CN102719525B - Primer, probe and detection kit for detection of EML4-ALK fusion gene mutation - Google Patents

Abstract

The invention discloses a primer, a probe and a detection kit for detection of an EML4-ALK fusion gene mutation. The primer and probe provided by the invention are SEQ ID NO 1-SEQ ID NO 24. The primer and probe of the invention can carry out specific detection on EML4-ALK fusion gene mutation. The present invention has the following advantages: (1) an established real-time fluorescent PCR system capable of simultaneously detecting 9 kinds of fusion mutation of EML4-ALK gene; (2) high sensitivity capable of detecting mutation of 5-10 copies; (3) simple operation, cheap detection and wide clinical application range; (4) a wide range of samples from fresh pathological tissue to paraffin embedded tissue or pleural fluid; and (5) high speed detection with a detection procedure taking only 90 minutes.

Description

For detection of primer, probe and the detection kit of the sudden change of EML4-ALK fusion gene

Technical field

The present invention relates to biological technical field, relate to particularly the detection kit of fusion gene sudden change.

Background technology

Lung cancer is modal malignant tumour in world wide, and M & M occupies first of each cancer.The annual whole world has and exceedes 1,300,000 patient and die from lung cancer, and nearly half occurs in developing country.According to the statistics of the Ministry of Health of China in 2010, lung cancer mortality is 30.83/10 ten thousand, and lung cancer has become the primary malignant tumour of M & M.(Orras JM, Fernandez E, Gonzalez JR, et al.Lung cancer mortality in European regions (1955-1997) .Ann Oncol, 2003,14 (1): 159-161; Ministry of Health of the People's Republic of China, " China Health statistics in 2010 " yearbook).

Lung cancer can be divided into small cell carcinoma (SCLC) and non-small cell carcinoma (non-small cell lung cancer, NSCLC) two large classes histopathology, and wherein non-small cell carcinoma accounts for 85% of the total case of lung cancer.Be only 13% in China's patients with lung cancer survival rate of 5 years, its major cause is most of lung cancer owing to lacking highly sensitive detection in Gene Mutation and making a definite diagnosis technology, and the treatment plan of the science that matches with it, thereby makes patient miss the best moment for the treatment of.

Chemotherapy is still lung cancer primary treatment means at present, but most chemotherapy can produce larger toxic side effect, and the chemotherapy effect between different patients has larger difference.Along with the development of oncomolecularbiology, the molecular targeted therapy of lung cancer because of its specificity high, toxic side effect is low, day by day becomes the first-selected therapeutic modality of clinician.The NSCLC patient that is found to be of EML4-ALK (Echinoderm Microtubule-associated protein-Like 4-Anaplastic Lymphoma Kinase) gene fusion sudden change provides new treatment target spot.EML4 (echinoderms microtubule-associated protein 4) forms closely related with microtubule; ALK (Nucleophosmin-anaplastic lymphoma kinase) plays important regulating effect at tumour cell signal transduction.EML4 mainly comprises coiled coil structure, hydrophobic EMAP protein structure domain, tryptophan-aspartic acid repeating structure; Two genes of EML4 and ALK lay respectively at No. 2 chromosomal p21 of the mankind and P23 band, the about 12Mb of being separated by.The inversion of these two gene fragments merges, and inv (2) (p21p23) can make the EML4-ALK fusion rotein that tissue expression is new.EML4 promotor after fusion is positioned at the upstream of alk tyrosine kinase, thereby makes fusion gene activation, expresses EML4-ALK fusion rotein.The dimer forming by EML4 born of the same parents' outer structure makes ALK acceptor continue phosphorylation, and then activates the cell signal path (Soda M, the et al.Nature 2007 that continue downstream; 448:561-6; Martelli MP, et al.Am.J.Pathol.174 (2): 661-70; Koh Y, et al.J Thorac Oncol 2011; 6:905-912.).

With Crizotinib (Crizotinib, Pfizer) for the medicine of representative is the small molecules targeted drug for EML4-ALK gene fusion sudden change exploitation, by suppressing the activity in alk tyrosine kinase region, block its downstream abnormal signal path, thus the growth of inhibition tumor cell.Clinical study shows that Crizotinib merges sudden change the efficient of patient to EML4-ALK and reaches more than 61%, and the patient of wild-type is almost of no curative effect.Therefore, detecting EML4-ALK fusion sudden change situation is to instruct prerequisite and the basis of the medication of Crizotinib class medicine, before chemotherapy, detect the sudden change of EML4-ALK fusion gene for the survival rate that improves patients with lung cancer by high-sensitive detection method, extend lifetime, avoid excessive chemotherapy, improve life quality important in inhibiting.

At present, the detection method that EML4-ALK merges sudden change is mainly fluorescence in situ hybridization (FISH) method, but, FISH method detection specificity is poor, sensitivity is lower, and detection time is long, and cannot detect the multiple fusion varient that EML4-ALK fusion produces simultaneously.In addition, FISH detects needs expensive specialized instrument and equipment, and reagent cost is higher, and complicated operation is widely used clinical detection and is restricted.The time of FISH testing requirement detection Sample preservation is unsuitable oversize, adopts long sample of shelf time to carry out detection and can cause false-negative generation, has affected the accuracy detecting.Therefore, FISH detection method cannot meet clinician and detect the demand of practical application, clinical in develop a kind of highly sensitive detection method that can detect EML4-ALK fusion gene various mutations simultaneously, adopt fast detection method to merge sudden change to many kinds of EML4-ALK to detect to realize simultaneously, thereby provide science reference frame for clinical lung cancer individualized treatment scheme.

For the problems referred to above, the present invention develops a kind of quick cheapness, EML4-ALK fusion gene mutation detection kit and detection method easy and simple to handle.A kind of novel special primer and probe are used in the design of this detection method.This detection method can once detect 9 kinds of fusion sudden changes of EML4 and ALK gene simultaneously, and detection sensitivity is high, only needs detection time within 90 minutes, can complete, possessed highly sensitively, specificity is good simultaneously, fast cheap, simple operation and other advantages, can meet the actual demand of clinical rapid detection.

Summary of the invention

The object of the present invention is to provide one to detect primer and probe for the sudden change of EML4-ALK gene fusion, its special primer and probe comprise following sequence:

Table 1EML4-ALK merges the two primers of mutation specific and probe nucleotide sequence

EML4-ALK-reverse transcription 1:TCAGGTCACTGATGGAGGAG SEQ ID NO:01

EML4-ALK-reverse transcription 2:CAGGAGGAGCAATGATCTTG SEQ ID NO:02

No. 1: M 1,2,3

EML4-ALK-M-F：GCCCACACCTGGGAAAGGACCT SEQ ID NO：03

EML4-ALK-M-F：CAGACAAGCATAAAGATGTCAT SEQ ID NO：04

EML4-ALK-M-F：ACACCTTGACTGGTCCCCAGAC SEQ ID NO：05

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ ID NO：06

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ ID NO：07

No. 2: M 4,5

EML4-ALK-M-F：GCAGAAGGAAAGGCAGATCAAT SEQ ID NO：08

EML4-ALK-M-F：TCTGTGGGATCATGATCTGAATC SEQ ID NO：09

EML4-ALK-M-R：TCAGGTCACTGATGGAGGAGGTC SEQ ID NO：10

EML4-ALK-M-P：FAM-5-TGTATGACCGACTACAACCCCAACTACTGGGT-3-BHQ1 SEQ ID NO：11

No. 3: M 6,7

EML4-ALK-M-F：CCAGAGATCTAGTTTCTATCCAC SEQ ID NO：12

EML4-ALK-M-F：ATCTCTGAAGATCATGTGGCCTC SEQ ID NO：13

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ ID NO：14

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ ID NO：15

No. 4: M 8

EML4-ALK-M-F：ATAGGAACGCACTCAGGCAGAG SEQ ID NO：16

EML4-ALK-M-R：AGGTGCGGAGCTTGCTCAGCT SEQ ID NO：17

EML4-ALK-M-P：FAM-5-AGCTCACCAGGAGCTGCAAGCCATGCTTGC-3-BHQ1 SEQ ID NO：18

No. 5: M 9

EML4-ALK-M-F：ATCTCTGAAGATCATGTGGCCTC SEQ ID NO：19

EML4-ALK-M-R：GCAGCCTGGCCCTTGAAGCACT SEQ ID NO：20

EML4-ALK-M-P：FAM-5-GATCCCTCCCTGGATCTCCATATCCTCCTGGA-3-BHQ1 SEQ ID NO：21

No. 6:

ACTB-F：CTGGCATTGCCGACAGGA SEQ ID NO：22

ACTB-R：AGGAGCAATGATCTTGATCTTC SEQ ID NO：23

ACTB-P：FAM-CAGTAAGGAGATCACTGCCCTGGCACCCAAGGG-BHQ SEQ ID NO：24

It is a kind of for detection of EML4-ALK gene fusion mutation detection kit that the present invention provides on the other hand, and its PCR reaction amplification system is as follows:

The present invention provides a kind of method for mRNA reverse transcription cDNA on the other hand, and method comprises reverse transcription composing system and following operation steps:

MRNA reverse transcription cDNA system comprises following composition:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.

(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1～5 μ g, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..

It is a kind of for detection of EML4-ALK gene fusion mutation method that further aspect of the present invention provides, and its method comprises the following steps:

(1) mankind EML4-ALK announcing according to COSMIC data is wild type gene sequence, merges sudden change for 9 kinds of EML4-ALK genes, designs special primer and probe.

(2) extract the RNA that detects sample, detect sample and comprise fresh pathological tissue, paraffin-embedded tissue or pleural fluid.

(3) preparation real-time fluorescence PCR amplification reaction system.

(4) the Ct value showing according to fluorescent PCR amplification instrument judges detected result: the FAM of detection reaction system and HEX fluorescence intensity, while reaching the threshold value of setting using FAM, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive.

The invention has the beneficial effects as follows: the present invention has adopted special primer and probe technique, can the sudden change of specific detection mankind EML4-ALK gene fusion.This method: (1) has set up real-time fluorescence PCR system, can detect 9 kinds of EML4-ALK genes simultaneously and merge sudden change; (2) highly sensitive, the sudden change of 5-10 copy can detect; (3) simple to operate, detect cheapness, clinical application range is wide; (4) pattern detection scope is wide, and sample can be fresh pathological tissue, paraffin-embedded tissue or pleural fluid; (5) detection speed is fast, and testing process only needs to complete for 90 minutes.

Accompanying drawing explanation

Fig. 1 is that the present invention detects plasmid PCR figure.

Fig. 2 is sensitivity analysis test-results PCR figure.

Fig. 3 is positive PCR figure for detection clinical sample suddenlys change.

Fig. 4 is for detecting clinical sample wild-type PCR figure.

Embodiment

The mutant plasmid that the present invention builds take genetically engineered is as template, build EML4-ALK real-time fluorescence PCR amplification reaction system, take FAM as jump signal sense channel, merge 9 site design specific probes of sudden change and two primer for EML4-ALK, realize highly sensitive specific detection by the optimization of primer and detection system.The method that detects the sudden change of EML4-ALK gene fusion comprises the following steps:

(1) for mutational site design synthetic primer and probe:

The mankind EML4-ALK gene order of announcing according to COSMIC database is wild-type sequence, merges sudden change design Auele Specific Primer and probe for 9 kinds of EML4-ALK genes.By Auele Specific Primer and probe system optimization, realize highly sensitive and specific detection, 9 of EML4-ALK genes merge mutational site in table 2.

For 9 selected fusion mutational sites, application Premier 6.0 primer-design softwares design multipair special primer and many probes, and primer and probe sequence are as shown in table 1.

(2) extraction of sample process and RNA:

The extraction of sample preparation and RNA: the sample scope of application comprises fresh tumor tissues and pleural fluid.Fresh pathological tissue, gets 1 gram of left and right, uses the RNA extraction test kit of TIANGEN to extract its RNA.Pleural fluid uses the RNA extraction test kit of organizing of TIANGEN to extract its RNA.Paraffin-embedded tissue, uses the RNA extraction test kit of organizing of Qiagen to extract its RNA.Above-mentioned concrete operation step is pressed the operation of test kit specification sheets.

(3) set up pcr amplification reaction system:

By put on and state RNA and be dissolved in 0.1%DEPC water, extract quality through UV spectrophotometer measuring, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.Get the RNA of 0.1～5 μ g as the synthetic template of its cDNA, adopt the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd., cDNA synthetic system is as follows:

Apply above-mentioned reverse transcription system and carry out as follows reverse transcription:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.

(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1～5 μ g, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..

By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, carry out pcr amplification according to following amplification system:

Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard as a result of judging according to Ct value:

Detect FAM fluorescent signal Ct value, the Ct value judged result showing according to fluorescent PCR amplification instrument: the FAM fluorescence intensity of detection reaction system, while reaching the threshold value of setting using FAM, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive.

Below in conjunction with specific embodiment, the present invention is further set forth.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention.Unless otherwise defined or described herein, the scientific and technical term described in this patent is understood and is had identical implication with those of ordinary skills.

Embodiment 1

Use system of the present invention to detect plasmid, plasmid template for experiment (suddenling change containing EML4-ALK variant 1), utilizes the method for above-mentioned fluorescent PCR detection EML4-ALK gene fusion sudden change as follows:

(1) plasmid is processed and is extracted:

The extraction of plasmid adopts the plasmid extraction kit of TIANGEN (HighPure Plasmid Kit, DP116) to extract, and specifically extracts operation steps and operates by test kit specification sheets.The DNA that carries is dissolved in (10mmol/L in Tris-HCl, PH8.0), extract quality through UV spectrophotometer measuring, determine its concentration, then use Tris-HCl (10mmol/L, PH8.0) solution is adjusted DNA concentration and is arrived 2ng/ μ L as pcr template, gets 5 μ L and carries out PCR reaction amplification.

(2) set up pcr amplification reaction system:

By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, carry out pcr amplification according to following amplification system:

Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard as a result of judging according to Ct value:

Adopt MX3000P real-time fluorescence PCR instrument to increase, detect the fluorescent signal of FAM and HEX in rear 31 cycle annealing stages, while reaching the threshold value of setting using FAM, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive

Sensitivity analysis: after learning from else's experience quantitatively, concentration is the sample DNA of 1000 copies, carries out 10 times of dilutions, then respectively 3 concentration is detected, and every secondary response adds 5 μ L DNA.Result shows the highly sensitive of fluorescence PCR method of the present invention, and 10 copy DNA genomes can detect, and result is as Fig. 2.

Replica test: each reaction adds respectively mutant plasmid DNA1000 copy, 100 copies, repeats to carry out fluorescent PCR amplification 10 times, and 10 times Ct value differs less than 0.5 circulation.

Detected result shows, detection system of the present invention can accurately detect plasmid and detect EML4-ALK and merge sudden change, and the sensitivity of detection can reach 5-10 copy.

Embodiment 2

Use the present invention to detect clinical sample, fetch and deliver my company clinical lung cancer paraffin-embedded tissue sample 110 examples to be detected, the male sex's 65 examples, women's 45 examples, the age is 34-75 year, the mean age is 54 years old, the median age 50 years old.Utilize special primer of the present invention and fluorescence probe PCR system to detect the gene fusion sudden change step of EML4-ALK of 110 routine clinical samples as follows:

(1) extraction of sample process and RNA:

(a) get above-mentioned each lung cancer sample, add respectively 1ml dimethylbenzene, mix, under room temperature, the centrifugal 2min of 14000RPM, abandons supernatant liquor, adds 1ml dehydrated alcohol in precipitation, concussion mixes (removal dimethylbenzene), under room temperature, the centrifugal 2min of 14000RPM abandons supernatant liquor, opens centrifuge tube lid, and 37 ℃ are dried;

(b) in centrifuge tube, add 150 μ l Buffer PKD and 10 μ l Proteinase Ks, concussion mixes, hatch 15min for 56 ℃, hatch 15min for 80 ℃, after dropping to room temperature, add 16ul DNase Booster Buffer and 10ul DNaseI stoste, incubated at room 15min, after add 320 μ l Buffer RBC, mix;

(c) add 720 μ l dehydrated alcohols toward supernatant liquor, mix, get 700 μ l samples and comprise that the precipitation generating transfers in the RNA MinElute centrifugal column with 2ml collection tube above, be greater than 10, the centrifugal 15s of 000rpm, abandon waste liquid, repeat previous step until sample is transferred in RNA MinElute centrifugal column.

(d) uncap adds 500 μ l Buffer RPE, covers tightly lid, is greater than the centrifugal 2min of 10000rpm, and posts transfer, in collection tube, is dripped to 14-30 μ l RNase-free water to adsorption film middle part, after centrifugal 1min, collects RNA.

(2) set up pcr amplification reaction system:

By put on and state RNA and be dissolved in 0.1%DEPC water, extract quality through UV spectrophotometer measuring, determine that its concentration OD260/OD280 is 1.9-2.1, and read its content.Get the RNA of 0.1～5 μ g as the synthetic template of its cDNA, adopt the synthetic cDNA of test kit of Xiamen Amoydx Bio-Pharmaceutical Technology Co., Ltd., cDNA synthetic system is as follows:

Apply above-mentioned reverse transcription system and carry out as follows reverse transcription:

(a) get reverse transcription reaction mixed solution 18 μ l, M-MLV reversed transcriptive enzyme 1 μ l, adds in aseptic centrifuge tube, mixes.

(b) add testing sample RNA 6 μ l, RNA total amount within the scope of 0.1～5 μ g, moisturizing to 25 μ l.

(c) 42 ℃ are incubated 1 hour.

(d) 95 ℃ insulation 5 minutes after cooled on ice, obtain cDNA template..

By above-mentioned gained cDNA template, as the template of real-time fluorescence PCR amplification, carry out pcr amplification according to following amplification system:

Real-time PCR reactions condition is 95 ℃ of denaturations 5 minutes, 1 circulation; 95 ℃ of sex change 25 seconds, 64 ℃ of annealing 20 seconds, 72 ℃ are extended 20 seconds, 15 circulations; 93 ℃ of sex change 25 seconds, 60 ℃ of annealing 35 seconds, 72 ℃ are extended 20 seconds, 31 circulations.Latter 31 circulate in when annealing and detect FAM and HEX or ROX fluorescent signal.

(4) detect fluorescent signal, the standard as a result of judging according to Ct value:

Detect FAM fluorescent signal Ct value, the Ct value judged result showing according to fluorescent PCR amplification instrument: the FAM fluorescence intensity of detection reaction system, while reaching the threshold value of setting using FAM, needed cycle index Ct value is as yin and yang attribute criterion, and Ct value is more than or equal to 30: feminine gender; Ct value is less than 30: the positive

Detected result show detect and in 110 routine lung cancer samples, have 8 examples have EML4-ALK to merge to suddenly change, mutation rate is 7.2%, above-mentioned all samples are carried out to FISH comparison and detection simultaneously, FISH result shows that sudden change has 8 examples, the coincidence rate of two kinds of detection methods is 100%, further prove the accuracy that system of the present invention detects, the results are shown in Table 4.

9 kinds of fusion sudden changes of table 2EML4-ALK gene

9 kinds of fusion sudden change PCR of table 3EML4-ALK gene react each pipe and detect catastrophe point

The comparison of table 4 clinical sample detected result

Claims (1)

1. for the detection reaction system of EML4-ALK fusion gene sudden change, it is characterized in that,

Comprise primer and the probe of following sequence: SEQ ID NO1-SEQ ID NO24;

Comprise the reaction system of following fluorescent PCR:

Template 5 μ L

Each primer 1.0～4.0pmol

Each probe 1.0～3.0pmol

Taq enzyme 0.5～2.0U

dNTP 1～2mmol

MgCL ₂ 2～3mmol

Methane amide 1～2%

Cumulative volume 20-40 μ L;

Also comprise the reaction system of following mRNA reverse transcription cDNA:

5×M-MLV buffer 3-6μL

Primer final concentration 1-3pM

dNTP 1-2mM

M-MLV 100-300U

RNA 4-9μL

Mend DEPC water to 20-40 μ L.

Images