CN117604110B - Biomarker for breast cancer diagnosis and prognosis and application thereof - Google Patents
Biomarker for breast cancer diagnosis and prognosis and application thereof Download PDFInfo
- Publication number
- CN117604110B CN117604110B CN202410089751.9A CN202410089751A CN117604110B CN 117604110 B CN117604110 B CN 117604110B CN 202410089751 A CN202410089751 A CN 202410089751A CN 117604110 B CN117604110 B CN 117604110B
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- her2
- expression
- shcbp1
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 206010006187 Breast cancer Diseases 0.000 title claims abstract description 105
- 208000026310 Breast neoplasm Diseases 0.000 title claims abstract description 105
- 238000004393 prognosis Methods 0.000 title claims abstract description 19
- 238000003745 diagnosis Methods 0.000 title claims abstract description 15
- 239000000090 biomarker Substances 0.000 title abstract description 11
- 101001012157 Homo sapiens Receptor tyrosine-protein kinase erbB-2 Proteins 0.000 claims abstract description 92
- 102100030086 Receptor tyrosine-protein kinase erbB-2 Human genes 0.000 claims abstract description 92
- 101000863815 Homo sapiens SHC SH2 domain-binding protein 1 Proteins 0.000 claims abstract description 55
- 102100029989 SHC SH2 domain-binding protein 1 Human genes 0.000 claims abstract description 55
- 238000012360 testing method Methods 0.000 claims description 29
- 239000000523 sample Substances 0.000 claims description 27
- 206010028980 Neoplasm Diseases 0.000 claims description 24
- 208000005443 Circulating Neoplastic Cells Diseases 0.000 claims description 19
- 238000007901 in situ hybridization Methods 0.000 claims description 14
- 238000001514 detection method Methods 0.000 claims description 10
- 239000013068 control sample Substances 0.000 claims description 9
- 210000004369 blood Anatomy 0.000 claims description 5
- 239000008280 blood Substances 0.000 claims description 5
- 238000004519 manufacturing process Methods 0.000 claims description 4
- 210000000056 organ Anatomy 0.000 claims description 4
- 210000004915 pus Anatomy 0.000 claims description 4
- 210000002966 serum Anatomy 0.000 claims description 4
- 230000003321 amplification Effects 0.000 claims description 3
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 3
- 229940079593 drug Drugs 0.000 abstract description 7
- 239000003814 drug Substances 0.000 abstract description 7
- 230000001419 dependent effect Effects 0.000 abstract description 4
- 210000001519 tissue Anatomy 0.000 description 24
- 210000004027 cell Anatomy 0.000 description 23
- 238000003364 immunohistochemistry Methods 0.000 description 9
- 238000010186 staining Methods 0.000 description 8
- 206010027476 Metastases Diseases 0.000 description 7
- 238000001574 biopsy Methods 0.000 description 7
- 230000009401 metastasis Effects 0.000 description 7
- 210000000481 breast Anatomy 0.000 description 6
- 201000011510 cancer Diseases 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 210000002381 plasma Anatomy 0.000 description 6
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 5
- 210000000170 cell membrane Anatomy 0.000 description 5
- 239000003153 chemical reaction reagent Substances 0.000 description 5
- 108020004999 messenger RNA Proteins 0.000 description 5
- 108090000623 proteins and genes Proteins 0.000 description 5
- 102000004169 proteins and genes Human genes 0.000 description 5
- 210000004881 tumor cell Anatomy 0.000 description 5
- 101100314454 Caenorhabditis elegans tra-1 gene Proteins 0.000 description 4
- 238000011529 RT qPCR Methods 0.000 description 4
- 102220497176 Small vasohibin-binding protein_T47D_mutation Human genes 0.000 description 4
- 229940049595 antibody-drug conjugate Drugs 0.000 description 4
- 230000001575 pathological effect Effects 0.000 description 4
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 4
- 208000017891 HER2 positive breast carcinoma Diseases 0.000 description 3
- 230000004083 survival effect Effects 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 229920000742 Cotton Polymers 0.000 description 2
- 108020004414 DNA Proteins 0.000 description 2
- 238000002965 ELISA Methods 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 239000000611 antibody drug conjugate Substances 0.000 description 2
- 230000008901 benefit Effects 0.000 description 2
- 239000012472 biological sample Substances 0.000 description 2
- 210000001124 body fluid Anatomy 0.000 description 2
- 239000010839 body fluid Substances 0.000 description 2
- 239000003795 chemical substances by application Substances 0.000 description 2
- 230000000875 corresponding effect Effects 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 210000002865 immune cell Anatomy 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 239000012188 paraffin wax Substances 0.000 description 2
- 238000010837 poor prognosis Methods 0.000 description 2
- 230000028327 secretion Effects 0.000 description 2
- 210000002700 urine Anatomy 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 241000251468 Actinopterygii Species 0.000 description 1
- 108091033409 CRISPR Proteins 0.000 description 1
- 238000010354 CRISPR gene editing Methods 0.000 description 1
- 208000005623 Carcinogenesis Diseases 0.000 description 1
- 101150054472 HER2 gene Proteins 0.000 description 1
- 101000738771 Homo sapiens Receptor-type tyrosine-protein phosphatase C Proteins 0.000 description 1
- 208000007433 Lymphatic Metastasis Diseases 0.000 description 1
- 241000124008 Mammalia Species 0.000 description 1
- 206010027459 Metastases to lymph nodes Diseases 0.000 description 1
- 108010033276 Peptide Fragments Proteins 0.000 description 1
- 102000007079 Peptide Fragments Human genes 0.000 description 1
- 241000288906 Primates Species 0.000 description 1
- 102100037422 Receptor-type tyrosine-protein phosphatase C Human genes 0.000 description 1
- 230000010100 anticoagulation Effects 0.000 description 1
- 239000011324 bead Substances 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 230000036952 cancer formation Effects 0.000 description 1
- 231100000504 carcinogenesis Toxicity 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 238000010924 continuous production Methods 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 238000001035 drying Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 108700020302 erbB-2 Genes Proteins 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 238000003119 immunoblot Methods 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 206010061289 metastatic neoplasm Diseases 0.000 description 1
- 239000011325 microbead Substances 0.000 description 1
- 210000004923 pancreatic tissue Anatomy 0.000 description 1
- 230000007170 pathology Effects 0.000 description 1
- 210000005259 peripheral blood Anatomy 0.000 description 1
- 239000011886 peripheral blood Substances 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000008685 targeting Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 238000001262 western blot Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57415—Specifically defined cancers of breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Pathology (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to the technical field of biological medicines, in particular to a biomarker for diagnosing and prognosis judging breast cancer and application thereof. More specifically, the present invention relates to a biomarker for diagnosis and prognosis of breast cancer, in particular HER2 low expressing breast cancer, said biomarker being SHCBP1. The inventors have found that SHCBP1 is expressed at significantly higher levels in breast cancer patients than in healthy humans. More particularly, the inventors have found that high levels of expression of SHCBP1 are dependent on the expression of HER2 in breast cancer patients, even low levels of expressed HER2 may cause high levels of expression of SHCBP1. High levels of SHCBP1 expression can therefore be used as markers for HER2 expression for diagnosis of HER2 low expressing breast cancer.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to a biomarker for diagnosing and prognosis judging breast cancer and application thereof.
Background
Improving the accuracy and the high efficiency of breast cancer treatment has become the medical target of the new era. HER2 is an important target for accurate treatment of breast cancer, and recently, with rapid development of targeted drugs and novel Antibody Drug Conjugates (ADCs), HER2 low expression and heterogeneity are hot spot problems of current interest.
The expression of HER2 in breast cancer is divided into HER2 negative (HER 2-) and HER2 positive (her2+), with hr+her2-breast cancer being the most common breast cancer subtype, by using Immunohistochemistry (IHC) and Fluorescence In Situ Hybridization (FISH). IHC results from HER2 detection were classified into IHC 0, IHC1+, IHC2+ and IHC3+ according to the 2018 ASCO/CAP guidelines, based on staining intensity and percentage of intact cell membrane staining number; wherein IHC 0 represents an incomplete cell membrane staining without staining or weakly staining and the stained tumor cells are 10% or less; ihc1+ represents weak stained incomplete cell membrane staining and stained tumor cells are greater than 10%; IHC2+ represents weak to moderate intact cell membrane staining, and stained tumor cells are greater than 10%; ihc3+ represents highly intact cell membrane staining, and stained tumor cells are greater than 10%. HER2 positive includes ihc2+ and fish+ and ihc3+, HER2 negative includes IHC 0 or ihc1+ or ihc2+ and FISH negative. Whereas HER2 negative can be further divided into HER2low and HER2-0 based on IHC and FISH detection results. HER2low is defined as: IHC1+ or IHC2+ and FISH negative; HER2-0 is defined as: IHC 0.
Breast cancer HER2 positivity accounts for approximately 15-20% of all breast cancer cases. However, as the intensive research studies have found that HER2 expression levels are a continuous process, even in HER2 ihc3+ patients, the mRNA levels may be quite different. Thus, HER2 alone is positive or negative and does not meet clinical treatment requirements. With the rapid development of ADC drugs, the definition of HER2 low expression is proposed, i.e. HER2 ihc1+ or 2+ and no HER2 amplification. If the breast cancers are proportioned, the breast cancers of HER2 are not really detected, and about 30-40% of the total breast cancers are left, and about 45-55% of the breast cancers are left, which is called 'HER 2 low expression breast cancers'.
The american pathologist association (CAP) uses a tissue chip tableting method to statistically analyze the results of HER2 expression compartment interstitial control in 2019-2020, which shows that the HER2 positive or negative determination consistency is as high as 90% or more, but the consistency between 0 and 1+ is less than 70%. Subsequently, 18 pathologists with more than 5 years of working experience performed HER2 expression interpretation on 170 scan slices, with 0 and 1+ being only 26% identical, far less than 2+ and 3+58% identical. The results of the study demonstrate that pathologists still have identifying deficiencies in HER2 low expression, especially the accurate differentiation of 1+ from 0.
Therefore, although ADC drugs have made significant progress in the field of breast cancer treatment targeting HER2, there is still a worrying hidden danger behind it, and in-study patients, HER2 detection follows a dichotomy of HER2 expression, and no specific detection mode and standard are proposed for HER2 low expression. Thus, when the detection method does not exactly match a potentially benefited patient, it may result in some of the patients who would benefit losing medication opportunities (false negatives) or in poor benefited patients taking medication (false positives).
Thus, there is an urgent need in the art for methods and methods for HER2 low expression detection that are effective in improving the consistency of HER2 low expression interpretation.
Circulating tumor cells are a subset of tumor cells that shed from a primary tumor or metastatic tumor and are released into the blood circulation. Recent studies have found that, on the one hand, circulating tumor cells may appear in the peripheral blood of patients very early in tumorigenesis, which aids in early diagnosis of cancer. On the other hand, these circulating tumor cells can also be used to predict prognosis in cancer patients, and the discovery of circulating tumor cells often predicts recurrence or metastasis of a tumor, which also suggests poor prognosis in patients. How to use circulating tumor cells for diagnosis or prognosis of cancer, especially specific cancers such as breast cancer, is also an important direction in our future in the search of circulating tumor cell lines. A great benefit of using circulating tumor cells for diagnosis or prognosis is that it can effectively replace tumor biopsies, which is a good surrogate indicator for those patients who cannot take a pathological tissue biopsy, and can help clinicians to dynamically monitor and determine the biological characteristics of cancer in real time. However, due to the scarcity of circulating tumor cells, the use thereof as a means of diagnosing cancer, particularly specific cancers such as breast cancer, presents challenges, and not all cancer-related markers can be detected in circulating tumor cells.
Therefore, it is of great clinical value to find biomarkers suitable for diagnosis by means of circulating tumor cells.
Disclosure of Invention
To solve the above problems, the present inventors have found that SHCBP a has significantly higher expression levels in breast cancer patients than in healthy people. More particularly, the inventors have found that high levels of expression of SHCBP1 are dependent on the expression of HER2 in breast cancer patients, even low levels of expressed HER2 may cause high levels of expression of SHCBP 1. High levels of SHCBP1 expression can therefore be used as markers for HER2 expression for diagnosis of HER2 low expressing breast cancer.
Accordingly, the present invention provides a biomarker for diagnosis of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer and the biomarker is SHCBP1.
In other aspects, the invention also provides a biomarker for prognosis of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer and the biomarker is SHCBP a 1.
In other aspects, the invention also provides the use of an agent that detects SHCBP a expression in the manufacture of a tool for diagnosis of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer.
In other aspects, the invention also provides the use of an agent that detects SHCBP a expression in the manufacture of a tool for prognosis determination of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer.
Further, the diagnosis of breast cancer comprises the steps of:
(1) Collecting a sample of a test subject, and collecting a control sample;
(2) Detecting and comparing the expression level of SHCBP1 in the sample of the test subject and the control sample;
(3) Detecting the expression level of HER2 in a sample of a test subject by In Situ Hybridization (ISH);
If step (3) ISH detection is negative and the expression level of SHCBP1 in the sample of the test subject is increased compared to the expression level of SHCBP1 in the control sample, diagnosing that the test subject has HER 2-underexpressing breast cancer.
Further, the control sample is derived from healthy tissue of a healthy population or test subject.
Further, the prognosis of breast cancer comprises the following steps:
(1) Collecting samples of a pre-breast cancer patient as a group to be tested, and taking the samples of the pre-breast cancer patient as a control group;
(2) Detecting and comparing the expression level of SHCBP1 in the samples of the test group and the control group;
If the expression level of SHCBP1 in the test group sample is lower than the expression level of SHCBP1 in the control group sample, the prognosis of the test group is judged to be good.
As used herein, the subject includes a mammal, preferably a primate mammal, more preferably a human.
As used herein, a sample of the test subject includes a clinical biological sample of the subject, including, but not limited to, one or more of serum, plasma, whole blood, secretions, cotton swabs, pus, body fluids, tissues, organs, paraffin sections, tumor tissue, biopsy samples, circulating tumor cells, circulating tumor DNA, or urine shed cells. In a preferred embodiment, the sample of the test subject comprises breast tissue of the test subject, such as a breast biopsy sample, and the control sample is derived from breast tissue of a healthy subject, such as a breast biopsy sample, or healthy tissue of the test subject, such as a paracancerous tissue. In a preferred embodiment, the sample of the test subject is a circulating tumor cell.
As used herein, the samples of the prognostic and pre-breast cancer patients include clinical biological samples of the subject, including, but not limited to, one or more of serum, plasma, whole blood, secretions, cotton swabs, pus, body fluids, tissues, organs, paraffin sections, tumor tissue, biopsy samples, circulating tumor cells, circulating tumor DNA, or urine shed cells. In a preferred embodiment, the sample of the prognostic and pre-breast cancer patient comprises breast tissue of the subject to be tested, such as a breast biopsy sample. In a preferred embodiment, the sample of the prognostic and pre-breast cancer patient is circulating tumor cells.
As used herein, the reagent for detecting the expression of SHCBP1 in a sample of a test subject is not particularly limited and is a reagent for detecting the expression of SHCBP1 at the mRNA or protein level in a sample of a subject, which is well known and readily available to those skilled in the art. For example, reagents for detecting expression of SHCBP1 in a subject sample may include corresponding reagents for real-time fluorescent quantitative PCR, enzyme-linked immunosorbent assay (ELISA), protein/peptide fragment chip detection, chemiluminescence, immunoblotting, microbead immunodetection, microfluidic immunodetection.
The beneficial effects of the invention are that
According to the invention, SHCBP is selected as a diagnosis and prognosis marker of HER2 low-expression breast cancer, so that the problem of poor judgment consistency rate of HER2 IHC 0 and 1+ in the prior art is perfectly solved. The inventors have found that there is a certain correlation between the increase in SHCBP1 expression level and HER2 expression, and from the results of example 2 of the present invention, it is clear that the expression level of SHCBP1 is significantly increased even at lower HER2 expression levels, and therefore the expression level of SHCBP1 is very suitable as a measure of low HER2 expression levels. Thus, the present inventors have found that it is possible to determine that a subject is HER 2-low expressing breast cancer, as long as an increase in SHCBP1 expression level is detected and the ISH detection result of HER2 is negative, which has not been found by the past studies. In addition, the present invention also finds that diagnosis and prognosis of breast cancer can be performed by harvesting circulating tumor cells from a subject and detecting the expression level SHCBP therein.
Drawings
Figure 1 shows high expression of SHCBP1 in HER 2-low expressing breast cancer and HER 2-positive breast cancer tissue samples (part a in figure 1 is at the mRNA level and part B in figure 1 is at the protein level).
Figure 2 shows high expression of SHCBP1 in circulating tumor cells of HER 2-low expressing breast cancer and HER 2-positive breast cancer patients.
Figure 3 shows the verification of HER2 expression levels in T47D cells, ZR-75-1 cells and BT474 cells and changes in HER2 expression levels after HER2 knockout.
FIG. 4 shows the change in expression levels of SHCBP1 before and after HER2 knockout in T47D cells, ZR-75-1 cells, and BT474 cells.
FIG. 5 shows the results of a test of SHCBP expression versus tumor size.
Figure 6 shows the test results of SHCBP high expression versus pathological grading of HER2 low expressing breast cancer patients.
Fig. 7 shows the test results of SHCBP for high expression versus HER2 low expression breast cancer metastasis.
Figure 8 shows the test results of SHCBP on the level of expression versus overall survival of HER 2-low expressing breast cancer patients.
Detailed Description
The present invention is further illustrated below with reference to specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.
Example 1: SHCBP1 high expression in breast cancer
Clinical 138 breast cancer tissue samples and 24 paracancestral normal tissue samples are collected, tissue chips are made, HER2 expression levels in the breast cancer tissue samples are detected through In Situ Hybridization (ISH), and typing is carried out according to the HER2 expression levels, so that 50 HER2 IHC0+ breast cancer tissue samples, 58 HER2 IHC1+ or IHC2+ and ISH negative breast cancer tissue samples (namely, so-called HER2 low-expression breast cancer) and 30 HER2 positive (namely, IHC2+ and ISH positive and IHC3+) breast cancer tissue samples are obtained.
MRNA and protein levels of SHCBP were measured by RT-qPCR and Western Blot methods, respectively, using TRIzol (15596018, invitrogen) to extract mRNA and protein from the above-described breast cancer tissue sample and paracancerous normal tissue sample, respectively. The results are shown in fig. 1, which shows that SHCBP1 expression levels were significantly increased in both HER2 ihc1+, 2+ and 3+ breast cancer tissue samples, whereas the increase was not significant in HER2 ihc0+ breast cancer tissue samples, suggesting that SHCBP1 expression levels could be used to distinguish HER2 negative breast cancer from HER2 low expressing breast cancer.
Example 2: detection of SHCBP1 expression levels in circulating tumor cells of breast cancer patients
1) Respectively extracting 10mL of venous blood of HER2 IHC0+ breast cancer, HER2 IHC1+ or IHC2+ breast cancer with ISH negative (namely, so-called HER2 low-expression breast cancer) and HER2 positive (namely, IHC2+ breast cancer with ISH positive and IHC3+) breast cancer patients in an ACD anticoagulation tube, and conventionally centrifuging and separating plasma for later use;
2) Enrichment and separation of CTC cells in plasma comprises the following specific steps: extracting a single cell layer in the blood plasma by adding a sample density separating liquid (CYTELLIGEN) into the blood plasma, then adding immune cell removing magnetic beads to remove CD45 + immune cells in the extracted single cell layer, and concentrating and enriching CTC in the single cell layer by differential enrichment;
3) The enriched CTC cells were harvested by centrifugation and 1ml of RNA lysate was added to the enzyme-free EP tube; 200ul of chloroform is added into an EP tube, vigorously oscillated for 15 seconds, and kept still at room temperature for 3 minutes, and repeated for 3 times; centrifuging at 12000 Xg and 4 ℃ for 15min; adding the upper water phase into a new enzyme-free EP pipe, adding equal volume of isopropanol into the EP pipe, reversing, mixing uniformly, and standing for 10min; centrifuging at 12000 Xg and 4 ℃ for 15min; the EP tube liquid was discarded, 1ml of 75% ethanol was added, and the EP tube was shaken; centrifuging at 12000 Xg and 4 ℃ for 5min; discarding the supernatant, and standing at room temperature for drying; adding a proper amount of DEPC water to dissolve RNA; the purity and concentration of RNA was measured and the expression of SHCBP1 in CTC cells was measured by RT-qPCR and compared to the expression of SHCBP1 in cells harvested from normal pancreatic tissue, as shown in figure 2, which demonstrates that abnormally high expression levels of SHCBP1 can be detected in CTC cells of HER2 ihc1+, 2+ and 3+ breast cancer patients.
Example 3: high expression of SHCBP1 in breast cancer is dependent on HER expression
RNA was extracted using T47D cells (HER 2 negative breast cancer cells), ZR-75-1 cells (HER 2 low expressing breast cancer cells) and BT474 cells (HER 2 positive breast cancer cells), and the HER2 expression level was verified by RT-qPCR and SHCBP expression levels were detected. The results are shown in FIG. 3, which shows that SHCBP a has increased expression levels in both BT474 cells and ZR-75-1 cells compared to T47D cells.
HER2 gene (hHer 2 grna_f: CACCGCGGCACAGACAGTGCGCGTC; hHer 2grna_r: AAACGACGCGCACTGT CTGTGCCGC) was knocked out in BT474 cells and ZR-75-1 cells using CRISPR editing techniques, RNA was extracted, HER2 expression was verified using RT-qPCR and SHCBP1 expression levels were detected. The results are shown in figure 4, which shows that the expression level of SHCBP a is no longer elevated after HER2 knockout, indicating that high expression of SHCBP a in breast cancer is dependent on HER expression, and thus the expression level of SHCBP a can reflect HER expression levels and can be used to diagnose HER low expressing breast cancer.
As can be seen from a comparison of the results of fig. 3 and fig. 4, the expression level of SHCBP1 was significantly increased even at lower HER2 expression levels, and thus the expression level of SHCBP1 was very suitable as a measure of low HER2 expression levels.
Example 4: SHCBP1 relation to clinical prognosis of breast cancer
Based on SHCBP expression levels determined in example 1, the relationship between SHCBP1 and tumor size, pathological grading and metastasis of HER2 low expressing breast cancer patients was statistically analyzed, and the results are shown in fig. 5 and 6.
FIG. 5 shows the results of a test of the relationship between SHCBP and tumor size, and FIG. 6 shows the results of a test of the relationship between SHCBP high expression and HER2 low expression breast cancer patient pathology, it can be seen that the higher the SHCBP1 expression, the larger the tumor in the patient; it was also found that: in cases of grade I, grade II and grade III of HER2 low expressing breast cancer patients, SHCBP1 expression in the corresponding breast cancer patients showed an increasing trend as grade I, grade II and grade III levels increased, indicating: SHCBP1 and breast cancer patients' tumor size and pathological grading appear to be positively correlated.
The inventors performed statistical analysis based on the presence or absence of metastasis and the number of lymph node metastases in the obtained HER 2-low-expression breast cancer patients, and the results are shown in fig. 7: it can be seen that of the HER2 low expressing breast cancer patients with metastasis, 78.2% exhibited SHCBP1 high expression, and of the HER2 low expressing breast cancer patients without metastasis, 52.4% exhibited SHCBP1 high expression, which also suggests that SHCBP1 high expression and HER2 low expressing breast cancer metastasis may exhibit a high positive correlation.
Finally, the inventors analyzed the relationship between the level of SHCBP1 expression and the overall survival of patients with HER 2-low expressing breast cancer. As shown in fig. 8, it can be seen that the overall survival rate was significantly lower for five years in the SHCBP1 High (SHCBP 1 High) HER2 Low expressing breast cancer patient group than in the SHCBP1 Low expressing (SHCBP Low) breast cancer patient group. This illustrates: SHCBP1 high expression results in a poor prognosis for patients with HER2 low expression breast cancer.
It should be noted that while the present invention has been illustrated in the drawings and described in connection with the preferred embodiments thereof, it is to be understood that the invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but are to be construed as providing a full breadth of the disclosure. The above-described features are further combined with each other to form various embodiments not listed above, and are considered to be the scope of the present invention described in the specification; further, modifications and variations of the present invention may be apparent to those skilled in the art in light of the foregoing teachings, and all such modifications and variations are intended to be included within the scope of this invention as defined in the appended claims.
Claims (4)
1. Use of an agent that detects SHCBP1 expression in the manufacture of a tool for diagnosis of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer;
The definition of HER2 low expression is: HER2 ihc1+, or HER2 ihc2+ without HER2 amplification.
2. The use according to claim 1, wherein the diagnosis of breast cancer comprises the steps of:
(1) Collecting a sample of a test subject, and collecting a control sample;
The control sample is derived from healthy tissues of healthy people or a to-be-detected subject, and the sample of the to-be-detected subject is one or more of serum, plasma, whole blood, pus, organs, tumor tissues, circulating tumor cells and circulating tumor DNA;
(2) Detecting and comparing the expression level of SHCBP1 in the sample of the test subject and the control sample;
(3) Detecting the expression level of HER2 in a sample of a test subject by In Situ Hybridization (ISH);
If step (3) ISH detection is negative and the expression level of SHCBP1 in the sample of the test subject is increased compared to the expression level of SHCBP1 in the control sample, diagnosing that the test subject has HER 2-underexpressing breast cancer.
3. Use of an agent that detects SHCBP1 expression in the manufacture of a tool for prognosis of breast cancer, wherein the breast cancer is HER2 low expressing breast cancer;
The definition of HER2 low expression is: HER2 ihc1+, or HER2 ihc2+ without HER2 amplification.
4. The use according to claim 3, wherein the prognosis of breast cancer comprises the steps of:
(1) Collecting samples of a pre-breast cancer patient as a group to be tested, and taking the samples of the pre-breast cancer patient as a control group;
the samples of the prognosis and pre-breast cancer patients are one or more of serum, plasma, whole blood, pus, organs, tumor tissues, circulating tumor cells and circulating tumor DNA;
(2) Detecting and comparing the expression level of SHCBP1 in the samples of the test group and the control group;
If the expression level of SHCBP1 in the test group sample is lower than the expression level of SHCBP1 in the control group sample, the prognosis of the test group is judged to be good.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410089751.9A CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410089751.9A CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN117604110A CN117604110A (en) | 2024-02-27 |
| CN117604110B true CN117604110B (en) | 2024-04-19 |
Family
ID=89960174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410089751.9A Active CN117604110B (en) | 2024-01-23 | 2024-01-23 | Biomarker for breast cancer diagnosis and prognosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117604110B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805197A (en) * | 2015-04-09 | 2015-07-29 | 嘉兴市第二医院 | Method for taking molecular marker in diagnosis and prognosis evaluation of breast cancer |
| CN107106687A (en) * | 2014-10-03 | 2017-08-29 | 诺华股份有限公司 | Combined therapy |
| CN110628913A (en) * | 2019-04-15 | 2019-12-31 | 德阳市人民医院 | lncRNA marker related to breast cancer |
| CN114712512A (en) * | 2021-01-06 | 2022-07-08 | 兰州大学第二医院 | Novel combination therapy for treating HER2 positive cancer |
-
2024
- 2024-01-23 CN CN202410089751.9A patent/CN117604110B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107106687A (en) * | 2014-10-03 | 2017-08-29 | 诺华股份有限公司 | Combined therapy |
| CN104805197A (en) * | 2015-04-09 | 2015-07-29 | 嘉兴市第二医院 | Method for taking molecular marker in diagnosis and prognosis evaluation of breast cancer |
| CN110628913A (en) * | 2019-04-15 | 2019-12-31 | 德阳市人民医院 | lncRNA marker related to breast cancer |
| CN114712512A (en) * | 2021-01-06 | 2022-07-08 | 兰州大学第二医院 | Novel combination therapy for treating HER2 positive cancer |
Non-Patent Citations (4)
| Title |
|---|
| A four-gene signature in the tumor microenvironment that significantly associates with the prognosis of patients with breast cancer;Jianxin Wang 等;《Gene》;20200810;第761卷;第1-8页 * |
| Eight hub genes as potential biomarkers for breast cancer diagnosis and prognosis: A TCGA-based study;Nan Liu 等;《World J Clin Oncol》;20220824;第13卷(第8期);第675-688页 * |
| SHCBP1 is over-expressed in breast cancer and is important in the proliferation and apoptosis of the human malignant breast cancer cell line;Wen Feng 等;《Gene》;20160426;第587卷;第91页摘要、第92页左栏、第93页表2、第94页左栏、第96页 * |
| SHCBP1: 乳腺癌治疗候选靶点和潜在预后标志物;赵诗哲 等;《生物信息学》;20200331;第18卷(第1期);第45-55页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN117604110A (en) | 2024-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Elhanafi et al. | Comparison of endoscopic ultrasound tissue acquisition methods for genomic analysis of pancreatic cancer | |
| KR20110063753A (en) | Lung cancer biomarkers and uses thereof | |
| CN108179134B (en) | EpCAM/PSMA-based double-antibody functionalized microfluidic chip and preparation method and application thereof | |
| US20130196355A1 (en) | Method and a kit to quantify and qualify exosomes for diagnosis of prostate cancer and prostate hyperplasia | |
| CN103602720A (en) | Application and method of prostatic cancer genetic marker in marking relapse and metastasis of prostatic cancer | |
| CN110541030B (en) | Bladder cancer detection kit and application thereof | |
| Zhu et al. | Six stroma-based RNA markers diagnostic for prostate cancer in European-Americans validated at the RNA and protein levels in patients in China | |
| CN105899673A (en) | Keratins as biomarkers for cervical cancer and survival | |
| KR102384848B1 (en) | Keratin 17 as a biomarker for bladder cancer | |
| Lu et al. | Detection of circulating stage III–IV gastric cancer tumor cells based on isolation by size of epithelial tumor: using the circulating tumor cell biopsy technology | |
| KR101704828B1 (en) | Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid | |
| CN117604110B (en) | Biomarker for breast cancer diagnosis and prognosis and application thereof | |
| CN106480188B (en) | The application of the molecular probe, kit and the molecular probe of metastatic prostate cancer early prediction | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN117625790B (en) | Biomarker for diagnosis and prognosis of prostate cancer and application thereof | |
| US11448650B2 (en) | Methods for diagnosing high-risk cancer using polysialic acid and one or more tissue-specific biomarkers | |
| CN117604111B (en) | Biomarker for diagnosis and prognosis judgment of small cell lung cancer and application thereof | |
| CN112680514A (en) | Marker for liver cancer diagnosis and application thereof | |
| CN117604109B (en) | Biomarker for bladder cancer diagnosis and prognosis and application thereof | |
| CN117604106B (en) | Biomarker for diagnosis and prognosis judgment of non-small cell lung cancer and application thereof | |
| CN111690746A (en) | Platelet RNA marker related to lung cancer and application thereof | |
| CN117625791B (en) | Biomarker for colorectal cancer diagnosis and prognosis and application thereof | |
| CN117604112B (en) | Biomarker for pancreatic cancer diagnosis and prognosis and application thereof | |
| CN117604108B (en) | Biomarker for liver cancer diagnosis and prognosis and application thereof | |
| CN117625792B (en) | Biomarker for diagnosis and prognosis of gastric cancer and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |