CN111705060A

CN111705060A - shRNA of NCAPD2 gene and application thereof

Info

Publication number: CN111705060A
Application number: CN202010608552.6A
Authority: CN
Inventors: 何劲松; 崔军威; 李锋; 高睿; 郭秋怡; 黄康华; 周子函
Original assignee: Peking University Shenzhen Hospital
Current assignee: Peking University Shenzhen Hospital
Priority date: 2020-06-29
Filing date: 2020-06-29
Publication date: 2020-09-25
Anticipated expiration: 2040-06-29
Also published as: CN111705060B

Abstract

The invention provides shRNA of an NCAPD2 gene and application thereof, wherein a target sequence of the shRNA is shown as SEQ ID NO. 1, and/or the target sequence is shown as SEQ ID NO. 2, and/or the target sequence is shown as SEQ ID NO. 3. The constructed lentiviral vector realizes the silencing of the NCAPD2 gene in the breast cancer cell, the expression level of NCAPD2 in the edited cell is obviously reduced, and a new method and an idea are provided for the treatment of the breast cancer.

Description

shRNA of NCAPD2 gene and application thereof

Technical Field

The invention relates to the field of biomedical research, in particular to shRNA of an NCAPD2 gene and application thereof.

Background

Breast cancer (breast cancer) is one of the most common malignancies in women, usually occurring in mammary epithelial tissue. According to statistics, the incidence rate of breast cancer accounts for 7-10% of various malignant tumors of the whole body. There are 135 million new breast cancers worldwide each year, 42 of them dying, with 2% annual increase. More than 4 million women die of the disease every year in China, and although the Chinese is not a country with high incidence of breast cancer, the growth rate of the Chinese is far higher than that of other countries. Its pathogenic factors are more, and genetic susceptibility and gene-environment interaction are closely related to its occurrence, progression and transfer. Although a variety of oncogenes and cancer suppressor genes have been found through previous studies to improve the diagnosis rate and treatment effect of breast cancer, the problems cannot be completely solved. There is therefore a need for a thorough understanding of the molecular mechanisms of tumorigenesis, which provides new and effective therapeutic approaches for the treatment of breast cancer patients. Early diagnosis and early treatment of breast cancer are key to reducing breast cancer mortality before the cause of breast cancer is not completely found.

NCAPD2(non-SMC condensin I complex Subunit D2) is one of the key components of the condensin I complex, mediates recruitment and localization of the complex on chromatin, and is primarily involved in chromosome condensation and segregation during the cell cycle. Therefore, specific silencing of NCAPD2 is crucial to the research of the action mechanism of NCAPD2 in diseases, and provides an application basis for the treatment of related diseases.

RNA interference (RNAi) is a phenomenon of sequence-specific gene silencing mediated by double-stranded RNA that is widely present in the body, and is widely used in scientific research and gene therapy because it can efficiently and specifically block the expression of specific genes in the body to cause specific gene silencing. The shRNA, namely small hairpin RNA or short hairpin RNA (shRNA) is an exogenous RNA sequence with a stem-loop structure, can be processed into siRNA in cells, and then the siRNA is combined with protein to form an RNA-induced silencing complex (RISC) which is combined to homologous mRNA and induces the degradation of the homologous mRNA. The shRNA has strict targeting effect, the selection of specific target sites has position effect, and the interference efficiency of different target sites to the same gene is greatly different.

At present, NCAPD2-siRNA is used for interfering the mRNA expression of NCAPD2 gene in the prior art, but the defects of not obvious enough interference effect, low transfection efficiency, high cytotoxicity and incapability of realizing long-acting stable interference exist.

Disclosure of Invention

In view of the defects of the prior art, the invention provides the shRNA of the NCAPD2 gene and the application thereof, the shRNA and the lentivirus vector constructed by the shRNA realize the silencing of the NCAPD2 gene in breast cancer cells, the expression level of NCAPD2 in the breast cancer cells after editing is obviously reduced, and a new method and a new thought are provided for the treatment of the breast cancer.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, a shRNA is provided, wherein a target sequence of the shRNA is shown as SEQ ID NO. 1, and/or,

the target sequence is shown as SEQ ID NO. 2, and/or,

the target sequence is shown as SEQ ID NO. 3;

preferably, the shRNA comprises a sense strand and an antisense strand, and a stem-loop structure linking the sense strand segment and the antisense strand segment, the sequences of the sense strand segment and the antisense strand segment are complementary, and the sequence of the sense strand segment is substantially identical to a target sequence in the NCAPD2 gene.

The shRNA comprises SEQ ID NO 4-5, and/or,

6-7 of SEQ ID NO, and/or,

8-9 of SEQ ID NO.

In a preferred embodiment, the shRNA is a nucleic acid sequence shown as SEQ ID NO 8-9.

In the present invention, SEQ ID NOS 4 to 5 are positive and negative strands, SEQ ID NOS 6 to 7 are positive and negative strands, and SEQ ID NOS 8 to 9 are positive and negative strands.

In a second aspect of the present invention, there is provided a shRNA expression vector comprising the shRNA of the first aspect;

preferably, the expression vector comprises a viral vector;

preferably, the viral vector comprises any one of a lentiviral vector, a retroviral vector or an adeno-associated viral vector, preferably a lentiviral vector.

In a third aspect of the present invention, there is provided a method for preparing the shRNA expression vector of the second aspect, the method comprising the steps of:

(1) designing shRNA according to the sequence of the NCAPD2 gene;

(2) inserting shRNA into an expression vector to obtain the shRNA expression vector;

preferably, the expression vector is BR-V108;

preferably, the shRNA is inserted into the AgeI and EcoRI cleavage sites of the expression vector.

In a fourth aspect of the invention, there is provided a recombinant lentivirus prepared by co-transfecting a mammalian cell with the expression vector of the second aspect and a packaging helper plasmid.

Preferably, the mammalian cells comprise any one or a combination of at least two of 293 cells, 293T cells or 293F cells, preferably 293T cells.

In a fifth aspect of the invention, there is provided an application of the shRNA according to the first aspect, the shRNA expression vector according to the second aspect or the recombinant lentivirus according to the third aspect in preparing a kit for reducing the expression of the NCAPD2 gene or protein in a cell.

In a sixth aspect of the invention, there is provided a host cell transfected with any one of or a combination of at least two of the shRNA according to the first aspect, the shRNA expression vector according to the second aspect or the recombinant lentivirus according to the fourth aspect.

Preferably, the host cell comprises a tumor cell;

preferably, the tumor cells comprise breast cancer cells.

In a seventh aspect of the invention, there is provided a method of silencing the NCAPD2 gene, the method comprising: transfecting an shRNA according to the first aspect, an shRNA expression vector according to the second aspect or a recombinant lentivirus according to the fourth aspect into a host cell for silencing of the NCAPD2 gene.

In an eighth aspect of the invention, there is provided an inhibitor of NCAPD2, wherein the inhibitor of NCAPD2 comprises any one of or a combination of at least two of the shRNA according to the first aspect, the shRNA expression vector according to the second aspect or the recombinant lentivirus according to the fourth aspect.

In a ninth aspect of the invention, there is provided a pharmaceutical composition comprising any one of or a combination of at least two of the shRNA according to the first aspect, the shRNA expression vector according to the second aspect, the recombinant lentivirus according to the fourth aspect, the host cell according to the sixth aspect or the inhibitor of NCAPD2 according to the eighth aspect.

Preferably, the pharmaceutical composition further comprises any one or a combination of at least two of a pharmaceutically acceptable carrier, excipient or diluent.

In a tenth aspect of the present invention, there is provided an application of the shRNA of the first aspect, the shRNA expression vector of the second aspect, the recombinant lentivirus of the fourth aspect, the host cell of the sixth aspect, the NCAPD2 inhibitor of the eighth aspect, or the pharmaceutical composition of the ninth aspect in preparing a medicament for treating a disease associated with NCAPD 2.

Preferably, the disease associated with NCAPD2 comprises breast cancer.

The invention takes the NCAPD2 gene as an action object to screen medicines so as to find an inhibitor which can inhibit the expression of the human NCAPD2 gene as a candidate medicine for treating breast cancer. The NCAPD2 gene small interfering RNA (shRNA) is obtained by screening human NCAPD2 gene serving as an action object and can be used as a medicine for inhibiting the proliferation of breast cancer cells. In addition, the NCAPD2 gene can be used as an object of action, for example, an antibody drug, a small molecule drug, or the like.

The medicine for treating the NCAPD 2-related diseases is a molecule capable of specifically inhibiting the transcription or translation of NCAPD2 gene, or specifically inhibiting the expression or activity of NCAPD2 protein, and can down-regulate CDK1, EIF3C and PSMC2 expression and up-regulate MAPK9 expression, so that the expression level of NCAPD2 gene in breast cancer cells is reduced, the proliferation and migration of the breast cancer cells are inhibited, and the apoptosis is promoted to achieve the purpose of treatment. Specifically, in treatment, a drug effective in reducing the expression level of human NCAPD2 gene is administered to a patient.

The amount of the drug administered is a dose sufficient to reduce transcription or translation of the human NCAPD2 gene, or sufficient to reduce expression or activity of the human NCAPD2 protein. Such that the expression of the human NCAPD2 gene is reduced by at least 50%, 80%, 90%, 95% or 99%.

Based on the technical scheme, the invention has the following beneficial effects:

the invention adopts RNAi method to reduce the expression of NCAPD2 gene, which can effectively inhibit the proliferation of breast cancer cell, promote the apoptosis, and effectively control the invasion process of breast cancer.

The invention successfully screens the shRNA with high transfection efficiency and high interference efficiency and constructs the nucleic acid construct and the lentivirus containing the shRNA sequence, which can effectively interfere the expression of NCAPD in cells, inhibit the proliferation rate of breast cancer cells, inhibit the migration and invasion of the breast cancer cells and promote the apoptosis of the breast cancer cells, thereby treating the breast cancer and opening up a new direction for the treatment of the breast cancer.

Drawings

FIG. 1 differential expression levels of NCAPD2 and prognostic survival;

FIG. 2NCAPD2 expression in breast cancer cells;

FIG. 3 cellular fluorescence detection of lentivirus infected target cells;

FIG. 4qRT-PCR screening for effective interference targets;

FIG. 5 shows the expression level of NCAPD2 mRNA in shNCAPD 2-transfected breast cancer cells;

FIG. 6 shows the expression level of NCAPD2 protein in shNCAPD 2-transfected breast cancer cells;

figure 7 impact on breast cancer cell proliferation following knockdown of NCAPD 2;

figure 8 impact on apoptosis of breast cancer cells following knockdown of NCAPD 2;

figure 9 impact on breast cancer cell cycle following knockdown of NCAPD 2;

figure 10 impact on breast cancer cell migration following knockdown of NCAPD 2;

figure 11 impact on breast cancer cell invasion following knockdown of NCAPD 2.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 tissue chips and HE staining

1. Sample information

153 postoperative specimens of breast cancer patients collected from 2004 to 2008 of Shenzhen Hospital of Beijing university were collected. All patients do not receive radiotherapy and chemotherapy before operation and have complete clinical data. Another 11 cases of para-cancerous tissue removed by the same surgery were used as controls. All samples were fixed in 10% formalin and embedded in paraffin by convention.

2. Immunohistochemistry

To study the expression of NCAPD2 in breast cancer tissues and its relationship to patient prognosis. The inventors examined the expression of NCAPD2 in a tissue chip containing 153 cases of breast cancer and 11 cases of paracancerous tissues by an immunohistochemical method.

The preparation of the tissue chip and the immunohistochemical experiment are completed by the bio-pharmaceutical technology ltd of exemplary Beirui, Shanghai. Immunohistochemistry adopts IHC thirteen-point score standard:

positive cell score in sample: cytoplasm, no positive signal of cell membrane or cell nucleus < 0% -0 point-negative;

0% < positive cells < 25% 1 point-positive;

positive cells account for less than 50% and 2 points-positive cells with the proportion of more than 25%;

the proportion of positive cells is more than or equal to 50 percent and less than 75 percent, 3 points is positive;

the positive cells account for more than or equal to 75 percent and are divided into 4 points, namely positive cells;

scoring according to intensity of staining color of the sample: the staining depth of cytoplasm, cell membrane or nucleus is scored 0-3 points;

no signal color 0 score-negative in cytoplasm, cell membrane or nucleus and stroma;

cytoplasm, cell membrane or nucleus and interstitial light yellow 1 point-positive;

plasma, envelope or nucleus and stroma are brown-yellow 2 points-positive;

dark brown 3 points-positive for cytoplasm, cell membrane or nucleus and stroma;

as a result: positive cell score staining color intensity score judged IHC results, the higher the score the higher antibody expression.

Score 0-negative, score 1-4-positive, score 5-8-positive + +, score 9-12-positive + + +.

3. Statistical method

Statistical analysis was performed using SPSS18.0 statistical software, with the metrology data expressed as mean. + -. standard deviation (x. + -.s) and the count data instances expressed as n. The correlation between the NCAPD2 protein and clinical case characteristics was examined using a nonparametric Mann-Whitney U test. The Kaplan-Meier method is adopted to carry out single-factor survival analysis. When P <0.05, the difference was statistically significant.

4. Results

The results showed that the expression of the NCAPD2 gene was significantly higher in breast cancer tissues than in paracarcinoma tissues (P <0.001) (table 1). The Mann-Whitney U analysis shows that the gene is closely related to (p is 0.041) breast cancer lymph node metastasis (N) and the Spearman grade correlation analysis shows that the expression of the NCAPD2 gene is positively related to the lymph node metastasis (N), namely, the expression of the NCAPD2 gene is increased as the malignancy degree of a patient tumor is increased.

Kaplan-Meier analysis showed (fig. 1) that the expression of the NCAPD2 gene was significantly associated with the overall survival (Overallsurvival) of breast cancer, i.e. the patient's survival was shortened with increased expression of the NCAPD2 gene. The NCAPD2 gene is possibly related to the occurrence, development and prognosis of breast cancer and is possibly used as a drug target point for treating the breast cancer.

TABLE 1 analysis of immunohistochemical expression of breast cancer tissue and tissue adjacent to the cancer

TABLE 2 relationship between NCAPD2 expression and tumor characteristics in breast cancer patients

Example 2 differential expression of the NCAPD2 Gene in breast cancer cell lines

1. Cell culture

Human breast cancer cell lines MCF-7, MDA-MB-231, MDA-MB-453, HS578T and human ductal carcinoma cell BT-549(ATCC) in DMEM medium containing 10% fetal bovine serum at 37 deg.C and 5% CO₂And culturing in an incubator with relative humidity of 90%. The solution was changed 1 time 2-3 days and passaged by conventional digestion with 0.25% EDTA-containing trypsin.

2. RNA extraction

1) Collecting cells, centrifuging at 2000rpm for 5min, removing supernatant, adding 1ml Trizol into cell precipitate, mixing well, standing at room temperature for 5min, and transferring to new 1.5ml EP tube;

2) adding 200 μ l of chloroform into each tube, turning the eppendorf tube upside down by hand for 15s, and standing at room temperature for 10 min;

3) centrifuging at 12800rpm at 4 deg.C for 10 min;

4) absorbing the upper layer liquid, transferring to a new 1.5ml EP tube, adding equal volume of precooled isopropanol, mixing uniformly, and standing for 10min at 4 ℃;

5) centrifuging at 4 deg.C and 12800rpm for 10min, and removing supernatant;

6) adding 1ml of 75% ethanol (prepared by DEPC water fresh), washing the precipitate;

7) centrifuging at 11800rpm at 4 deg.C for 5min, and discarding most of supernatant;

8) centrifuging at 11800rpm at 4 deg.C for 5min, and removing supernatant; drying at room temperature;

9) when the RNA precipitate is basically transparent, RNase-free water (the addition volume depends on the RNA precipitate amount) is added until the RNA precipitate is completely dissolved, and the concentration and the quality of the extracted RNA are analyzed and determined by a Nanodrop 100 spectrophotometer.

3. Obtaining cDNA by RNA reverse transcription (according to the instructions of the Vzyme Hiscript QRT supermix for qPCR (+ gDNA WIPER))

The method comprises the following specific steps:

1) 4 XgDNA wiper mix and 1.0. mu.g total RNA were added to the PCR vial and RNase-FreeH was supplemented₂O to 8 mu l, mixing uniformly, centrifuging, and carrying out warm bath at 42 ℃ for 2 min;

2) adding 5 XqPCR supermix at 55 deg.C for 15min, and adding 85 deg.C for 2min to perform reverse transcription;

3) the RT product-cDNA obtained was stored at-80 ℃ for future use.

4. Real-time PCR assay

1) An amplification primer:

NCAPD2 gene:

upstream primer 3 '-TCCATCAAACATCTTCCACCAC-5' (EQ ID NO: 12);

the downstream primer 3 '-GAGGCCAGGATCTATACTTCG-5' (SEQ ID NO: 13).

GAPDH gene:

an upstream primer 3 '-TGACTTCAACAGCGACACCCA-5' (SEQ ID NO: 14);

the downstream primer 3 '-CACCCTGTTGCTGTAGCCAAA-5' (SEQ ID NO: 15).

2) The reaction system was configured in proportion according to the AceQ qPCR SYBR Green master mix instructions, as shown in Table 3:

TABLE 3 reaction System

3) The Real-Time PCR procedure was performed as follows: 1min at 95 ℃; (95 ℃ 10s, 60 ℃ 30s) 45 cycles; 95 ℃ for 15s, 55 ℃ for 60s, 95 ℃ for 15 s.

5. Data analysis

Relative quantitative analysis

Delta Ct is the Ct value of the target gene-Ct value of the reference gene;

the average value of Δ Ct for NC group- Δ Ct value for each sample;

reflecting the relative expression level of each sample relative to the target gene of the NC group sample.

6. Results

The results are shown in FIG. 2, where NCAPD2 was highly expressed in MCF-7, MDA-MB-231, MDA-MB-453, HS578T and BT-549 cells.

Example 3 NCAPD2-shRNA lentiviral vector construction

The main reagent materials of this example are as follows: lentivirus vectors and packaging systems (BR-V lentivirus vector series, pHelper 1.0 vector and pHelper2.0 vector), 293T cells from the Shanghai-yi Beirui biological medicine science and technology company; TOP10 E.coli competent cells were purchased from TIANGEN; age I, EcoRI, CutSmart Buffer from NEB; TaqPlus DNA Polymerase was purchased from Vazyme, # P201-D3; t4 DNA Ligase was purchased from Fermentas Cat. # EL 0016; TIANgel Midi Purification Kit, Endofree Maxi Plasmid Kit, available from TIANGEN;

1. RNA interference target design

According to the design principle of RNA interference sequences, a plurality of 19-21 nt RNA interference target sequences are designed by taking an NCAPD2 (NM-014865.3) gene sequence in GenBank as a template. After evaluation and determination by design software, the following sequences are selected as interference targets:

Human-NCAPD2-1(Pbr17597)：CAGGTTCTCAGTGGCGATCAA，SEQ ID NO:1；

Human-NCAPD2-2(Pbr17598)：TTGCATCACTTTCGAAGTATA，SEQ ID NO:2；

Human-NCAPD2-3(Pbr17599)：TTGGATGGAATCAAGGAGCTT，SEQ ID NO:3。

2. DNA oligo sequence synthesis and preparation

And designing shRNA interference sequences according to the selected target sequences, and adding appropriate restriction enzyme cutting sites at two ends to complete vector construction. In addition, TTTTT termination signal was added to the 3 'end of the plus strand, and the complementary sequence of termination signal was added to the 5' end of the minus strand (Table 4, after completion of the design, sent to Jinwei Corp. Single-stranded DNA oligo was synthesized, the synthesized single-stranded DNA oligo dry powder was dissolved in annealing buffer (final concentration 100M), and after water bath at 90 ℃ for 15min and natural cooling to room temperature, a double strand with sticky ends was formed.

TABLE 4 shRNA interference sequences

CCGG: an AgeI enzyme cleavage site; AATTC: EcoRI enzyme cutting sites; g: EcoRI restriction site complementary sequence.

3. Preparation of linearized vector

A50. mu.l reaction system was prepared according to the NEB instructions and linearized as shown in Table 5 using the Age I and EcoR I double digestion of the BR-V108 vector.

TABLE 5 enzyme digestion System

After reacting for 1h at 37 ℃ (optimum temperature), carrying out 1% agarose gel electrophoresis on the product of the enzyme digestion of the vector, and recovering the target fragment.

4. Ligation of the fragment of interest to the vector

A20. mu.l reaction was prepared according to Fermentas T4 DNA Ligase instructions, and double-stranded DNA was ligated to the linearized vector as shown in Table 6.

TABLE 6 linking system

After reaction at 16 ℃ for 1h-3h, the conversion experiment was carried out.

4. PCR identification and sequencing of transformation and positive clones

Adding 10 μ L of the ligation product into 100 μ L of Escherichia coli competent cells, ice-cooling for 30min, heat-shocking for 90s at 42 ℃, and ice-cooling for 2 min; adding 500 μ L LB liquid culture medium without antibiotics, shaking and culturing at 200rpm and 37 deg.C for 1 hr; and (3) uniformly coating the bacterial liquid on an LB solid culture medium containing Amp, and culturing in an incubator at 37 ℃ overnight. And selecting a single colony, carrying out PCR identification, selecting a positive clone for sequencing (Yibeirui biological medicine science and technology Co., Ltd., Shanghai), and identifying the positive clone to be the NCAPD2-shRNA lentiviral vector successfully constructed after sequencing comparison.

5. Lentiviral packaging and titer determination

The extracted BR-V108 (plasmid extraction reagent of Qiagen company) is co-transfected with pHelper 1.0 plasmid and pHelper2.0 plasmid into 293T cells (transfection reagent is provided by the company of Esperi), virus supernatant is collected at 48h, cell morphology and GFP expression are observed, the extracted virus is purified and concentrated, the virus titer is determined by adopting a gradient dilution method, and the prepared virus concentrate is subpackaged at-80 ℃ for storage.

EXAMPLE 4 Virus infection of Breast cancer cells

At 2 × 10⁵Cell seeding in 6-well plates, 24hours later virus dilutions were added:

BT549 cells, experimental group (LV-shNCAPD2 group), 6.7 uL/hole of virus diluent containing NCAPD2-shRNA lentivirus, and virus titer of 3 × 10⁸TU/mL (multiplicity of infection MOI 10); control group (LV-shCtrl) 5. mu.L of a virus dilution containing a negative control lentivirus with a virus titer of 4 × 10⁸TU/mL。

MDA-MB-231 cells, experimental group (LV-shNCAPD2 group) added with virus diluent containing NCAPD2-shRNA lentivirus, 3.3 mu L/hole, and virus titer of 3 × 10⁸TU/mL (multiplicity of infection MOI 5); adding virus diluent containing negative control lentivirus into control group (LV-shCtrl)2.5 μ L, viral titer 4 × 10⁸TU/mL。

After culturing for 12 hours, the medium was changed and culturing was continued for 72 hours, and then the fluorescence and infection efficiency were observed under a microscope. If the fluorescence efficiency is more than 80%, the cell state is good, and the cell fusion degree is more than 80%, the infection is successful.

Fluorescence observation under a microscope 72 hours after the control and target lentiviruses infect the target cells (MDA-MB-231 and BT549 cells), and the observation result shows that the cell infection efficiency reaches more than 80 percent and the cell state is normal, as shown in figure 3.

Example 5 qRT-PCR screening of effective interference targets

Grouping experiments: uninfected cell group (CON), infected negative control cell group (shCtrl), infected shRNA1 cell group (RNAi-Pbr17597), infected shRNA2 cell group (RNAi-Pbr17598) and infected cell group (RNAi-Pbr 17599).

The procedure was followed as in example 2. Real-time quantitative PCR

The method performs relative quantitative analysis.

The qRT-PCR results are shown in FIG. 4, and in MDA-MB-231 cells, after lentivirus infection, compared to shCtrl group:

the knockout efficiency of NCAPD2 gene of the shNCAPD2(RNAi-Pbr17597) group is 78.1% (P < 0.001);

the knockout efficiency of NCAPD2 gene of the shNCAPD2(RNAi-Pbr17598) group is 81.6% (P < 0.001);

the knockout efficiency of NCAPD2 gene of the shNCAPD2(RNAi-Pbr17599) group is 85.2% (P < 0.001).

Among them, shRNA-Pbr17599 was most effective in silencing (used in subsequent experiments).

Example 6 detection of Gene knockout efficiency at mRNA level by qRT-PCR

After 72h of lentivirus infection, the lentivirus-transfected cells (shNCAPD2) and control cells (shCtrl) were collected separately and subjected to real-time quantitative PCR according to the procedure of example 1, using

The method performs relative quantitative analysis.

The qRT-PCR results are shown in fig. 5, after lentiviral infection: compared with shCtrl group, the knockout efficiency of NCAPD2 gene of shNCAPD2 group in BT549 cells is 76.9% (P < 0.001).

The knockout efficiency of the NCAPD2 gene of the shNCAPD2 group in MDA-MB-231 cells was 85.2% (P < 0.001).

Example 7 Western blot assay for efficiency of silencing of NCAPD2 protein levels in cells

And after the lentivirus is infected for 72 hours, respectively collecting the cells (shNCAPD2) of an experimental group and a control group transfected with the lentivirus, extracting the total protein of each group, fully contacting and cracking the cultured cells with a lysate, transferring the cells to a centrifugal tube, violently shaking for 30s, taking out the supernatant, and determining the protein concentration by a BSA method. Adding appropriate amount of sample buffer solution, boiling at 100 deg.C for denaturation for 5 min; 50 μ g of protein per well, 80V constant pressure SDS-PAGE, and transferring the protein to PVDF membrane by electric rotation for 90min under the conditions of 4 ℃ and 300mA constant current. 5% skimmed milk, sealing at room temperature for 1h, adding Rabbit Anti-human NCAPD2 monoclonal antibody, diluting at 1:1000 (abcam, ab137075), Rabbit Anti-human GAPDH antibody, diluting at 1:3000 (Bioworld, AP0063)), standing overnight at 4 deg.C, rinsing at TBST for 10min x 3 times the next day, adding HRP-labeled secondary antibody (Goat Anti-Rabbit dilution 1:3000(Beyotime, A0208)) and incubating at room temperature for 1h, rinsing at TBST for 10min x 3 times, and developing with IMMOBILE Western ChemildingHRP substrate kit from Millipore corporation; the chemiluminescent imager performs chemiluminescence.

Western blot results are shown in FIG. 6, which shows that the protein level of NCAPD2 in shNCAPD2 group is reduced compared with that in shCtrl group (P <0.05) after lentivirus infection.

Example 8 Celigo cell count assay the Effect of silencing NCAPD2 on cell proliferation Capacity

1. Cell transfection procedure as in example 3

2. Celigo cell count detection of cell proliferation

1) After the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out;

2) plating cell density (mostly) is determined according to the growth speed of cellsThe number of cell plates was set at 2000 cells/well). Each group has 3 multiple wells, the culture system is 100 μ L/well, and the number of cells added into each well is 37 deg.C and 5% CO in the plating process₂Culturing in an incubator;

3) starting from the next day after the plate laying, once per day, Celigo detection and plate reading are carried out, and the plate reading is continuously carried out for 5 days;

4) accurately calculating the number of cells with green fluorescence in each scanning pore plate by adjusting input parameters of analysis settings; the data were statistically plotted and cell proliferation curves were plotted for 5 days.

Results of Celigo cell counts as shown in fig. 7, after lentiviral transfection, compared to shCtrl groups:

in the BT549 cells, the shNCAPD2 group cells have slower proliferation speed (P < 0.01);

in MDA-MB-231 cells, the shNCAPD2 group cells proliferated slowly (P < 0.001).

Example 9 apoptosis assay

(1) When the 6-well plate cells of each experimental group grow to the coverage rate of about 70%, the drug induces apoptosis.

(2) Pancreatin digestion, re-suspending the complete culture medium into cell suspension, collecting the cell suspension and the supernatant in the same 5mL centrifuge tube, and setting three multiple holes in each group (to ensure the number of cells on machine is enough, the number of cells is not less than 5 × 10)⁵Treatment). And directly collecting the suspension cells.

(3)1300rmp was centrifuged for 5min, the supernatant was discarded, and the cell pellet was washed with 4 ℃ precooled D-Hanks (pH 7.2-7.4).

(4) The cell pellet was washed once with 1 Xbinding buffer, centrifuged at 1300rmp for 3min, and the cells were collected.

(5)200 μ L of 1 XBinding buffer resuspended cell pellet.

(6) Add 10. mu.L Annexin V-APC staining, and keep away from light for 10-15min at room temperature.

(7) According to the cell amount, 400-800. mu.L of 1 XBinding buffer is added and the detection is carried out on the machine.

Flow cytometry results are shown in fig. 8, where the apoptosis rate of shNCAPD2 group was higher than that of shCtrl group after lentivirus infection (P < 0.001).

Example 10 cell cycle assays

Inoculating each group of cells onto a 6-hole plate, digesting with pancreatin when the cell coverage rate reaches 80%, centrifuging and collecting the cells; after washing with 4 ℃ precooled PBS (pH 7.2), centrifugation was carried out; fixing the cells for at least 1h by using 70% ethanol pre-cooled at 4 ℃, centrifuging and washing cell precipitates; 1ml of resuspended PI cell stain (Sigma P4170) was added, incubated at 37 ℃ for 30min and the cell cycle was monitored by flow cytometry (Millipore Guava easy Cyte HT). Each group is provided with three multiple holes.

Flow cytometry results as shown in fig. 9, after lentiviral infection, compared to shCtrl group,

the G2 phase cell percentage of the shNCAPD2 group BT549 cells is increased (P < 0.01);

the percentage of G2 cells in the shNCAPD2 group MDA-MB-231 cells is increased (P < 0.05).

Example 11 cell scratch test

(1) About 3 × 10 was added to the wells according to the experimental design group⁴The infected cells were treated to achieve a cell confluence of 90% or more the next day.

(2) The low-concentration serum culture medium is changed the next day, the central part of the lower end of the 96-well plate is aligned by using a scratch instrument, and the lower end of the 96-well plate is slightly pushed upwards to form a scratch.

(3) Serum-free medium is used to gently rinse 2-3 times, and low-concentration serum medium (e.g., 0.5% FBS) is added to photograph.

(4)37℃、5％CO₂The culture box is used for culturing, and the appropriate time points are selected according to the preliminary experiment to take pictures (24 h and 48h are selected), and the pictures are taken by a fluorescence microscope (the central shaded area of the 96-well is taken as a reference, and the scratch is in the middle of the picture).

(5) From the post-scratch pictures, the cell mobilities of each group were calculated.

After the lentivirus infected breast cancer cells, the mobility of the experimental group (shNCAPD2) was compared with that of the control group (shCtrl), and the results are shown in FIG. 10,

the mobility of the BT549 cells in the shNCAPD2 group (48h) is reduced by 59 percent (P < 0.01);

the shNCAPD2 group (48h) had a 32% reduction in MDA-MB-231 cell mobility (P < 0.001).

The results show that the NCAPD2 gene knockout can inhibit the proliferation and migration of breast cancer cell strains BT549 and MDA-MB-231.

Example 12 Transwell Chamber in vitro invasion assay

1) Placing the required number of small chambers in an empty 24-hole plate, adding 100 mu L of serum-free culture medium into the small chambers, and placing the culture box for 1-2 h;

2) preparing a cell suspension: pancreatin digests each group of cells in logarithmic growth phase, and resuspends the cells by using a low serum culture medium to prepare cell suspension;

3) counting the cells of the cell suspension by a blood cell counting plate;

4) after step 1 was completed, the medium was carefully removed from the chamber;

5) add 600. mu.L of medium containing 30% FBS to the lower chamber;

6) diluting cells by serum-free medium according to a certain proportion, and adding 100 mu L of the cell suspension (containing 100000-200000 cells) into each chamber;

7) transferring the chamber into a lower chamber containing 30% FBS medium with forceps;

8) culturing 4-24hours in a tissue culture incubator;

9) reverse the chamber on absorbent paper to remove the medium, using cotton swab to gently remove non-transferred cells;

10) adding 400 mul of staining solution into empty holes of a 24-hole plate;

11) soaking the small chamber in a staining solution for 5min, and staining the transfer cells on the lower surface of the membrane;

12) the infusion chamber was rinsed several times in a large cup. And (5) drying in the air.

13) The film was photographed by a microscope.

As shown in FIG. 11, after lentiviral infection, the Transwell transfer rate was reduced by 70% in the BT549 cells of shNCAPD2 group compared with that of shCtrl group (P < 0.001); the Transwell transfer rate in the shNCAPD2 group MDA-MB-231 cells was reduced by 51% (P < 0.001).

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Shenzhen Hospital of Beijing university

<120> shRNA of NCAPD2 gene and application thereof

<130>P200229

<141>2020-06-29

<160>15

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213>Human-NCAPD2-1（Pbr17597）

<400>1

caggttctca gtggcgatca a 21

<210>2

<211>21

<212>DNA

<213>Human-NCAPD2-2（Pbr17598）

<400>2

ttgcatcact ttcgaagtat a 21

<210>3

<211>21

<212>DNA

<213>Human-NCAPD2-3（Pbr17599）

<400>3

ttggatggaa tcaaggagct t 21

<210>4

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

ccggcaggtt ctcagtggcg atcaactcga gttgatcgcc actgagaacc tgtttttg 58

<210>5

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

aattcaaaaa caggttctca gtggcgatca actcgagttg atcgccactg agaacctg 58

<210>6

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ccggttgcat cactttcgaa gtatactcga gtatacttcg aaagtgatgc aatttttg 58

<210>7

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>7

aattcaaaaa ttgcatcact ttcgaagtat actcgagtat acttcgaaag tgatgcaa 58

<210>8

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>8

ccggttggat ggaatcaagg agcttctcga gaagctcctt gattccatcc aatttttg 58

<210>9

<211>58

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>9

aattcaaaaa ttggatggaa tcaaggagct tctcgagaag ctccttgatt ccatccaa 58

<210>10

<211>57

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>10

ccggttctcc gaacgtgtca cgtttcaaga gaacgtgaca cgttcggaga atttttg 57

<210>11

<211>57

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>11

aattcaaaaa ttctccgaac gtgtcacgtt ctcttgaaac gtgacacgtt cggagaa 57

<210>12

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>12

tccatcaaac atcttccacc ac 22

<210>13

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>13

gaggccagga tctatacttc g 21

<210>14

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>14

tgacttcaac agcgacaccc a 21

<210>15

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>15

caccctgttg ctgtagccaa a 21

Claims

1. An shRNA is characterized in that the target sequence of the shRNA is shown as SEQ ID NO. 1, and/or,

the target sequence is shown as SEQ ID NO. 2, and/or,

the target sequence is shown as SEQ ID NO. 3;

preferably, the shRNA comprises a sense strand and an antisense strand;

the shRNA comprises SEQ ID NO 4-5, and/or,

6-7 of SEQ ID NO, and/or,

8-9 of SEQ ID NO.

2. An shRNA expression vector comprising the shRNA according to claim 1.

3. A method for preparing a shRNA expression vector according to claim 2, comprising the steps of:

(1) designing shRNA according to the sequence of the NCAPD2 gene;

(2) and inserting shRNA into an expression vector to obtain the shRNA expression vector.

4. A recombinant lentivirus prepared by co-transfecting a mammalian cell with the expression vector of claim 2 and a packaging helper plasmid.

5. Use of an shRNA according to claim 1, an shRNA expression vector according to claim 2 or a recombinant lentivirus according to claim 4 for the preparation of a kit for reducing the expression of the NCAPD2 gene or protein in a cell.

6. A host cell transfected with any one of or a combination of at least two of the shRNA according to claim 1, the shRNA expression vector according to claim 2, or the recombinant lentivirus according to claim 4.

7. A method of silencing an NCAPD2 gene, the method comprising: transfecting an shRNA according to claim 1, an shRNA expression vector according to claim 2 or a recombinant lentivirus according to claim 4 into a host cell to silence the NCAPD2 gene.

8. An inhibitor of NCAPD2, wherein the inhibitor of NCAPD2 comprises any one of or a combination of at least two of the shRNA of claim 1, the shRNA expression vector of claim 2 or the recombinant lentivirus of claim 4.

9. A pharmaceutical composition comprising any one of or a combination of at least two of the shRNA according to claim 1, the shRNA expression vector according to claim 2, the recombinant lentivirus according to claim 4, the host cell according to claim 6 or the NCAPD2 inhibitor according to claim 8.

10. Use of an shRNA according to claim 1, an shRNA expression vector according to claim 2, a recombinant lentivirus according to claim 4, a host cell according to claim 6, an NCAPD2 inhibitor according to claim 8 or a pharmaceutical composition according to claim 9 for the preparation of a medicament for the treatment of a disease associated with NCAPD 2.