CN115786501B - Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof - Google Patents
Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof Download PDFInfo
- Publication number
- CN115786501B CN115786501B CN202210779427.0A CN202210779427A CN115786501B CN 115786501 B CN115786501 B CN 115786501B CN 202210779427 A CN202210779427 A CN 202210779427A CN 115786501 B CN115786501 B CN 115786501B
- Authority
- CN
- China
- Prior art keywords
- colorectal cancer
- risk
- enhancer
- auxiliary diagnosis
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to an enhancer function site marker related to early colorectal cancer screening and auxiliary diagnosis and application thereof, wherein the marker is rs4810856. Large-scale crowd data and biological functional experiments prove that the rs4810856 locus has enhancer function regulation activity, and individuals carrying the rs4810856[ C ] genotype are easier to combine with a transcription factor ZEB1, so that chromatin interaction of the region and a promoter of a target gene is influenced, expression levels of the target genes PREX1, CSE1L and STAU1 are promoted, cancer cell proliferation is promoted, and the risk of colorectal cancer of the individuals is increased. By means of ingenious primer and probe design aiming at rs4810856, detection of rs4810856 dangerous sites can be carried out on normal people by means of fluorescence quantitative PCR, so that high-risk people of colorectal cancer are identified, and diagnosis of colorectal cancer patients is assisted.
Description
Technical Field
The invention relates to the fields of genetic engineering and oncology medicine, in particular to an enhancer functional site related to early colorectal cancer screening and application thereof.
Background
Colorectal cancer is one of the common malignant tumors of the digestive tract, and seriously threatens the life and health of human beings. The incidence rate of the colorectal cancer is the third malignant tumor in China, and along with the development of national economic level and the change of resident life style and dietary structure, the incidence rate and the death rate of the colorectal cancer in China all show a trend of rising year by year, and the colorectal cancer becomes a major public health problem to be solved urgently in China and even worldwide. Currently, the most effective screening method for colorectal cancer is fecal occult blood examination (fit) in combination with colonoscopy. However, this method also has problems such as low detection rate and low patient acceptance. Therefore, if early screening and early diagnosis can be performed more accurately on high-risk individuals of colorectal cancer, the acceptance of patients can be made higher, and a great deal of medical expenditure can be saved for the country.
In recent years, a personalized screening scheme based on molecular genetics is an important point for screening colorectal cancer high-risk groups. Single nucleotide polymorphisms (Single Nucleotide Polymorphism, SNPs) are the most common genetic variation, a class of molecular markers that have been shown to be associated with risk of tumorigenesis, reflecting differences in genetic background of individuals. To date, GWAS have identified more than 100 colorectal cancer genetic susceptibility SNPs, of which more than 90% of the non-coding regions located in the genome can affect colorectal cancer risk by participating in gene expression regulation. While GWAS have progressed rapidly, researchers have found that many Cis-regulatory elements (Cis-Regulatory Element, CRE) such as promoters, enhancers and insulators are contained in non-coding regions with the support of genome high-throughput detection technology, and they can play a great role in gene expression regulation, thereby affecting the occurrence and susceptibility of tumors. With the rise of apparent histology and three-dimensional genomics, researchers have become more and more aware of the characteristics and mechanisms of action of CREs. For example, CREs Chang Fu were found to be concentrated in the chromatin open region by chromatin transposase accessibility sequencing (Assay for Transposase Accessible Chromatin with high-throughput sequencing, ATAC-seq) technology, and naked DNA made it more likely to bind transcription factors (Transcription Factor, TF) and thus involved in gene expression regulation. Nucleosomes near CREs were found to often have specific histone modifications, including H3K27ac, H3K27me3 and H3K4me1, by chromatin co-immunoprecipitation sequencing (Chromatin Immunoprecipitation and high-throughput sequencing, chIP-seq) techniques. These specific epigenetic markers can help predict the active status of CREs and distinguish between different CREs. Furthermore, with the continued maturation of High throughput chromatin three-dimensional conformation capture technology (High-Through Chromosome Conformation Capture, hi-C). Researchers have found that chromatin can form a circular structure through three-dimensional folding (Chromatin Looping), spatially pulling the distance between enhancers and promoters, thereby activating gene transcription.
However, how to integrate these multiple sets of chemical data efficiently, thereby finding CREs and determining their target genes across the whole genome, is always a great challenge. Recently, to optimize predictions of CREs and their target genes, researchers developed a Contact Activity Model (ABC Model) that identifies Activity enhancer elements across the genome and determines the target genes they regulate by integrating ATAC-seq and H3K27ac ChIP-seq signal peaks representing the Activity state (Activity) of the regulatory elements and Hi-C data representing chromatin Contact frequency (Contact). The ABC model is based on the simple biochemical concept that the quantitative impact of a remote candidate regulatory element on target gene expression should depend on its Activity as an enhancer, weighted by its chromatin Contact frequency (Contact) with the target gene promoter; and the relative contribution of a candidate regulatory element to the expression of a target gene depends on the quantitative effect of that element divided by the total quantitative effect of all candidate regulatory elements in the region of the target gene. The model finally obtains ABC fraction corresponding to each enhancer-target gene so as to evaluate the strength of the enhancer on the gene expression regulation effect.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide an enhancer function SNP locus marker for early colorectal cancer screening and auxiliary diagnosis and application thereof.
The technical scheme for solving the technical problems is as follows:
an enhancer function site marker associated with early screening and assisted diagnosis of colorectal cancer, which marker is rs4810856.
The specific amplification primer of the enhancer function site marker related to colorectal cancer early screening and auxiliary diagnosis is characterized in that the specific amplification primer sequence of rs4810856 is SEQ ID NO:1 and SEQ ID NO:2.
the specific probe of the enhancer function site marker related to colorectal cancer early screening and auxiliary diagnosis is characterized in that the probe sequence of rs4810856 is SEQ ID NO:3 and SEQ ID NO:4.
the detection reagent of the enhancer function site marker related to colorectal cancer early screening and auxiliary diagnosis is applied to the preparation of colorectal cancer auxiliary diagnosis kit.
An early colorectal cancer screening and auxiliary diagnosis kit is used for detecting rs4810856 in peripheral blood DNA.
The colorectal cancer early screening and auxiliary diagnosis kit comprises the specific amplification primer of the SNP marker and a specific probe of the SNP marker.
The beneficial effects of the invention are as follows: provides a technical method for screening colorectal cancer high risk groups from the molecular biology and gene diagnosis level. The method is based on the early integration of multiple groups of chemical technologies by an ABC model, and the rs4810856 locus is related to colorectal cancer susceptibility of Chinese people. Through ingenious primer and probe design aiming at the rs4810856 locus, the detection of the rs4810856 dangerous locus can be carried out on normal people by means of fluorescence quantitative PCR, so that the high-risk people of colorectal cancer are identified, early colorectal cancer screening and diagnosis are assisted.
Drawings
FIG. 1A is a flow chart for the ABC mapping method for identifying colorectal cancer susceptibility locus rs 4810856;
FIG. 2 is a schematic diagram of screening and potential regulatory effects of enhancer site rs4810856 population;
FIG. 3 is a graph of AUC of colorectal cancer risk prediction model based on SNP locus rs 4810856;
FIG. 4 is a schematic diagram of the experimental result of rs4810856 dual-luciferase reporter;
FIG. 5 is a schematic diagram of the regulation of expression levels of target genes PREX1, CSE1L and STAU1 by rs4810856 genotype;
FIG. 6 schematic representation of the single nucleotide mutation of rs4810856 in SW480 and HCT116 cells constructed by CRISPR/Cas 9;
FIG. 7 is a schematic diagram of the effect of the site rs48110856 on colorectal cancer cell proliferation capacity;
FIG. 8 is a schematic representation of the effect of overexpression of target genes PREX1, CSE1L and STAU1 on proliferation potency of colorectal cancer cell lines;
FIG. 9 is a schematic representation of the effect of target gene PREX1, CSE1L and STAU1 overexpression on subcutaneous neoplasia in nude mice.
Detailed Description
The principles and features of the present invention are described below with examples given for the purpose of illustration only and are not intended to limit the scope of the invention.
The technical scheme for solving the technical problems is as follows:
an enhancer function site marker associated with early screening and assisted diagnosis of colorectal cancer, which marker is rs4810856.
The specific amplification primer sequence of rs4810856 is SEQ ID NO:1 and SEQ ID NO:2.
the specific probe of the enhancer function site marker related to colorectal cancer early screening and auxiliary diagnosis, and the probe sequence of rs4810856 is SEQ ID NO:3 and SEQ ID NO:4.
the detection reagent of the enhancer function site marker related to colorectal cancer early screening and auxiliary diagnosis is applied to the preparation of colorectal cancer auxiliary diagnosis kits.
An early colorectal cancer screening and auxiliary diagnosis kit is used for detecting rs4810856 in peripheral blood DNA.
The kit comprises the specific amplification primer of the SNP marker and the specific probe of the SNP marker.
Specifically, the technical scheme for solving the problems of the invention comprises the following steps: (1) establishing a unified standard specimen library and database: standard-compliant subject blood samples were collected with standard procedures (SOP) and the system collected complete demographic and clinical data. (2) genotype detection: and selecting colorectal cancer cases and healthy controls, combining multiple genealogy such as ATAC-seq, CHIP-seq, RNA-se, hi-C and the like by using an ABC model, more accurately finding the SNP marker rs4810856 (3) related to colorectal cancer pathogenesis, and verifying the screened positive association marker in independent large crowd samples to judge the association stability. (4) development of colorectal cancer auxiliary diagnosis kit: early screening and auxiliary diagnosis kit is developed according to genetic markers with obvious differences in genotype distribution frequency in colorectal cancer cases and healthy controls.
In particular, the experimental method of the invention mainly comprises the following steps:
first, we collected 10 fresh colorectal cancer tissue samples from the affiliated homozygous hospital of the university of science and technology in China, which were surgically resected from colorectal cancer. 10 samples were each subjected to ATAC-seq, H3K27ac ChIP-seq and RNA-seq experiments. We integrated ATAC-seq, H3K27acChIP-seq, RNA-seq and Hi-C sets of data using the ABC model system, hi-C experimental data were obtained from the download of the ENCODE database, comprehensively considering the effect of enhancer activity and chromatin interaction with the target gene promoter on gene expression, and further identifying enhancer elements and their regulated target genes across the whole genome, and drawing an enhancer-target gene mapping map. The ABC score is more than or equal to 0.02 as a significance threshold, 26,877 significant ABC enhancer SNPs sites are identified in total, and the specific flow is shown in figure 1.
Next, we downloaded three colorectal cancer GWAS datasets from the dbGaP database for the european population, which combined data contained a total of 17,789 colorectal cancer cases and 19,951 control samples. The basic demographic characteristics are shown in table 1. Based on an unconditional Logistic regression model, and after correction for age and sex confounding factors, we calculated the association of the identified ABC enhancer SNPs with colorectal cancer susceptibility and thus drawn a manhattan plot, the results of which are shown in figure 2, panel a. During the calculation we identified 4,847 ABC enhancer SNPs associated with colorectal cancer risk altogether with P values < 0.05 as significance threshold. Among them, we send outNow the enhancer region where rs4810856 is: chr20:48682097-48683408 has the strongest gene expression regulation effect, and can regulate three target genes simultaneously: PREX1, CSE1L and STAU1, the results are shown in fig. 2B. Case control study results show that individuals carrying the rs4810856 risk genotype have a disease risk of colorectal cancer increased by 4% in the european population sample (or=1.04, 95% ci:1.01-1.08, p=3.68×10) compared to normal individuals, respectively -5 )。
TABLE 1 basic data for colorectal cancer patients and normal controls in European and Chinese populations employed in the study
TABLE 2 European crowd sample rs4810856 colorectal cancer risk correlation analysis results
Meanwhile, 6,024 colorectal cancer patients with complete medical history data and 10,022 normal controls without tumor history were recruited from two areas of Beijing and Wuhan in China, and these individuals were genotyped. The patient is subjected to histopathological diagnosis without age limitation; normal controls had no history of tumor and no signs of tumor upon physical examination. And information of sex, age, smoking, drinking and the like of the study subjects is collected. Each subject informed consent was given to the study and 2ml of peripheral venous blood was donated for isolation of lymphocyte genomic DNA. The basic demographic characteristics are shown in table 1.
The crowd samples recruited in two places are used for two-stage crowd verification, the correlation of SNP locus rs4810856 and colorectal cancer susceptibility is calculated for the two-stage crowd samples by applying an unconditional logistic regression model, and gender, age, smoking and drinking conditions are corrected. Analysis results of two-stage case control of Chinese crowd show that rs4810856[ C ] is carried]Individuals of risk genotype have an increased risk of colorectal cancer of 30% and 14%, respectively (or=1.30，95％CI:1.12-1.49，P＝2.72×10 -4 ；OR＝1.14，95％CI:1.05-1.22，P＝3.76×10 -4 ). To enhance the test efficacy of the case control study, two-stage samples were pooled and rs4810856 was tested for association with colorectal cancer susceptibility. The results of the case control research of Chinese population are consistent with the results of the colorectal cancer sample of European population, and rs4810856[ C ] is carried]Individuals of risk genotype are at 16% increased risk of developing colorectal cancer (or=1.16, 95% ci:1.10-1.23, p=9.74×10 -7 ) The detailed results are shown in Table 3.
TABLE 3 analysis results of risk correlation of rs4810856 colorectal cancer in Chinese crowd samples
* And (5) calculating by using a Logistic regression model, and correcting gender, age, smoking and drinking conditions.
The early large sample crowd association analysis result shows that the site is colorectal cancer risk site, so that we use the risk SNP site to build a colorectal cancer risk prediction model. A formula is constructed, and three genotypes and sexes of SNP, age, smoking and drinking conditions are comprehensively considered. Wherein, for SNP genotyping, wild homozygous= "1", heterozygous= "2", mutant homozygous= "3"; for gender, male is "1" and female is "0"; for age, greater than or equal to 60 years old is "1", less than 60 years old is "0". In the analysis, a multi-factor logistic regression coefficient beta is taken as a weight, and a formula for obtaining the rs 4810856-based typing risk score is as follows:
chinese population risk score = (0.1064 x gender score) + (0.0121 x age score) + (0.2015 x smoking score) + (0.1129 x drinking score) + (0.0648 x rs8100241 score).
European population risk score= (-0.1889 x sex score) +(-0.0296 x age score) +(-0.0437 x rs8100241 score)
By plotting the AUC curve, the area under the model curve was 0.591 and 0.561 for european and chinese populations, respectively, and the results are shown in fig. 3.
In order to functionally analyze colorectal cancer risk association of the rs4810856 marker, the action mechanism of the SNP locus on colorectal cancer occurrence and development is explored.
First, we verified the enhancer function regulatory function of the region where rs4810856 is located through a reporter gene test. DNA fragments containing different alleles of rs4810856 are constructed in the forward direction or the reverse direction on a reporter gene plasmid vector, and respectively co-transfect SW480 and HCT116 two human colorectal cancer cell lines with an internal control plasmid pRL-SV40, and then the expression condition of double luciferase genes is detected, and the relative luciferase activity difference among different groups is compared. The reporter gene activity of the recombinant plasmid containing rs4810856[ C ] allele is obviously higher than that of pGL3-Promoter empty vector no matter the insertion direction of the DNA fragment, which shows that the DNA fragment with the target site has enhancer activity. Compared with the rs4810856[ C ] genotype group, the reporter gene activity of the rs4810856[ T ] genotype group is obviously reduced. The experimental result shows that the region of rs4810856 has enhancer activity, and the enhancer of the site rs4810856[ C ] has stronger transcriptional activation effect than that of rs4810856[ T ], and the result is shown in FIG. 4. The eQTL analysis results show that the rs4810856 locus with enhancer activity is closely related to the expression levels of target genes PREX1, CSE1L and STAU1 in CRC tissues of a crowd sample, and the results are shown in FIG. 5.
In order to deeply explore the influence of rs4810856 single-base gene editing and target genes on colorectal cancer cell proliferation, experiments such as cell proliferation experiments, clone formation experiments and in-vivo nude mice subcutaneous tumor formation are respectively carried out. In a cell proliferation experiment, a CRISPR/Cas9 is used for constructing an rs4810856 mononucleotide mutant cell line in SW480 and HCT116 cells as an experimental model, the influence of an rs4810856 site on the malignant phenotype of colorectal cancer cells is studied, and the construction process is shown in figure 6. The cell proliferation capacity of the cell line carrying rs4810856[ C ] is significantly greater than that of the rs4810856[ T ] cell line, and the results are shown in FIG. 7. Then, we used stable transgenic cell lines of pre 1, CSE1L and STAU1 over-expression and combined over-expression respectively as experimental models to detect the effect of target genes on colorectal cancer cell proliferation capacity. Experiments show that compared with the cells in the blank control group, the clone forming ability of the cell line with the target genes over-expressed respectively is obviously enhanced, and the clone forming ability of the cell line with the target genes combined over-expressed is strongest, and the result is shown in figure 8. In vivo nude mice subcutaneous tumor experiments, we injected the nude mice subcutaneously with a stable cell line, periodically measured the size of subcutaneous tumor-bearing volumes of nude mice between different groups, and plotted subcutaneous tumor growth curves. We found that the volume of subcutaneous tumor was significantly increased in nude mice injected with PREX1, CSE1L and STAU1 over-expressing cell lines, respectively, compared to nude mice injected with the blank cell line, whereas the volume of subcutaneous tumor was maximized in nude mice injected with the target gene in combination with the over-expressing cell line, as shown in fig. 9. The cell phenotype and the in-vivo nude mouse subcutaneous tumor experimental result show that the PREX1, the CSE1L and the STAU1 can exert a certain synergistic effect to promote proliferation of colorectal cancer cells.
Combining the large-scale crowd analysis, bioinformatics analysis and strict experimental design, the result shows that the rs4810856 risk site located in the 20q13.13 enhancer region of the chromatin leads to a significant increase in colorectal cancer disease risk for individuals carrying [ C ] allelic variation relative to individuals carrying rs4810856[ T ]. The action mechanism is that the binding capacity of rs4810856 and a transcription factor ZEB1 is influenced, so that the chromatin interaction between the region where the rs4810856 is located and a promoter of a target gene is inhibited, the expression level of target genes PREX1, CSE1L and STAU1 is further reduced, the activation of AKT signal paths is inhibited, and the incidence risk of colorectal cancer is reduced. Therefore, the rs4810856 risk site positioned in the non-coding region has close relation with the colorectal cancer disease risk, is expected to be clinically applied to assist early diagnosis of colorectal cancer, and early-discovered colorectal cancer high-risk groups.
The experimental method comprises the following steps:
1. peripheral blood DNA extraction:
the DNA is extracted by a conventional phenol-chloroform method, and the specific steps are as follows:
1) About 3ml of anticoagulated blood was centrifuged at 5,000Xg for 15min at room temperature, and the upper layer was discarded, leaving about 0.3ml of blood cells. 0.5ml of freshly prepared extraction buffer with a final concentration of 20. Mu.g/ml RNase was added and incubated at 37℃for 1h after mixing.
2) Proteinase K was added at a final concentration of 100. Mu.g/ml and incubated overnight at 37℃after mixing.
3) 0.7ml of Tris buffer equilibrated phenol (ph=7.0) was added to each tube, thoroughly mixed, and centrifuged at 8,000Xg for 15min at room temperature.
4) Transferring the upper liquid into another 1.5ml centrifuge tube, adding 0.7ml of equal volume phenol-chloroform (1:1), and mixing thoroughly for 15min; centrifuge at 8,000Xg for 15min at room temperature.
5) The supernatant was transferred to another clean 1.5ml centrifuge tube, 10% by volume of 10M ammonium acetate solution was added, 2 volumes of pre-chilled absolute ethanol was added, and the mixture was allowed to stand at-20℃for 2 hours to precipitate DNA.
6) Washing the precipitated DNA with 75% ethanol, centrifuging at 12,000Xg for 15min, and discarding the upper layer liquid; the supernatant was discarded after centrifugation at 12,000Xg for 15min with 75% ethanol.
7) The tubes were inverted over absorbent paper, and after ethanol was evaporated, appropriate TE buffer was added to each tube, and stored at-20℃for one week at 4 ℃.
2. Genotyping
The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system,Applied Biosystems), and a 5. Mu.l PCR reaction system is shown in Table 4:
TABLE 4 TaqMan genotyping System formulation
The reaction conditions are as follows: pre-denaturation at 95℃for 10min, followed by 45 cycles of 15sec at 95℃and 1min at 60℃and cooling to 4 ℃.
The primers and probes used for the reaction were as follows:
rs4810856 primer:
forward primer: caatacctctcattagttatgcctaagc (SEQ ID NO: 1)
Reverse primer: cagggaggagtctggtattttttaata (SEQ ID NO: 2)
rs4810856 probe:
forward probe: fam-acctaccatctttc-mgb (SEQ ID NO: 3)
Reverse probe: vic-acctaccacctttc-mgb (SEQ ID NO: 4)
3. Cell proliferation assay
1) Cell count
Before CCK-8 proliferation and clonogenic experiments, cell counting is required to ensure that appropriate numbers of cells are seeded in different groups of well plates. The experiment was performed using a blood cell counting plate consisting of two equally sized cells, each cell consisting of nine 1mm x 1mm squares, each square containing a 0.1mm3 volume of liquid. The specific counting steps are as follows:
(1) and (3) digesting the cell pore plate after being cultured for a period of time to obtain a cell suspension, and uniformly mixing and scattering the cells as much as possible.
(2) The counting plate is sterilized and then covered with a cover glass.
(3) 10mL of the cell suspension is sucked up, and the cell suspension is slowly dripped into the counting plate along the edge of the glass slide, so that no bubbles are generated between the cover glass and the counting plate).
(4) The plate was left to stand for 1min, and the square at the four corners was counted under a microscope as follows: a. for cells pressed against the square edges, only the upper and left cells are counted, b. If the cells are clumped, they are counted as one cell.
(5) Cell suspension concentration = total number of cells in square/4 x 104 cells/mL.
2) CCK-8 cell proliferation assay
The present study uses CCK-8 kit (Dojindo, japan) to examine colorectal cancer cell proliferation capacity.
(1) 100mL of the cell suspension was aspirated and diluted to a cell size of about 2,000 at the concentration counted, and inoculated into a 96-well plate.
(2) Cell activity assays were performed at four time points, 24h, 48h, 72h and 96 h. 10mL of CCK-8 reagent is added into each well, and the mixture is shaken up and down and left and right to be gently mixed, and the mixture is put back into a cell culture box for further culture for 1.5 hours.
(3) Absorbance measurement was performed using a microplate reader, the wavelength was set at 450nm, and cell proliferation curves of different experimental groups were plotted according to absorbance values at four time points to compare differences.
3) Cloning formation experiments
(1) After 36h of transfection of cells, cell counts were performed and diluted to appropriate concentrations. 2mL of the cell suspension was added to each well of the 6-well plate to give a cell amount of about 1,000, and the culture was continued for about 2 weeks.
(2) During which the cell morphology was observed every 2-3 days and fresh medium was changed. If cell clones are observed under a microscope, a fixation stain may be performed.
(3) The 6-well plate was removed from the incubator, the waste liquid was aspirated and slowly washed 2 times with PBS. After each well of PBS was blotted, 2mL of methanol solution was added and left at room temperature for 30min.
(4) After methanol was removed by suction, a 0.25% crystal violet solution was added and the mixture was left in the dark for 30min to dye.
(5) After the dyeing is finished, waste liquid in the hole is sucked, the hole plate is washed by double distilled water until the visual field is clear, and photographing and storage are carried out.
In summary, we constructed colorectal cancer enhancer-target gene mapping profiles by using the ABC model, systematically integrating multiple sets of data including ATAC-seq, CHIP-seq, RNA-seq, and Hi-C. Furthermore, the technical methods of case control research, biological experiments and the like of large samples of European population and Chinese population are combined. Rs4810856 in the 20q13.13 region was found to have the strongest gene expression regulatory effect, with a significantly increased risk of colorectal cancer in individuals carrying the [ C ] allele compared to rs4810856[ T ] individuals. Mechanically, we found that rs4810856 located in the 20q13.13 region of chromatin can regulate three target genes simultaneously: PREX1, CSE1L and STAU1. And the binding capacity of rs4810856[ C ] and the transcription factor ZEB1 is stronger than that of rs4810856[ T ] carrier, so that the chromatin interaction of the region where the rs4810856[ C ] and the transcription factor ZEB1 are located with the promoter of the target gene is influenced, the expression level of the target genes PREX1, CSE1L and STAU1 is further promoted, the activation of AKT signal paths is also influenced, and the incidence risk of colorectal cancer is further promoted. Therefore, the rs4810856 mutation in the non-coding region has close relation with the colorectal cancer disease risk, is expected to be clinically applied to assist early diagnosis of colorectal cancer and early discovery of colorectal cancer patients.
The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.
Claims (1)
1. Application of a detection reagent of enhancer functional site rs4810856 in preparing colorectal cancer auxiliary diagnosis kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210779427.0A CN115786501B (en) | 2022-07-02 | 2022-07-02 | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210779427.0A CN115786501B (en) | 2022-07-02 | 2022-07-02 | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115786501A CN115786501A (en) | 2023-03-14 |
| CN115786501B true CN115786501B (en) | 2023-06-16 |
Family
ID=85431305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210779427.0A Active CN115786501B (en) | 2022-07-02 | 2022-07-02 | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115786501B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106912B (en) * | 2023-08-21 | 2024-02-02 | 武汉大学 | Enhancer RNA functional site related to colorectal cancer high-risk group identification and early screening and application thereof |
Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005304497A (en) * | 2004-03-25 | 2005-11-04 | Joji Inasawa | Method for detecting cancer using specified cancer-related gene and method for inhibiting the cancer |
| WO2006138275A2 (en) * | 2005-06-13 | 2006-12-28 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| WO2009055011A1 (en) * | 2007-10-26 | 2009-04-30 | Ludwig Institute For Cancer Research Ltd. | Enhancer signatures in the prognosis and diagnosis of cancers and other disorders |
| CN102084000A (en) * | 2008-02-01 | 2011-06-01 | 总医院有限公司 | Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions |
| CA3012783A1 (en) * | 2016-01-28 | 2017-08-03 | The University Of Melbourne | Methods for assessing risk of developing colorectal cancer |
| CN107254531A (en) * | 2017-06-28 | 2017-10-17 | 南京医科大学 | The genetic biomarkers thing of early onset colorectal cancer auxiliary diagnosis and its application |
| CN108220394A (en) * | 2018-01-05 | 2018-06-29 | 清华大学 | Identification method, system and its application of gene regulation sex chromatin interaction |
| WO2018146033A1 (en) * | 2017-02-07 | 2018-08-16 | F. Hoffmann-La Roche Ag | Non-invasive test to predict recurrence of colorectal cancer |
| CN110283908A (en) * | 2019-06-04 | 2019-09-27 | 华中科技大学 | A kind of colorectal cancer auxiliary diagnosis SNP marker and its application |
| CN110592213A (en) * | 2019-09-02 | 2019-12-20 | 深圳市新合生物医疗科技有限公司 | Gene panel for prediction of neoantigen load and detection of genomic mutations |
| WO2020257353A1 (en) * | 2019-06-17 | 2020-12-24 | The Board Of Trustees Of The Leland Stanford Junior University | Diagnostics and treatments based upon molecular characterization of colorectal cancer |
| KR20210066635A (en) * | 2019-11-28 | 2021-06-07 | 의료법인 성광의료재단 | Compositions, kits and methods for diagnosing cancer resistant to cancer therapeutics |
| WO2022135552A1 (en) * | 2020-12-25 | 2022-06-30 | 上海善准生物科技有限公司 | Colorectal cancer molecular typing and survival risk factor gene cluster, diagnostic product, and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080032943A1 (en) * | 2005-11-04 | 2008-02-07 | Johji Inazawa | Method for detecting cancer and a method for suppressing cancer |
| US8492096B2 (en) * | 2008-12-24 | 2013-07-23 | Boris Pasche | TGFBR1 expression modifies risk for colorectal cancer |
-
2022
- 2022-07-02 CN CN202210779427.0A patent/CN115786501B/en active Active
Patent Citations (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005304497A (en) * | 2004-03-25 | 2005-11-04 | Joji Inasawa | Method for detecting cancer using specified cancer-related gene and method for inhibiting the cancer |
| WO2006138275A2 (en) * | 2005-06-13 | 2006-12-28 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| WO2009055011A1 (en) * | 2007-10-26 | 2009-04-30 | Ludwig Institute For Cancer Research Ltd. | Enhancer signatures in the prognosis and diagnosis of cancers and other disorders |
| CN102084000A (en) * | 2008-02-01 | 2011-06-01 | 总医院有限公司 | Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions |
| CA3012783A1 (en) * | 2016-01-28 | 2017-08-03 | The University Of Melbourne | Methods for assessing risk of developing colorectal cancer |
| WO2018146033A1 (en) * | 2017-02-07 | 2018-08-16 | F. Hoffmann-La Roche Ag | Non-invasive test to predict recurrence of colorectal cancer |
| CN107254531A (en) * | 2017-06-28 | 2017-10-17 | 南京医科大学 | The genetic biomarkers thing of early onset colorectal cancer auxiliary diagnosis and its application |
| CN108220394A (en) * | 2018-01-05 | 2018-06-29 | 清华大学 | Identification method, system and its application of gene regulation sex chromatin interaction |
| CN110283908A (en) * | 2019-06-04 | 2019-09-27 | 华中科技大学 | A kind of colorectal cancer auxiliary diagnosis SNP marker and its application |
| WO2020257353A1 (en) * | 2019-06-17 | 2020-12-24 | The Board Of Trustees Of The Leland Stanford Junior University | Diagnostics and treatments based upon molecular characterization of colorectal cancer |
| CN110592213A (en) * | 2019-09-02 | 2019-12-20 | 深圳市新合生物医疗科技有限公司 | Gene panel for prediction of neoantigen load and detection of genomic mutations |
| KR20210066635A (en) * | 2019-11-28 | 2021-06-07 | 의료법인 성광의료재단 | Compositions, kits and methods for diagnosing cancer resistant to cancer therapeutics |
| WO2022135552A1 (en) * | 2020-12-25 | 2022-06-30 | 上海善准生物科技有限公司 | Colorectal cancer molecular typing and survival risk factor gene cluster, diagnostic product, and application |
Non-Patent Citations (1)
| Title |
|---|
| 肠内营养剂对结直肠癌患者术后体征及并发症的影响;朱颖;《结直肠肛门外科》;第429-434页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115786501A (en) | 2023-03-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Deelen et al. | A meta-analysis of genome-wide association studies identifies multiple longevity genes | |
| Heap et al. | Complex nature of SNP genotype effects on gene expression in primary human leucocytes | |
| KR20180039629A (en) | Detection of chromosomal interactions | |
| Murphy et al. | Integrated analysis of the genomic instability of PTEN in clinically insignificant and significant prostate cancer | |
| Hingorani et al. | Current state of pediatric sarcoma biology and opportunities for future discovery: A report from the sarcoma translational research workshop | |
| US20200377932A1 (en) | Ddx24 mutations and use thereof | |
| CN110283908B (en) | Colorectal cancer auxiliary diagnosis SNP marker and application thereof | |
| Blein et al. | An original phylogenetic approach identified mitochondrial haplogroup T1a1 as inversely associated with breast cancer risk in BRCA2 mutation carriers | |
| Schadt | Exploiting naturally occurring DNA variation and molecular profiling data to dissect disease and drug response traits | |
| CN115786501B (en) | Enhancer functional site related to colorectal cancer early screening and auxiliary diagnosis and application thereof | |
| CN116334223B (en) | Application of detection reagent of alternative splicing functional site rs61746794 in preparation of colorectal cancer auxiliary diagnosis kit | |
| Lu et al. | Association analysis of variants of DSCAM and BACE2 with Hirschsprung disease susceptibility in Han Chinese and functional evaluation in zebrafish | |
| CN106676183A (en) | ZFHX4 as biomarker for prognosis of esophagus cancer | |
| Brant et al. | Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain | |
| Thompson et al. | p53 transcriptional pathways in breast cancer: the good, the bad and the complex | |
| Hong et al. | Molecular landscape of pediatric type IDH wildtype, H3 wildtype hemispheric glioblastomas | |
| CN106337058B (en) | CRYL1-IFT88 fusion gene and application thereof in diagnosis and treatment of primary hepatocellular carcinoma | |
| Chen et al. | cDNA microarray analysis and immunohistochemistry reveal a distinct molecular phenotype in serous endometrial cancer compared to endometrioid endometrial cancer | |
| Pei et al. | Contribution of cyclin-dependent kinase inhibitor 1B genotypes to childhood leukemia risk | |
| Zheng et al. | Lack of associations between XPC gene polymorphisms and neuroblastoma susceptibility in a Chinese population | |
| CN117106912B (en) | Enhancer RNA functional site related to colorectal cancer high-risk group identification and early screening and application thereof | |
| CN104212884B (en) | Pancreatic Neuroendocrine Tumors tumor susceptibility gene site and detection method and test kit | |
| CN115820845B (en) | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof | |
| CN108441560B (en) | SNP marker located in CEP128 gene and related to radioactive brain injury caused by radiotherapy and application thereof | |
| Zheng et al. | Association between miR-492 rs2289030 G> C and susceptibility to Hirschsprung disease in southern Chinese children |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |