CN115820845B - Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof - Google Patents
Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof Download PDFInfo
- Publication number
- CN115820845B CN115820845B CN202210776014.7A CN202210776014A CN115820845B CN 115820845 B CN115820845 B CN 115820845B CN 202210776014 A CN202210776014 A CN 202210776014A CN 115820845 B CN115820845 B CN 115820845B
- Authority
- CN
- China
- Prior art keywords
- colorectal cancer
- risk
- functional site
- diagnosis
- site marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof, wherein the functional site marker is rs 1020570. Large-scale crowd data and biological function experiments prove that the rs 1020570 (C > G) locus increases mRNA stability by promoting 3' UTR of a target gene DNM1L to be shortened, promotes cancer cell proliferation, and finally leads to increased risk of colorectal cancer of an individual. By means of ingenious primer and probe design aiming at the site rs 1020570, the rs 1020570 mutation detection can be carried out on normal people by means of fluorescence quantitative PCR, so that high-risk people of colorectal cancer are identified, and diagnosis of colorectal cancer patients is assisted. The method of the invention provides help for assessing the risk of colorectal cancer, and is helpful for clinically screening colorectal cancer and early intervention of the crowd.
Description
Technical Field
The invention relates to the fields of genetic engineering and oncology, in particular to a polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof.
Background
Colorectal cancer is a common malignant digestive tract tumor, seriously threatens the health of people in China, and has incidence rate of the third malignant tumor in China and death rate of the second malignant tumor. And with the development of national economic level and the change of resident life style and dietary structure, the incidence rate of colorectal cancer in China rises year by year, so that the colorectal cancer becomes a serious public health problem seriously affecting national health. Currently, the most effective screening method for colorectal cancer is the stool immunochemistry test (FIT) in combination with colonoscopy. However, these methods have drawbacks such as low detection rate and low patient acceptance. If screening and early diagnosis can be carried out on high-risk individuals aiming at colorectal cancer more accurately, the acceptance of patients can be higher, and a great deal of medical expenditure is saved for the country. In recent years, identification of individuals at high risk for colorectal cancer has been focused on the study of genetic susceptibility factors. Single nucleotide polymorphisms (Single Nucleotide Polymorphism, SNPs) are the most common genetic variations, playing an important role in complex diseases in humans. To date, a series of genetic variation sites closely related to colorectal cancer susceptibility in the chinese population have been identified by Genome-wide association studies (Genome-Wide Association Study, GWAS). However, identification of functional genetic variation behind colorectal cancer association and revealing its underlying biological mechanism remain major research, and for this reason, researchers have used a Quantitative Trait Locus (QTL) -based analysis method system to mine true functional SNPs. Variable polyadenylation of mRNA (Alternative Polyadenylation, APA) is widely present in colorectal cancer and is closely related to the development of tumorigenesis, which refers to the process by which selective changes in tailing signals during mRNA processing produce transcripts of different 3 'untranslated region (3' UTR) lengths, and furthermore, studies have reported that genetic variations at the polyA tailing site or related regulatory elements can cause abnormal APA events to occur, further affecting disease susceptibility. Therefore, the SNP marker can be applied to identification, early screening and auxiliary diagnosis of individuals at high risk of colorectal cancer of Chinese population.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, and aims to provide a polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof.
A polyadenylation functional site marker associated with assisted diagnosis of colorectal cancer, characterized in that the functional site marker is rs 1020570.
Further, the specific amplification primer sequence of rs 1020570 is SEQ ID NO:1 and SEQ ID NO:2.
further, the probe sequence of rs 1020570 is SEQ ID NO:3 and SEQ ID NO:4.
the detection reagent of the polyadenylation functional site mark related to colorectal cancer auxiliary diagnosis is applied to the preparation of colorectal cancer auxiliary diagnosis kits.
A colorectal cancer auxiliary diagnosis kit, which is used for detecting rs 1020570 in peripheral blood DNA.
The colorectal cancer auxiliary diagnosis kit comprises the specific amplification primer marked by the functional site and the specific probe marked by the functional site.
The beneficial effects of the invention are as follows: provides a technical method for screening colorectal cancer high risk groups from the molecular biology and gene diagnosis level. The method is based on our earlier study, and shows that the rs 1020570 locus is related to colorectal cancer susceptibility of Chinese population. By means of ingenious primer and probe design aiming at the site rs 1020570, detection of rs 1020570 variation can be carried out on normal people by means of fluorescence quantitative PCR, so that high-risk people of colorectal cancer are identified, and diagnosis of colorectal cancer patients is assisted. The technical method has ingenious, simple and feasible design, accurate and reliable results, can be popularized in hospitals at all levels, provides assistance for evaluating the risk of colorectal cancer, and is beneficial to clinically screening and early intervention of colorectal cancer for the crowd.
Drawings
FIG. 1 is a flowchart of screening a colorectal cancer potential pathogenic SNP locus rs 1020570;
FIG. 2 is a graph of AUC of a colorectal cancer risk prediction model based on SNP locus rs 1020570;
FIG. 3 is a schematic representation of 3' -RACE results and product sequence alignment in colorectal cancer cell lines.
Fig. 4 is a schematic diagram showing the effect of SNP locus rs 1020570 on colorectal cancer cell proliferation corresponding to transcripts of different lengths.
Detailed Description
The principles and features of the present invention are described below with examples given for the purpose of illustration only and are not intended to limit the scope of the invention. The technical scheme of the invention is as follows:
a polyadenylation functional site marker associated with assisted diagnosis of colorectal cancer, the polyadenylation functional site marker being rs 1020570.
The specific amplification primer sequence of rs 1020570 is SEQ ID NO:1 and SEQ ID NO:2.
the probe sequence of rs 1020570 is SEQ ID NO:3 and SEQ ID NO:4.
the detection reagent of the polyadenylation functional site mark related to colorectal cancer auxiliary diagnosis is applied to the preparation of colorectal cancer auxiliary diagnosis kits.
A colorectal cancer auxiliary diagnosis kit, which is used for detecting rs 1020570 in peripheral blood DNA.
The colorectal cancer auxiliary diagnosis kit comprises the specific amplification primer marked by the functional site and the specific probe marked by the functional site.
Specifically, the technical scheme for solving the problems of the invention comprises the following steps: (1) establishing a unified standard specimen library and database: standard-compliant subject blood samples were collected with standard procedures (SOP) and the system collected complete demographic and clinical data. (2) genotype detection: selecting colorectal cancer cases and healthy controls, finding out functional site markers related to colorectal cancer morbidity of Chinese people on abnormal polyadenylation gene DNM1L, and (3) verifying the screened positive related functional site markers in independent samples to judge the related stability. (4) development of colorectal cancer auxiliary diagnosis kit: and developing an auxiliary diagnosis kit according to genetic functional site marks with obvious differences in genotype distribution frequency in colorectal cancer cases and healthy controls.
In particular, the experimental method of the invention mainly comprises the following steps:
we downloaded from the genotype and phenotype database (dbGaP) the european population colorectal cancer genotype and phenotype dataset from the GECCO project, containing 17,789 cases and 19,951 controls altogether. In addition, we genotyped the recruited normal control chinese population with complete medical records, well-defined typing for 6,024 colorectal cancer patients and 10,022 non-tumor history. Colorectal cancer patients and normal controls were both chinese han nationality. The patient is subjected to histopathological diagnosis without age limitation; normal controls had no history of tumor and no signs of tumor upon physical examination, and each subject had informed consent to participate in the study and donated 2mL of peripheral venous blood for isolation of lymphocyte genomic DNA. The basic information of sex, age, etc. of the above study subjects from European and Chinese population are shown in Table 1.
TABLE 1 European and Chinese populations colorectal cancer patients and normal controls used in the study
We calculated the association of SNP locus rs 1020570 with colorectal cancer susceptibility using an unconditional logistic regression additive model (additive model) and corrected for gender, age. The research results show that after the gender and age are corrected, individuals carrying rs 1020570 risk genotypes increase the risk of colorectal cancer by 8% and 22% respectively (OR=1.08, 95% CI:1.03-1.13, P=4.14X10) compared with normal individuals in European and Chinese population results -4 ；OR＝1.22,95％CI:1.13-1.32，P＝1.35×10 -6 ). The correlation results of rs 1020570 with colorectal cancer risk are shown in table 2.
Table 2. Rs1020570 results of colorectal cancer risk correlation analysis for European and Chinese populations
We further used this SNP site to build a model for risk prediction of colorectal cancer. A formula is constructed, and three genotypes and sexes of SNP, age, smoking and drinking conditions are comprehensively considered. Wherein, for SNP typing, wild homozygote= "1", heterozygote= "2", mutant homozygote= "3"; for gender, male is "1" and female is "0"; for age, greater than or equal to 60 years old is "1", less than 60 years old is "0". In the analysis, a formula for obtaining the rs 1020570-based typing hazard score by taking the multifactor logistic regression coefficient beta as a weight is as follows:
chinese population risk score= (-0.14118 x gender score) +(-0.07357 x age score) + (0.21604 x smoking score) +(-0.11053 x drinking score) + (0.20260 x rs 1020570 typed score).
European population risk score= (-0.19051 ×gender score) + (0.02964 ×age score) + (0.07338 ×rs 1020570-typed score).
By plotting the AUC curve, the area under the model curve was 0.596 and 0.556 for european and chinese populations, respectively, see fig. 2.
To functionally resolve the colorectal cancer risk association of the rs 1020570 functional site marker, we found using the apaQTL analysis that the different genotypes of the pathogenic site are significantly correlated with the 3' utr length of the target gene DNM1L, then confirmed in both colorectal cancer cell lines using a 3' race experiment that the overexpressing rs 1020570 [ G ] risk allele promoted poly (a) tailing signal to occur proximal to the transcript, resulting in a shortened 3' utr length of DNM1L and an increased expression of the short transcript. The results of 3' race in both colorectal cancer cell lines and Sanger sequencing were aligned and verified for their products, see in particular fig. 3.
To explore in depth the effect of DNM1L [ C ] or DNM1L [ G ] on colorectal cancer cell proliferation we over-expressed plasmids of different genotypes corresponding to transcripts of different lengths in HCT116 and SW480 colorectal cancer cell lines, and tested the cell proliferation capacity using CCK-8 and clonogenic experiments. The result shows that the target gene DNM1L plays a role in cancerogenesis in colorectal cancer, and compared with DNM1L [ C ], the overexpression of DNM1L [ G ] leads the proliferation activity of colorectal cancer cells to be stronger. The results of CCK-8 and clone formation experiments are shown in FIG. 4.
Combining the large-scale crowd data and biological function experimental results, the rs 1020570 (C > G) locus increases mRNA stability by promoting 3' UTR of a target gene DNM1 to be shortened, promotes cancer cell proliferation, and finally leads to increased risk of colorectal cancer of an individual. Therefore, the rs 1020570 mutation of the crowd is detected, so that the high risk crowd of colorectal cancer is identified, and the diagnosis of colorectal cancer patients is assisted.
The experimental method comprises the following steps:
1. peripheral blood DNA extraction:
the DNA is extracted by a conventional phenol-chloroform method, and the specific steps are as follows:
1) About 3mL of anticoagulated blood was centrifuged at 5,000Xg for 15min at room temperature, and the upper layer was discarded, leaving about 0.3mL of blood cells. 0.5mL of freshly prepared extraction buffer with a final concentration of 20. Mu.g/mL RNase was added and incubated at 37℃for 1h after mixing.
2) Proteinase K was added at a final concentration of 100. Mu.g/mL and incubated overnight at 37℃after mixing.
3) 0.7mL of Tris buffer-equilibrated phenol (pH=7.0) was added to each tube, thoroughly mixed, and centrifuged at 8,000Xg for 15min at room temperature.
4) Transferring the upper liquid into another 1.5mL centrifuge tube, adding 0.7mL of equal volume phenol-chloroform (1:1), and fully and uniformly mixing for 15min; centrifuge at 8,000Xg for 15min at room temperature.
5) The supernatant was transferred to another clean 1.5mL centrifuge tube, 10% volume of 10M ammonium acetate solution was added, 2 volumes of pre-chilled absolute ethanol was added, and the mixture was allowed to stand at-20℃for 2h to precipitate DNA.
6) Washing the precipitated DNA with 75% ethanol, centrifuging at 12,000Xg for 15min, and discarding the upper layer liquid; the supernatant was discarded after centrifugation at 12,000Xg for 15min with 75% ethanol.
7) The tubes were inverted over absorbent paper, and after ethanol was evaporated, appropriate TE buffer was added to each tube, and stored at-20℃for one week at 4 ℃.
2. Genotyping
The typing platform adopted is TaqMan genotyping technology (ABI 7900HT Real Time PCR system,Applied Biosystems), and a 5 mu LPCR reaction system is shown in Table 3:
TABLE 3 TaqMan genotyping PCR reaction System
The reaction conditions are as follows: pre-denaturation at 95℃for 10min, followed by 45 cycles of 15sec at 95℃and 1min at 60℃and cooling to 4 ℃.
The primers and probes used for the reaction were as follows:
rs 1020570 primer:
forward primer: caaactgctttgcacaactagaaca (SEQ ID NO: 1)
Reverse primer: cagaacacatcacacatttaatccaa (SEQ ID NO: 2)
rs 1020570 probe:
forward probe: fam-taacagttgtttttaagttaag-mgb (SEQ ID NO: 3)
Reverse probe: vic-taacagttctttttaagttaag-mgb (SEQ ID NO: 4)
Rapid amplification of cDNA 3' Ends
To investigate the effect of genetic variation on the length of the 3' UTR of the target gene, plasmids carrying different alleles were transfected in colorectal cancer cell lines HCT116 and SW480, and the change in the length of the 3' UTR of the mRNA of the target gene was compared by using the 3' -Full RACE Core Set with PrimeScript RTase kit (No. 6106; takara). The method comprises the following steps:
1) And (3) reacting. The reaction system was prepared as in table 3, followed by amplification using a high-speed gene amplification apparatus under the following conditions: 60min at 42℃and 15min at 70 ℃. After the end, a nested PCR reaction may be performed or stored at-20 ℃.
TABLE 3 3.3' -RACE reverse transcription reaction System
2) And (3) sleeve type PCR reaction: the reaction process uses high-fidelity enzyme TaKaRa LA Taq (CodeNo. RR002A), and the specific operation steps are as follows:
(1) OuterPCR reaction. The reaction system was prepared as shown in Table 4, and then amplified in a high-speed gene amplification apparatus under the conditions shown in Table 5.
TABLE 4 Outer PCR reaction System
* In general, the amount of the reverse transcription reaction solution used is 2. Mu.L to 5. Mu.L.
(2) Inner PCR reaction. The reaction system was prepared and amplified in accordance with Table 5.
TABLE 5 Inner PCR reaction System
3) Lipo-glycogel electrophoresis: and (3) taking 5-10 mu L of PCR reaction liquid for electrophoresis, and confirming experimental amplification products.
4) Sequencing analysis: the possible bands of interest were sequenced and the amplified products were further confirmed.
4. Cell proliferation assay
1) Cell count
Before CCK-8 proliferation and clonogenic experiments, cell counting is required to ensure that appropriate numbers of cells are seeded in different groups of well plates. The experiment used a blood cell counting plate consisting of two equally sized cells, each cell consisting of nine 1mm x 1mm squares, each square accommodating 0.1mm 3 Liquid volume. The specific counting steps are as follows:
(1) and (3) digesting the cell pore plate after being cultured for a period of time to obtain a cell suspension, and uniformly mixing and scattering the cells as much as possible.
(2) The counting plate is sterilized and then covered with a cover glass.
(3) 10. Mu.L of the cell suspension was aspirated and slowly dropped into the counting plate along the edge of the slide, ensuring no air bubbles were generated between the cover glass and the counting plate).
(4) The plate was left to stand for 1min, and the square at the four corners was counted under a microscope as follows: a. for cells pressed against the square edges, only the upper and left cells are counted, b. If the cells are clumped, they are counted as one cell.
(5) Cell suspension concentration = total number of cells in square/4×10 4 And each mL.
2) CCK-8 cell proliferation assay
The present study uses CCK-8 kit (Dojindo, japan) to examine colorectal cancer cell proliferation capacity.
(1) 100. Mu.L of the cell suspension was aspirated and diluted to a cell size of about 2,000 at the concentration counted, and plated in 96-well plates.
(2) Cell activity assays were performed at four time points, 24h, 48h, 72h and 96 h. 10 mu LCCK-8 reagent is added into each hole, and the mixture is shaken up and down and left and right to be gently mixed, and the mixture is put back into a cell culture box to be cultured for 1.5 hours.
(3) Absorbance measurement was performed using a microplate reader, the wavelength was set at 450nm, and cell proliferation curves of different experimental groups were plotted according to absorbance values at four time points to compare differences.
3) Cloning formation experiments
(1) After 36h of transfection of cells, cell counts were performed and diluted to appropriate concentrations. 2mL of the cell suspension was added to each well of the 6-well plate to give a cell amount of about 1,000, and the culture was continued for about 2 weeks.
(2) During which the cell morphology was observed every 2-3 days and fresh medium was changed. If cell clones are observed under a microscope, a fixation stain may be performed.
(3) The 6-well plate was removed from the incubator, the waste liquid was aspirated and slowly washed 2 times with PBS. After each well of PBS was blotted, 2mL of methanol solution was added and left at room temperature for 30min.
(4) After methanol was removed by suction, a 0.25% crystal violet solution was added and the mixture was left in the dark for 30min to dye.
(5) After the dyeing is finished, waste liquid in the hole is sucked, the hole plate is washed by double distilled water until the visual field is clear, and photographing and storage are carried out.
In summary, we used TCGA database colorectal cancer genotype data and APA event phenotypes to analyze the APA quantitative trait locus (APA Quantitative Trait Loci, apaQTL) and identify genetic variations significantly associated with APA events. Further, in combination with case control studies of large samples of European populations, rs 1020570 (C > G) located in the 12p11.12 region was found to have the most significant colorectal cancer apoQTL effect value, while in combination with the Chinese population colorectal cancer onset risk correlation studies, individuals carrying [ G ] allelic variation were found to significantly increase colorectal cancer onset risk compared to rs 1020570 [ C ] individuals. Functionally, rs 1020570 [ G ] causes the 3' UTR length to be shortened by influencing the variable polyadenylation process of the target gene DNM1L, so that the half-life of the oncogene DNM1L is prolonged and the stability is increased. Thereby promoting proliferation of tumor cells. The screening flow of the pathogenic sites is shown in figure 1. Thus, the rs 1020570C > G mutation in the 3' UTR region of DNM1L gene is associated with increased risk of colorectal cancer, individuals carrying rs 1020570 [ G ] can be considered as a high risk group of colorectal cancer, and the discovery of the genetic mutation site of the risk is expected to be clinically applied to assist early diagnosis of colorectal cancer and early discovery of colorectal cancer patients.
The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.
Claims (1)
1. The application of a detection reagent of a polyadenylation functional site marker rs 1020570 related to colorectal cancer auxiliary diagnosis in preparing a colorectal cancer auxiliary diagnosis kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210776014.7A CN115820845B (en) | 2022-07-02 | 2022-07-02 | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210776014.7A CN115820845B (en) | 2022-07-02 | 2022-07-02 | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115820845A CN115820845A (en) | 2023-03-21 |
| CN115820845B true CN115820845B (en) | 2023-08-04 |
Family
ID=85522744
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210776014.7A Active CN115820845B (en) | 2022-07-02 | 2022-07-02 | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820845B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2547824A1 (en) * | 2006-06-05 | 2007-12-05 | Cancer Care Ontario | Assessment of risk for colorectal cancer |
| WO2016176446A2 (en) * | 2015-04-29 | 2016-11-03 | Geneoscopy, Llc | Colorectal cancer screening method and device |
| CN110283908B (en) * | 2019-06-04 | 2021-01-15 | 华中科技大学 | Colorectal cancer auxiliary diagnosis SNP marker and application thereof |
-
2022
- 2022-07-02 CN CN202210776014.7A patent/CN115820845B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN115820845A (en) | 2023-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | A high-risk retinoblastoma subtype with stemness features, dedifferentiated cone states and neuronal/ganglion cell gene expression | |
| US8685647B2 (en) | SNP markers associated with polycystic ovary syndrome | |
| CN110283908B (en) | Colorectal cancer auxiliary diagnosis SNP marker and application thereof | |
| KR20190025814A (en) | Detection of chromosome interactions associated with breast cancer | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN111534588B (en) | Kit and method for detecting gene mutation in acute lymphoblastic leukemia based on fluorescence quantitative PCR | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN116334223B (en) | Application of detection reagent of alternative splicing functional site rs61746794 in preparation of colorectal cancer auxiliary diagnosis kit | |
| CN115786501B (en) | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof | |
| CN106834501A (en) | To the fat related mononucleotide polymorphism site of Children in China and its application | |
| KR101206028B1 (en) | Method for diagnosing a breast cancer using a breast cancer specific polymorphic sequence, polynucleotide specific to a breast cancer and microarray immobilized with the polynucleotide | |
| CN109457031B (en) | BRCA2 gene g.32338309A & gtG mutant and application thereof in breast cancer auxiliary diagnosis | |
| CN115820845B (en) | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof | |
| CN107267611B (en) | Primer group for detecting p.Pro189Ala locus genotype and detection kit and application thereof | |
| CN106337081A (en) | Correlation of SNP site rs1054135 of FABP4 gene with triple-negative breast cancer prognosis | |
| CN111979315A (en) | Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target | |
| CN106755330B (en) | Cancer-related gene expression difference detection kit and application thereof | |
| US20180105878A1 (en) | Biomarker of detecting a biological sample, probe, kit and method of non-invasively and qualitatively determining severity of endometriosis | |
| CN103320510A (en) | Detection method and use of single nucleotide polymorphism of cattle hepatocyte growth factor (HGF) gene | |
| CN110129438B (en) | Kit for detecting endometrial cancer susceptibility related genetic molecular markers | |
| CN117106912B (en) | Enhancer RNA functional site related to colorectal cancer high-risk group identification and early screening and application thereof | |
| CN103451303B (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN110218793A (en) | A kind of SNP marker relevant to cancer of the esophagus auxiliary diagnosis | |
| CN109609503A (en) | Molecular labeling and its application of the INVS gene as pig immune trait | |
| Wang et al. | IκBα polymorphisms were associated with increased risk of gastric cancer in a southern Chinese population: A case–control study |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |