CN114990142B - FYCO1-ALK fusion gene, detection kit and application thereof - Google Patents

Abstract

The invention relates to a non-small cell lung cancer FYCO1-ALK fusion gene, a detection kit and application thereof, wherein the fusion partner gene of the ALK gene is the FYCO1 gene, and the gene fusion mutation occurs between the No. 12 exon of the FYCO1 gene and the No. 20 exon of the ALK gene; the FYCO1-ALK fusion gene has a sequence shown in SEQ ID NO. 1. Wherein the FYCO1 gene is located on chromosome 3 3p21.31, at position 45917903-45995824, for a total of 23 exons. The ALK gene is located on chromosome 2 2p23.2-p23.1, at position 29190992-29921589, for a total of 29 exons. The invention discovers a novel fusion partner of ALK gene by a high-throughput sequencing technology, designs a specific FYCO1-ALK fusion gene, an upstream primer and a downstream primer of an internal reference HPRT1 gene and a Taqman probe, and has the advantages of high accuracy, good specificity, simple and convenient operation, rapid detection and the like.

Description

FYCO1-ALK fusion gene, detection kit and application thereof

Technical Field

The invention relates to a non-small cell lung cancer FYCO1-ALK fusion gene, a detection kit and application thereof, and belongs to the field of biomedical detection.

Background

Lung cancer is the malignant tumor with highest morbidity and mortality in China, wherein Non-small cell lung cancer (Non-Small Cell Lung Cancer, NSCLC) is one of the most common types of lung cancer, about 50% of NSCLC has targeted drug-related gene mutation, and most common are point mutation of 18 exons and deletion mutation of 19 exons of epidermal growth factor receptor (Epidermal Growth Factor Receptor, EGFR) gene and fusion mutation of anaplastic lymphoma kinase (Anaplastic Lymphoma Kinase, ALK) gene. The targeted drug has the characteristics of small side effect and good effect, can obviously improve the life quality and the survival time of patients, especially ALK gene fusion mutation patients, and the progression-free survival time (PFS) of diseases can reach 3-5 years after the targeted drug is taken. Therefore, how to rapidly and accurately detect ALK gene fusion mutation is very important for the treatment and survival of patients.

The ALK gene expressed protein is located on the cell membrane and is divided into an extracellular receptor region, a transmembrane region and an intracellular kinase region, and 2 ALK proteins are coupled through extracellular ligands under normal conditions to activate intracellular signal paths and promote cell growth. When ALK gene is fused, ligand is not needed, the ALK protein intracellular tyrosine kinase can be automatically activated, so that abnormal expression of the protein of the structural domain is caused, ALK and a downstream signal transmission channel thereof are activated, and further cell proliferation is promoted to form tumors in an uncontrolled manner. 80% of fusion partner genes of ALK genes are EML4, and new fusion genes KIF5B, TGF, KLC1, PTPN3, STRN and the like are continuously discovered in recent years through a second-generation sequencing technology.

The FYCO1 gene is located on chromosome 3, has the length of 79kb and contains 18 exons, encodes 1478 amino acids, has the relative molecular mass of 167 000 Da, is expressed in various tissues, and has been shown to be the main cause of autosomal recessive hereditary cataract.

Detection of the ALK gene partial fusion mutation type can be achieved by conventional detection methods such as Immunohistochemistry (IHC), fluorescence in situ hybridization (Fluorescence in situ hybridization, FISH), reverse transcription polymerase chain reaction (RT-PCR) and the like. But IHC detection method has poor specificity; the FISH method is used for detecting ALK, so that the sensitivity is low; RT-PCR can only detect the known ALK fusion gene. At present, high-throughput sequencing is the only detection method capable of definitely unknown fusion mutation, but the technology is high in cost and long in detection period, has severe requirements on equipment and laboratory areas, is only developed in a few large comprehensive hospitals at present, and is not the preferred detection method for most patients.

The method is a most convenient and economical method for detecting the fusion mutation of the genes by designing a specific PCR primer combination aiming at the known fusion site and utilizing a fluorescent quantitative PCR technology. Therefore, new pathogenic fusion sites are found, and further, the design of PCR primers and probes is beneficial to improving the detection range and level of fusion mutation of lung cancer ALK gene, so that more patients benefit.

Disclosure of Invention

In view of the shortcomings of the prior art, a first object of the present invention is to provide a novel fusion gene FYCO1-ALK for non-small cell lung cancer.

The second object of the invention is to provide the application of fusion gene FYCO1-ALK in the treatment of non-small cell lung cancer.

The third object of the invention is to provide a detection kit for detecting FYCO1-ALK fusion genes.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

an FYCO1-ALK fusion gene, wherein the fusion partner gene of the ALK gene is the FYCO1 gene, and the gene fusion mutation occurs between the exon 12 of the FYCO1 gene and the exon 20 of the ALK gene; the FYCO1-ALK fusion gene has a sequence shown in SEQ ID NO. 1.

The FYCO1 gene is located on chromosome 3 3p21.31, position 45917903-45995824, for a total of 23 exons.

The ALK gene is located on chromosome 2 2p23.2-p23.1, at position 29190992-29921589, for a total of 29 exons.

A composition for detecting the FYCO1-ALK fusion gene, comprising an FYCO1-ALK fusion gene, an upstream primer, a downstream primer and a probe sequence of an internal reference HPRT1 gene, specifically as follows:

the upstream primer FYCO1-E12-F: AAGCGGGAGTTCAGCTGGATGG; (SEQ ID NO. 2);

downstream primer ALK-E20-R: CTCCATCTGCATGGCTTGCAGC (SEQ ID NO. 3);

probe FYCO1-ALK-Probe: FAM-5-CCGGAAGCACCAGGA-3-MGB (SEQ ID NO. 4);

the upstream primer HPRT1-F:5-CAGGCAGTATAATCCAAAGATGGTCA-3 (SEQ ID NO. 5);

downstream primer HPRT1-R:5-GTCTGGCTTATATCCAACACTTCGT-3 (SEQ ID NO. 6);

probe HPRT 1-Probe: VIC-5-TCACCAGCAAGCTT-3-MGB (SEQ ID NO. 7).

A kit for detecting the FYCO1-ALK fusion gene, comprising the following components:

PCR reaction solution (1): the composition, magnesium ions, dNTPs and deionized water;

PCR reaction solution (2): PCR buffer;

PCR mixing enzyme: tap enzyme, reverse transcriptase, UDG enzyme;

positive control: plasmid of FYCO1-ALK fusion gene and plasmid of HPRT1 gene;

negative control: deionized water.

A method for detecting FYCO1-ALK fusion genes for non-diagnostic and therapeutic purposes comprising the steps of:

(1) Extracting RNA of a sample to be detected;

(2) Using the kit to perform fluorescent quantitative PCR reaction;

(3) And judging a detection result according to the PCR amplification result.

The reaction system of the fluorescent quantitative PCR is as follows: PCR reaction solution (1): the concentration of each primer and probe was 10 pmol, the upstream primer was 1.0. Mu.L, the downstream primer was 1.0. Mu.L, the probe was 0.7. Mu.L, 25mM magnesium ion was 0.5. Mu.L, 25mM dNTP was 0.3. Mu.L, deionized water was 30.5. Mu.L, and 34. Mu.L;

PCR reaction solution (2): 5 XPCR buffer 10. Mu.L;

PCR mixing enzyme: 5U/. Mu.L of Tapzyme 0.5. Mu.L, 5U/. Mu.L of reverse transcriptase 0.2. Mu.L, 5U/. Mu.L of UDG enzyme 0.3. Mu.L, 1. Mu.L in total;

positive control: 10 ng/. Mu.L of FYCO1-ALK fusion gene plasmid, 10 ng/. Mu.L of HPRT1 gene plasmid, 5. Mu.L in total;

negative control: deionized water 5. Mu.L.

The amplification procedure of the fluorescent quantitative PCR is as follows: the first stage: 42 ℃, 5min,95 ℃ and 5min; and a second stage: 95 ℃,25 s,64 ℃, 20s,72 ℃, 20s, 10 cycles; and a third stage: 93 ℃,25 s,60 ℃, 35 s,72 ℃, 20s, 36 cycles; signal collection: FAM and VIC fluorescence signals were collected at 60℃in the third stage.

The judging method of the detection result comprises the following steps:

the FAM and VIC fluorescence signals of the positive control have amplification curves raised, ct values are all less than 26, and the FAM and VIC fluorescence signals of the negative control have no amplification curves raised; if the positive control or negative control result is abnormal, detecting an experimental instrument and experimental conditions, and re-detecting after solving the problems;

if the VIC fluorescent signal of the sample to be detected has an amplification curve rising, and the Ct value is less than or equal to 27; the FAM fluorescent signal has an amplification curve rising, and the Ct value is less than or equal to 27, so that the sample to be detected has mutation of FYCO1-ALK fusion gene;

if the Ct value of the FAM fluorescence signal of the sample to be detected is more than 27, the sample to be detected does not contain FYCO1-ALK fusion genes or is lower than the detection lower limit;

if the Ct value of the VIC fluorescent signal of the sample to be detected is more than 27, re-extracting RNA and detecting.

The FYCO1-ALK fusion gene is applied to the treatment of non-small cell lung cancer.

The invention has the beneficial effects that:

the research team finds that ALK protein expression of one NSCLC patient is positive when conventional pathological detection is carried out on the patient, but EML4-ALK fusion gene mutation is not detected by a fluorescent quantitative PCR technology, and then the patient is found to be FYCO1-ALK fusion mutation by a second generation sequencing technology (figure 1), and the NSCLC with the fusion gene mutation has no literature report in the world.

The invention discovers a novel fusion partner of ALK gene by a high-throughput sequencing technology, designs a specific FYCO1-ALK fusion gene, an upstream primer and a downstream primer of an internal reference HPRT1 gene and a Taqman probe, and has the advantages of high accuracy, good specificity, simple and convenient operation, rapid detection and the like.

The invention provides a novel ALK fusion gene locus, increases the detection proportion of ALK gene fusion positive patients of non-small cell lung cancer, increases the possibility of using targeted drugs for the patients of the non-small cell lung cancer, and is greatly helpful for the treatment scheme and the life quality of the patients.

Drawings

Fig. 1: second generation sequencing results of FYCO1-ALK fusion gene in example 1.

In the figure, the green letter is "A", the blue letter is "C", the brown letter is "G", and the red letter is "T".

Fig. 2: fluorescent quantitative PCR results for the samples tested in example 3.

Fig. 3: the first generation sequencing result of the FYCO1-ALK fusion gene of the sample to be tested in example 3.

In the figure, the green letter is "A", the purple letter is "C", the black letter is "G", and the red letter is "T".

Fig. 4: CT contrast images of patients with samples to be tested before and after treatment with targeted drugs in example 3.

Wherein A is before treatment; b is after treatment.

Detailed Description

The following describes the embodiments of the present invention in further detail with reference to examples. In the embodiment, unless otherwise specified, the instruments and equipment involved are conventional instruments and equipment; the related reagents are all conventional reagents sold in the market; the related test methods are all conventional methods.

Example 1 FYCO1-ALK fusion Gene

The DNA and RNA extracted from the tumor tissue of a patient are sequenced by utilizing a second generation sequencing technology, EGFR, ALK, ROS and other genes are detected, bioinformatics analysis is carried out on sequencing data, novel fusion genes of FYCO1-ALK which are not reported in the literature at home and abroad are found, the analysis result is shown in figure 1, and a plurality of sequencing data show that the FYCO1 genes and the ALK genes are spliced and fused.

The FYCO1-ALK novel fusion gene occurs between exon 12 of the FYCO1 gene and exon 20 of the ALK gene;

the FYCO1 gene is located on the 3 rd chromosome 3p21.31 short arm, position 45917903-45995824, the sequence is from GeneBank, sequence version number grch38.p13 (gcf_ 000001405.39), a total of 23 exons;

the ALK gene is located on chromosome 2 2p23.2-p23.1, position 29190992-29921589, the sequence is from GeneBank, sequence version number GRCh38.p13 (GCF_ 000001405.39), 29 exons total.

The specific sequence of the FYCO1-ALK fusion gene is shown in SEQ ID NO. 1: GGACAAGGATGCTCTCTGGCAGAAGTCAGATGCCCTGGAATTCCAGCAGAAGCTCAGTGCTGAGGAGAGATGGCTCGGAGACACAGAGGCAAACCACTGCCTCGACTGTAAGCGGGAGTTCAGCTGGATGGTGCGGCGGCACCACTGCAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGCTTTGCTGGCAAGACCTCCTCCATCAGTGACCTGAAGGAGGTGCCGCGGAAAAACATCACCCTCATTCG (SEQ ID NO. 1).

Example 2 preparation of FYCO1-ALK fusion Gene detection kit

Specific primers and probes of the FYCO1-ALK fusion gene and the internal reference HPRT1 gene are designed according to the gene sequences provided by the national center for biotechnology information of the national library of medical science.

Primer design principle: the primer is preferably designed in a conserved region of the template cDNA, the length of the primer is between 15bp and 30bp, the GC content of the primer is between 40% and 60%, the annealing temperature is preferably close to 72 ℃, no complementary sequence exists between the primer and the primer, and the amplified band is single-specific.

fYCO1 gene: gene ID 79443, gene reference sequence NM-024513.4; ALK gene: gene ID 238, gene reference sequence NM-004304.5; HPRT1 gene: gene ID 3251, gene reference sequence NM-000194.3.

The upstream and downstream primer and probe sequences of FYCO1-ALK fusion gene and internal reference HPRT1 gene are as follows:

FYCO1-E12-F：AAGCGGGAGTTCAGCTGGATGG；(SEQ ID NO.2)；

ALK-E20-R ：CTCCATCTGCATGGCTTGCAGC (SEQ ID NO.3)；

FYCO1-ALK-Probe：FAM-5-CCGGAAGCACCAGGA-3-MGB(SEQ ID NO.4)；

HPRT1-F：5-CAGGCAGTATAATCCAAAGATGGTCA-3(SEQ ID NO.5)；

HPRT1-R：5-GTCTGGCTTATATCCAACACTTCGT-3(SEQ ID NO.6)；

HPRT1- Probe：VIC-5-TCACCAGCAAGCTT-3-MGB(SEQ ID NO.7)。

FYCO1-ALK probe (SEQ ID NO. 4) has FAM reporter fluorophore at its 5 'end and MGB quencher at its 3' end. When target DNA molecules do not exist in the sample to be detected, the specific primer cannot be combined with the target DNA molecules, so that the probe is not degraded by Taq enzyme, the integrity of the probe is kept, and because of the resonance energy transfer characteristic of fluorescence, FAM fluorescent signals are absorbed by a quenching group and do not emit fluorescence; when target DNA molecules exist in a sample to be detected, the specific primer is combined with a target gene for amplification, and the 5 'end-3' end exonuclease activity of Taq enzyme is used for carrying out enzyme digestion and degradation on the probe, so that a FAM reporting fluorescent group and a quenching fluorescent group are separated, a FAM fluorescent signal emitted by the reporting fluorescent group can be detected, and a FAM fluorescent signal curve is generated.

The 5 'end of the internal reference HPRT1 gene probe (SEQ ID NO. 7) may be labeled with a VIC reporter fluorophore, and the 3' end of the probe is labeled with an MGB quencher. The purpose of the reference gene is to monitor whether the nucleic acid of the sample to be detected is added in the sample adding process or not and the correctness of the PCR reaction system. If the PCR reaction system is correct and sample nucleic acid to be detected is added, the internal reference probe is combined with DNA molecules of the internal reference gene, the 5 '. Fwdarw.3' double-stranded exonuclease activity of Taq enzyme degrades the probe to release a report fluorescent group VIC fluorescent signal, and a VIC fluorescent curve is generated after the detection, so that the experimental operation is proved to be successful, and the result is credible. If the PCR reaction system is incorrect or the sample nucleic acid to be detected is not added, the probe is not degraded by Taq enzyme, the integrity of the probe can be maintained, and due to the resonance energy transfer characteristic of fluorescence, the VIC fluorescent signal is absorbed by the quenching group and does not emit fluorescence, so that the experimental operation is proved to be failed, and the result is unreliable.

The FYCO1-ALK fusion gene detection kit comprises a PCR reaction liquid (1), a PCR reaction liquid (2), a PCR mixed enzyme, a negative control and a positive control, wherein the compositions of the components are shown in a table 1:

TABLE 1 FYCO1-ALK fusion gene detection kit composition

Example 3 detection method of FYCO1-ALK fusion Gene detection kit

The kit for detecting whether the patient carries the FYCO1-ALK fusion gene comprises the following operation steps:

1. extracting RNA in paraffin-embedded samples: the extraction was performed strictly according to the RNA extraction protocol of formalin-fixed paraffin-embedded tissue samples.

(1) Collecting tissue: the microtome was cleaned, a fresh blade was mounted, the thickness of the sections was adjusted to 5 μm, 2-10 sections were cut according to tissue size, and the sections were collected in a 1.5ml centrifuge tube.

(2) Dewaxing: adding 1mL of dimethylbenzene and 2 mu L of Tissue tracker into a centrifuge tube, shaking and uniformly mixing for 10s, centrifuging for 2min at the room temperature of 13000 Xg, and gently sucking the supernatant; repeating the steps for one time; adding 1mL of absolute ethyl alcohol and 2 mu L of Tissue tracker into a centrifuge tube, shaking and uniformly mixing for 10s, centrifuging for 2min at the room temperature of 13000 Xg, and gently sucking the supernatant; repeating the steps for one time; the centrifuge tube is placed in a metal bath at 56 ℃ and is covered for cooling for 3-10min, so that the volatilization of the absolute ethyl alcohol is ensured to be clean.

(3) Enzyme digestion: 200. Mu.L Buffer RTL lysate was added, followed by 25. Mu. L Proteinase K Solution, shaking and mixing, and digestion at 56℃for 30min at 500 rpm. Centrifugation at 13000g for 2min at room temperature, transferring 180 μl of supernatant into a new 1.5mL centrifuge tube, placing in a metal bath, and incubating at 80deg.C at 500 rpm for 30min; adding 30 mu L DNaseI working mixture, blowing and mixing uniformly, and digesting for 15min at 37 ℃.

(4) Washing: adding 340 mu L Buffer RTB and 750 mu L absolute ethanol, shaking and mixing uniformly, and centrifuging for 5s by using a palm type centrifuge; transferring 650 mu L of the liquid into an RNA adsorption column, centrifuging 13000g for 1min, and pouring out the liquid in a collecting pipe; the remaining liquid in the 1.5mL centrifuge tube was transferred to the RNA adsorption column, centrifuged for 1min at 13000g, and the liquid in the collection tube was decanted.

(5) Purifying: adding 600 mu L of Wash Buffer A into the RNA adsorption column, centrifuging for 1min with 13000g, and pouring out the liquid in the collecting pipe; adding 600 mu L of Wash Buffer B into the RNA adsorption column, centrifuging for 1min with 13000g, and discarding the collecting pipe; the collection tube was replaced with a new one, centrifuged at 13000g for 3min, and discarded.

(6) And (3) collecting: transferring the RNA adsorption column into a new 1.5mL centrifuge tube, uncovering at 56 ℃ and airing for 3min; 100 mu L of Buffer TRE mixed solution is dripped into the center of the RNA adsorption film, the mixture is heated for 2min at the temperature of 56 ℃ in a closed cover manner, 13000g is centrifuged for 1min, RNA in the centrifuge tube is collected into a new centrifuge tube, concentration and purity measurement are carried out, and the mixture is preserved at the temperature of minus 80 ℃ for later use.

2. Fluorescent quantitative PCR reaction

The reaction system was prepared as shown in Table 1, and 3 PCR reaction tubes were filled with PCR reaction solution (1) (34. Mu.L in total), PCR reaction solution (2) (10. Mu.L in total) and PCR enzyme mixture (1. Mu.L in total).

To the 3 PCR reaction tubes were added 5. Mu.L of the sample RNA to be tested (concentration: 10 ng/. Mu.L), 5. Mu.L of the positive control, 5. Mu.L of the negative control, respectively, and each PCR reaction tube was mixed uniformly and centrifuged rapidly for 15s.

Real-time fluorescent quantitative PCR amplification, the amplification procedure is as follows, the first stage: 42 ℃ for 5min and 95 ℃ for 5min; and a second stage: 95 ℃ 25s,64 ℃ 20s,72 ℃ 20s, 10 cycles; and a third stage: 93 ℃ 25s, 60 ℃ 35 s,72 ℃ 20s, 36 cycles; signal collection: FAM and VIC fluorescence signals were collected at 60℃in the third stage.

3. And judging a detection result:

the positive control FAM and VIC fluorescent signals should have an amplification curve rise and have Ct values of <26, and the negative control FAM and VIC fluorescent signals should have no amplification curve rise. If the positive control or negative control result is abnormal, the experimental instrument and experimental conditions are needed to be detected, and the detection is carried out again after the problem is solved.

If the VIC fluorescent signal of the sample to be detected has an amplification curve which is raised and the Ct value is less than or equal to 27, the FAM fluorescent signal has an amplification curve which is raised and the Ct value is less than or equal to 27, and the sample to be detected has mutation of FYCO1-ALK fusion gene;

if the Ct value of the FAM fluorescence signal of the sample to be detected is more than 27, the sample to be detected does not contain FYCO1-ALK fusion genes or is lower than the detection lower limit;

if the Ct value of the VIC fluorescent signal of the sample to be detected is more than 27, re-extracting RNA and detecting.

4. Detection of a sample to be tested

The sample of the patient in example 1 was used as a sample to be tested, and PCR was performed using the above kit, and the result showed that FYCO1-ALK fusion gene was found, and the result was shown in FIG. 2, wherein the FAM fluorescent signal had an amplification curve, and the Ct value was 25. In FIG. 2, the upper curve shows the fluorescence signal amplification curve of the objective gene FAM, and the lower curve shows the fluorescence signal amplification curve of the reference gene VIC.

The amplified product is subjected to sanger sequencing, the fact that the non-small cell lung cancer patient carries a novel FYCO1-ALK fusion gene is confirmed, the verification result is shown in figure 3, and it is confirmed that the exon 12 of the FYCO1 gene and the exon 20 of the ALK gene are spliced and fused.

The non-small cell lung cancer patient is verified to carry FYCO1-ALK fusion gene, after taking targeted drug for 2 months, tumor is reduced from 32X 26mm to 8X 14mm, and the result is shown in FIG. 4, A is 2021 CT result 11 month, and B is 2022 CT result 2 month.

After the non-small cell lung cancer carrying the FYCO1-ALK fusion gene is treated by using the targeting drug, the life quality and the life cycle of a patient can be obviously improved, and the positive FYCO1-ALK fusion mutation is a reliable basis for the targeting treatment of the non-small cell lung cancer patient.

Example 4 control sample detection

30 cases of lung adenocarcinoma with definite gene status are selected as control cases: comprises 8 EGFR gene L858R mutations, 9 EGFR gene 19 exon deletion mutations, 6 EML4-ALK gene fusion mutations, 4 RET gene fusion mutations and 3 ROS1 gene fusion mutations. None of the control cases had FYCO1-ALK gene fusion. Control cases were assayed using the kit from which RNA was extracted as in example 3.

The results show that: no FYCO1-ALK fusion gene was detected in the 30 control cases.

Experiments show that the primer, the probe and the detection kit are aimed at FYCO1-ALK fusion genes, the type of ALK gene fusion is expanded, and the detection rate of non-small cell lung cancer positive to the ALK fusion genes is increased. The kit has the advantages of simple operation, rapidness and accuracy, and can effectively avoid false negative results caused by operation and other reasons by utilizing negative and positive control and internal references.

The above is only a preferred embodiment of the present invention, and modifications made on the premise of the present invention should be considered as the protection scope of the present invention.

Sequence listing

<110> Zhengzhou university second affiliated Hospital

<120> FYCO1-ALK fusion gene, and detection kit and application thereof

<130> biomedical detection

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 337

<212> DNA

<213> Artificial sequence ()

<400> 1

ggacaaggat gctctctggc agaagtcaga tgccctggaa ttccagcaga agctcagtgc 60

tgaggagaga tggctcggag acacagaggc aaaccactgc ctcgactgta agcgggagtt 120

cagctggatg gtgcggcggc accactgcag tgtaccgccg gaagcaccag gagctgcaag 180

ccatgcagat ggagctgcag agccctgagt acaagctgag caagctccgc acctcgacca 240

tcatgaccga ctacaacccc aactactgct ttgctggcaa gacctcctcc atcagtgacc 300

tgaaggaggt gccgcggaaa aacatcaccc tcattcg 337

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 2

aagcgggagt tcagctggat gg 22

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 3

ctccatctgc atggcttgca gc 22

<210> 4

<211> 15

<212> DNA

<213> Artificial sequence ()

<400> 4

ccggaagcac cagga 15

<210> 5

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 5

caggcagtat aatccaaaga tggtca 26

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence ()

<400> 6

gtctggctta tatccaacac ttcgt 25

<210> 7

<211> 14

<212> DNA

<213> Artificial sequence ()

<400> 7

tcaccagcaa gctt 14

Claims (9)

1. An FYCO1-ALK fusion gene, characterized in that the fusion partner gene of the ALK gene is the FYCO1 gene, and the gene fusion mutation occurs between the No. 12 exon of the FYCO1 gene and the No. 20 exon of the ALK gene; the FYCO1-ALK fusion gene has a sequence shown in SEQ ID NO. 1.

2. The FYCO1-ALK fusion gene of claim 1, wherein said FYCO1 gene is located on chromosome 3 3p21.31 at position 45917903-45995824 for a total of 23 exons; gene ID 79443 of the FYCO1 Gene.

3. The FYCO1-ALK fusion gene of claim 1, wherein said ALK gene is located on chromosome 2 2p23.2-p23.1 at position 29190992-29921589 for a total of 29 exons; gene ID 238 of the ALK Gene.

4. A composition for detecting FYCO1-ALK fusion gene according to claim 1, comprising the FYCO1-ALK fusion gene, an upstream primer, a downstream primer and a probe sequence of an internal reference HPRT1 gene, specifically as follows:

the upstream primer FYCO1-E12-F: AAGCGGGAGTTCAGCTGGATGG, the sequence of which is shown as SEQ ID NO. 2;

downstream primer ALK-E20-R: CTCCATCTGCATGGCTTGCAGC, the sequence of which is shown as SEQ ID NO. 3;

probe FYCO1-ALK-Probe: FAM-5-CCGGAAGCACCAGGA-3-MGB, the sequence of which is shown as SEQ ID NO. 4;

the upstream primer HPRT1-F:5-CAGGCAGTATAATCCAAAGATGGTCA-3, the sequence of which is shown as SEQ ID NO. 5;

downstream primer HPRT1-R:5-GTCTGGCTTATATCCAACACTTCGT-3, the sequence of which is shown as SEQ ID NO. 6;

probe HPRT 1-Probe: VIC-5-TCACCAGCAAGCTT-3-MGB, the sequence of which is shown in SEQ ID NO. 7.

5. A kit for detecting the FYCO1-ALK fusion gene of claim 1, comprising the following components:

PCR reaction solution (1): the composition of claim 4, magnesium ions, dntps, deionized water;

PCR reaction solution (2): PCR buffer;

PCR mixing enzyme: taq enzyme, reverse transcriptase, UDG enzyme;

positive control: plasmid of FYCO1-ALK fusion gene and plasmid of HPRT1 gene;

negative control: deionized water.

6. A method for detecting FYCO1-ALK fusion genes for non-diagnostic and therapeutic purposes, comprising the steps of:

(1) Extracting RNA of a sample to be detected;

(2) Performing a fluorescent quantitative PCR reaction using the kit of claim 5;

(3) And judging a detection result according to the PCR amplification result.

7. The method of claim 6, wherein the reaction system of the fluorescent quantitative PCR is: PCR reaction solution (1): the concentration of each primer and probe was 10 pmol, the upstream primer was 1.0. Mu.L, the downstream primer was 1.0. Mu.L, the probe was 0.7. Mu.L, 25mM magnesium ion was 0.5. Mu.L, 25mM dNTP was 0.3. Mu.L, deionized water was 30.5. Mu.L, and 34. Mu.L;

PCR reaction solution (2): 5 XPCR buffer 10. Mu.L;

PCR mixing enzyme: 5U/. Mu.L of Taq enzyme 0.5. Mu.L, 5U/. Mu.L of reverse transcriptase 0.2. Mu.L, 5U/. Mu.L of UDG enzyme 0.3. Mu.L, 1. Mu.L in total;

positive control: 10 ng/. Mu.L of FYCO1-ALK fusion gene plasmid, 10 ng/. Mu.L of HPRT1 gene plasmid, 5. Mu.L in total;

negative control: deionized water 5. Mu.L.

8. The method of claim 6, wherein the amplification procedure of fluorescent quantitative PCR is: the first stage: 42 ℃, 5min,95 ℃ and 5min; and a second stage: 95 ℃,25 s,64 ℃, 20s,72 ℃, 20s, 10 cycles; and a third stage: 93 ℃,25 s,60 ℃, 35 s,72 ℃, 20s, 36 cycles; signal collection: FAM and VIC fluorescence signals were collected at 60℃in the third stage.

9. The method of claim 6, wherein the determination method of the detection result is:

the FAM and VIC fluorescence signals of the positive control have amplification curves raised, ct values are all less than 26, and the FAM and VIC fluorescence signals of the negative control have no amplification curves raised; if the positive control or negative control result is abnormal, detecting an experimental instrument and experimental conditions, and re-detecting after solving the problems;

if the VIC fluorescent signal of the sample to be detected has an amplification curve rising, and the Ct value is less than or equal to 27; the FAM fluorescent signal has an amplification curve rising, and the Ct value is less than or equal to 27, so that the sample to be detected has mutation of FYCO1-ALK fusion gene;

if the Ct value of the FAM fluorescence signal of the sample to be detected is more than 27, the sample to be detected does not contain FYCO1-ALK fusion genes or is lower than the detection lower limit;

if the Ct value of the VIC fluorescent signal of the sample to be detected is more than 27, re-extracting RNA and detecting.

Images