CN102776286A - Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation - Google Patents

Abstract

The invention discloses a primer, a probe and an assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation, wherein the primer and the probe comprises the following sequences of SEQ ID NO 1 to SEQ ID NO 8. A specific primer and probe technique is adopted, and can specifically detect the human ROS1 gene fusion mutation. The method has the advantages that (1) a real-time fluorescent polymerase chain reaction (PCR) system is built to simultaneously detect four types of ROS1 gene fusion mutation; (2) the sensitivity is high, the mutation of 10-20kb can be detected; (3) the method is simple to operate and low in detection, and has a wide clinical application scope; (4) the sample detection scope is wide, and the sample can be fresh pathological tissues and paraffine-embedded tissues; and (5) the detection speed is fast, and the detection process can be completed within 90 minutes.

Description

Be used to detect primer, probe and the detection kit of the sudden change of ROS1 gene fusion

Technical field

The present invention relates to biological technical field, relate to a kind of primer, probe and detection kit that is used to detect the sudden change of ROS1 gene fusion particularly.

Background technology

Lung cancer is modal malignant tumour in the world wide, and M & M occupies first of each cancer.The annual whole world has the patient above 1,300,000 to die from lung cancer.At China's lung cancer mortality is 30.83/10 ten thousand, and lung cancer has become the primary malignant tumour of China's M & M.（Orras JM,Fernandez E,Gonzalez JR,et al.Lung cancer mortality in European regions(1955-1997).Ann Oncol,2003,14(1):159）。

5 years survival rates at developed country's patients with lung cancer can reach about 20%; And 5 years survival rates of China's patients with lung cancer are merely 13%; Its major cause is most of lung cancer owing to lack high-sensitive detection in Gene Mutation and make a definite diagnosis technology; Thereby make the patient can't in time accept the regimen of science, and then make the patient miss the best moment of treatment.

Chemotherapy is still the main treatment means of lung cancer at present, yet most chemotherapy can produce bigger toxic side effect, and the chemotherapy effect between different patients also has than big-difference.Along with the development of tumour molecular diagnostic techniques, the molecular targeted treatment of lung cancer is low because of its toxic side effect, and specificity is high, becomes the first-selected therapeutic modality of clinician day by day.The patients with lung cancer that is found to be of new fusion gene ROS1 provides new treatment target spot.ROS1 is a kind of receptor type tyrosine kinase (Receptor Tyrosine Kinase) of Insulin Receptor Family; ROS 1 fusion at first is found in the glioblastoma, and it merges sudden change and betides karyomit(e) q22 district (Birchmeier et al.Proc Natl Acad Sci.87 (12): 1990 No. 6; Charest et al.Genes Chromosomes Cancer.37:58,2003).The ROS1 fusion comprises a complete Tyrosylprotein kinase zone, and it merges sudden change can cause the activation of cell downstream signal path, thereby influences the growth of cell, propagation and differentiation.Up-to-date research shows that ROS1 is that a kind of new tumour drives mutator gene, and its fusion is decided to be a kind of new molecular isoform in nonsmall-cell lung cancer.

Clinical studies show small molecules targeted drug Crizotinib (azoles base of a fruit Buddhist nun in the gram; Pfizer) can suddenly change in the ROS1 gene fusion by specific action; Through suppressing the activity in ROS1 Tyrosylprotein kinase zone, block its downstream abnormal signal path, thereby suppress the growth of tumour cell.Therefore; Detecting ROS1 fusion mutation status is the prerequisite that instructs targeted drug Crizotinib medication; Detect the sudden change of ROS1 fusion gene for the survival rate that improves patients with lung cancer through high-sensitive detection method before the chemotherapy, prolong lifetime, avoid excessive chemotherapy, the raising life quality has significance.

The detection method that at present, can detect fusion gene sudden change clinically is mainly real time fluorescent PCR method and direct sequencing.Yet directly the sensitivity of order-checking is low, and detection sensitivity has only 20-30%; Detecting operation is complicated, and efficient is low, wants 1-2 talent can go out detected result usually.Thereby direct sequencing can't satisfy the actual demand of clinical detection, the clinical a kind of quick fusion gene detection method of exploitation that presses for, and detection method detects merging sudden change simultaneously to realize adopting fast.

At present, also do not have the detection method and the detection kit of ROS1 fusion gene sudden change, the present invention develops a kind of ROS1 fusion gene quick, easy and simple to handle sudden change detection kit and detection method first.This detection method can once detect 4 kinds of fusion sudden changes that the ROS1 gene produces simultaneously, and detection sensitivity is high, and only needed to accomplish in 90 minutes detection time; Possessed highly sensitive simultaneously; Fast cheap, simple operation and other advantages can satisfy the actual demand of clinical rapid detection.

Summary of the invention

The object of the present invention is to provide a kind of ROS1 of being used for gene fusion sudden change to detect primer and probe, or with it identity nucleotide sequence is arranged, this detection kit comprises following primer and probe sequence:

Table 1.ROS1 merges mutant primer and probe nucleotide sequence

SL-RO-M1-F1 GGAGATTGATTTTACTTCTCGGATTTCTCTAC SEQ ID NO：1

SR-M1 SL-RO-M1-R1 CCCTTCTAGTAATTTGGGAATGCCTGG SEQ ID NO：2

SR-M2 SL-RO-M2-R1 CCAACTATAATAGTAAGTATGAAACTTGTTTCTGGTATCC SEQ ID NO：3

SL-RO-M1-P1 5-FAM-CTCCAACCAGCTGGAAGGCGCTAC-3-BHQ1 SEQ ID NO：4

CD-RO-M1-F2 GAAATGAGCAGGCACTCCTTGGAG SEQ ID NO：5

CR-M1CD-RO-M1-R1 CCCTTCTAGTAATTTGGGAATGCCTGG SEQ ID NO：6

CR-M2CD-RO-M2-R1 CCAACTATAATAGTAAGTATGAAACTTGTTTCTGGTATCC SEQ ID NO：7

CD-RO-M1-P1 5-FAM-CCCACTGACGCTCCACCGAAAG-3-BHQ1 SEQ ID NO：8

" identity nucleotide sequence " described herein is illustrated in the oligonucleotide of (under the maximum stringency condition) and target hybridization under the stringent condition; And have that suitable Nucleotide inserts or deletion condition under when comparing, be same as above-mentioned nucleotide fragments at the Nucleotide at least about 60% of Nucleotide.More preferably, for having the Nucleotide of 80% identity, best, for having the Nucleotide of 90% identity.

Hybridization conditions is divided according to the stringency degree of used condition of when hybridization, the stringency degree can nucleic acid combine mixture or probe melting temperature(Tm) (Tm) be foundation.For example, " maximum stringency " is Tm-5 ℃ (being lower than 5 ℃ of probe Tm); " high stringency " occurs in following about 5-10 ℃ of Tm; " medium stringency " occurs in following about 10-20 ℃ of Tm; Low stringency occurs in following about 20-25 ℃ of Tm.

In the present invention, " identity " refer to, when two kinds or above sequence or subsequence compare, and identical or identical Nucleotide or amino-acid residue with particular percentile.Be used for confirming that the algorithm of sequence identity and sequence similarity percentage ratio is according to BLAST or BLAST2.0 algorithm, they are open in following document respectively: (1990) J.Mol.Biol.215:403-410. such as (1977) Nucl.Acid.res.25:3389-3402 such as Altschul and Altschul

The present invention provides a kind of ROS1 gene fusion sudden change detection kit that is used to detect on the other hand, and its PCR reaction amplification system is following:

The present invention provides the method for a kind of mRNA of being used for reverse transcription cDNA on the other hand, and method comprises that the reverse transcription system is formed and following operation steps: mRNA reverse transcription cDNA system comprises following composition:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1 ~ 5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

Further aspect of the present invention provides a kind of ROS1 gene fusion mutation method that is used to detect, and its method may further comprise the steps:

(1) the human ROS1 that announces according to the COSMIC data is the wild type gene sequence, merges sudden change for 4 kinds to the ROS1 gene, designs special primer and probe.

(2) extract the RNA that detects sample, detect sample and comprise fresh pathological tissue and paraffin-embedded tissue.

(3) preparation real-time fluorescence PCR amplification reaction system.

(4) the Ct value that shows according to fluorescent PCR amplification appearance is judged detected result: the FAM of detection reaction system and HEX fluorescence intensity, and needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

The invention has the beneficial effects as follows: the present invention has adopted special primer and probe technique, can the human ROS1 gene fusion sudden change of special detection.This method: the real-time fluorescence PCR system has been set up in (1), can detect the ROS1 gene simultaneously and merge sudden change for 4 kinds; (2) highly sensitive, the sudden change of 10-20 copy can detect; (3) simple to operate, detect cheapness, clinical application range is wide; (4) the pattern detection scope is wide, and sample can be fresh pathological tissue, paraffin-embedded tissue; (5) detection speed is fast, and testing process only needed to accomplish in 90 minutes.

Description of drawings

Fig. 1 detects plasmid PCR figure for the present invention.

Fig. 2 is sensitivity analysis test-results PCR figure.

Fig. 3 is positive PCR figure for the detection clinical sample suddenlys change.

Fig. 4 is for detecting clinical sample wild-type PCR figure.

Embodiment

The present invention is a template with the mutant plasmid that genetically engineered makes up; Make up ROS1 real-time fluorescence PCR amplification reaction system; With FAM is the jump signal sense channel; Merge 4 site designs specificity probes of sudden change and primer to ROS1, through the highly sensitive special detection of the optimization implementation of primer and detection architecture.The method that detects the sudden change of R0S1 gene fusion may further comprise the steps:

(1) to mutational site design synthetic primer and probe:

The human ROS1 gene order of announcing according to the COSMIC DB is a wild-type sequence, merges sudden change to 4 kinds of ROS1 genes and comes design specific primers and probe.Through Auele Specific Primer and probe system optimization, realize highly sensitive and special detection, 4 of R0S1 genes merge the mutational site sees table 2.

To 4 selected fusion mutational sites, the design of Using P remier 6.0 primer-design softwares is many to special primer and many probes, and primer and probe sequence are as shown in table 1.

Table 2.ROS1 gene fusion detection site

(2) extraction of sample process and RNA:

The extraction of sample preparation and RNA: the sample scope of application comprises fresh tumor tissues and paraffin-embedded tissue.Fresh pathological tissue is got about 1 gram, uses the RNA of TIANGEN to extract its RNA of test kit extraction.Paraffin-embedded tissue uses the RNA that organizes of Qiagen to extract its RNA of test kit extraction.Above-mentioned concrete operations step is pressed the operation of test kit specification sheets.

(3) set up the pcr amplification reaction system:

With put on and state RNA and be dissolved in the 0.1%DEPC water, extract quality through UV spectrophotometer measuring, confirm that its concentration OD260/OD280 is 1.9-2.1, and read its content.The RNA that gets 0.1 ~ 5 μ g adopts the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. as its cDNA synthetic template, and synthetic cDNA system is following:

Use above-mentioned reverse transcription system and carry out rt as follows:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1 ~ 5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification:

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Detect FAM fluorescent signal Ct value; Ct value judged result according to the demonstration of fluorescent PCR amplification appearance: the FAM fluorescence intensity of detection reaction system; Needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

Below in conjunction with specific embodiment, the present invention is further set forth.Should be understood that these embodiment only to be used for the present invention and be not used in the restriction scope of the present invention.Only if definition or explanation are arranged in addition, the described scientific and technical term of this patent is understood with those of ordinary skills and is had identical implication.

Embodiment 1

Use system of the present invention to detect plasmid, experiment utilizes the method for above-mentioned fluorescent PCR detection R0S1 gene fusion sudden change following with plasmid template (containing ROS1 merges):

(1) plasmid is handled and is extracted:

TIANGEN is adopted in the extraction of plasmid, and (HighPure Plasmid Kit, plasmid extraction kit DP116) extracts, and specifically extracts operation steps and operates by the test kit specification sheets.The DNA that carries is dissolved among the Tris-HCl that (10mmol/L PH8.0), extracts quality through UV spectrophotometer measuring; Confirm its concentration; Use Tris-HCl (10mmol/L, PH 8.0) solution adjustment DNA concentration to arrive 2ng/ μ L then, get 5 μ L and carry out PCR reaction amplification as pcr template.

(2) set up the pcr amplification reaction system:

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Adopt MX3000P real-time fluorescence PCR appearance to increase, at the fluorescent signal of back 31 cycle annealing stages detection FAM and HEX, needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive

Sensitivity analysis: concentration is the sample DNA of 1000 copies after learning from else's experience quantitatively, carries out 10 times of dilutions, respectively 3 concentration is detected then, and each reaction adds 5 μ L DNA.The result shows the highly sensitive of fluorescence PCR method of the present invention, and 10 copy DNA genomes can detect result such as Fig. 2.

Replica test: each reaction adds mutant plasmid DNA1000 copy, 100 copies respectively, repeats 10 times and carries out the fluorescent PCR amplification, and 10 times the Ct value differs less than 0.5 circulation.

Detected result shows that detection architecture of the present invention can accurately detect plasmid and detect R0S1 fusion sudden change, and the sensitivity of detection can reach the 5-10 copy.

Embodiment 2

Utilization the present invention detects clinical lung cancer paraffin-embedded tissue sample; The ROS1 that the direct sequencing of learning from else's experience detect to be confirmed merges positive 4 examples and 11 routine ROS1 wild-type samples, and the R0S1 fusion gene that utilizes special primer of the present invention and fluorescence probe PCR system the to detect 15 routine clinical samples step of suddenling change is following:

(1) extraction of sample process and RNA:

(a) get above-mentioned each lung cancer sample, add 1ml YLENE respectively, mixing, the centrifugal 2min of 14000RPM under the room temperature; Abandon supernatant, add the 1ml absolute ethyl alcohol in deposition, concussion mixing (removal YLENE); The centrifugal 2min of 14000RPM abandons supernatant under the room temperature, opens the centrifuge tube lid, and 37 ℃ are dried;

(b) in centrifuge tube, add 150 μ l Buffer PKD and 10 μ l Proteinase Ks, the concussion mixing is hatched 15min for 56 ℃; Hatch 15min for 80 ℃; After waiting to drop to room temperature, add 16ul DNase Booster Buffer and 10ul DNaseI stoste, incubated at room 15min; The back adds 320 μ l Buffer RBC, mixing;

(c) add 720 μ l absolute ethyl alcohols toward supernatant; Mixing; Get the deposition that 700 μ l samples comprise that the front generates and transfer in the centrifugal post of RNA MinElute that has the 2ml collection tube, greater than 10, the centrifugal 15s of 000rpm; Abandon waste liquid, repeat one and go on foot up to sample transfer in the centrifugal post of RNA MinElute.

(d) uncap adds 500 μ l Buffer RPE, covers tight lid, greater than the centrifugal 2min of 10000rpm, posts transfer in collection tube, is dripped 14-30 μ l RNase-free water to the adsorption film middle part, collects RNA. behind the centrifugal 1min

(2) set up the pcr amplification reaction system:

With put on and state RNA and be dissolved in the 0.1%DEPC water, extract quality through UV spectrophotometer measuring, confirm that its concentration OD260/OD280 is 1.9-2.1, and read its content.The RNA that gets 0.1 ~ 5 μ g adopts the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd. as its cDNA synthetic template, and the cDNA synthetic system is following:

Use above-mentioned reverse transcription system and carry out rt as follows:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1 ~ 5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template..

With above-mentioned gained cDNA template,, carry out pcr amplification according to following amplification system as the template of real-time fluorescence PCR amplification:

The real-time PCR reactions condition is 95 ℃ of preparatory sex change 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ were extended 15 circulations 20 seconds; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ were extended 31 circulations 20 seconds.When circulating in annealing, 31 of backs detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard of as a result of judging according to the Ct value:

Detect FAM fluorescent signal Ct value; Ct value judged result according to the demonstration of fluorescent PCR amplification appearance: the FAM fluorescence intensity of detection reaction system; Needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: merge positive

Detected result show detect and have 4 examples to have ROS1 to merge sudden change in the 15 routine lung cancer samples, the concordance rate of the sensitivity of this fluorescence PCR method and PCR sequencing PCR detection method is 100%, has further proved the accuracy of system detection of the present invention, the result sees table 3.

Table 3. detected result of the present invention and direct sequencing are relatively

Claims (6)

1. be used to detect primer, the probe of the sudden change of ROS1 fusion gene, it is characterized in that, comprise following sequence: SEQ ID NO 1-SEQID NO 8.

2. be used to detect the test kit of ROS1 fusion gene sudden change, it is characterized in that, comprise following sequence: SEQ ID NO 1-SEQID NO 8.

3. the detection kit of detection ROS1 fusion gene as claimed in claim 2 sudden change is characterized in that: the reaction system that comprises following fluorescent PCR.

4. the detection kit of detection ROS1 fusion gene as claimed in claim 2 sudden change, its method of use may further comprise the steps:

(1) extracts the RNA that detects in the sample, detect sample and comprise the RNA in fresh pathological tissue, paraffin-embedded tissue or the pleural fluid tissue;

(2) RNA reverse transcription cDNA, preparation real-time fluorescence PCR amplification reaction system;

(3) the Ct value that shows according to fluorescent PCR amplification appearance is judged detected result: the FAM of detection reaction system and HEX fluorescence intensity, and needed cycle index Ct value is as yin and yang attribute criterion when reaching preset threshold with FAM, and the Ct value is more than or equal to 30: feminine gender; The Ct value is less than 30: the positive.

5. the detection kit of detection ROS1 fusion gene as claimed in claim 4 sudden change is characterized in that the reaction system of mRNA reverse transcription cDNA does.

6. the detection kit of detection ROS1 fusion gene as claimed in claim 4 sudden change is characterized in that RNA reverse transcription cDNA comprises following operation steps:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l adds in the aseptic centrifuge tube mixing.

(b) add testing sample RNA 6 μ l, the RNA total amount in 0.1 ~ 5 μ g scope, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ the insulation 5 minutes after cooled on ice, obtain the cDNA template.

Images