMBs on solid surfaces was but not shown yet. There are several reasons why immobilization of TMBs is problematic.

The Loop must be both Fulfill functions, where it is an attachment site and a site for hybridization of the target molecule. this leads to to problems with the folding of the central part of the TMBs (wrong Positive) as well as the access of the target molecules to the loop due steric hindrance by the strain and sequences that to the F and QDNA elements are complementary.

The Attempts by our group to change the TMB immobilization by amino compound-modified FDNA, QDNA or both (i.e. FDNA + QDNA) to complications of the procedure before spotting (conducting a Folding reaction to form TMBs before spotting) Complications during of spotting (a composition of the spotting buffer must be careful and problems after spotting (extreme conditions in terms of ionic strength / Presence of detergents, and the temperature must be avoided) due the need for the formation and conservation of the TMB structure.

Especially in the immobilization of preformed TMBs by FDNA, QDNA or FDNA and QDNA in contrast to that of Nutiu et al. described Method [18, 19] lead the bulky structures add to the problem of overloading, i. the problem access to the surfactant Groups for efficient immobilization reactions.

Farther The presence of universally complementary strands can lead to intermolecular recombination (Exchange of F and QDNAs) during lead to immobilization, and thus may cause a disordered / arbitrary arrangement. This disordered / arbitrary Arrangement arises from a surplus at surface-active Groups compared to the maximum density of preformed TMBs. Furthermore For example, leakage of the TMBs, i. the possibility that the central part the structure itself at any time during of the experiment can and elsewhere because of the universality of FDNA and QDNA sequences bind, can not be excluded.

in view of the problems of the prior art of the above Technology of molecular beacons, there is a need for novel probe formats, the one higher specificity and sensitivity available put.

As well there is a need for a higher specificity of the immobilization process, which requires a high probe yield, which is used to hybridize the targets to be ready.

This Demand can be met by probes of a novel arrangement, those according to claim 1 allows an addressable immobilization of these probes on solid surfaces, by a method for detecting a target molecule according to claims 24 or 25, a use of the arrangements according to claim 35 of the present Invention, and a kit according to claim 43rd

The dependent claims include preferred embodiments of the present invention.

Further Features and advantages of the present invention are achieved by the Description of the examples and by the accompanying drawings explained.

It demonstrate:

1 : State of the Art of Molecular Beacon Technology;

2A : Individual components of AZMH;

2 B : Individual components of the AZMH (closed and assembled form);

3A : Individual components of a preferred embodiment of the AZMH;

3B : Preferred embodiment of the AZMH (closed and open state);

4 : Presentation of the use of AZMHs for gene expression studies;

5A Positioning elements arranged schematically on a solid support;

5B : Position elements and hook elements arranged schematically on a solid support;

6 : MB (Traf2) melting curve;

7 TMB (Traf2) 1F 1L 1Q melting curve;

8th TMB (Traf2) 1F 2L 3Q melting curve;

9 : AZMH (Traf2-Bodipy) melting curve;

10A : Table with the ratios of Bodipy vs. TAMRA of the AZMH (Traf2-Bodipy) array

10B : Diagram showing the ratios of Bodipy vs. TAMRA of the AZMH (Traf2-Bodipy) array;

11A : Table with the ratios of hook vs. Aim of the AZMH (Traf2-Bodipy) array;

11B : Diagram with the ratios of hook vs. Aim of the AZMH (Traf2-Bodipy) array;

list the reference numbers used:

1

loop Similar Area

2

Complementary sequence 1 (KS 1)

3

Complementary sequence 2 (KS 2)

4

hybridized KS 1 + KS 2 = strain

5

modification

6

target molecule

7

hybridized) Loop / target molecule

8th

fDNA

9

QDNA

10

LDNA complementary Sequence to FDNA

11

LDNA complementary Sequence to QDNA

12

hybridized FDNA / LDNA complementary Sequence to FDNA

13

hybridized QDNA / LDNA complementary sequence to QDNA

14

recognition motif

15

spacer

16

left

17

Adresskomplement

18

hybridized Address sequence / Adresskomplement

19

position member

20

hook element

21

Target molecule-specific Job

The present invention describes a new type of hairpin probe ( 2A and 2 B ), which are called Addressable Two Part Molecular Hooks (AZMHs) and solve most of the problems associated with using MB or TMB technology. In contrast to the problems associated with the types of probes described in the prior art, the present invention utilizes a novel structural approach that allows for specific, lossless localization of the structure with significantly improved immobilization properties, improved patterning, and an improved hybridization procedure.

DESCRIPTION THE ARRANGEMENT

The AZMH ( 2A and B) as a molecular probe arrangement according to the invention comprises:
a position element ( 19 ) with a recognition motif ( 14 ); a hook element ( 20 ) with a loop-like area ( 1 ), this one a loop-like area ( 1 ) from a target molecule ( 6 ) - specific site, and the loop-like area ( 1 ) through a double-stranded polynucleotide stem region ( 2 . 3 . 4 ) is stabilized, whereby a strand ( 2 ) of the root area ( 2 . 3 . 4 ) into an element ( 17 ) which is complementary to at least part of the recognition motif ( 14 ) of the position element ( 19 ) extends.

• 1) das Positionselement (19) in Form einer Positionssequenz (19), insbesondere eines Polynukleotids, DNA oder RNA, oder einer Aminosäurensequenz, mit einer einzigartigen Adresssequenz (14), flankiert durch eine Spacersequenz (15), einen oberflächenaktiven Linker (16) und einer Modifikation (5).
• 2) das Hakenelement (20) mit einer klassischen Schleife (1), stabilisiert durch den Stamm (2, 3, 4), wobei ein Strang (2) sich in eine Sequenz (17), welche komplementär zur Adresssequenz (14) ist, erstreckt, und der andere Strang (3) eine Modifikation (5) trägt.

In a preferred embodiment, the AZMH ( 3A and B)

• 1) the position element ( 19 ) in the form of a position sequence ( 19 ), in particular a polynucleotide, DNA or RNA, or an amino acid sequence, with a unique address sequence ( 14 ) flanked by a spacer sequence ( 15 ), a surface-active linker ( 16 ) and a modification ( 5 ).
• 2) the hook element ( 20 ) with a classic loop ( 1 ), stabilized by the strain ( 2 . 3 . 4 ), whereby one strand ( 2 ) into a sequence ( 17 ), which are complementary to the address sequence ( 14 ), and the other strand ( 3 ) a modification ( 5 ) wearing.

The bow ( 1 ) comprises the binding element. In a preferred embodiment, the binding element extends over the entire loop sequence.

The target-specific site ( 21 ) may contain multiple partial sequences or a sequence complementary to, or generally recognized by, a specific target molecule or multicloning site (MCS) for insertion of a desired probe sequence.

In a preferred embodiment, the position element comprises ( 19 ) four parts: a linker ( 14 ), a spacer ( 15 ), an address sequence ( 14 ) and a modification ( 5 ) as well as the hook element ( 20 ), which comprises five specific parts: a sequence ( 17 ), which is called address complement and complementary to the address sequence ( 14 ), the target molecule-specific side ( 21 ), a second complementary sequence ( 3 ) which ( 1 ) and complementary to the first complementary sequence ( 2 ), as well as a modification ( 5 ).

Of the AZMH can be any chemical structures and / or subunits which are capable of targeting molecules using any mechanism to recognize the subsequent detection of this event and / or to bind.

The modifications ( 5 ) of the position element ( 19 ) and the hook element ( 20 ) may be identical or different.

The modification ( 5 ) or means for distinguishing between open and closed state of the arrangement according to the invention may be any part which allows the observation of the various changes in the states of the probe assembly. Modifications of this type are known to the person skilled in the art and may for example be at least one fluorescent reporter (F), a luminescence reporter (M), a metal (Me), a protein (P), a radioactive reporter (R), a quencher (Q) or a molecule which can bind additional reporter molecules. The use of fluorescent reporters as described in the present invention is only illustrative and not limiting of the invention.

In a preferred embodiment is a fluorophore (F1) covalently attached to the oligonucleotide position sequence as a position element and a fluorophore (F2) is attached bound the oligonucleotide hook element.

In a further preferred embodiment the quencher is covalent to the position element and a fluorophore tied to the hook element.

In a further preferred embodiment a fluorophore is covalent to the position element and a quencher tied to the hook element.

Without the presence of a target molecule ( 6 ) the hook element ( 20 ) with the corresponding position element ( 19 ) by means of the corresponding address sequence ( 14 ) and the corresponding address compliment ( 17 ) hybridize ( 18 ). The AZMH will therefore alter its hairpin structure by complementing a first complementary sequence ( 2 ) to a second complementary sequence ( 3 ) accept. This brings the structure into a "closed" form ( 3B "Closed and assembled form"), whereby a fluorophore ( 5 ) by a quencher ( 5 ) (no fluorescence) or to another fluorophore ( 5 ) is transferred (FRET). The melting point of the probe-target duplex ( 7 ) is approximately equal to the melting point of the strain ( 4 ) (+/- a few degrees Celcius) which is between the first complementary sequence ( 2 ) and a second complementary sequence ( 3 ) is formed.

The AZMH is constructed in such a way that the address sequence ( 14 ) / Address Complement ( 17 ) Hybrids after formation of the target molecule-specific site ( 1 ) / Target molecule ( 6 ) / Duplex ( 7 ) formed hybrid even after formation of a duplex ( 7 ) from the target molecule specific site ( 1 ) and target molecule ( 6 ) do not dissociate due to their increased length and sequence content.

The AZMH is constructed in such a way that the first complementary sequence ( 2 ) / second complementary sequence ( 3 ) Hybrid after formation of a target molecule-specific site ( 1 ) / Target molecule ( 6 ) Duplex dissociate.

DESCRIPTION THE PROCEDURE

The The present invention also provides methods of use the AZMHs available.

• a. Reagieren von mindestens einem Hakenelement (20) mit dessen entsprechendem Zielmolekül (6);
• b. Adressierung des gebildeten Hakenelement-Zielmolekül (6)- Komplexes zu dem Positionselement; und
• c. Erfassen eines Signals, das durch Mittel (5) zum Unterscheiden eines geschlossenen und offenen Zustands der Anordnung erzeugt wird.

The method of the present invention comprises a method for the detection of a target molecule ( 6 ) using the inventive arrangement, comprising the following steps:

• a. Reacting at least one hook element ( 20 ) with its corresponding target molecule ( 6 );
• b. Addressing of the formed hook element target molecule ( 6 ) - complex to the position element; and
• c. Detecting a signal transmitted by means ( 5 ) is generated to distinguish a closed and open state of the device.

• a. Reaktion von wenigstens einem Hakenelement (20) mit dessen entsprechendem Positionselement (19);
• b. Reaktion von wenigstens einem Zielmolekül (6) mit ihrer entsprechenden adressierter Anordnung gemäß einem der Ansprüche 1 bis 23; und
• c. Erfassen eines Signals, das durch Mittel (5) zum Unterscheiden eines geschlossenen und offenen Zustands der Anordnung erzeugt wird.

In another embodiment, the following steps include:

• a. Reaction of at least one hook element ( 20 ) with its corresponding position element ( 19 );
• b. Reaction of at least one target molecule ( 6 ) with its corresponding addressed arrangement according to one of claims 1 to 23; and
• c. Detecting a signal transmitted by means ( 5 ) is generated to distinguish a closed and open state of the device.

The The order of these steps can also be reversed.

at a preferred embodiment the position element is first immobilized on a solid support, in that the reactive group contained in the spacer with a the modified surface a solid carrier contained reactive group is brought into contact.

Of the solid carriers can be made of any material that immobilizes of the position element. examples for the solid support can Slides, a bullet, a pillar, a microtiter plate, a tube, a membrane, an optical Fiber or a nanoparticle. The use of slides like described in the present invention provides only one exemplary embodiment and limited not the present invention.

The The method described above is to be understood as meaning that one or more several position elements / AZMHs with one or more target molecules, individually, can be reacted in combination or in a complex mixture.

With target molecules are molecules of any biological origin, such as Humans, animals, plants, invertebrates, lower eukaryotes, Prokaryotes or viruses. Examples of biological samples are tissues, body fluids and cells. targets can as well as nucleic acids, Be peptides and proteins, or they may be of synthetic origin such as nucleic sequences, peptide nucleic acids, proteins, Peptides, peptide mimetics or aptamers.

DESCRIPTION THE USE

The The present invention also describes uses the AZMHs.

Possible uses The AZMHs are studies of nucleic acids and / or proteins, such as for example, determination / separation / analysis of specific nucleotides, Proteins or molecules with low molecular weight.

Examples for such Applications include gene expression analysis, genotyping analysis, real-time monitoring of nucleic acid amplifications, Analysis of DNA-protein and / or RNA-protein interactions either in solution or on a solid carrier (e.g., qRT-PCR, qPCR, real-time NASBA, etc.), sequence analysis, or high-throughput analysis.

The Design of the AZMHs is particularly as part of a microarray advantageous as a component in integrated analysis systems (lab-on-a-chip system) or as part of an in vitro / ex vivo diagnostic kit with an electronic evaluation system or a patient data management system. The specific design of the AZMHs combines the advantages of a simple one Nucleotide immobilization with the high specificity and sensitivity of Hairpin structures in solution were demonstrated.

• 1) Als Positionssequenz wird ein Positionselement entworfen, das eine Adresssequenz (AS) aus AS₁ bis AS_n enthält (5A: Nummer 1,2,3, ...,n stellen voneinander verschiedene Adresssequenzen dar, welche zur räumlichen Lokalisierung auf einem festen Träger benutzt werden). Diese Positionssequenzen werden individuell auf einem festen Träger wie beispielsweise einem Objektträger eines Mikroskops angeordnet.
• 2) Nach einer korrekten Immobilisierung werden die verschiedenen Hakenelemente auf dem vorgespotteten Positionssequenzarray angewendet, was in der korrekten Adressierung jedes einzelnen Hakenelements resultiert. Damit wird jedes Hakenelement individuell genau adressierbar aufgebracht. Der resultierende Array wird anschließend gewaschen und auf „geschlossenen Zustand" überprüft (5B).
• 3) RNA wird aus der zu untersuchenden Blutprobe eines Patienten und einer Kontrollprobe (z.B. gesunder Proband) extrahiert. Diese beiden RNA-Proben können optional in cDNA revers transkripiert werden.
• 4) Die Nukleinsäuren (RNA oder cDNA) aus der Patienten- und Kontrollprobe werden gleichzeitig hybridisiert, um die Objektträger unter denselben Bedinungen zu trennen.
• 5) Anschließend werden die resultierenden Fluoreszenzsignale aufgezeichnet und die gesammelten zeigen nebeneinander die Fluoreszenzmuster der zu untersuchenden Probe und der Referenzprobe. Die Daten können dann gemäß dem Fachmann bekannter Techniken normaliert werden, was zu der Bewertung der differentiellen Genexpression zwischen der zu untersuchenden Probe und der Kontrollprobe führt.

The use of the AZMHs according to the present invention described below for gene expression studies by means of their addressable characteristics is exemplary and does not represent a limitation of the present invention ( 4 ).

• 1) A position element is designed as a position sequence, which contains an address sequence (AS) from AS ₁ to AS _n ( 5A : Numbers 1,2,3, ..., n represent different address sequences used for spatial localization on a fixed carrier). These position sequences are arranged individually on a solid support such as a microscope slide.
• 2) After proper immobilization, the various hook elements are applied to the pre-spotted position sequence array, resulting in the correct addressing of each hook element. Thus, each hook element is applied individually accurately addressed. The resulting array is then washed and checked for "closed state" ( 5B ).
• 3) RNA is extracted from the patient's blood sample to be tested and a control sample (eg, healthy subject). These two RNA samples can optionally be reverse transcribed into cDNA.
• 4) The nucleic acids (RNA or cDNA) from the patient and control samples are hybridized simultaneously to separate the slides under the same conditions.
• 5) Subsequently, the resulting fluorescence signals are recorded and the collected show next to each other the fluorescence patterns of the sample to be examined and the reference sample. The data may then be normalized according to techniques known to those skilled in the art resulting in the assessment of the differential gene expression between the sample to be examined and the control sample.

One such system can be applied to a variety of fluorophores and hook element sets become what the representation of several fluorescence patterns on one slides allowed. In this way, there is the possibility of several different ones Areas that have different degrees of severity or degrees of illness represent, to construct. This approach is extremely important for applications in in vitro diagnostics, for example in oncology, in inflammatory, or genetic diseases. If such an arrangement for Example applied in the field of sepsis, it can be the various Represent stages, namely: SIRS, sepsis, severe sepsis, septic shock, multiple organ failure.

• 1) Eine Positionssequenz wird entworfen, um eine Adresssequenz (AS) aus AS₁ bis AS_n zu enthalten (5A: Nummer 1,2,3, ...,n stellen voneinander verschiedene Adresssequenzen dar, welche zur räumlichen Lokalisierung auf einem festen Träger benutzt werden). Diese Positionssequenzen werden einzeln auf einem festen Träger angeordnet, welcher innerhalb eines Lab-on-a-chip-Systems verwendet wird.
• 2) Für die verschiedenen Marker-Zielmolekülsequenzen werden Hakenelemente entworfen. Diese Zielsequenzen repräsentieren Gencluster, welche den verschiedenen Schweregraden der Krankheit, d.h. SIRS, Sepsis, schwere Sepsis, septischer Schock, Multiorganversagen (definiert nach [22]), entsprechen. Diese Hakenelemente tragen alle den gleichen Fluorophor pro Cluster (z.B. F1 = SIRS, F2 = Sepsis, F3 = schwere Sepsis, etc.). Alle Hakenelemente besitzen jedoch eine unterschiedliche Adresskomplemente (AC) von 1 bis n.
• 3) Die verschiedenen Hakenelemente werden auf dem vorgespotteten Positionssequenzarray angewendet, was zu einer korrekten Adressierung jedes einzelnen Hakenelements führt. Der daraus resultierende Array wird anschließend gewaschen und auf den „geschlossenen Zustand" überprüft (5B).
• 4) RNA wird aus der Blutprobe eines Patienten extrahiert. Diese RNA-Probe kann optional in cDNA revers transkribiert werden.
• 5) Die aus der Patientenprobe erhaltenen Nukleinsäuren (RNA oder cDNA) werden dann auf dem Objektträger angewendet. Die sich ergebenden Hakenelemente werden an ihre entsprechenden Zielmoleküle aus der Patientenprobe hybridisiert.

In a preferred embodiment, the use of AZMHs is described by means of their addressable characteristics for in vitro diagnostics and therapeutic course control in sepsis. This description is merely exemplary and does not limit the scope of the present invention.

• 1) A position sequence is designed to contain an address sequence (AS) from AS ₁ to AS _n ( 5A : Numbers 1,2,3, ..., n represent different address sequences used for spatial localization on a fixed carrier). These position sequences are individually placed on a solid support which is used within a lab-on-a-chip system.
• 2) Hook elements are designed for the different marker target molecule sequences. These target sequences represent gene clusters corresponding to the various severity of the disease, ie, SIRS, sepsis, severe sepsis, septic shock, multi-organ failure (defined by [22]). These hook elements all carry the same fluorophore per cluster (eg F1 = SIRS, F2 = sepsis, F3 = severe sepsis, etc.). However, all hook elements have different address complements (AC) from 1 to n.
• 3) The various hook elements are applied to the pre-spotted position sequence array, resulting in correct addressing of each hook element. The resulting array is then washed and set to the "closed state" checked ( 5B ).
• 4) RNA is extracted from the blood sample of a patient. This RNA sample can optionally be reverse transcribed into cDNA.
• 5) The nucleic acids (RNA or cDNA) obtained from the patient sample are then applied to the slide. The resulting hook elements are hybridized to their respective target molecules from the patient sample.

In a preferred embodiment can the AZMHs according to the invention for the Determination of efficacy and toxicity in drug screening and / or for the Production of medicines and for the manufacture of medicines used compounds.

at a further preferred embodiment can the AZMHs according to the invention for the determination of synthetic contaminants in organisms, foods, medicines or environmental samples are used.

DESCRIPTION OF KITS

The The present invention also provides a kit for use of the AZMHs and the simultaneous easy detection of multiple target molecules for Available.

• 1) Mehrere einzelne Positionssequenzen, die entweder einen identischen Reporter oder einen identischen Quencher beinhalten.
• 2) Mehrere einzelne Hakenelemente, die entweder einen identischen Reporter oder einen identischen Quencher beinhalten, so dass der komplette AZMH ein Reporter/Quencher-Paar oder, umgekehrt, ein identisches Reporter/Reporter-Paar besitzt.

The kit includes:

• 1) Several single position sequences containing either an identical reporter or an identical quencher.
• 2) Several single hook elements containing either an identical reporter or an identical quencher such that the complete AZMH has a reporter / quencher pair or, conversely, an identical reporter / reporter pair.

• 1) Mehrere einzelne Positionssequenzen, die entweder verschiedene Fluorophore oder Quencher beinhalten.
• 2) Mehrere einzelne Hakenelemente, die entweder verschiedene Fluorophore oder einen Quencher beinhalten, so dass der komplette AZMH ein kompatibles Fluorophor/Quencher-Paar oder, umgekehrt, ein kompatibles Fluorophor/Fluorophor-Paar besitzt.

In a preferred embodiment, the kit comprises:

• 1) Several single position sequences containing either different fluorophores or quenchers.
• 2) Several single hook elements containing either different fluorophores or a quencher such that the complete AZMH has a compatible fluorophore / quencher pair or, conversely, a compatible fluorophore / fluorophore pair.

The The present invention also provides a kit for addressable Immobilization of AZMHs and the simultaneous detection of a multitude of target molecules in a multiplexed process. This multiplex procedure finds especially in the assessment and observation of single nucleotide polymorphisms (SNPs) application.

• 1) Mehrere einzelne Positionselemente, die entweder verschiedene Reporter oder Quencher beinhalten.
• 2) Mehrere einzelne Hakenelemente, die entweder verschiedene Reporter oder einen Quencher beinhalten, so dass der komplette AZMH ein kompatibles Reporter/Quencher-Paar oder, umgekehrt, ein kompatibles Reporter/Reporter-Paar besitzt.

The kit includes:

• 1) Several single position elements containing either different reporters or quenchers.
• 2) Several single hook elements containing either different reporters or a quencher such that the complete AZMH has a compatible reporter / quencher pair or, conversely, a compatible reporter / reporter pair.

at All of the kits described above will be apparent to those skilled in the art that the binding sequence of the individual hook element has a known sequence that is complementary to a specific target sequence or a multicloning site (MCS) for the May contain insertion of any probe sequences.

DETAILED DESCRIPTION OF THE INVENTION BELONGING TO TWO EXAMPLES

• 1) Beispiel 1 zeigt das thermische Denaturierungsprofil und die Spezifität von MBs TMBs und AZMHs.
• 2) Beispiel 2 demonstriert die Immobilisierung der AZMHs an einer modifizierten Glassoberfläche, deren Hybridisierung mit komplementären Zielmolekülen und die Bestimmung des resultierenden Signal/Rausch Verhältnisses.

Two examples demonstrate the feasibility and improvements that result from the novel double-modified hairpin probes (AZMH) of this invention. The use of the MB and TMB technology for immobilization on a solid support has been found to be inadequate and / or expensive, and much remains to be done in terms of immobilization procedures, as well as in terms of correctly addressing the loop to a particular site Specificity, as well as the reduction of the background. By using the new type of hairpin probes according to the present invention, the above-mentioned problems have been solved.

• 1) Example 1 shows the thermal denaturation profile and specificity of MBs TMBs and AZMHs.
• 2) Example 2 demonstrates the immobilization of AZMHs on a modified glass surface, their hybridization with complementary target molecules, and the determination of the resulting signal-to-noise ratio.

For this two examples were used the following MB, AZMH and TMB.

MB

• (TAMRA) -gCACg T GGGGGAAGGAGCCAC CAGCCAG TCCAcgTgC- (DABSYL)

ABMH-

Position sequence as position element:

• 5 'Amino C6-dT-ACTgACTgACTgAcTgACTgACTgACTgAC-TAMRA 3 '

hook elements

• Hook element TRAF-BODIPY: 5'BODIPY630-GCACGTGGAAGGAGCCACCAGCCAGTACG TGCCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGT-3 '

TMB

• fDNA : 5 'TAMRA-GCGGAGCGTGGCAGG-2 X SPACER 18- [AMC7] 3'
• QDNA : 3 'DABCYL-GAGCGTGGCAGGTGG- (2 X SPACER 18- [AM UNI]) 5'
• LDNA: 5 'CCTGCCACGCTCCGCGCACGTGGAAGGAGCCACCAGCCAGTACGTGCCTCGCACCGTCCACC 3 '

Targets:

• Traf-goal: 5'GTCTCTGAAATCTGAGGACTGGCTGGTGGCTCCTTCCCCC GTGTCAGTGAACTTG3 '
• FAM-tagged traffic target: 5'GTCTCTGAAATCTGAGGACTGGCTGGTGGCT CCTTCCCCCGTGTCAGTGAACTTG-FAM 3 '
• Irrelevant target molecule: ACCTTTTACAGAACGATCTCTTCACTTCCTGCCCAGCAGAC ATTCATACTGTTTCCT (To assess the target molecule specificity).

Example 1:

TMB experiments were made using 1 part FDNA, 1 part loop, 1 part QDNA (1F 1L 1Q) or using 1 part FDNA, 2 parts Loop, 3 parts QDNA (1F 2L 3Q) performed, the latter of the Nutiu and Li [19] used the configuration.

The thermal denaturation profiles of the MBs (Traf2) were determined in buffers of three compositions to assess their functioning in different salt concentrations. (Buffer 1: 20 mM Tris-HCl, pH 8.0 and 1 mM MgCl ₂ , buffer 2: 10 mM Tris-HCl, pH 8.0, 50 mM KCl and 4 mM MgCl ₂ , buffer 3:10 mM Tris ₎ . HCl, pH 8.0, 10 mM KCl and 2 mM MgCl ₂ ). Thermal denaturation profiles of TMB (Traf2) 1F1L1Q, TMB (Traf2) 1F2L3Q and AZMH (traf2-bodipy) were determined in the TMB buffer (10 mM Tris-HCl, pH 8.3, 0.5 M NaCl and 3, 5mM MgCl ₂ ) described by Nutiu and Li [19] was determined for comparison. The individual DNA mixtures were heated for 5 minutes at 95 ° C and after subsequent cooling to 80 ° C, the fluorescence was measured for the first time. Thereafter, the temperature was decreased in steps of 1 ° C per minute, and the fluorescence was detected at each temperature level for 1 minute. The temperature profiles are in 3 shown.

The melting curves determined in different buffers of different salt concentration and MB (Traf2) with or without target molecule, ie a classical molecular probe design for experiments in solution ( 6 ), have shown that the chosen design was successful. Due to the above-mentioned limitations in the immobilization of MBs, the design of MBs has been translated into the design of TMBs and their efficiency has been determined.

Thermal denaturation profiles consisting of different stoichiometries FDNA ( 1B . 9 ), LDNA ( 1B . 11 . 2 . 1 . 3 . 12 ) and QDNA ( 1B . 10 ) were created. The melting curves ( 4 and 6 ), despite the use of the described optimized TMB buffers, did not show all the typical designated characteristics (Tyagi and Kramer, 1996) of a typical MB melting curve due to the various conformational limitations of their complex structure. TMB (traf2) 1F1L1Q (S / N ~ 1.5) and TMB (traf2) 1F2L3Q (S / N ~ 2) showed by analysis under FRET or without FRET conditions ( 7 and 8th ) similar signal-to-noise ratios. However, it could be demonstrated that the specificity of the target molecules (using an irrelevant target molecule) is dependent on the stoichiometric ratios used when TMB (traf2) 1F 1L 1Q ( 7 ) a better distinction than TMB (traf2) 1F 2L 3Q ( 8th ). In contrast to the results of the TMB experiments, the studies carried out under similar experimental conditions with irrelevant target molecules in combination with the AZMH according to the invention showed identical signal strengths to the signals which were obtained without a target molecule ( 9 ).

There the TMB structure limited the choice of fluorophores (the Bodipy chemistry allowed no coupling to the 3 'end the QDNA), a system equivalent to the combination AZMH-FRET for TMB (Traf2) not possible. That's why was for the TMB structure is a FRET system using the 3 'FAM tag of the target molecule chosen and showed similar Signal / noise ratios between 12 ° C up to 40 ° C. However, the resulting TMB curve did not show the characteristics a typical MB melting curve, as with the AZMH invention was and would be received to a higher one Fluorescence background signal and reduced sensitivity to lead.

When transferring the classical MB structure of the MB (Traf2) to the AZMH structure of the invention, the markan were generally found The characteristics of a typical MB melting curve clearly show that this new structure has the characteristics of classical MBs in solution. These advantages also became apparent in the sensitivity since hybridization of the hook elements with the target molecules in solution prior to hybridization of the resulting complex to the solid support have the same discrimination potential as their MB equivalents in solution (see Example 2 for more extensive results).

Example 2:

This Example demonstrates the correct functioning of this novel Designs when the invention AZMH immobilized on a solid support are and are addressed there.

For this Example were none despite several tested test conditions Comparisons with spotted MBs and the TMB equivalent are possible, as these are not visible Differences in the presence or absence of a target molecule showed (e.g., for TMB: immobilization by means of modified FDNA, or both modified FDNA and modified QDNA, various spotting and hybridization buffers, Slides chemistry, etc.), and due to the restriction of the TMB design, no suitable FRET system could be obtained (see Example 1).

First, serial dilutions of the 3'-end TAMRA modified position sequence as well as relevant positive and negative controls in different spotting buffers were prepared. The samples thus prepared were immobilized on three-dimensional modified glass surfaces as an array (3-D CodeLink ^™ , Amersham, UK). The hook element TRAF, modified at the 5 'end with BODIPY630 / 650, and its target molecule were then hybridized and the fluorescence recorded after each of these hybridizations by means of a confocal epifluorescence scanner. In addition, the initial TAMRA fluorescence signal intensities of the spots of the position sequences were recorded after each immobilization. All data obtained were normalized and the BODIPY630 / 650 / TAMRA ratios calculated ( 10 and 11 ).

It could be clearly demonstrated that the hybridization of the hook elements leads to suitable AZMH arrangements, since BODIPY630 signals were measurable, while reducing the TAMRA signals (via FRET with BODIPY630) ( 10A and B).

It were therefore spot-specific BODIPY630 / TAMRA ratios determinable. After successful hybridization of the target molecules showed the results the flawless function of the AZMH. The obtained conditions were opposite the ratios contained in the previous step about 2 to 3 times lower.

The resulting signal (with target molecule) / noise (without target molecule) ratio from the investigations in solution were about 5-fold ( 9 ). On the slide ( 11A and B), this ratio was> 2 in most buffer conditions. It is known from the prior art that the signal-to-noise ratios are significantly reduced upon immobilization of the probes due to eg spatial [15] or electrostatic [16] interactions of the surface. In Example 2 of the present invention, a reduction in the signal-to-noise ratio ( 11A and B) by a factor of ≤ 2.5, which is significantly better than previously described (eg [12]: (signal / noise loss when using classical MBs approximately 10-fold (S / N in solution ~ 10-fold, Signal / Noise immobilized 1.6-fold)).

It could also be shown that the S / N ratio of the AZMH remained relatively constant within the various buffer and concentration ranges ( 11A and B). At the concentration of 5μM, the spot signals were in saturation and therefore difficult to assess ( 11A and B).

Furthermore, the same sensitivity was measured at the concentrations 1 μM and 0.2 μM. This results in the possibility of using smallest amounts of AZMH (eg 0.2 μM) for equivalent signal strengths ( 9 ). In comparison, the linear oligonucleotides shown in the prior art had a spotting concentration of 25 μM (100 times greater than the AZMN concentration) and MB probes had a spotting concentration of 50 μM (200 times greater than the AZMN concentration). stated [23]. Taking into account the high prices for the synthesis of the MBs and the resulting high price for the microarrays, the use of AZMHs can significantly contribute to the cost reduction.

The proposed immobilization scheme and the structure of the AZMH were carried out in two steps, each step being specific components until the formation of the final Structure had.

First, linear oligonucleotides were immobilized. In the subsequent step, the final construction of the AZMH was performed by solution hybridization. This approach solves the problems of disordered immobilization / disposition of the structures known in the art. The hybridization of hook elements a long positional sequence allows the spatial separation of the fluorophores away from the surface, causing elimination of surface interactions with the structures.

• 1) Vermeidung von Verlusten an Spezifität bei Systemübertragung auf TMB im Vergleich zum klassischen MB-Design.
• 2) Vermeidung von Verlusten an Sensivität und Spezifität bei klassischen MB-Arrays.
• 3) Geeignete Immobilisierung, Adressierung der Hakenelemente und Funktionieren der immobilisierten AZMHs.

In summary, the present invention demonstrates that the AZMN design solves the following problems of the prior art:

• 1) Avoidance of system specificity loss on TMB compared to classic MB design.
• 2) Avoiding loss of sensitivity and specificity in classic MB arrays.
• 3) Suitable immobilization, addressing of the hook elements and functioning of the immobilized AZMHs.

literature

• 1. Tyagi S. and Kramer F.R., (1996), Molecular beacons: Probes that fluoresce upon hybridisation, Nat. Biotech, 14: 303-308.
• 2. Kostrikis L.G., Tyagi S., Mhlanga M.M., Ho.D. D and Kramer F.R. (1998) Spectral genotyping of human alleles. Science, 279: 1228-29.
• 3. Marras S.A., Kramer F.R. and Tyagi S. (1999) Multiplex detection of singlenucleotide variations using molecular beacons. Genet. Anal., 14: 151-6.
• 4. Dubertret B., Calame M. and Libchaber A. (2001) Single-mismatch detection using gold-quenched fluorescent oligonucleotides. Nat. Biotechnol., 19: 365-70.
• 5. Bonnet G., Tyagi S., Libchaber A., Krammer F.R., (1999), Thermodynamic basis of the enhanced specificity of structured DNA probes, proc. Natl. Acad. Sci. USA, 96: 6171-6176.
• 6. Tyagi S., Maras S.A.E., Kramer F.R., (2000), Wavelength-shifting molecular beacons, Nat. Biotech, 18: 1191-1196.
• 7. US 2003/01296011: Dual resonance energy transfer nucleic acid probes, Xu Y. Bao G., Tsourkas A.
• 8. Zhang P., Beck T., Tan W., (2001), design of a molecular beacon DNA probe with two fluorophores, Angew. Chem. Int. Ed., 40 (2): 402-405.
• 9. Joshi H.S., Tor Y., (2001), Metal-containing DNA hair-pins as hybridization probes, Chem. Comm., 549-550.
• 10. Steemers F.J., Ferguson J.A., Walt D.R., (2000), screening unlabelled DNA targets with randomly ordered fiber-optic gene arrays, Nat. Biotech, 18: 91-94.
• 11. Brown L.J., Cummins J., Hamilton A., Brown T., (2000), Molecular beacons attached to glass beads fluoresce upon hybridization to target DNA, Chem. Comm., 621-622.
• 12. Fang X., Liu X., Schuster S., Tan W., (1999), Designing of a novel molecular beacon for surface-immobilized DNA hybridization studies, J. Am. Chem. Soc., 121: 2921-2922.
• 13. Wang N., Li J., Liu N., Liu Q., Mei Q., Wang Y., Zhu J., He N., Lu Z., (2002), Label-free hybridization detection of a single nucleotide mismatch by immobilization of molecular beacons on agarose film, Nucl. Ac. Res., 30 (12): e61.
• 14. Du H., Disney D., Miller B.L., Krauss T., D., (2003), Hxbridisation-baxsed unquenching of DNA hairpins on Au surfaces: prototypical "molecular beacon "biosensors, J. Am. Chem. Soc., 125: 4012-4013.
• 15. Shchepinov, M.S., Case-Green, S.C. and Southern, E.M. (1997) Steric factors influencing hybridization of nucleic acids to oligonucleotides arrays. Nucleic Acids Res. 25 (6), 1155-1161.
• 16. Vainrub A., Pettitt M. Coulomb blockage of hybridization in two-dimeentional DNA arrays. (2002) Physical Review E 66, 041905.
• 17. Monroe W.T., Haselton F.R. Molecular beacon sequence design algorithm. (2003) BioTechniques 34: 68-73.
• 18. Nutiu R., Li Y., (2002), Tripartite molecular beacons, Nucl. Ac. Res., 30 (18): e94
• 19. WO 03/054223 (2002): Tripartite molecular beacons, LI Y., Nutiu R.
• 20. Frutos A.G., Pal S., Quesada M., Lahiri J., (2002), Mehtod for detection of single-base mismatches using bimolecular beacons, J. Am. Chem. Soc., 124 (11): 2396-2397.
• 21. Foerster, T. (1948). Annals of Physics, 2, 55-75
• 22. Bone RC, Balk RA, Cerra FB, Dellinger EP, Fein AM, Knaus WA, Schein RM, Sibbald WJ, the ACCP / SCCM Consensus Conference Committee (1992) Definitions for Sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. Chest 101, 1656-1662; and Crit Care Med 1992; 20: 864-874.
• 23. Ramachandran A., Flinchbaugh J., Ayoubi P., Olah G. A., Malayer J.R., (2003), Target discrimination by surface-immobilized molecular beacons designed to detect francisella tularensis, Biosens. Bioelec., 19: 727-736.

Claims (46)

A molecular probe assembly comprising: a positional element ( 19 ), which has a recognition motif ( 14 ); a hook element ( 20 ) with a loop-like area ( 1 ), the loop-like region ( 1 ) a target molecule ( 6 ) -specific location, and the loop-like area ( 1 ) through a double-stranded polynucleotide stem region ( 2 . 3 . 4 ) is stabilized, one strand ( 2 ) of the root area ( 2 . 3 . 4 ) into an element ( 17 ) which is complementary to at least part of the recognition motif ( 14 ) of the position element ( 19 ) extends. The device of claim 1, wherein the device is capable of being in a closed state if a target molecule ( 6 ) not at his destination Molecule-specific page ( 21 ) and the arrangement is capable of assuming an open state if the target molecule ( 6 ) to its target molecule-specific site ( 21 ) is bound. Arrangement according to claim 1 or 2, wherein the arrangement modifications ( 5 ), which are used to distinguish the closed and open states, in order to determine whether a target molecule ( 6 ) specific to the target molecule-specific site ( 21 ) on the loop-like area ( 1 ) of the hook element ( 20 ). Arrangement according to any one of claims 1 to 3, wherein the molecular probe assembly is an addressable two-part molecular hook is. Arrangement according to any of claims 1 to 4, wherein the recognition motif ( 14 ) is a nucleic acid sequence or an amino acid sequence or a synthetic analog of nucleic acid or amino acid sequences. Arrangement according to claim 5, wherein the recognition motif ( 14 ) is a unique address sequence. Arrangement according to any one of claims 1 to 6, wherein the position element ( 19 ) at least one modification ( 5 ) owns. Arrangement according to claim 7, wherein the modification ( 5 ) is a fluororesin reporter, a luminescent reporter, a metal, a radioactive reporter, a protein, a quencher, or a molecule capable of binding additional reporter molecules. Arrangement according to any one of claims 1 to 8, wherein the position element ( 19 ) a spacer ( 15 ). Arrangement according to any one of claims 1 to 9, wherein the position element ( 19 ) a linker ( 16 ). Arrangement according to any one of claims 1 to 10, wherein the loop-like region ( 1 ) and the stem area ( 2 . 3 . 4 ) of the hook element ( 20 ) is a nucleic acid sequence, in particular DNA or RNA sequence. Arrangement according to claim 11, wherein the loop region ( 1 ) comprises various partial sequences or sequences which are complementary to, or are generally recognized by, a specific target molecule ( 6 ) or a multi-cloning site. Arrangement according to any one of claims 1 to 12, wherein the element ( 17 ) of the hook element ( 20 ) which is complementary to at least part of the recognition motif ( 14 ) of the position element ( 19 ) is a nucleic acid sequence or an amino acid sequence or a synthetic analog of nucleic acid or amino acid sequences. Arrangement according to claim 13, wherein the element of the hook element ( 20 ) is an address complement sequence which corresponds to the address sequence ( 14 ) of the position element ( 19 ) is complementary. Arrangement according to any one of claims 1 to 13, wherein the hook element ( 20 ) at least one modification ( 5 ) owns. Arrangement according to claim 15, wherein the modification ( 5 ) is a fluororescense reporter, a luminescent reporter, a metal, a radioactive reporter, a protein, a quencher, or a molecule capable of binding additional reporter molecules. Arrangement according to any one of claims 1 to 16, wherein the position element ( 19 ) and the hook element ( 20 ) the same modification ( 5 ). Arrangement according to any one of claims 1 to 16, wherein the position element ( 19 ) and the hook element ( 20 ) different modifications ( 5 ). Arrangement according to any of claims 1 to 18, wherein a fluorophore is covalently attached to the position element ( 19 ) and another fluorophore is covalently attached to the hook element ( 20 ) is bound. An assembly according to any one of claims 1 to 18, wherein a quencher is covalently attached to the position element ( 19 ) and a fluorophore is covalently attached to the hook element ( 20 ) is bound. Arrangement according to any of claims 1 to 18, wherein a fluorophore is covalently attached to the position element ( 19 ) and a quencher covalently attached to the hook element ( 20 ) is bound. The device of any one of claims 1 to 21, wherein the address sequence / address complement hybrids after formation of the binding sequence with the target molecular sequence ( 6 ) do not dissociate. The assembly of any one of claims 1 to 22, wherein the hybrids of the first complementary sequence / second complementary sequence after hybrid formation between the binding sequence and the target molecule-specific sequence ( 6 ) dissociate. Method for detecting a target molecule ( 6 ) using the arrangement according to claims 1-23 with the following steps a. Reaction of at least one hook element ( 20 ) with its corresponding target molecule ( 6 ); b. Addressing a formed hook element target molecule ( 6 ) Complex to the position element ( 19 ); and c. Detecting a signal transmitted by means ( 5 ) is generated to distinguish between a closed and an open state of the device. Method for detecting a target molecule ( 6 ) using the arrangement according to claims 1-23 with the following steps a. Reaction of at least one hook element ( 20 ) with its corresponding position element ( 19 ); b. Reaction of at least one target molecule ( 6 ) with its corresponding addressed arrangement according to any of claims 1-23; and c. Detecting a signal transmitted by means ( 5 ) is generated to distinguish between a closed and an open state of the device. Method according to claim 24 or 25, wherein the position element ( 19 ) is immobilized on a solid support. The method of claim 26, wherein the immobilization by contacting the in the linker ( 16 ) contained reactive group with the reactive group of the modified surface of the solid support. A method according to any one of claims 24 to 27, wherein the solid support a slide, a Sphere, a pillar, a microtiter plate, a tube, a membrane, an optical Fiber or a nanoparticle. A method according to any one of claims 24 to 28, wherein the assembly comprises one or more target molecules ( 6 ), individually, in combination or in a complex mixture. A method according to any of claims 24 to 29, wherein the target molecule ( 6 ) of biological origin. The method of claim 30, wherein the biological Origin selected is selected from the group consisting of: human, animal, plant, invertebrate, low eukaryotic, prokaryotic and viral origin. The method of claim 30, wherein the target molecule ( 6 ) from tissue, body fluids or cells. A method according to any one of claims 24 to 32, wherein the target molecule ( 6 ) of synthetic origin. A method according to any one of claims 24 to 33, wherein the target molecule ( 6 ) is a nucleic acid, in particular DNA or RNA or a peptide nucleic acid, or a peptide or a peptidomimetic or a protein or an aptamer. Use of the arrangement according to any one of claims 1 to 23 for the study of nucleic acids and / or peptides and / or proteins and / or molecules low molecular weights. Use according to claim 35, wherein the assay the detection and / or separation and / or analysis of nucleotides and / or synthetic analogs and / or peptides and / or proteins and / or peptidomimetics and / or low molecular weight molecules, includes. Use according to claim 35 or 36, wherein gene expression analyzes, Genotyping analyzes, real-time observations of nucleic acid amplifications, Interaction analysis between protein DNA or protein RNA, sequencing or in high-throughput screening or any combination thereof, are included. Use according to any of claims 35-37 as part of a microarray and / or an integrated analysis system and / or an electronic evaluation system and / or a patient data management system and / or as part of a kit. Use according to any of claims 35-37 for in vitro / ex vivo diagnosis. Use according to claim 39 for in vitro / ex vivo Diagnosis of sepsis and / or during therapy course observation in sepsis. Use according to any of claims 35-40 for the determination of efficacy and toxicity in drug screening and / or for the manufacture of active substances and of compounds intended for Drug production can be used. Use according to any of claims 35-41 for the determination of artificial Contaminants in organisms, foods, drugs and the environment. A kit comprising the assembly according to any one of claims 1 to 23 contains. A kit according to claim 43 for use in solution and / or for addressable immobilization tion of the arrangement according to one of claims 1-23 with: a. several individual position elements ( 19 ), either an identical reporter ( 5 ) or identical quencher ( 5 ). b. several individual hook elements ( 20 ) containing either an identical reporter or a quencher ( 5 ) so that the complete array has one reporter / quencher pair or vice versa, an identical reporter / reporter pair. Kit according to claim 43 or 44 for use in solution and / or for the addressable immobilization of the assembly according to any of claims 1-23, comprising: a. several individual position elements ( 19 ) containing either a different fluorophore ( 5 ) or a quencher ( 5 ); b. several individual hook elements ( 20 ) containing either a different fluorophore ( 5 ) or a quencher ( 5 ) so that the complete assembly has a compatible fluorophore / quencher pair, or vice versa, a compatible fluorophore / fluorophore pair. Kit according to any one of claims 43 to 45 for the simultaneous detection of several target molecules ( 6 ) in a multiplexed procedure.