CN111551733A - Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method - Google Patents
Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method Download PDFInfo
- Publication number
- CN111551733A CN111551733A CN202010475030.3A CN202010475030A CN111551733A CN 111551733 A CN111551733 A CN 111551733A CN 202010475030 A CN202010475030 A CN 202010475030A CN 111551733 A CN111551733 A CN 111551733A
- Authority
- CN
- China
- Prior art keywords
- antibody
- extracellular vesicles
- derived
- content
- hole
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/581—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with enzyme label (including co-enzymes, co-factors, enzyme inhibitors or substrates)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54393—Improving reaction conditions or stability, e.g. by coating or irradiation of surface, by reduction of non-specific binding, by promotion of specific binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57496—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/7051—T-cell receptor (TcR)-CD3 complex
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
- G01N2333/70532—B7 molecules, e.g. CD80, CD86
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the field of molecular biology and biotechnology, in particular to a method for quantitatively detecting the content of PD-1 in immunocyte-derived extracellular vesicles, an ELISA kit and a using method thereof, wherein an anti-CD 3 antibody is used for specifically capturing the immunocyte-derived extracellular vesicles in body fluid, an anti-PD-1 antibody is used for detecting the content of PD-1 protein in the extracellular vesicles, and the constructed CD3-PD-1 fusion protein is used as a standard substance for realizing the quantitative detection of PD-1 in the immunocyte-derived extracellular vesicles. By adopting the detection method, the sample does not need to be subjected to ultracentrifugation, so that the influence of the low recovery rate of the ultracentrifugation on the reliability of the detection result is avoided, and the reliability of the detection result is ensured; secondly, the method can specifically detect the extracellular vesicle-PD-1 derived from the immune cells, and avoid the influence of the extracellular vesicle-PD-1 derived from non-immune cells.
Description
Technical Field
The invention relates to the field of molecular biology and biotechnology, in particular to a method for quantitatively detecting the content of extracellular vesicle PD-1 derived from immune cells, an ELISA kit and a using method.
Background
Malignant tumors are one of the major diseases that seriously threaten human health and life. Most malignant tumor patients are diagnosed at an advanced stage, lose the chance of operation and are insensitive to traditional conservative treatment modes such as radiotherapy and chemotherapy, so that the survival and prognosis are generally poor. Tumor immunotherapy, as an emerging therapeutic modality, relies on autoimmunity to kill tumor cells by reactivating the human immune system. The PD-L1/PD-1 monoclonal antibody (hereinafter referred to as monoclonal antibody) is the most representative drug in the field of tumor immunotherapy, has proved to have significant curative effect on various malignant tumors, is approved to be on the market in 2014, and brings hope for patients with advanced malignant tumors. Compared with the traditional treatment methods such as radiotherapy, chemotherapy and the like, the PD-L1/PD-1 monoclonal antibody treatment has the greatest characteristics that: once the medicine takes effect to patients, the curative effect is obvious and lasting, and even the tumor can be completely eliminated to achieve the curative effect. However, only less than 30% of tumor patients can benefit from the treatment with PD-L1/PD-1 monoclonal antibody, and the treatment period of the treatment is long and expensive, and the treatment is ineffective once being proved, so that the time for the patients to receive other treatments is delayed. Therefore, there is an urgent need to find a biomarker capable of accurately predicting the efficacy of immunotherapy.
Extracellular Vesicles (EVs) are a general term for membrane structures with diameters of 50-1000nm, which are produced by cell secretion, carry abundant bioactive molecules (such as proteins, nucleic acids, etc.), and can participate in the functional regulation of local or distant cells through autocrine or paracrine pathways, affecting the Extracellular microenvironment. A large number of researches show that tumor cells inhibit the functions of immune cells through direct contact, secretion of extracellular vesicles rich in PD-L1, secretion of cytokines and other ways; and the T cells secrete PD-1-rich extracellular vesicles to enter a peripheral circulation system to regulate and control anti-tumor immunity. Therefore, the detection of the extracellular vesicle PD-1 derived from the immune cells has important significance for monitoring the immune response of an organism and the like.
Traditional Enzyme linked immunosorbent assay (ELISA) is a qualitative and quantitative detection method in which soluble antigen or antibody is bound to a solid phase carrier and immunoreaction is carried out by utilizing antigen-antibody specific binding. ELISA detection has the advantages of high sensitivity, strong specificity, good repeatability and the like. Due to factors such as stable reagent, easy storage, simple operation, objective result judgment and the like, ELISA has been widely used in various fields of immunological tests. The existing ELISA strategies for detecting the PD-1 level of the extracellular vesicles derived from body fluid of a patient can be mainly divided into two main categories: the first type takes an anti-PD-1 antibody as a capture antibody and takes an anti-PD-1 antibody as a detection antibody at the same time to form a classic sandwich structure and detect the total PD-1 level in body fluid; the second type uses marker molecules corresponding to extracellular vesicle surface molecules as capture antibodies (such as CD63, CD9, CD81, etc.), the extracellular vesicles are fixed on a solid phase carrier, and then the anti-PD-1 antibody is used for detecting the PD-1 level on the extracellular vesicles.
As the most common detection means of the PD-1 in body fluid at present, the two ELISA strategies provide important support for quantitatively detecting the PD-1 in the body fluid of a patient, but the strategy is still used for specifically detecting the PD-1 in extracellular vesicles and has certain defects. First, to avoid interference from free PD-1, the above strategy requires the isolation and purification of extracellular vesicles from body fluids by ultracentrifugation. The ultracentrifugation method is time-consuming and labor-consuming, lacks of a standardized operation process, and needs large-scale ultracentrifugation equipment; more importantly, the efficiency of ultracentrifugation to separate extracellular vesicles is less than 30%, and it is still unclear whether the PD-1 level in 30% of extracellular vesicles accurately reflects the PD-1 level in total extracellular vesicles. In addition, there are a number of immune cells other than T lymphocytes (e.g., NK cells, B cells, DC cells, macrophages, etc.) that can also secrete PD-1-bearing extracellular vesicles. Neither of the two ELISA strategies described above allowed differentiation of the cellular source of PD-1-bearing extracellular vesicles. Therefore, an ELISA strategy which avoids ultracentrifugation and can specifically and quantitatively detect the PD-1 level of the immune cell extracellular vesicle in body fluid is urgently needed to be established, so as to improve the accuracy of the prediction of the curative effect of the immunotherapy and promote the long-term development of the immunotherapy.
Disclosure of Invention
One of the purposes of the invention is to provide a method for quantitatively detecting the content of the immune cell-derived extracellular vesicle PD-1, a sample does not need to be subjected to ultracentrifugation, the influence of the low recovery rate of the ultracentrifugation on the reliability of a detection result is avoided, and the reliability of the detection result is ensured; secondly, the method can specifically detect the extracellular vesicle-PD-1 derived from the immune cells, and avoids the influence of the extracellular vesicle PD-1 derived from non-immune cells.
The invention also aims to provide an ELISA kit for quantitatively detecting the content of PD-1 in the extracellular vesicles derived from the immune cells, which can quickly, specifically and quantitatively detect the content of PD-1 in the extracellular vesicles derived from the immune cells.
The invention also aims to provide a using method of the ELISA kit for quantitatively detecting the content of the PD-1 in the extracellular vesicles derived from the immune cells.
The scheme adopted by the invention for realizing one of the purposes is as follows: a method for quantitatively detecting the content of PD-1 in immunocyte-derived extracellular vesicles comprises the steps of specifically capturing the immunocyte-derived extracellular vesicles in body fluid by using an anti-CD 3 antibody, detecting the content of PD-1 protein in the extracellular vesicles by using the anti-PD-1 antibody, and quantitatively detecting the PD-1 in the immunocyte-derived extracellular vesicles by using the constructed CD3-PD-1 fusion protein as a standard substance.
The extracellular vesicles are highly inherited from the maternal cell surface marker molecules, and thus, the CD3 molecule can serve as a T lymphocyte-derived extracellular vesicle-specific marker molecule. Based on the current research situation, the invention provides a novel ELISA detection method for quantitatively detecting the PD-1 level of the immunocyte-derived extracellular vesicles in body fluid, and the method takes an anti-CD 3 antibody as a capture antibody, an anti-PD-1 antibody as a detection antibody and the constructed CD3-PD-1 fusion protein as a standard substance, so that the content of the immunocyte-derived extracellular vesicles PD-1 in the body fluid is quantitatively detected. The invention realizes the specificity and accurate quantitative detection of the PD-1 protein level on the immune cell source extracellular vesicles in body fluid, and has obvious advantages compared with the existing ELISA detection strategy: firstly, the sample does not need to be subjected to ultracentrifugation, so that the influence of the low recovery rate of the ultracentrifugation on the reliability of the detection result is avoided, and the reliability of the detection result is ensured; secondly, the strategy can specifically detect the extracellular vesicle PD-1 derived from the immune cells, and avoids the influence of the extracellular vesicle PD-1 derived from non-immune cells.
Preferably, the nucleic acid sequence of the CD3-PD-1 fusion protein is shown in SEQ ID No: 1 is shown.
Preferably, the anti-CD 3 antibody can be replaced by a marker molecule antibody aiming at different immune cell subtypes according to specific detection requirements, the capture antibodies are selected and self-paired, and include a plurality of antibodies against CD45, CD4, CD8, CD14, CD11b, CD11c, CD25, CD19, CD20, CD5, CD7, CD10, CD15, CD16, CD21, CD22, CD23, CD25, CD28, CD30, CD33, CD34, CD36, CD38, CD40, CD49, CD52, CD62, CD64, CD79, CD80, CD86, CD89, CD91, CD94, CD95, CD115, CD116, CD120, CD122, CD124, CD125, CD126, CD127, CD129, CD132, CD134, CD152, CD153, CD154, CD178, CD158, CD179, CD181, CD182, CD183, CD193, CD185, CD181, CD185, CD213, CD247, CD213, CD282, CD213, CD247, CD213, CD282, CD213, CD247, CD282, CD213, CD247, CD213, CD282, CD213, CD197, CD247, CD213, CD.
The invention utilizes a marker molecule specifically expressed by immune cells as a capture target of extracellular vesicles derived from the immune cells, and shows a detection strategy and a detection method by taking CD3 as an example. The capture antibodies are selected and self-matched according to specific detection needs and for different immune cell subtypes, including but not limited to antibodies corresponding to CD3 and other immune cell marker molecules as capture antibodies.
Preferably, the body fluid includes any one of blood, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, sweat, semen, and lymph.
Except that the blood is specific to various cancers of the whole body, the other collected body fluids are specific part fluids for the detected cancers, such as saliva for cancers of oral cavity and adjacent parts, urine for urothelial cancer, pleural effusion for lung cancer, cerebrospinal fluid for brain glioma and the like. Body fluid samples include, but are not limited to, humans, monkeys, mice, rats, rabbits, pigs, monkeys, dogs, and other animals.
The second scheme adopted by the invention for achieving the purpose is as follows: an ELISA kit for quantitatively detecting the content of immunocyte-derived extracellular vesicles PD-1 comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an enzyme-labeled antibody A, an enzyme-labeled antibody B, a color-developing agent A liquid, a color-developing agent B liquid and stop solution;
wherein, the ELISA plate is coated with anti-CD 3 antibody in advance according to the concentration of 1-5 mug/mL;
the standard protein is constructed CD3-PD-1 fusion protein.
The ELISA plate selected by the ELISA kit is a Nunc type ELISA plate of a Biolegend company, the sealing plate membrane is a sealing plate membrane of a Corning company, the product number is UC-500, the standard protein diluent comprises 100-300 mmol/L of buffer solution, 5-20 g/L of stabilizing agent and 2-6 g/L of preservative, and the concentrated washing solution is an aqueous solution containing 0.01-0.05 mol/L of PBS and 1-5 per thousand of Tween-20.
Preferably, the nucleic acid sequence of the CD3-PD-1 fusion protein is shown in SEQ ID No: 1 is shown.
The standard protein is a CD3-PD-1 fusion protein which is constructed independently, and the construction method comprises the following steps: constructing plasmids of CD3 and CD 3-connexin-PD-1 in stages; synthesized, isolated and purified using standard methods for protein expression.
Preferably, the anti-CD 3 antibody is an anti-CD 3 antibody from R & D, cat # MAB 100.
The selected CD3 capture antibody was commercially available, and after screening of various commercially available antibodies, CD3 antibody from R & D, cat # MAB100, was selected.
Preferably, the ELISA plate can be replaced by one or more of antibodies pre-coated with anti-CD 45, CD4, CD8, CD14, CD11b, CD11c, CD25, CD19, CD20, CD5, CD7, CD10, CD15, CD16, CD21, CD22, CD23, CD25, CD28, CD30, CD33, CD34, CD36, CD38, CD40, CD49, CD52, CD62, CD64, CD79, CD80, CD86, CD89, CD91, CD94, CD95, CD115, CD116, CD120, CD122, CD124, CD335, CD125, CD126, CD127, CD129, CD132, CD134, CD152, CD158, CD154, CD153, CD283, CD182, CD191, CD181, CD213, CD197, CD213, CD282, CD197, CD247, CD185, CD197, CD247, CD 197; the standard protein is the constructed corresponding CD molecule-PD-1 fusion protein.
Preferably, the enzyme-labeled antibody A is a 1 mu g/mL PD-1 detection antibody, and the enzyme-labeled antibody B is a 1 mu g/mL horseradish peroxidase-coupled chromogenic antibody; the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid, 0.02% of hydrogen peroxide and the balance of distilled water by mass percent; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol, 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine and the balance of distilled water in percentage by mass; the stop solution is 2mol/L dilute sulfuric acid.
The enzyme-labeled antibody A is a PD-1 detection antibody of 1 mu g/mL, and a PD-1 antibody of the company R & D, the cargo number AF1086, is selected after various commercially available PD-1 detection antibodies are screened. The enzyme-labeled antibody B is a horseradish peroxidase-coupled chromogenic antibody with the concentration of 1 mu g/mL, and is a HRP chromogenic antibody of BD company, the product number of which is 554066, after screening various commercially available HRP chromogenic antibodies.
The scheme adopted by the invention for realizing the third purpose is as follows: the use method of the ELISA kit for quantitatively detecting the content of the PD-1 in the extracellular vesicles derived from the immune cells comprises the following steps:
(1) taking out the ELISA plate after balancing at room temperature, arranging a standard substance hole and a sample hole on the ELISA plate, adding standard proteins with different concentration gradients into the standard substance hole, adding a body fluid sample to be detected into the sample hole, and culturing for 1 hour at 37 ℃;
(2) discarding liquid in the hole, injecting washing liquid, repeatedly washing for many times, and inversely placing on absorbent paper for drying;
(3) adding 100 mu L of enzyme-labeled antibody A liquid and enzyme-labeled antibody B liquid which are mixed in advance into an ELISA plate hole, sealing the ELISA plate hole by using a sealing plate film, and incubating for 1 hour at 37 ℃;
(4) discarding liquid in the hole, injecting washing liquid, repeatedly washing for many times, and inversely placing on absorbent paper for drying;
(5) mixing the color developing agent A solution and the color developing agent B solution according to the volume ratio of 1:1, adding 100 mu L of the mixture into each hole, and developing at room temperature in a dark place;
(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, slightly shaking until the color is completely stopped in the hole, respectively measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample, and calculating the concentration of the sample to be measured.
The body fluid sample mentioned in step 1 of the present invention needs to be subjected to preliminary centrifugation treatment, and there are three main centrifugation conditions for different body fluids: one method for treating saliva and other viscous body fluid comprises centrifuging at 4 deg.C for 15 min at 2600g, collecting supernatant, and centrifuging twice; the second method is a centrifugation method for blood, the centrifugal force is 1550g, the centrifugation temperature is 25 ℃, the centrifugation time is 20 minutes, transparent plasma above the blood is collected, and the centrifugation is carried out twice; the third method is a centrifugation method aiming at relatively clear body fluid such as urine, etc., the centrifugation force is 1550g, the centrifugation temperature is 4 ℃, the centrifugation time is 15 minutes, and the supernatant is taken and centrifuged twice.
The preferred standard concentration gradients proposed in step 1 of the present invention are eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, 0ng/mL, with 100. mu.L per standard well.
The washing method mentioned in step 2 and step 4 of the invention comprises the steps of sucking up the reaction liquid in the holes, filling the holes with the washing liquid, placing for 2 minutes, slightly shaking, sucking up the washing liquid in the holes, and then placing on absorbent paper for patting dry.
The invention uses 8 or 12-channel pipettor to add liquid in steps 2 to 6 so as to reduce operation errors and loading errors.
The OD value mentioned in step 6 of the invention is an absorbance value, and the OD value at the wavelength of 570nm needs to be subtracted from the OD value at the wavelength of 450nm for correction, and finally the sample concentration is calculated according to the linear relation of the standard.
The invention has the following advantages and beneficial effects:
the traditional ELISA detection strategy can only detect the total PD-1 level in body fluid or the PD-1 level on total extracellular vesicles, and the invention utilizes the double-antibody sandwich ELISA strategy to realize the specific and quantitative detection of the content of PD-1 carried by the immunocyte-derived extracellular vesicles in the body fluid, and has obvious advantages. In addition, the invention also has the following characteristics: 1. by adopting the detection method, the sample does not need to be subjected to ultracentrifugation, so that the influence of the low recovery rate of the ultracentrifugation on the reliability of the detection result is avoided, and the reliability of the detection result is ensured; 2. an ELISA strategy for specifically and quantitatively detecting the content of PD-1 carried by extracellular vesicles derived from immune cells is provided for the first time, so that the influence of free PD-1 and extracellular vesicles PD-1 derived from non-immune cells is avoided; 3. firstly constructing a CD3-PD-1 fusion protein as a standard protein, and being recognized by a commercially available CD3 capture antibody and a PD-1 detection antibody; 4. the mode of traditional 'A-A-A sandwich' ELISA for detecting free single protein molecules is changed, and the 'A-AB-B' strategy is utilized to detect the content of PD-1 on the complex structure of the extracellular vesicles.
The ELISA kit disclosed by the invention can be used for specifically and quantitatively detecting PD-1 on the extracellular vesicles derived from tumor cells, and can be widely applied to the aspects of early diagnosis, prognosis evaluation and curative effect prediction of various diseases including tumors.
Drawings
FIG. 1 is a graph showing the extracellular vesicle size distribution (a-b) of a normal cell line (HUVEC) and a human peripheral blood leukemia T cell line (Jurkat) in the second example of the present invention;
FIG. 2 is a standard curve of CD3-PD-1 recombinant protein in example II of the present invention;
FIG. 3 shows the results of ELISA detection of the level of extracellular vesicles PD-1 in the cell supernatants (Supernatant), Extracellular Vesicles (EVs) and ultracentrifugation supernatants (EVs-Free superanatant) of the normal cell line (HUVEC) and the human leukemia T cell line (Jurkat) in the second example of the present invention;
FIG. 4 shows ELISA results of the levels of extracellular vesicle PD-1 in plasma of a normal subject (HD), an oral cancer patient (OSCC) who is not treated, and an oral cancer patient (tOSCC) who is treated in the third embodiment of the present invention;
FIG. 5 shows ELISA results of the level of extracellular vesicle PD-1 in saliva of a normal subject (HD), an oral cancer patient (OSCC) who did not receive treatment, and an oral cancer patient (tOSCC) who received treatment in the fourth example of the present invention.
Detailed Description
The following examples are provided to further illustrate the present invention for better understanding, but the present invention is not limited to the following examples.
The first embodiment is as follows: construction of CD3-PD-1 fusion protein
1. According to the sequence (Gene ID:916) of a human-derived CD3 Gene queried by Pubmed Gene, selecting a fragment from Gln22 to Asp 126; PD-1 Gene sequence (Gene ID:5133), wherein Leu125 to Gln167 segments were selected. Designing a His protein tag sequence, an initiation codon and a stop codon; a connexin sequence (GGTGGTGGTGGTAGCGGTGGTGGCGGTAGTGGTGGTGGTGGTAGC) is inserted between the two sequences, EcoRl and Xhol double enzyme cutting sites are introduced, a pair of positive and negative primers are designed, and PCR amplification is carried out to obtain a CD3-PD-1 gene fragment.
TABLE 1 primer CD3-PD-1
2. The CD3-PD-1 gene fragment and the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol are connected through an Exnase recombinase (Nonunza company, the cargo number C113-01), and a recombinant plasmid CD3-PD-1 is obtained after transformation and screening, wherein the nucleic acid sequence of the recombinant plasmid is shown as SEQ ID No: 1, and the amino acid sequence is shown as SEQ ID No: 2, respectively. .
3. The recombinant plasmid CD3-PD-1 is transferred into E.coli DH5 α competent bacteria and cultured by Kanamycin resistant agaroseRadical (K)+LB) and extracting the plasmid.
4. The extracted recombinant plasmid CD3-PD-1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K+The LB plate was used to obtain the desired clonal strain.
5. Single colonies were picked to 50mL K+LB culture to OD600When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.5-1 mmol/L to stimulate protein expression, the continuous culture is carried out for 4-8 hours, centrifugation is carried out for 15 minutes at 12,000 r/min, supernatant and precipitate are respectively collected, 20 mu L of 6 × protein loading buffer is added to 100 mu L after PBS dilution or re-suspension, and SDS-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining analysis and identification are carried out.
6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl 50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30 minutes, centrifuged at 4 ℃ at 12,000g for 10 minutes, and the pellet was resuspended in 15 volumes of inclusion body dissolution buffer (TRIS-HCl 50mmol/L, NaCl 100mmol/L, EDTA 1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).
7. Adding 10mmol/L imidazole into the heavy suspension, adding into a chromatographic column, controlling the concentration of 0.5-1 mL/min of tassels, washing the column with a washing buffer (TRIS-HCl 50 mmol/L; NaCl300 mmol/L; imidazole 10 mmol/L; pH 8.0) at a flow rate of 1 mL/min to remove the hetero-proteins, repeating the washing for 6 times, eluting with an elution buffer (TRIS-HCl 50 mmol/L; NaCl300 mmol/L; imidazole 250 mmol/L; pH 8.0) for 4 times, and collecting the eluents.
8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD3-PD-1 fusion protein.
Example two: method for quantitatively detecting PD-1 of immune cell-derived extracellular vesicles and application of kit in detection of PD-1 level in-vitro cultured immune cell-derived extracellular vesicles
1. Cell supernatants starved-cultured with low-concentration fetal calf serum (5%) over 48 hours were collected using HUVEC, a human normal cell line cultured with exosome-free fetal calf serum (100000g, centrifuged overnight at 4 ℃), and Jurkat, a human peripheral blood leukemia T cell line.
2. The collected 10mL of cell supernatant was centrifuged at 2000g at 4 ℃ for 30 minutes, the supernatant was retained to remove cells and cell debris, 1mL of the supernatant was retained for examination, the remaining 9mL of the supernatant was centrifuged at 100000g at 4 ℃ for 70 minutes, the centrifuged supernatant was collected and the pellet was resuspended in 20. mu.L of PBS to obtain extracellular vesicles.
3. The resuspended extracellular vesicles were examined by Nanoparticle Tracking Analysis (NTA) and found to have an average particle size of about 100nm for both HVUEC and Jurkat cell-derived extracellular vesicles (FIG. 1, a-b).
4. 100 μ L of Supernatant (Supernatant) collected from the HUVEC and Jurkat cell lines, extracellular vesicles (diluted 20 times), and Supernatant obtained by ultracentrifugation were added to the sample wells, and 100 μ L of CD3-PD-1 standard protein obtained in example one was added to each standard well according to eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, and 0ng/mL, and the wells were sealed with a membrane to seal the well plates, and incubated at 37 ℃ in an incubator for 1 h.
5. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 5 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
6. Discarding the liquid in the wells of the ELISA plate, injecting 300. mu.L of PBST cleaning solution (0.05% Tween 20 in PBS), repeatedly washing for 4 times, inverting on absorbent paper, patting dry, adding 100. mu.L of the enzyme-labeled antibody mixture of step 6, and incubating in a 37 ℃ incubator for 1 hour.
7. Discarding liquid in the holes of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 4 times, and inversely placing on absorbent paper for drying; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
8. After the color of the standard hole changes linearly (10-30 minutes), adding 50 mu L of stop solution into each hole, slightly shaking until the liquid in the hole is yellow, and measuring OD values at the wavelength of 450nm and 570nm by using an enzyme labeling instrument within 15 minutes (the OD value at 450nm minus the OD value at 570nm is the final OD value of the sample).
9. The PD-1 concentration of each cell line sample was calculated by plotting a standard curve (fig. 2) from the standard results (fig. 3) showing: for HUVEC cell lines which do not express PD-1, PD-1 can not be detected in cell Supernatant (Supernatant), Extracellular Vesicles (EVs) and ultracentrifugation Supernatant (EVs-Free superanatant); the results of Jurkat lymphocyte cell line cell supernatant and extracellular vesicle obtained by centrifugation are similar, and the PD-1 content of the cell supernatant is slightly high, while a certain PD-1 content can be detected in the supernatant obtained after ultracentrifugation. The above results suggest that the PD-1 content of the immunocyte line-derived extracellular vesicles can be detected by capturing CD3 using the ELISA kit; the traditional ultracentrifugation method can not completely centrifuge the extracellular vesicles, and the PD-1 on the extracellular vesicles in the culture supernatant can be directly and quantitatively detected by using the ELISA kit.
Example three: method for quantitatively detecting immune cell-derived extracellular vesicle PD-1 and application of kit in detection of peripheral blood immune cell-derived extracellular vesicle PD-1
1. 2mL of peripheral blood was collected from a Healthy subject (HD), an untreated oral cancer patient (OSCC), and a Treated oral cancer patient (Treated OSCC, tOSCC).
2. Centrifuging peripheral blood at 25 deg.C and 1550g for 10 min, and collecting upper layer plasma; the supernatant plasma was centrifuged under the same conditions for 10 minutes, and the remaining blood cells were discarded to collect the supernatant and store it for further use.
3. mu.L of the above plasma (diluted 20 times) was added to the sample well, and 100. mu.L of the CD3-PD-1 standard protein obtained in example one was added to each of the standard wells according to eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, and 0ng/mL, and the wells were sealed with a sealing membrane and incubated at 37 ℃ in an incubator for 1 hour.
4. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
5. Discarding the liquid in the hole of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 4 times, inversely placing on absorbent paper, patting dry, adding 100 mu L of the enzyme-labeled antibody mixed solution obtained in the step 4, and placing in a 37 ℃ incubator for incubation for 1 hour.
6. Discarding liquid in the holes of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 5 times, and inversely placing on absorbent paper for drying; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
7. After the color of the standard hole changes linearly (10-30 minutes), adding 50 mu L of stop solution into each hole, slightly shaking until the liquid in the hole is yellow, and measuring OD values at the wavelength of 450nm and 570nm by using an enzyme labeling instrument within 15 minutes (the OD value at 450nm minus the OD value at 570nm is the final OD value of the sample).
8. The PD-1 content was calculated for each group based on the standard protein and the results (fig. 4) show: HD blood extracellular vesicles have almost no PD-1, OSCC blood extracellular vesicles have high PD-1 content, and tOSCC blood extracellular vesicles have low PD-1 content compared with the content before treatment. The results indicate that the ELISA kit can quantitatively detect the PD-1 content of the extracellular vesicles derived from the immune cells in blood by grabbing CD3, and the change of the PD-1 content in the extracellular vesicles of peripheral blood can be used as a potential index for predicting the immunotherapy effect.
Example four: method for quantitatively detecting immune cell-derived extracellular vesicle PD-1 and application of kit in detection of immune cell-derived extracellular vesicle PD-1 in saliva
1. 2mL of saliva was collected from a healthy subject (HD), an oral cancer patient (OSCC) who did not receive treatment, and an oral cancer patient (tOSCC) who received treatment.
2. Centrifuging saliva at 4 deg.C and 2600g for 10 min, and collecting supernatant; the cells were centrifuged again under the same conditions, and the supernatant was collected and stored at 4 ℃ for further use.
3. mu.L of saliva (diluted 20 times) was added to the sample wells, and the CD3-PD-1 standard protein obtained in example one was subjected to eight concentration gradients of 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, and 0ng/mL, 100. mu.L of each standard well was added, the well plates were sealed with a sealing membrane, and the wells were incubated at 37 ℃ for 1 hour in an incubator.
4. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.
5. Discarding the liquid in the hole of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 4 times, inversely placing on absorbent paper, patting dry, adding 100 mu L of enzyme-labeled antibody mixed solution obtained in the step 3, and placing in a 37 ℃ incubator for incubation for 1 hour.
6. Discarding liquid in the holes of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 5 times, and inversely placing on absorbent paper for drying; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.
7. After the color of the standard hole changes linearly (10-30 minutes), adding 50 mu L of stop solution into each hole, slightly shaking until the liquid in the hole is yellow, and measuring OD values at the wavelength of 450nm and 570nm by using an enzyme labeling instrument within 15 minutes (the OD value at 450nm minus the OD value at 570nm is the final OD value of the sample).
8. The PD-1 content was calculated for each group based on the standard protein, with results similar to the blood test (fig. 5): HD salivary extracellular vesicles have almost no PD-1, OSCC salivary extracellular vesicles have high PD-1 content, and tOSCC salivary extracellular vesicles have low PD-1 content compared with that before treatment. The results indicate that the ELISA kit can quantitatively detect the PD-1 content of the extracellular vesicles derived from the immune cells in saliva by grabbing CD 3; similarly, changes in PD-1 content in extracellular vesicles in saliva can be used as a potential indicator for predicting the effectiveness of immunotherapy.
While the foregoing is directed to the preferred embodiment of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.
Sequence listing
<110> Wuhan university
<120> method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>813
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgcaagatg gtaatgaaga aatgggtggt attacacaga caccatataa agtctccatc 60
tctggaacca cagtaatatt gacatgccct cagtatcctg gatctgaaat actatggcaa 120
cacaatgata aaaacatagg cggtgatgag gatgataaaa acataggcag tgatgaggat 180
cacctgtcac tgaaggaatt ttcagaattg gagcaaagtg gttattatgt ctgctacccc 240
agaggaagca aaccagaaga tgcgaacttt tatctctacc tgagggcaag agtgtgtgag 300
aactgcatgg agatggatgg tggtggtggt agcggtggtg gcggtagtgg tggtggtggt 360
agcttagact ccccagacag gccctggaac ccccccacct tctccccagc cctgctcgtg 420
gtgaccgaag gggacaacgc caccttcacc tgcagcttct ccaacacatc ggagagcttc 480
gtgctaaact ggtaccgcat gagccccagc aaccagacgg acaagctggc cgccttcccc 540
gaggaccgca gccagcccgg ccaggactgc cgcttccgtg tcacacaact gcccaacggg 600
cgtgacttcc acatgagcgt ggtcagggcc cggcgcaatg acagcggcac ctacctctgt 660
ggggccatct ccctggcccc caaggcgcag atcaaagaga gcctgcgggc agagctcagg 720
gtgacagaga gaagggcaga agtgcccaca gcccacccca gcccctcacc caggccagcc 780
ggccagttcc aacatcacca tcatcatcat taa 813
<210>2
<211>270
<212>PRT
<213>CD3-PD-1(CD3-PD-1)
<400>2
Met Gln Asp Gly Asn Glu Glu Met Gly Gly Ile Thr Gln Thr Pro Tyr
1 5 10 15
Lys Val Ser Ile Ser Gly Thr Thr Val Ile Leu Thr Cys Pro Gln Tyr
20 25 30
Pro Gly Ser Glu Ile Leu Trp Gln His Asn Asp Lys Asn Ile Gly Gly
35 40 45
Asp Glu Asp Asp Lys Asn Ile Gly Ser Asp Glu Asp His Leu Ser Leu
50 55 60
Lys Glu Phe Ser Glu Leu Glu Gln Ser Gly Tyr Tyr Val Cys Tyr Pro
65 70 75 80
Arg Gly Ser Lys Pro Glu Asp Ala Asn Phe Tyr Leu Tyr Leu Arg Ala
85 90 95
Arg Val Cys Glu Asn Cys Met Glu Met Asp Gly Gly Gly Gly Ser Gly
100 105 110
Gly Gly Gly Ser Gly Gly Gly Gly Ser Leu Asp Ser Pro Asp Arg Pro
115 120 125
Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly
130 135 140
Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe
145 150 155 160
Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu
165 170 175
Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe
180 185 190
Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val
195 200 205
Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser
210 215 220
Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg
225 230 235 240
Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser
245 250 255
Pro Arg Pro Ala Gly Gln Phe Gln His His His His His His
260 265 270
Claims (10)
1. A method for quantitatively detecting the content of immune cell-derived extracellular vesicle PD-1 is characterized in that: the anti-CD 3 antibody is used for capturing immune cell-derived extracellular vesicles in body fluid specifically, the anti-PD-1 antibody is used for detecting the content of PD-1 protein in the extracellular vesicles, and the constructed CD3-PD-1 fusion protein is used as a standard substance for realizing the quantitative detection of PD-1 in the immune cell-derived extracellular vesicles.
2. The method for quantitatively detecting the PD-1 content of the immunocyte-derived extracellular vesicles according to claim 1, wherein: the nucleic acid sequence of the CD3-PD-1 fusion protein is shown as SEQ ID No: 1 is shown.
3. The method for quantitatively detecting the PD-1 content of the immunocyte-derived extracellular vesicles according to claim 1, wherein: the anti-CD 3 antibody can be replaced by a marker molecule antibody aiming at different immune cell subtypes according to specific detection requirements, the capture antibodies are selected and self-paired, and include a plurality of antibodies against CD45, CD4, CD8, CD14, CD11b, CD11c, CD25, CD19, CD20, CD5, CD7, CD10, CD15, CD16, CD21, CD22, CD23, CD25, CD28, CD30, CD33, CD34, CD36, CD38, CD40, CD49, CD52, CD62, CD64, CD79, CD80, CD86, CD89, CD91, CD94, CD95, CD115, CD116, CD120, CD122, CD124, CD125, CD126, CD127, CD129, CD132, CD134, CD152, CD153, CD154, CD178, CD158, CD179, CD181, CD182, CD183, CD193, CD185, CD181, CD185, CD213, CD247, CD213, CD282, CD213, CD247, CD213, CD282, CD213, CD247, CD282, CD213, CD247, CD213, CD282, CD213, CD197, CD247, CD213, CD.
4. The method for quantitatively detecting the PD-1 content of the immunocyte-derived extracellular vesicles according to claim 1, wherein: the body fluid comprises any one of blood, saliva, urine, cerebrospinal fluid, abdominal dropsy, pleural effusion, sweat, semen and lymph fluid.
5. An ELISA kit for quantitatively detecting the content of immune cell-derived extracellular vesicle PD-1 is characterized in that: the kit comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an ELISA antibody A, an ELISA antibody B, a color developing agent A liquid, a color developing agent B liquid and stop solution;
wherein, the ELISA plate is coated with anti-CD 3 antibody in advance according to the concentration of 1-5 mug/mL;
the standard protein is constructed CD3-PD-1 fusion protein.
6. The ELISA kit for quantitatively detecting the content of PD-1 in extracellular vesicles derived from immune cells according to claim 5, wherein: the nucleic acid sequence of the CD3-PD-1 fusion protein is shown as SEQ ID No: 1 is shown.
7. The ELISA kit for quantitatively detecting the content of PD-1 in extracellular vesicles derived from immune cells according to claim 5, wherein: the anti-CD 3 antibody is an anti-CD 3 antibody from R & D, cat # MAB 100.
8. The ELISA kit for quantitatively detecting the content of PD-1 in extracellular vesicles derived from immune cells according to claim 5, wherein: the ELISA plate can be replaced by one or more of CD45, CD4, CD8, CD14, CD11b, CD11c, CD25, CD19, CD20, CD5, CD7, CD10, CD15, CD16, CD21, CD22, CD23, CD25, CD28, CD30, CD33, CD34, CD36, CD38, CD40, CD49, CD52, CD62, CD64, CD79, CD80, CD86, CD89, CD91, CD94, CD95, CD115, CD116, CD120, CD122, CD124, CD125, CD126, CD127, CD129, CD132, CD134, CD152, CD159, CD158, CD159, CD154, CD182, CD179, CD181, CD213, CD247, CD282, CD247, CD282, CD247, CD197, CD282 and CD247 antibodies coated in advance at a concentration of 1-5 mug/mL; the standard protein is the constructed corresponding CD molecule-PD-1 fusion protein.
9. The ELISA kit for quantitatively detecting the content of PD-1 in extracellular vesicles derived from immune cells according to claim 5, wherein: the enzyme-labeled antibody A is a 1 mu g/mL PD-1 detection antibody, and the enzyme-labeled antibody B is a 1 mu g/mL horseradish peroxidase-coupled chromogenic antibody; the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid, 0.02% of hydrogen peroxide and the balance of distilled water by mass percent; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol, 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine and the balance of distilled water in percentage by mass; the stop solution is 2mol/L dilute sulfuric acid.
10. Use of the ELISA kit for the quantitative determination of the PD-1 content of extracellular vesicles derived from immune cells according to any one of claims 5 to 9, characterized in that it comprises the following steps:
(1) taking out the ELISA plate after balancing at room temperature, arranging a standard substance hole and a sample hole on the ELISA plate, adding standard proteins with different concentration gradients into the standard substance hole, adding a body fluid sample to be detected into the sample hole, and culturing for 1 hour at 37 ℃;
(2) discarding liquid in the hole, injecting washing liquid, repeatedly washing for many times, and inversely placing on absorbent paper for drying;
(3) adding 100 mu L of enzyme-labeled antibody A liquid and enzyme-labeled antibody B liquid which are mixed in advance into an ELISA plate hole, sealing the ELISA plate hole by using a sealing plate film, and incubating for 1 hour at 37 ℃;
(4) discarding liquid in the hole, injecting washing liquid, repeatedly washing for many times, and inversely placing on absorbent paper for drying;
(5) mixing the color developing agent A solution and the color developing agent B solution according to the volume ratio of 1:1, adding 100 mu L of the mixture into each hole, and developing at room temperature in a dark place;
(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, shaking until the hole is completely stopped, measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample, and calculating the concentration of the sample to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010475030.3A CN111551733A (en) | 2020-05-29 | 2020-05-29 | Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010475030.3A CN111551733A (en) | 2020-05-29 | 2020-05-29 | Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111551733A true CN111551733A (en) | 2020-08-18 |
Family
ID=72003171
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010475030.3A Pending CN111551733A (en) | 2020-05-29 | 2020-05-29 | Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111551733A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112881684A (en) * | 2021-01-18 | 2021-06-01 | 北京晶科瑞医学检验实验室有限公司 | Kit for predicting immunotherapy effect |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101339195A (en) * | 2008-08-06 | 2009-01-07 | 苏州大学 | Elisa kit for checking soluble PD-1 protein and checking method |
| CN108350082A (en) * | 2016-06-13 | 2018-07-31 | 爱迈博 | PD-L1 antibody and application thereof |
| WO2019234220A1 (en) * | 2018-06-09 | 2019-12-12 | Boehringer Ingelheim International Gmbh | Dll3-cd3 bispecific antibodies |
| CN111133106A (en) * | 2017-07-12 | 2020-05-08 | 外来体诊断公司 | Method for isolating and enriching extracellular vesicles from biological fluid sources and methods of use thereof |
-
2020
- 2020-05-29 CN CN202010475030.3A patent/CN111551733A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101339195A (en) * | 2008-08-06 | 2009-01-07 | 苏州大学 | Elisa kit for checking soluble PD-1 protein and checking method |
| CN108350082A (en) * | 2016-06-13 | 2018-07-31 | 爱迈博 | PD-L1 antibody and application thereof |
| CN111133106A (en) * | 2017-07-12 | 2020-05-08 | 外来体诊断公司 | Method for isolating and enriching extracellular vesicles from biological fluid sources and methods of use thereof |
| WO2019234220A1 (en) * | 2018-06-09 | 2019-12-12 | Boehringer Ingelheim International Gmbh | Dll3-cd3 bispecific antibodies |
Non-Patent Citations (6)
| Title |
|---|
| ANTJE KRONER等: "A PD-1 polymorphism is associated with disease progression in multiple sclerosis", 《ANNALS OF NEUROLOGY》 * |
| HAKAREL INC.: "PD-L1/CD9 Exosome ELISA Kit, Human", 《HTTPS://SEARCH.COSMOBIO.CO.JP/COSMO_SEARCH_P/SEARCH_GATE2/DOCS/HAK_/HAKHELPDL1091.20190926.PDF》 * |
| 于涟: "《传染性法氏囊病病毒的分子生物学及新型疫苗研究》", 31 March 2007, 浙江大学出版社 * |
| 刘伟等: "肝癌患者外周血CD3+T细胞和CD19+B细胞中程序性死亡蛋白1（PD-1）及其配体表达水平增加", 《细胞与分子免疫学杂志》 * |
| 牛勃: "《现代生物学技术进展》", 31 May 2007, 山西人民出版社 * |
| 郭忠胜等: "阻断PD-1PD-L1信号通路对负载HBsAg的树突细胞抗HBV免疫功能的影响", 《中华临床感染病杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112881684A (en) * | 2021-01-18 | 2021-06-01 | 北京晶科瑞医学检验实验室有限公司 | Kit for predicting immunotherapy effect |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110093356B (en) | DNA sequence coding for African swine fever virus antigen, composition of antigen coded by DNA sequence and application of DNA sequence in immunological detection | |
| CN108490174B (en) | Method for detecting CAR-T cells and application thereof | |
| CN108508200B (en) | Method for detecting CD19 CAR-expressing cells and application thereof | |
| EP1114322A1 (en) | Tandem immuno-assay for cancer | |
| EP2515114B1 (en) | Method for diagnosing malignant tumor | |
| CN111521816B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
| CN101949937A (en) | Oophoroma tumor marker HE4 time-resolved fluoroimmunoassay detection kit | |
| CN101074264B (en) | Recombinant anti-CTLA4 monoclonal antibody, its production and use | |
| CN110684740A (en) | Monoclonal antibody of anti-human ubiquitin carboxyl terminal hydrolase-1 (UCH-L1) and application thereof | |
| CN108484779B (en) | Fusion protein of nano antibody and human placenta alkaline phosphatase and application | |
| CN116874597B (en) | Monoclonal antibody of mouse anti-human vascular endothelial growth factor and application | |
| CA2287545A1 (en) | Ma family polypeptides and anti-ma antibodies | |
| CN111537725A (en) | Method for efficiently and quantitatively detecting PD-1 level in extracellular vesicles, ELISA kit and using method | |
| CN106404731B (en) | PCT and CRP double-labeling time-resolved fluorescence immunoassay method for simultaneously detecting bacterial meningitis and viral meningitis | |
| CN111551732A (en) | Method for quantitatively detecting content of tumor-derived extracellular vesicle PD-L1 in body fluid, ELISA kit and using method | |
| CN111551733A (en) | Method for quantitatively detecting content of immune cell-derived extracellular vesicle PD-1, ELISA kit and using method | |
| CN107698683A (en) | CK MB fusion proteins and preparation method thereof and detection kit | |
| CN111796090B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
| CN114891091B (en) | NMDAR encephalitis resistant recombinant antigen and application thereof | |
| CN112540176B (en) | Kit, method and computer-readable storage medium for diagnosing diseases associated with FAP expression abnormality | |
| CN111537726A (en) | Method for efficiently and quantitatively detecting PD-L1 level in extracellular vesicle, ELISA kit and using method | |
| JP7306661B2 (en) | Methods and reagents for detecting gastrointestinal stromal tumors | |
| CN110437341B (en) | Detection protein with red fluorescence activity and application thereof | |
| US20220187309A1 (en) | Compositions and methods for detection of disease-related antibody | |
| KR102466369B1 (en) | Diagnosis method for autoimmune encephalitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20230526 Address after: Room 409, Building 1, Block B, Gaonong Biological Park Headquarters, No. 888 Gaoxin Avenue, Donghu New Technology Development Zone, Wuhan City, Hubei Province, 430000 Applicant after: Jiabi Biotechnology (Wuhan) Co.,Ltd. Address before: 430072 Hubei Province, Wuhan city Wuchang District of Wuhan University Luojiashan Applicant before: WUHAN University |
|
| TA01 | Transfer of patent application right |