CN111705060B

CN111705060B - shRNA of NCAPD2 gene and application thereof

Info

Publication number: CN111705060B
Application number: CN202010608552.6A
Authority: CN
Inventors: 何劲松; 崔军威; 李锋; 高睿; 郭秋怡; 黄康华; 周子函
Original assignee: Peking University Shenzhen Hospital
Current assignee: Peking University Shenzhen Hospital
Priority date: 2020-06-29
Filing date: 2020-06-29
Publication date: 2023-07-28
Anticipated expiration: 2040-06-29
Also published as: CN111705060A

Abstract

The invention provides shRNA of NCAPD2 gene and application thereof, wherein the shRNA target sequence is shown as SEQ ID NO. 1, and/or the target sequence is shown as SEQ ID NO. 2, and/or the target sequence is shown as SEQ ID NO. 3. The constructed lentiviral vector realizes silencing of NCAPD2 genes in breast cancer cells, the expression level of NCAPD2 in the edited cells is obviously reduced, and a novel method and thinking are provided for treating breast cancer.

Description

shRNA of NCAPD2 gene and application thereof

Technical Field

The invention relates to the field of biomedical research, in particular to shRNA of NCAPD2 gene and application thereof.

Background

Breast cancer (breast cancer) is one of the most common malignant tumors in women, and usually occurs in mammary epithelial tissue. According to data statistics, the incidence rate of breast cancer accounts for 7-10% of various malignant tumors of the whole body. There is a 135 million new increase in breast cancer worldwide each year, with 42 deaths, an increment of 2% each year. More than 4 ten thousand women die from the disease every year in China, and although the women are not in the country with high incidence of breast cancer, the growth rate of the women is far higher than that of the women in other countries. Its pathogenesis has many influencing factors, and genetic susceptibility and gene-environment interaction are closely related to its occurrence, progress and metastasis. Although various oncogenes and oncogenes have been found through previous studies to improve the diagnosis rate of breast cancer and the therapeutic effect, the problem has not been completely solved. There is therefore a need for a thorough understanding of the molecular mechanisms of tumorigenesis, providing new and effective therapeutic approaches for the treatment of breast cancer patients. Early diagnosis and early treatment of breast cancer are key to reducing the mortality of breast cancer before the pathogenesis of breast cancer is not completely found.

NCAPD2 (non-SMC condensin I complex subunit D2) is one of the key components of the condosin I complex, mediating the recruitment and localization of the complex to the chromatin, mainly involved in the aggregation and isolation of the chromosome during the cell cycle. Therefore, the specific silencing NCAPD2 is important to the research on the action mechanism of the NCAPD2 in diseases, and provides an application basis for the treatment of related diseases.

RNA interference (RNAi) is a double-stranded RNA-mediated sequence-specific gene silencing phenomenon that is widely present in the body, and is widely used in scientific research and gene therapy because it can efficiently and specifically block the expression of specific genes in the body, resulting in specific gene silencing. Wherein, the shRNA is small hairpin RNA or short hairpin RNA (asmallhairpin RNAor short hairpin RNA, shRNA) is an exogenous RNA sequence with a stem-loop structure, can be processed into siRNA in cells, and the siRNA is combined with protein to form RNA-induced silencing complex (RNA-inducedsilencing complex, RISC) which is combined with homologous mRNA and induces degradation of the mRNA. The shRNA has strict targeting, the selection of specific target sites has a position effect, and different target sites have great difference on the interference efficiency of the same gene.

In the prior art, NCAPD2-siRNA is utilized to interfere with the expression of NCAPD2 gene mRNA, but the interference effect is not obvious enough, the transfection efficiency is low, the cytotoxicity is high, and the long-acting stable interference cannot be realized.

Disclosure of Invention

In view of the shortcomings of the prior art, the invention provides shRNA of NCAPD2 gene and application thereof, the shRNA and a slow virus vector constructed by the shRNA realize silencing of NCAPD2 gene in breast cancer cells, the expression level of NCAPD2 in the edited breast cancer cells is obviously reduced, and a novel method and thinking are provided for treating breast cancer.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided an shRNA, the shRNA target sequence is shown in SEQ ID NO. 1, and/or,

the target sequence is shown as SEQ ID NO. 2, and/or,

the target sequence is shown as SEQ ID NO. 3;

preferably, the shRNA comprises a sense strand and an antisense strand, and a stem-loop structure linking the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment being complementary, and the sequence of the sense strand segment being substantially identical to a target sequence in an NCAPD2 gene.

The shRNA comprises a sequence shown as SEQ ID NO. 4-5, and/or,

SEQ ID NOS 6 to 7, and/or,

the nucleic acid sequences shown in SEQ ID NOS 8 to 9.

In a preferred embodiment, the shRNA is a nucleic acid sequence as shown in SEQ ID NOS.8-9.

In the invention, SEQ ID NO 4-5 are positive and negative sense strands, SEQ ID NO 6-7 are positive and negative sense strands, and SEQ ID NO 8-9 are positive and negative sense strands.

In a second aspect of the present invention, there is provided an shRNA expression vector comprising an shRNA of the first aspect;

preferably, the expression vector comprises a viral vector;

preferably, the viral vector comprises any one of a lentiviral vector, a retroviral vector or an adeno-associated viral vector, preferably a lentiviral vector.

In a third aspect of the present invention, there is provided a method for preparing the shRNA expression vector according to the second aspect, the method comprising the steps of:

(1) Designing shRNA according to the sequence of NCAPD2 gene;

(2) Inserting shRNA into an expression vector to obtain the shRNA expression vector;

preferably, the expression vector is BR-V108;

preferably, the shRNA is inserted into the agoi and EcoRI cleavage sites of the expression vector.

In a fourth aspect of the invention, there is provided a recombinant lentivirus prepared by co-transfecting mammalian cells with an expression vector as described in the second aspect and a packaging helper plasmid.

Preferably, the mammalian cells comprise any one or a combination of at least two of 293 cells, 293T cells or 293F cells, preferably 293T cells.

In a fifth aspect, the invention provides the use of an shRNA as described in the first aspect, an shRNA expression vector as described in the second aspect or a recombinant lentivirus as described in the third aspect for the preparation of a kit for reducing the expression of an NCAPD2 gene or protein in a cell.

In a sixth aspect of the invention, there is provided a host cell transfected with any one or a combination of at least two of a shRNA as described in the first aspect, a shRNA expression vector as described in the second aspect or a recombinant lentivirus as described in the fourth aspect.

Preferably, the host cell comprises a tumor cell;

preferably, the tumor cells comprise breast cancer cells.

In a seventh aspect of the invention, there is provided a method of silencing an NCAPD2 gene, the method comprising: silencing of the NCAPD2 gene is performed by transfecting the shRNA of the first aspect, the shRNA expression vector of the second aspect, or the recombinant lentivirus of the fourth aspect into a host cell.

In an eighth aspect of the invention there is provided an NCAPD2 inhibitor comprising any one or a combination of at least two of the shRNA as described in the first aspect, the shRNA expression vector as described in the second aspect or the recombinant lentivirus as described in the fourth aspect.

In a ninth aspect of the invention, there is provided a pharmaceutical composition comprising any one or a combination of at least two of a shRNA as described in the first aspect, a shRNA expression vector as described in the second aspect, a recombinant lentivirus as described in the fourth aspect, a host cell as described in the sixth aspect or an NCAPD2 inhibitor as described in the eighth aspect.

Preferably, the pharmaceutical composition further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

In a tenth aspect of the invention, there is provided the use of a shRNA according to the first aspect, a shRNA expression vector according to the second aspect, a recombinant lentivirus according to the fourth aspect, a host cell according to the sixth aspect, an inhibitor of NCAPD2 according to the eighth aspect or a pharmaceutical composition according to the ninth aspect for the manufacture of a medicament for the treatment of a disease associated with NCAPD 2.

Preferably, the disease associated with NCAPD2 includes breast cancer.

The invention takes NCAPD2 gene as an acting object, screens medicines to find out an inhibitor capable of inhibiting the expression of human NCAPD2 gene as an alternative medicine for treating breast cancer. The NCAPD2 gene small interfering RNA (shRNA) is obtained by taking a human NCAPD2 gene as an action object and can be used as a medicament with the effect of inhibiting breast cancer cell proliferation. In addition, for example, antibody drugs, small molecule drugs, and the like can be targeted to the NCAPD2 gene.

The drug for treating the NCAPD2 related diseases is a molecule capable of specifically inhibiting the transcription or translation of NCAPD2 genes or specifically inhibiting the expression or activity of NCAPD2 proteins, and down-regulating CDK1, EIF3C and PSMC2 expression and up-regulating MAPK9 expression, so that the expression level of NCAPD2 genes in breast cancer cells is reduced, proliferation and migration of the breast cancer cells are inhibited, and apoptosis is promoted to achieve the purpose of treatment. Specifically, a drug effective to reduce the expression level of the human NCAPD2 gene is administered to a patient during treatment.

The amount of the drug administered is a dose sufficient to reduce transcription or translation of the human NCAPD2 gene, or to reduce expression or activity of the human NCAPD2 protein. Such that the expression of the human NCAPD2 gene is reduced by at least 50%, 80%, 90%, 95% or 99%.

Based on the technical scheme, the invention has the following beneficial effects:

the RNAi method is adopted to down regulate the expression of human NCAPD2 genes, so that proliferation of breast cancer cells can be effectively inhibited, apoptosis can be promoted, and invasion progress of breast cancer can be effectively controlled.

The invention successfully screens shRNA with high transfection efficiency and high interference efficiency, constructs a nucleic acid construct and slow virus containing the shRNA sequence, can effectively interfere NCAPD expression in cells, inhibit proliferation rate of breast cancer cells, inhibit migration and invasion of the breast cancer cells and promote apoptosis of the breast cancer cells, thereby treating the breast cancer and opening up a new direction for breast cancer treatment.

Drawings

FIG. 1NCAPD2 different expression levels and prognosis survival;

FIG. 2NCAPD2 shows the condition in breast cancer cells;

FIG. 3 fluorescence detection of lentivirus infected target cells;

FIG. 4qRT-PCR screening for effective interfering targets;

FIG. 5 expression levels of NCAPD2 mRNA in shNCAPD2 transfected breast cancer cells;

FIG. 6 expression levels of NCAPD2 protein in shNCAPD2 transfected breast cancer cells;

FIG. 7 effect on proliferation of breast cancer cells after knockdown of NCAPD 2;

FIG. 8 effect on breast cancer apoptosis after knockdown of NCAPD 2;

FIG. 9 effect on breast cancer cell cycle after knockdown of NCAPD 2;

FIG. 10 effect on breast cancer cell migration after knockdown of NCAPD 2;

figure 11 effect on breast cancer cell invasion after knockdown of NCAPD 2.

Detailed Description

The following examples are illustrative of the invention and are not intended to limit the scope of the invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.

Example 1 tissue chip and HE staining

1. Sample information

153 cases of postoperative specimens of breast cancer patients who are collected and treated in 2004 to 2008 of Shenzhen Hospital, beijing university were collected. All patients did not receive radiation and chemotherapy prior to surgery, with complete clinical data. As a control, 11 cases of cancer-side tissue excised by the same surgery were also taken. All samples were fixed with 10% formalin and embedded in conventional paraffin.

2. Immunohistochemistry

To investigate the expression of NCAPD2 in breast cancer tissue and its relationship to patient prognosis. The inventors examined the expression of NCAPD2 in a tissue chip containing 153 cases of breast cancer and 11 cases of paracancerous tissue by means of immunohistochemistry.

Tissue chip preparation and immunohistochemical experiments were all completed by Shanghai exemplary Barui Biotechnology Co., ltd. Immunohistochemistry was performed using the IHC thirteen point scoring standard:

positive cell score in sample: cytoplasmic, membranous or nuclear no positive signal <0% -0 min-negative;

0% < positive cells in <25%1 min-positive;

the positive cell proportion is less than or equal to 25 percent and less than 50 percent and is 2 minutes positive;

the positive cell proportion is less than or equal to 50 percent and less than 75 percent and 3 minutes is positive;

positive cells with the proportion of more than or equal to 75 percent are 4 minutes positive;

scoring according to sample staining color intensity: cytoplasmic, membrane or nuclear staining depth score 0-3 points;

no signal color of cytoplasm, cell membrane or nucleus and interstitium is 0 min-negative;

1 minute-positive of pale yellow cytoplasm, cell membrane or nucleus and interstitial;

cytoplasmic, membrane or nuclear and interstitial brown yellow 2 min-positive;

cytoplasmic, membranous or nuclear and interstitial dark brown 3 min-positive;

results: positive cell score staining color intensity score determines IHC results, with higher scores for higher antibody expression.

0 min-negative, 1-4 min-positive, 5-8 min-positive++, 9-12 min-positive++.

3. Statistical method

Statistical analysis was performed using SPSS18.0 statistical software, the measured data were expressed as mean.+ -. Standard deviation (x.+ -. S), and the counted data were expressed as n. Correlation between NCAPD2 protein and clinical case characteristics was examined using a nonparametric Mann-Whitney U. Single factor survival analysis was performed using Kaplan-Meier method. When P <0.05, the difference is statistically significant.

4. Results

The results showed that the NCAPD2 gene was significantly more expressed in breast cancer tissue than in paracancestral tissue (P < 0.001) (Table 1). The expression of the NCAPD2 gene was found to be positively correlated with lymphatic metastasis (N), i.e., the expression of the NCAPD2 gene increased as the malignancy of the patient increased, as a result of Mann-Whitney U analysis, which was found to be significantly correlated with breast cancer lymph node metastasis (N) (p=0.041) (Table 2), as well as Spearman-scale correlation analysis.

Kaplan-Meier analysis showed (fig. 1) that the expression of the NCAPD2 gene was significantly correlated with the total survival (over all survival) of breast cancer, i.e., patient survival was shortened as the expression of the NCAPD2 gene was increased in the patient. The NCAPD2 gene can be related to the occurrence, the development and the prognosis of the breast cancer, and can be used as a drug target point for treating the breast cancer.

TABLE 1 analysis of immunohistochemical expression conditions in breast cancer tissues and paracancerous tissues

TABLE 2 relation of NCAPD2 expression to tumor characteristics in breast cancer patients

Example 2 differential expression of NCAPD2 Gene in breast cancer cell lines

1. Cell culture

Human breast cancer cell lines MCF-7, MDA-MB-231, MDA-MB-453, HS578T and human breast ductal cancer cell BT-549 (ATCC) were cultured in DMEM medium containing 10% fetal bovine serum at 37deg.C, 5% CO ₂ Culturing in an incubator with a relative humidity of 90%. The solution was changed 1 time from 2 to 3 days and passaged by routine digestion with 0.25% trypsin containing EDTA.

2. RNA extraction

1) Collecting cells, centrifuging at 2000rpm for 5min, removing supernatant, adding 1ml Trizol into cell precipitate, mixing thoroughly, standing at room temperature for 5min, and transferring to new 1.5ml EP tube;

2) 200 μl of chloroform was added to each tube, the eppendorf tube was turned upside down by hand for 15s, and left standing at room temperature for 10min;

3) Centrifuging at 4 ℃ at 12800rpm for 10min;

4) Sucking the upper liquid, transferring to a new 1.5ml EP tube, adding equal volume of precooled isopropanol, mixing uniformly, and standing at 4 ℃ for 10min;

5) Centrifuging at 12800rpm at 4deg.C for 10min, and discarding supernatant;

6) 1ml of 75% ethanol (freshly prepared with DEPC water) was added and the precipitate washed;

7) Centrifuging at 11800rpm at 4deg.C for 5min, and discarding most supernatant;

8) Centrifuging at 11800rpm at 4deg.C for 5min, and discarding supernatant; drying at room temperature;

9) When the RNA precipitate was substantially transparent, RNase-free water (volume added depends on the amount of RNA precipitate) was added until complete dissolution, and the concentration and quality of the extracted RNA was determined by Nanodrop 100 spectrophotometry.

3. RNA reverse transcription to obtain cDNA (according to the instructions of the Vazyme company Hiscript QRT supermix for qPCR (+gDNA WIPER)

The method comprises the following specific steps:

1) Adding 4 XgDNA wind mix and 1.0 mu g total RNA into PCR water tube, supplementing RNase-Free H ₂ O to 8 μl, mixing, centrifuging, and bathing at 42 deg.C for 2min;

2) Adding 5X qPCR supermix 55 ℃ for 15min and 85 ℃ for 2min for reverse transcription;

3) And (3) placing the obtained RT product-cDNA at the temperature of-80 ℃ for standby.

4. Real-time PCR detection

1) Amplification primers:

NCAPD2 Gene:

upstream primer 3'-TCCATCAAACATCTTCCACCAC-5' (EQ ID NO: 12);

the downstream primer 3'-GAGGCCAGGATCTATACTTCG-5' (SEQ ID NO: 13).

GAPDH gene:

the upstream primer 3'-TGACTTCAACAGCGACACCCA-5' (SEQ ID NO: 14);

the downstream primer 3'-CACCCTGTTGCTGTAGCCAAA-5' (SEQ ID NO: 15).

2) The reaction system was prepared according to the AceQ qPCR SYBR Green master mix instructions and the reaction system is shown in Table 3:

TABLE 3 reaction system

3) The Real-Time PCR procedure was performed as follows: 95 ℃ for 1min; (95 ℃ 10s,60 ℃ 30 s) 45 cycles; 95℃15s,55℃60s,95℃15s.

5. Data analysis

Relative quantitative analysis

Delta Ct = target gene Ct value-reference gene Ct value;

- ΔΔct=nc group Δct average-sample Δct values;

reflecting the relative expression level of each sample relative to the NC group sample target gene.

6. Results

The results are shown in FIG. 2, where NCAPD2 is highly expressed in MCF-7, MDA-MB-231, MDA-MB-453, HS578T and BT-549 cells.

EXAMPLE 3 NCAPD2-shRNA lentiviral vector construction

The main reagent materials of this example are as follows: lentiviral vectors and packaging systems (BR-V lentiviral vector series, pHelper 1.0 vector and pHelper 2.0 vector), 293T cells were purchased from Shanghai Berile Biomedicine technologies Co., ltd; TOP10 E.coli competent cells were purchased from TIANGEN; age I, ecoRI, cutSmart Buffer from NEB; taq Plus DNA Polymerase from Vazyme, cat. #P201-D3; t4 DNA Ligase was purchased from Fermentas Cat. # EL0016; TIANgel Midi Purification Kit, endoFree Maxi Plasmid Kit are available from TIANGEN;

1. RNA interference target design

According to the design principle of the RNA interference sequence, a NCAPD2 (NM_ 014865.3) gene sequence in GenBank is used as a template, and a plurality of 19-21 nt RNA interference target sequences are designed. After evaluation and measurement by designed software, the following sequences are selected as interference targets:

Human-NCAPD2-1(Pbr17597)：CAGGTTCTCAGTGGCGATCAA，SEQ ID NO:1；

Human-NCAPD2-2(Pbr17598)：TTGCATCACTTTCGAAGTATA，SEQ ID NO:2；

Human-NCAPD2-3(Pbr17599)：TTGGATGGAATCAAGGAGCTT，SEQ ID NO:3。

2. DNA oligo sequence synthesis and preparation

And designing a shRNA interference sequence according to the selected target sequence, and adding proper restriction enzyme cutting sites at two ends to complete the construction of the vector. In addition, TTTTT termination signal was added to the 3 '-end of the forward strand, and termination signal complementary sequence was added to the 5' -end of the reverse strand (Table 4, after completion of the design, single-stranded DNA oligo was synthesized by Jin Wei Intelligence Co., ltd. The synthesized single-stranded DNA oligo was dissolved in annealing buffer (final concentration 100M), water bath was conducted at 90℃for 15min, and after naturally cooling to room temperature, a double strand with sticky ends was formed.

TABLE 4 shRNA interference sequences

X CCGG: an AgeI cleavage site; AATTC: ecoRI cleavage site; g: ecoRI cleavage site complement.

3. Linearized support preparation

A50. Mu.l reaction system was prepared according to NEB instructions and linearized using the Age I and EcoR I double digested BR-V108 vector shown in Table 5.

Table 5 enzyme digestion System

After reaction at 37℃for 1 hour (optimum temperature), the target fragment was recovered by 1% agarose gel electrophoresis of the vector cleavage product.

4. Ligation of the fragment of interest with the vector

A20. Mu.l reaction system was prepared according to Fermentas T4 DNA Ligase instruction, and double-stranded DNA was ligated to linearized vector as shown in Table 6.

Table 6 linking System

The reaction was carried out at 16℃for 1h to 3h, after which the transformation experiment was carried out.

4. PCR identification and sequencing of transformed and positive clones

Adding 10 μl of the ligation product into 100 μl of Escherichia coli competent cells, ice-bathing for 30min, and heat-shocking at 42deg.C for 90s, ice-bathing for 2min; adding 500 μl of LB liquid medium without antibiotics, shake culturing at 37deg.C at 200rpm for 1hr; the bacterial liquid is evenly smeared on LB solid medium containing Amp, and cultured overnight in a 37 ℃ incubator. And (3) selecting a single colony, carrying out PCR identification, selecting positive clones, sequencing (Shanghai, bairui biological medicine science and technology Co., ltd.), and carrying out sequencing comparison, wherein the positive clones are identified to be the NCAPD2-shRNA lentiviral vector successfully constructed.

5. Lentivirus packaging and titer determination

The extracted BR-V108 (plasmid extraction reagent of Qiagen company) was co-transfected with pHelper 1.0 plasmid and pHelper 2.0 plasmid into 293T cells (transfection reagent is provided by exemplary Berui company), virus supernatant was collected at 48h, cell morphology and GFP expression were observed, the extracted virus was purified and concentrated, virus titer was measured by gradient dilution method, and the prepared virus concentrate was sub-packaged at-80℃for preservation.

EXAMPLE 4 viral infection of breast cancer cells

At 2X 10 ⁵ Cell density cells were seeded in 6-well plates and virus dilutions were added after 24 hours:

BT549 cells: experimental group (LV-shNCAPD 2 group) added with virus dilution containing NCAPD2-shRNA lentivirus, 6.7 μl/well, virus titer was 3×10 ⁸ TU/mL (multiplicity of infection MOI=10); control group (LV-shCtrl) added with 5. Mu.L of virus dilution containing negative control lentivirus with a virus titer of 4X 10 ⁸ TU/mL。

MDA-MB-231 cells: experimental group (LV-shNCAPD 2 group) added with virus dilution containing NCAPD2-shRNA lentivirus, 3.3 μl/well, virus titer was 3×10 ⁸ TU/mL (multiplicity of infection MOI=5); control group (LV-shCtrl) added with 2.5. Mu.L of virus dilution containing negative control lentivirus with a virus titer of 4X 10 ⁸ TU/mL。

After culturing for 12 hours and replacing the culture medium and culturing for 72 hours, fluorescence and infection efficiency are observed under a microscope. If the fluorescence efficiency is more than 80%, the cell state is good, and the cell fusion degree is more than 80%, the infection is successful.

The control and target lentiviruses were observed under a microscope at 72 hours after infection of target cells (MDA-MB-231, BT549 cells), and the observation results showed that the cell infection efficiency reached 80% or more and the cell state was normal, as shown in FIG. 3.

Example 5 qRT-PCR screening for effective interfering targets

Experimental grouping: uninfected cell group (CON), infected negative control cell group (shCtrl), infected shRNA1 cell group (RNAi-Pbr 17597), infected shRNA2 cell group (RNAi-Pbr 17598), infected cell group (RNAi-Pbr 17599).

The procedure was followed as in example 2. Real-time quantitative PCRThe method is used for relative quantitative analysis.

The qRT-PCR results are shown in FIG. 4, and in MDA-MB-231 cells, after lentiviral infection, compared to shCtrl group:

the gene knockout efficiency of shNCAPD2 (RNAi-Pbr 17597) group NCAPD2 is 78.1 percent (P < 0.001);

the gene knockout efficiency of shNCAPD2 (RNAi-Pbr 17598) group NCAPD2 is 81.6 percent (P < 0.001);

the gene knockout efficiency of shNCAPD2 (RNAi-Pbr 17599) group NCAPD2 is 85.2% (P < 0.001).

Among them, shRNA-Pbr17599 had the highest silencing efficiency (for subsequent experiments).

Example 6 qRT-PCR detection of Gene knockout efficiency at the mRNA level

After 72h of lentiviral infection, cells of the experimental group transfected with lentivirus (shNCAPD 2) and control group (shCtrl) were collected, respectively, and real-time quantitative PCR was performed according to the procedure of example 1, usingThe method is used for relative quantitative analysis.

The qRT-PCR results are shown in FIG. 5, after lentiviral infection: compared with shCtrl group, in BT549 cells, shNCAPD2 group NCAPD2 gene knockout efficiency was 76.9% (P < 0.001).

In MDA-MB-231 cells, the shNCAPD2 group NCAPD2 gene knockout efficiency was 85.2% (P < 0.001).

EXAMPLE 7 Western blot detection of NCAPD2 protein level silencing efficiency in cells

After the lentivirus is infected for 72 hours, the cells of an experimental group (shNCAPD 2) and a control group (shCtrl) transfected with the lentivirus are respectively collected, total proteins of the groups are extracted, the cultured cells are fully contacted and cracked with a lysate, and then transferred to a centrifuge tube for violent shaking for 30 seconds, the supernatant is taken out, and the protein concentration is measured by a BSA method. Adding a proper amount of loading buffer solution, boiling and denaturing at 100 ℃ for 5min; 50 μg per well, 80V constant pressure SDS-PAGE electrophoresis, and electrotransfer of proteins onto PVDF membrane at 4deg.C under 300mA constant current conditions for 90 min. Sealing 5% skim milk at room temperature for 1h, adding Rabbit Anti-human NCAPD2 monoclonal antibody, diluting 1:1000 (abcam, ab 137075), rabbit Anti-human GAPDH antibody, diluting 1:3000 (Bioworld, AP 0063)), rinsing 10min x 3 times in TBST the next day overnight at 4 ℃, adding HRP-labeled secondary antibody (coat Anti-Rabbit dilution 1:3000 (Beyotide, A0208)) and incubating at room temperature for 1h, rinsing 10min x 3 times with Millipore immobilon Western Chemiluminescent HRP Substrote kit for color development; chemiluminescent imagers emit chemiluminescence.

The Western blot results are shown in FIG. 6, and after lentiviral infection, the NCAPD2 protein level of the shNCAPD2 group is reduced (P < 0.05) compared with that of the shCtrl group.

EXAMPLE 8 Celigo cell count assay of the Effect of silencing NCAPD2 on cell proliferation potency

1. Cell transfection procedure was as in example 3

2. Celigo cell count to detect cell proliferation

1) After pancreatin digestion of each experimental group in logarithmic growth phase, the complete culture medium was resuspended into cell suspension, and counted;

2) The plating cell density was determined according to the cell growth rate (most cell plating numbers were set at 2000 cells/well). 3 multiple wells per group, the culture system is 100 mu L/well, and the cell number added per well is ensured to be consistent with 37 ℃ and 5% CO in the plating process ₂ Culturing in an incubator;

3) Starting from the second day after the plate is paved, celigo is detected and read once every day, and the plate is continuously detected and read for 5 days;

4) Accurately calculating the number of cells with green fluorescence in each scanning hole plate by adjusting the input parameters of analysis settings; statistical plots were made on the data to plot 5 day cell proliferation curves.

Celigo cell count results are shown in FIG. 7, compared to shCtrl group after lentiviral transfection:

in BT549 cells, shNCAPD group 2 cells proliferated at a slower rate (P < 0.01);

in MDA-MB-231 cells, shNCAPD group 2 cells proliferated at a slower rate (P < 0.001).

Example 9 apoptosis detection

(1) Drug-induced apoptosis was achieved when 6-well plate cells of each experimental group were grown to a coverage of approximately 70%.

(2) In the case of adherent cells, the cells in the supernatant also need to be collected. Pancreatin digestion, complete culture medium re-suspension of cell suspension, collection of supernatant cells in the same 5mL centrifuge tube, each group of three compound holes (to ensure that the number of cells on the machine is enough, the number of cells is more than or equal to 5 multiplied by 10) ⁵ Treatment). In the case of suspension cells, they are collected directly.

(3) 1300rmp was centrifuged for 5min, the supernatant was discarded, and the cell pellet was washed with 4℃pre-chilled D-Hanks (pH=7.2-7.4).

(4) The cell pellet was washed once with 1 Xbinding buffer, centrifuged at 1300rmp for 3min and the cells were collected.

(5) 200 μL of 1 Xbinding buffer resuspended cell pellet.

(6) Add 10. Mu.L Annexin V-APC staining, keep out of light for 10-15min at room temperature.

(7) According to the cell quantity, 400-800 mu L of 1×binding buffer is added, and the cell is checked on the machine.

The flow cytometry results are shown in fig. 8, in which the apoptosis rate of shNCAPD2 group is increased (P < 0.001) compared to shCtrl group after lentiviral infection.

Example 10 cell cycle detection

Inoculating each group of cells onto a 6-hole plate, digesting by pancreatin when the cell coverage reaches 80%, and collecting the cells after centrifugation; washing with PBS (pH 7.2) pre-cooled at 4deg.C, and centrifuging; fixing cells with 70% ethanol precooled at 4deg.C for at least 1h, centrifuging and washing cell pellet; PI cell stain (Sigma P4170) was added to 1ml for resuspension, incubated at 37 ℃ for 30min, and cell cycle was detected by flow cytometry (Millipore Guava easy Cyte HT). Three complex holes are arranged in each group.

The flow cytometry results are shown in fig. 9, which shows that after lentiviral infection, compared to the shCtrl group,

shNCAPD2 group BT549 cells increased in G2 phase cell percentage (P < 0.01);

the percentage of cells in the shNCAPD2 group MDA-MB-231 cells in the G2 phase is increased (P < 0.05).

Example 11 cell scratch assay

(1) According to the experimental design group, about 3×10 is added to the wells ⁴ The cells after infection are subjected to the condition that the confluency of the cells reaches more than 90% on the next day.

(2) The next day the low concentration serum medium was changed and the lower center of the 96 well plate was aligned using a streaker instrument and gently pushed upward to form a streak.

(3) The cells were gently rinsed 2-3 times with serum-free medium, low concentration serum medium (e.g., 0.5% FBS) was added, and photographed.

(4)37℃、5％CO ₂ Incubator culture, taking photos according to pre-experiment selection at proper time points (24 h, 48 h), taking photos by a fluorescence microscope (taking 96-well central shadow area as reference, scratch in the center of the picture).

(5) From the scored pictures, the cell mobilities of each group were calculated.

After the lentivirus infection of breast cancer cells, the mobility of the experimental group (shNCAPD 2) is compared with that of the control group (shCtrl), and the result is shown in FIG. 10, compared with the shCtrl group after the lentivirus infection,

shNCAPD2 group (48 h) BT549 cell mobility was reduced by 59% (P < 0.01);

shNCAPD2 group (48 h) MDA-MB-231 cells mobility was reduced by 32% (P < 0.001).

The result shows that NCAPD2 gene knockout can inhibit proliferation and migration of breast cancer cell strains BT549 and MDA-MB-231.

Example 12 Transwell Chamber in vitro invasion assay

1) Taking the required number of cells in a hollow 24-hole plate, adding 100 mu L of serum-free culture medium into the cells, and placing the cells in an incubator for 1-2 hours;

2) Preparing a cell suspension: pancreatin digests each group of cells in logarithmic growth phase, and resuspension is carried out by using low serum culture medium to prepare cell suspension;

3) The cell counting plate counts cells of the cell suspension;

4) After step 1 is completed, carefully remove the medium from the chamber;

5) 600. Mu.L of medium containing 30% FBS was added to the lower chamber;

6) Diluting the cells in a serum-free medium at a certain ratio, and adding 100. Mu.L of the cell suspension (containing 100000 ～ 200000 cells) into each cell;

7) Transferring the cells into a lower chamber containing 30% fbs medium with forceps;

8) Culturing 4-24hours in a tissue culture incubator;

9) The back-off chamber is placed on a piece of absorbent paper to remove the culture medium, and the cotton swab is used for gently removing non-transferred cells;

10 400 μl of staining solution was added to the wells of the 24-well plate;

11 Immersing the cells in the staining solution for 5min, and staining the transfer cells on the lower surface of the membrane;

12 The infusion chamber is rinsed several times in one large water cup. Air-drying in air.

13 Microscope photo film.

As shown in fig. 11, after lentiviral infection, the Transwell transfer rate was reduced by 70% (< 0.001) in shNCAPD2 BT549 cells compared to shCtrl group; transwell transfer rate was reduced by 51% in shNCAPD2 group MDA-MB-231 cells (P < 0.001).

While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Shenzhen Hospital at Beijing university

<120> shRNA of NCAPD2 gene and application thereof

<130> P200229

<141> 2020-06-29

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Human-NCAPD2-1（Pbr17597）

<400> 1

caggttctca gtggcgatca a 21

<210> 2

<211> 21

<212> DNA

<213> Human-NCAPD2-2（Pbr17598）

<400> 2

ttgcatcact ttcgaagtat a 21

<210> 3

<211> 21

<212> DNA

<213> Human-NCAPD2-3（Pbr17599）

<400> 3

ttggatggaa tcaaggagct t 21

<210> 4

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

ccggcaggtt ctcagtggcg atcaactcga gttgatcgcc actgagaacc tgtttttg 58

<210> 5

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

aattcaaaaa caggttctca gtggcgatca actcgagttg atcgccactg agaacctg 58

<210> 6

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ccggttgcat cactttcgaa gtatactcga gtatacttcg aaagtgatgc aatttttg 58

<210> 7

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

aattcaaaaa ttgcatcact ttcgaagtat actcgagtat acttcgaaag tgatgcaa 58

<210> 8

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ccggttggat ggaatcaagg agcttctcga gaagctcctt gattccatcc aatttttg 58

<210> 9

<211> 58

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

aattcaaaaa ttggatggaa tcaaggagct tctcgagaag ctccttgatt ccatccaa 58

<210> 10

<211> 57

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57

<210> 11

<211> 57

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

tccatcaaac atcttccacc ac 22

<210> 13

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

gaggccagga tctatacttc g 21

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

tgacttcaac agcgacaccc a 21

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

caccctgttg ctgtagccaa a 21

Claims

1. An shRNA for inhibiting NCAPD2 in breast cancer cells, which is characterized in that the shRNA target sequence is shown as SEQ ID NO. 3; the shRNA consists of a sense strand and an antisense strand; the sense strand and the antisense strand are nucleic acid sequences shown in SEQ ID NO. 8-9.

2. An shRNA expression vector for inhibiting NCAPD2 in a breast cancer cell, wherein the shRNA expression vector comprises the shRNA of claim 1.

3. A method of preparing the shRNA expression vector of claim 2, comprising the steps of: inserting the shRNA of claim 1 into an expression vector to obtain the shRNA expression vector.

4. A recombinant lentivirus for inhibiting NCAPD2 in breast cancer cells, wherein the recombinant lentivirus is prepared by co-transfecting mammalian cells with the expression vector of claim 2 and a packaging helper plasmid.

5. Use of the shRNA of claim 1, the shRNA expression vector of claim 2, or the recombinant lentivirus of claim 4 for the preparation of a kit for reducing the expression level of an NCAPD2 gene or protein in a breast cancer cell.

6. An inhibitor of NCAPD2 in a breast cancer cell, wherein the inhibitor of NCAPD2 is any one or a combination of at least two of the shRNA of claim 1, the shRNA expression vector of claim 2, or the recombinant lentivirus of claim 4.

7. Use of the shRNA of claim 1, the shRNA expression vector of claim 2, the recombinant lentivirus of claim 4, or the NCAPD2 inhibitor of claim 6 for the preparation of a medicament for inhibiting the expression level of NCAPD2 in breast cancer cells.