CN111537726A

CN111537726A - Method for efficiently and quantitatively detecting PD-L1 level in extracellular vesicle, ELISA kit and using method

Info

Publication number: CN111537726A
Application number: CN202010478959.1A
Authority: CN
Inventors: 陈刚; 刘金元; 余自力; 吴敏; 赵怡芳
Original assignee: Wuhan University WHU
Current assignee: Jiabi Biotechnology (Wuhan) Co.,Ltd.
Priority date: 2020-05-29
Filing date: 2020-05-29
Publication date: 2020-08-14

Abstract

The invention relates to the field of molecular biology and biotechnology, in particular to a method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles, an ELISA kit and a using method thereof, wherein the extracellular vesicles are captured by using anti-CD 63 antibody, CD9 antibody or CD81 antibody in a specific manner, the level of PD-L1 protein in the extracellular vesicles is detected by using the anti-PD-L1 antibody, and the PD-L1 in the extracellular vesicles is quantitatively detected by using the constructed corresponding CD63-PD-L1, CD9-PD-L1 or CD81-PD-L1 fusion protein as a standard. The invention realizes the quantitative detection of the PD-L1 level of the extracellular vesicle complex structure; meanwhile, the detection result is characterized by specific protein concentration by using the independently constructed CD63-PD-L1, CD9-PD-L1 and CD81-PD-L1 fusion proteins as standard proteins.

Description

Method for efficiently and quantitatively detecting PD-L1 level in extracellular vesicle, ELISA kit and using method

Technical Field

The invention relates to the field of molecular biology and biotechnology, and particularly relates to a method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles, an ELISA kit and a using method.

Background

430 million new malignant tumor patients and 280 million dead patients are newly added in China every year, and tumors become the most main cause of death in China and are one of the most main public health problems in China. Further, the prognosis of patients with malignant tumors is not significantly improved with the advance of surgery and chemoradiotherapy techniques. Immunotherapy, which has rapidly emerged in recent years and earned the 2018 Nobel prize, has brought new hopes for patients with malignancies. The inhibitor aiming at the immune checkpoint programmed apoptosis ligand-1/programmed death receptor-1 (PD-L1/PD-1) is a representative drug for the current tumor immunotherapy, and has proved to have obvious curative effect on various malignant tumors. However, only less than 30% of patients could benefit from PD-L1/PD-1 immunotherapy. Patients with ineffective immunotherapy not only suffer from high treatment costs and side effects of immunotherapy, but may miss opportunities for receiving other treatments. Therefore, there is an urgent need to find biomarkers that can accurately predict the efficacy of immunotherapy.

Extracellular vesicles (Evs) are lipid bilayer particles secreted by cells with diameters between 50-1000nm that carry a variety of characteristic bioinformatic molecules from the mother cell, such as proteins, nucleic acids, lipids, and even organelles. In recent years, extracellular vesicles in body fluids have gained widespread attention as an important branch of fluid biopsy.

Recent studies in this project group have found that tumor cells can secrete PD-L1⁺The extracellular vesicles of (4) enter the peripheral blood, and PD-L1 in the peripheral blood of tumor patients⁺And its tendency to change and magnitude at the early stages of immunotherapy are effective in predicting the responsiveness of the patient to treatment. Based on the above results, we proposed a detection strategy based on the level of PD-L1 on the outer vesicle of peripheral blood cells of tumor patients by ELISA in the past. In the ELISA strategy, an anti-PD-L1 antibody is used as a capture antibody, extracellular vesicles are fixed in an ELISA (enzyme-Linked immuno sorbent assay) orifice plate, and the anti-PD-L1 antibody is used for detecting cellsPD-L1 levels on outer vesicles, extracellular vesicle PD-L1 levels were quantified using PD-L1 standard protein. However, both PD-L1 on extracellular vesicles and a significant amount of free PD-L1 protein were present in the patient's body fluids. Clearly, direct ELISA detection of PD-L1 levels on a body fluid sample will be interfered with by free PD-L1 protein. Therefore, to avoid interference from free PD-L1, this strategy requires the isolation and purification of extracellular vesicles from body fluids by ultracentrifugation in advance. However, the ultracentrifugation method is time-consuming and labor-consuming, lacks a standardized operation process, and requires a large-scale ultracentrifugation device, which is not favorable for clinical popularization and application; more importantly, the efficiency of ultracentrifugation for separating extracellular vesicles is less than 30%. Whether the level of PD-L1 in these 30% of extracellular vesicles accurately reflects the level of PD-L1 in total extracellular vesicles is currently unknown.

Therefore, the development of a reliable, rapid and economical method which can directly and efficiently quantitatively detect the level of PD-L1 on extracellular vesicles in body fluid is needed.

Disclosure of Invention

One of the purposes of the invention is to provide a method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles, so that the defects of complicated step of centrifugal purification of the extracellular vesicles and low sample recovery rate are avoided, the interference of free PD-L1 protein on detection results is avoided, and the specific identification and quantitative detection of the level of the protein of PD-L1 in the extracellular vesicles can be realized.

The invention also aims to provide an ELISA kit for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles, which can rapidly and quantitatively detect the level of PD-L1 in the extracellular vesicles.

The invention also aims to provide a using method of the ELISA kit for efficiently and quantitatively detecting the PD-L1 level in the extracellular vesicles.

The scheme adopted by the invention for realizing one of the purposes is as follows: a method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles comprises the steps of capturing the extracellular vesicles by utilizing the specificity of an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody, detecting the level of PD-L1 protein in the extracellular vesicles by utilizing the anti-PD-L1 antibody, and quantitatively detecting the PD-L1 in the extracellular vesicles by utilizing corresponding constructed CD63-PD-L1 fusion protein, CD9-PD-L1 fusion protein or CD81-PD-L1 fusion protein as a standard substance.

Preferably, the nucleic acid sequence of the CD63-PD-L1 fusion protein is shown as SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-L1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-L1 fusion protein is shown as SEQ ID No: 3, respectively.

Preferably, the extracellular vesicles are derived from any one of blood, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, sweat, semen, lymph fluid, and cell culture supernatant.

Except that the blood is specific to various cancers of the whole body, the other collected body fluids are specific part fluids for the detected cancers, such as saliva for cancers of oral cavity and adjacent parts, urine for urothelial cancer, pleural effusion for lung cancer, cerebrospinal fluid for brain glioma and the like.

The second scheme adopted by the invention for achieving the purpose is as follows: an ELISA kit for efficiently and quantitatively detecting the PD-L1 level in extracellular vesicles comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an enzyme-labeled antibody A, an enzyme-labeled antibody B, a color developing agent A liquid, a color developing agent B liquid and stop solution;

wherein, the ELISA plate is coated with anti-CD 63 antibody, anti-CD 9 antibody or anti-CD 81 antibody in advance according to the concentration of 1-5 mug/mL;

the standard protein corresponds to the constructed CD63-PD-L1, CD9-PD-L1 or CD81-PD-L1 fusion protein.

The ELISA plate is a Nunc type ELISA plate of Biolegend company; the sealing membrane is a sealing membrane of Corning company, with the product number of UC-500, and the standard protein diluent comprises 100-20 g/L buffer solution and 2-6g/L preservative, and the buffer solution is 300 mmol/L.

Preferably, the anti-CD 63 antibody is an anti-CD 63 antibody from Thermo Fisher, cat # TJ 26539346; the anti-CD 9 antibody is an anti-CD 9 antibody from Thermo Fisher, cat # TL 2686763; the anti-CD 81 antibody is an anti-CD 81 antibody from Novus, cat No. 531413.

Preferably, the concentrated washing solution is an aqueous solution containing 0.01-0.05mol/L PBS and 1-5 per mill of Tween-20 in mass percentage; the enzyme-labeled antibody A is a1 mu g/mL PD-L1 detection antibody, and the enzyme-labeled antibody B is a1 mu g/mL horseradish peroxidase-coupled chromogenic antibody.

The enzyme-labeled antibody A provided by the kit is a PD-L1 detection antibody of 1 mu g/mL, and is a PD-L1 antibody of eBioscience company with the code of 13-5983-82 after screening various commercially available PD-L1 detection antibodies. The enzyme-labeled antibody B provided by the kit is a horseradish peroxidase-coupled chromogenic antibody of 1 mu g/mL, and is a HRP chromogenic antibody of BD company, the product number of which is 554066, after screening various commercially available HRP chromogenic antibodies.

Preferably, the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid and 0.02% of hydrogen peroxide by mass percent, and is configured in distilled water; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol and 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine in percentage by mass, and is configured in distilled water; the stop solution is 2mol/L dilute sulfuric acid.

The scheme adopted by the invention for realizing the third purpose is as follows: the use method of the ELISA kit for efficiently and quantitatively detecting the PD-L1 level in the extracellular vesicles comprises the following steps:

(1) after balancing at room temperature, taking out the ELISA plate, arranging a standard substance hole and a sample hole on the ELISA plate, adding standard proteins with different concentration gradients into the standard substance hole, adding a body fluid sample to be detected into the sample hole, and culturing for 1 hour at 37 ℃;

(2) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;

(3) adding 100 mu L of enzyme-labeled antibody A liquid and enzyme-labeled antibody B liquid which are mixed in advance into an ELISA plate hole, sealing the ELISA plate hole by using a sealing plate film, and incubating for 1 hour at 37 ℃;

(4) discarding liquid in the hole, injecting washing liquid 300 mu L, washing, repeating for many times, discarding the washing liquid for the last time, and then inversely placing on absorbent paper for drying;

(5) mixing the color developing agent A solution and the color developing agent B solution according to the volume ratio of 1:1, adding 100 mu L of the mixture into each hole, and developing at room temperature in a dark place;

(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, slightly shaking until the color in the hole is yellow, measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample, and calculating the concentration of the sample to be measured.

Preferably, in step (1), the concentration gradient of the standard substance is eight concentration gradients of 16ng/mL, 12ng/mL, 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL and 0ng/mL, and 100. mu.L of the standard substance is added to each standard well.

The body fluid sample mentioned in step 1 of the present invention needs to be subjected to preliminary centrifugation treatment, and there are three main centrifugation conditions for different body fluids: firstly, for saliva and other viscous body fluids, the centrifugal force is 2600g, the centrifugal temperature is 4 ℃, the centrifugal time is 15 minutes, and supernatant is collected and centrifuged twice; secondly, for blood, the centrifugal force is 1550g, the centrifugal temperature is 25 ℃, the centrifugal time is 20 minutes, and upper transparent plasma is collected and centrifuged twice; thirdly, for relatively clear body fluid such as urine, the centrifugal force is 1550g, the centrifugal temperature is 4 ℃, the centrifugal time is 15 minutes, and the supernatant is taken and centrifuged twice.

The incubation temperature set in step 1 and step 3 of the present invention was 37 ℃ and the incubation time was 1 hour.

The washing method mentioned in step 2 and step 4 of the invention comprises the steps of completely sucking reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, completely sucking the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry.

The invention uses 8 or 12-channel pipettor to add liquid in steps 2 to 6 so as to reduce operation errors and loading errors.

The OD value mentioned in step 6 of the invention is an absorbance value, and the OD value at the wavelength of 570nm needs to be subtracted from the OD value at the wavelength of 450nm for correction, and finally the sample concentration is calculated according to the linear relation of the standard.

The invention has the following advantages and beneficial effects:

it has been shown that almost all extracellular vesicles express the tetraspanin family molecules CD63, CD9, CD81, and therefore CD63, CD9, CD81 molecules have been used as markers for identifying extracellular vesicles. Based on the above, the invention provides a novel method for directly detecting the level of extracellular vesicle-PD-L1 in human body fluid or cell culture supernatant, which adopts a double-antibody sandwich method, namely the method takes an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody as a capture antibody of the extracellular vesicle, takes an anti-PD-L1 antibody as a detection antibody, and takes a self-constructed CD63-PD-L1, CD9-PD-L1 or CD81-PD-L1 fusion protein as a standard substance, thereby realizing the quantitative and rapid detection of the PD-L1 content of the extracellular vesicle in the body fluid or cell culture supernatant. Compared with the existing ELISA detection strategy which takes the anti-PD-L1 antibody as the capture antibody, the method avoids the defects of complicated step of body fluid centrifugal purification and low sample recovery rate, simultaneously avoids the interference of free PD-L1 protein on the detection result, and realizes the specific identification and quantitative detection of the protein level of the extracellular vesicle-PD-L1. In addition, because not every extracellular vesicle can simultaneously express CD63, CD9 and CD81, the capture efficiency of the total extracellular vesicles can be greatly improved by combining and matching different marker molecules, and the high-efficiency capture of the total extracellular vesicles is realized. The method has wide application prospect in the aspects of early diagnosis, prognosis evaluation and immunotherapy curative effect prediction of malignant tumors.

Existing PD-L1⁺The quantitative detection of extracellular vesicles requires ultracentrifugation and purification of body fluid or cell culture supernatant to obtain extracellular vesicles, and then quantitative detection is performed by ELISA. The invention breaks through the mode of detecting free single protein molecules by the traditional 'A-A-A sandwich' ELISA, upgrades the original detection method by utilizing the 'A-AB-B' strategy, and realizes the quantitative detection of the extracellular vesicle complex structure; meanwhile, the detection knot is formed by using the independently constructed fusion proteins of CD63-PD-L1, CD9-PD-L1 and CD81-PD-L1 as standard proteinsThe results are no longer percent but are characterized by specific protein concentrations.

Drawings

FIG. 1 is the extracellular vesicle size distribution (a-c) of the normal cell line (HUVEC) and the cancer cell line (Cal27, H1975) in the fourth example of the present invention;

FIG. 2 is a standard curve of CD63-PD-L1 recombinant protein in the fourth embodiment of the present invention;

FIG. 3 shows ELISA detection results of cell supernatants (Supernatant), Extracellular Vesicles (EVs), and postultracentrifugation supernatants (EVs-Free superanatant) of normal cell lines (HUVEC) and cancer cell lines (Cal27, H1975) in example four of the present invention;

FIG. 4 shows the change trend of PD-L1 protein level and tumor volume in the WM164 transplanted tumor nude mouse extracellular vesicle in example V of the present invention;

FIG. 5 shows the results of ELISA detection of normal subjects (HD), patients with non-small cell lung cancer (NSCLC), patients with malignant Melanoma (MP) Plasma (Plasma), Extracellular Vesicles (EVs), and ultracentrifugation supernatant (EVs-Free Plasma) in the sixth example of the present invention;

FIG. 6 shows the results of ELISA detection of saliva of oral cancer patients after being captured by anti-CD 63 antibody, anti-CD 9 antibody, anti-CD 81 antibody, and anti-CD 63/9/81 mixed antibody in example seven of the present invention.

Detailed Description

The following examples are provided to further illustrate the present invention for better understanding, but the present invention is not limited to the following examples.

The first embodiment is as follows: construction of CD63-PD-L1 fusion protein

1. According to the sequence (Gene ID:967) of the human CD63 Gene queried by the Pubmed Gene, selecting a translation fragment from Ala103 to Val 203; PD-L1 Gene sequence (Gene ID:29126), selecting Phe19 to Thr239 translation fragment; inserting a connexin sequence (GGTGGTGGTGGTAGCGGTGGTGGCGGT AGTGGTGGTGGTGGTAGC) between the two segments, connecting a His tag fragment (CATCACCATC ATCATCAT) at the tail end of PD-L1, introducing EcoR and Xhol double enzyme cutting sites, designing a pair of forward and reverse primers (table 1), and carrying out PCR amplification to obtain a CD63-PD-L1 gene fragment, wherein the nucleic acid sequence of the fragment is shown in SEQ ID No: 1, and the amino acid sequence is shown in SEQ ID No: 4, respectively.

TABLE 1 PCR primers CD63-PD-L1

2. The CD63-PD-L1 gene fragment and the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol are connected by an Exnase recombinase (Novozak company, the cargo number C113-01), and the recombinant plasmid CD63-PD-L1 is obtained after transformation and screening.

3. The recombinant plasmid CD63-PD-L1 is transferred into E.coli DH5 α competent bacteria and is subjected to Kanamycin resistant agarose culture medium (K)⁺LB) and extracting the plasmid.

4. The extracted recombinant plasmid CD63-PD-L1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K⁺LB solid culture medium to obtain the target clone bacterial strain.

5. Single colonies were picked to 50mL K⁺LB culture to OD₆₀₀When the concentration is 0.6-0.8, IPTG is added to the final concentration of 0.5-1mmol/L to stimulate protein expression, the culture is continuously carried out for 4-8 hours, centrifugation is carried out at 12000 r/min for 15 minutes, supernatant and precipitate are respectively collected, 20 mu L of 6 × protein loading buffer is added to 100 mu L after the dilution or the re-suspension by PBS, and SDS-polyacrylamide gel electrophoresis and Coomassie brilliant blue staining analysis and identification are carried out.

6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl 50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30 minutes, centrifuged at 12000g at 4 ℃ for 10 minutes, and the pellet was resuspended in 15 volumes of inclusion body lysis buffer (TRIS-HCl 50mmol/L, NaCl 100mmol/L, EDTA 1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).

7. Adding 10mmol/L imidazole into the above heavy suspension, adding into chromatography column, controlling flow rate at 0.5-1 mL/min, washing column with washing buffer (TRIS-HCl 50 mmol/L; NaCl300 mmol/L; imidazole 10 mmol/L; pH 8.0) at 1 mL/min to remove hetero protein, repeating washing for 6 times, eluting with elution buffer (TRIS-HCl 50 mmol/L; NaCl300 mmol/L; imidazole 250 mmol/L; pH 8.0) for 4 times, and collecting eluate.

8. Dialyzing the collected eluate into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD63-PD-L1 fusion protein

Example two: construction of CD9-PD-L1 fusion protein

1. According to the sequence (Gene ID:928) of a human CD9 Gene queried by Pubmed Gene, selecting a Ser 112-Ile 195 translation segment; PD-L1 Gene sequence (Gene ID:29126), selecting Phe19 to Thr239 translation fragment, inserting a connexin sequence (GGTGGTGGTGGTAGCGGTGGTGGCGGT AGTGGTGGTGGTGGTAGC) between two segments, connecting His tag fragment (CATCACCATC ATCATCAT) at the tail end of PD-L1, introducing EcoR and Xhol double enzyme cutting sites, designing a pair of positive and negative primers (table 2), carrying out PCR amplification to obtain CD9-PD-L1 Gene fragment, wherein the nucleic acid sequence is shown in SEQ ID No: 2, and the amino acid sequence is shown in SEQ ID No: 5, respectively.

TABLE 2 CD9-PD-L1 PCR primers

2. Connecting the CD9-PD-L1 gene segment with the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol through an Exnase recombinase, and obtaining a recombinant plasmid CD9-PD-L1 after transformation and screening.

3. Transferring the recombinant plasmid CD63-PD-L1 into E.coli DH5 α competent bacteria, and carrying out K treatment⁺After the large scale amplification of LB culture medium, the plasmid is extracted.

4. The extracted recombinant plasmid CD9-PD-L1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K⁺LB solid culture medium to obtain the target clone bacterial strain.

6. The collected bacterial pellet was added to 8mL of bacterial lysate (TRIS-HCl 50mmol/L, NaCl300mmol/L, triton x-1000.5%, pH 8.0), mixed on ice for 30 minutes, centrifuged at 4 ℃ at 12,000g for 10 minutes, and the pellet was resuspended in 15 volumes of inclusion body dissolution buffer (TRIS-HCl 50mmol/L, NaCl 100mmol/L, EDTA 1mmol/L, triton x-1000.5%, urea 8mol/L, pH 8.0).

8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD9-PD-L1 fusion protein.

Example three: construction of CD81-PD-L1 fusion protein

1. According to the sequence of human CD81 Gene (Gene ID:975) queried by Pubmed Gene, selecting a Phe113 to Lys201 translation segment; PD-L1 Gene sequence (Gene ID:29126), selecting Phe19 to Thr239 translation fragment; inserting a connexin sequence (GGTGGTGGTGGTAGCGGTGGTGGCGGT AGTGGTGGTGGTGGTAGC) between the two segments, connecting a His tag fragment (CATCACCATC ATCATCAT) at the tail end of PD-L1, introducing EcoR and Xhol double enzyme cutting sites, designing a pair of forward and reverse primers (table 3), and carrying out PCR amplification to obtain a CD81-PD-L1 gene fragment, wherein the nucleic acid sequence of the fragment is shown in SEQ ID No: 3, and the amino acid sequence is shown in SEQ ID No: and 6.

TABLE 3 CD81-PD-L1 PCR primers

2. Connecting the CD81-PD-L1 gene segment with the Pet28a plasmid subjected to double enzyme digestion by Ecorl and Xhol through an Exnase recombinase, and obtaining a recombinant plasmid CD81-PD-L1 after transformation and screening.

3. Transferring the recombinant plasmid CD81-PD-L1 into E.coli DH5 α competent bacteria, and carrying out K treatment⁺After the large scale amplification of LB culture medium, the plasmid is extracted.

4. The extracted recombinant plasmid CD81-PD-L1 is transferred into Rosetta (DE3) competent bacteria and evenly coated on K⁺LB solid culture medium to obtain the target clone bacterial strain.

8. And dialyzing the collected eluent into PBS (phosphate buffer solution) by using a semipermeable membrane, dialyzing overnight at 4 ℃, and collecting the solution in the membrane to obtain the CD81-PD-L1 fusion protein.

Example four: ELISA detection of PD-L1 levels in extracellular vesicles derived from oral and lung cancer cell lines

1. Cell supernatants were collected after 48H starvation of low concentration fetal calf serum (5%) using HUVEC, Cal27 and H1975 cell lines, human normal cell lines cultured in exosome-free fetal calf serum (100000g, 4 ℃ overnight centrifugation).

2. The collected 10mL of cell supernatant was centrifuged at 4 ℃ for 30 minutes at 2000g, the supernatant was retained to remove cells and cell debris, 1mL of the supernatant was examined, the remaining 9mL of the supernatant was centrifuged at 4 ℃ for 70 minutes at 100000g, and the centrifuged supernatant was collected and the pellet was resuspended in 20. mu.L of PBS to obtain extracellular vesicles.

3. The resuspended extracellular vesicles were examined by Nanoparticle Tracking Analysis (NTA) and the average size of the extracellular vesicles from HUVEC, Cal27 and H1975 was found to be around 100nm (FIG. 1, a-c).

4. 100 μ L of the supernatant collected from the HUVEC, Cal27 and H1975 cell lines, extracellular vesicles (diluted 20 times), and the supernatant obtained by ultracentrifugation were added to wells of an ELISA plate on which CD63 capture antibody had been plated, eight concentration gradients of the CD63-PD-L1 standard protein obtained in example one were set according to 16ng/mL, 12ng/mL, 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL, and 0ng/mL, 100 μ L of each standard well was added, the well plate was sealed with a membrane, and the plate was incubated at 37 ℃ for 1 hour.

5. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 5 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.

6. Discarding the liquid in the wells of the ELISA plate, injecting 300. mu.L of PBST cleaning solution (0.05% Tween 20 in PBS), repeatedly washing for 4 times, inverting on absorbent paper, patting dry, adding 100. mu.L of the enzyme-labeled antibody mixture of step 6, and incubating in a 37 ℃ incubator for 1 hour.

7. Discarding liquid in the holes of the enzyme label plate, injecting 300 mu L of PBST cleaning solution, repeatedly washing for 5 times, and inversely placing on absorbent paper for drying; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.

8. After the color of the standard hole is changed linearly (10-30 minutes), adding 50 mu L of stop solution into each hole, slightly shaking until the liquid in the hole is completely stopped, and measuring OD values at the wavelength of 450nm and 570nm by using an enzyme labeling instrument within 15 minutes (the OD value at 450nm minus the OD value at 570nm is the final OD value of the sample).

9. Standard curves were plotted against the standard results (fig. 2), and the PD-L1 concentration was calculated for each cell line sample (fig. 3), showing: PD-L1 can hardly be detected in all three samples of the normal cell line HUVEC, the results of cell supernatants of the tumor cell lines Cal27 and H1975 and extracellular vesicles obtained by centrifugation are similar, and almost no PD-L1 exists in the supernatant obtained after ultracentrifugation, which indicates that the ELISA kit can be used for directly and quantitatively detecting PD-L1 on EVs in culture supernatant.

Example five: application of ELISA kit for efficiently and quantitatively detecting extracellular vesicle PD-L1 level in monitoring tumor progress

1. Logarithmic phase WM164 cells were inoculated subcutaneously into the backs of 8-week-old nude mice, each injected with 5 × 10⁶Individual cells (100. mu.L) were inoculated with a total of 20 cells; three weeks in culture, photographed and measured tumor volume, calculated as width²× length/2.

2. Euthanizing a nude mouse, immediately collecting 500 mu L of eyeball arterial blood, centrifuging for 10 minutes at 25 ℃ under 1550g, and collecting upper plasma; the supernatant plasma was collected by centrifugation for 10 minutes under the same conditions.

3. Taking out the ELISA plate on which the CD63 capture antibody is pre-paved, setting 8 concentration gradients of 16ng/mL, 12ng/mL, 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL and 0ng/mL of the CD63-PD-L1 recombinant protein prepared in the first embodiment, and adding the recombinant protein into a standard well; adding 100 mu L of nude mouse plasma into a sample hole; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.

4. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.

5. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.

6. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, sucking up liquid in the holes after shaking for 2 minutes, repeatedly washing for 5 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.

7. And observing the standard product hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the position of 570nm from the OD value at the position of 450nm, and calculating the concentration of the sample to be measured.

8. The correlation of tumor volume with PD-L1 concentration on blood extracellular vesicles was analyzed in conjunction with tumor measurements (fig. 4). The results show that the concentration of PD-L1 on extracellular vesicles in blood of nude mice increases with tumor volume (P ═ 0.0002), suggesting that PD-L1 on extracellular vesicles in body fluids can predict tumor progression.

Example six: application of ELISA kit for efficiently and quantitatively detecting PD-L1 level on human body fluid extracellular vesicle in tumor diagnosis and treatment

1. Collecting 2mL of blood from five normal subjects (HD), five non-small cell lung cancer (NSCLC) patients and five malignant Melanoma (Melanoma patient, MP), centrifuging at 25 deg.C and 1550g for 10 min, and collecting upper plasma; centrifuging for 10 minutes under the same conditions, and collecting upper plasma; reserving part of the plasma for detection, centrifuging the rest part of the plasma for 10 minutes at the temperature of 4 ℃ and 16000g, and collecting the supernatant; the cells were centrifuged at 120000g at 4 ℃ for 70 minutes, and the supernatant was collected and the pellet was resuspended in 20. mu.L LPBS to obtain extracellular vesicles.

2. Adding 100 μ L of the collected plasma, extracellular vesicles (diluted by 25 times), and supernatant obtained by ultracentrifugation into a well of an ELISA plate in which a CD63 capture antibody has been previously applied; setting the CD63-PD-L1 recombinant protein prepared in the first example to be 16ng/mL, 12ng/mL, 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL and 0ng/mL for 8 concentration gradients, and adding the protein into a standard hole; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.

3. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while the procedure of step 3 was performed, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.

4. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.

5. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, sucking up liquid in the holes after shaking for 2 minutes, repeatedly washing for 5 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.

6. And observing the standard product hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the position of 570nm from the OD value at the position of 450nm, and calculating the concentration of the sample to be measured.

7. The concentrations of PD-L1 in blood samples of normal subjects, patients with non-small cell lung cancer, and patients with malignant melanoma were compared (FIG. 5). The results show that: the results of plasma and extracellular vesicles obtained by centrifugation in the three groups of samples are similar, and PD-L1 cannot be detected in the supernatant obtained by ultracentrifugation, further suggesting that the ELISA kit can eliminate the interference of free PD-L1 protein and quantitatively detect PD-L1 on extracellular vesicles in the culture supernatant; the results of two groups of patients of non-small cell lung cancer and malignant melanoma are obviously higher than those of the HD group, which shows that the kit can be used for diagnosing malignant tumor patients.

Example seven: application of ELISA kit for efficiently and quantitatively detecting PD-L1 level on extracellular vesicles in detection of PD-L1 level of salivary extracellular vesicles in oral cancer

1. Five patients with oral cancer (OSCC) were collected in 5mL portions, centrifuged at 2600g at 4 ℃ for 15 minutes, and the supernatants were collected, centrifuged twice and stored at 4 ℃ for further use.

2. An anti-CD 63 antibody (Thermo Fisher, Cat. No. TJ26539346), an anti-CD 9 antibody (Thermo Fisher, Cat. No. TL2686763), and an anti-CD 81 antibody (Novus, Cat. No. 531413) were each diluted at a concentration of 5. mu.g/mL in a carbonic acid coating buffer (8.4g of NaHCO3, 3.56g of Na2CO3 in 1L of double distilled water, and the pH was adjusted to 9.5), and anti-CD 63, CD9, and CD81 antibodies were each mixed and diluted at a concentration of 5. mu.g/mL to serve as capture antibodies for total extracellular vesicles of body fluid.

Adding 50 mu L of the anti-CD 63, CD9, CD81 and CD63/9/81 mixed antibody into each hole of an ELISA plate, wherein each group has 5 holes and the total amount is 20 holes; the pore plate was sealed with a sealing film and left overnight at 4 ℃.

4. Sucking up reaction liquid in the holes, injecting 300 mu L of washing liquid, slightly shaking for 2 minutes, sucking up liquid in the holes, repeatedly washing for 4 times, sucking up the washing liquid in the holes for the last time, and inversely placing the holes on absorbent paper to be patted dry.

5. Add 200. mu.L of blocking solution (10% FBS, 2mL fetal bovine serum in 18mL PBS) per well and block for 1 hour at room temperature.

6. Adding 100 μ L of the supernatant collected in step 1 into the sample wells, each patient having a well without an incubated capture antibody as a blank; the well plate was sealed with a sealing membrane and incubated in an incubator at 37 ℃ for 1 hour.

7. The enzyme-labeled antibody A, B solution was mixed at a ratio of 1:1 while performing step 6, and the mixture was incubated in an incubator at 37 ℃ for 1 hour.

8. Sucking up reaction liquid in the pores, injecting 300 mu L of washing liquid, and sucking up liquid in the pores after shaking for 2 minutes; washing for 4 times, wherein the last time, the washing liquid in the holes needs to be completely absorbed, and the holes are inversely placed on the absorbent paper to be dried; add 100. mu.L of the enzyme-labeled antibody mixture of step 3, and incubate in 37 ℃ incubator for 1 hour.

9. Sucking up reaction liquid in the pores, injecting 300 mu L of washing liquid, and sucking up liquid in the pores after shaking for 2 minutes; washing for 5 times, wherein the last time, the washing liquid in the holes needs to be completely absorbed, and the holes are inversely placed on the absorbent paper to be dried; the color developing solution A, B was mixed at a ratio of 1:1, and 100. mu.L of the mixture was added to each well, and light-shielding color development was performed.

10. And (3) observing the color change of the sample hole within 10-30 minutes, adding 50 mu L of stop solution to stop the color reaction, slightly shaking until the color reaction is completely stopped in the hole, measuring the OD value of each hole at the wavelength of 450nm and 570nm of an enzyme-linked immunosorbent assay detector within 15 minutes, and calculating the OD value at 450nm minus the OD value at 570nm to obtain the final OD value of the sample.

11. Comparing the detection results obtained after capture of anti-CD 63, CD9, CD81, CD63/9/81 mixed antibody (fig. 6), with CD63/9/81 as a control, it can be seen that the content of PD-L1 obtained by using CD9 capture antibody is slightly higher than that obtained by using CD63 and CD81 capture antibody, i.e. more extracellular vesicles are captured by using anti-CD 9 antibody, while more extracellular vesicles and PD-L1 are detected by using anti-CD 63/9/63 mixed capture antibody than anti-CD 63, CD9 and CD81 antibodies, indicating that the surface protein expression of extracellular vesicles in different body fluids is different, and errors caused by the expression difference of surface protein molecules in different body fluids can be avoided by using anti-CD 63/9/81 mixed capture antibody.

While the foregoing is directed to the preferred embodiment of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.

Sequence listing

<110> Wuhan university

<120> method for efficiently and quantitatively detecting PD-L1 level in extracellular vesicle, ELISA kit and using method

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>1032

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gcgggttatg tgtttcgtga taaagtgatg agtgaattta ataataattt tcgccagcag 60

atggaaaatt atccgaaaaa taatcatacc gccagcattc tggatcgtat gcaggccgat 120

tttaaatgct gcggtgccgc caattatacc gattgggaaa aaattccgag catgagcaaa 180

aatcgcgttc cggattcatg ctgtattaat gtgaccgttg gctgcggcat taattttaat 240

gaaaaagcga ttcataaaga aggctgtgtt gaaaaaattg gtggttggct gcgcaaaaat 300

gtgggtggtg gtggtagcgg tggtggcggt agtggtggtg gtggtagctt taccgtgacc 360

gtgccgaaag atctgtatgt tgttgaatat ggtagcaata tgacaattga atgtaaattt 420

ccggtggaaa aacagctgga tctggcagcg ctgattgttt attgggaaat ggaagataaa 480

aacattattc agtttgtgca tggtgaagaa gatctgaaag tgcagcatag ctcatatcgc 540

cagcgtgccc gtctgctgaa agatcagctg agcctgggca atgccgcctt acagattacc 600

gatgttaaat tgcaggatgc gggtgtgtat cgttgcatga ttagctatgg tggcgcagat 660

tataaacgca ttaccgtgaa agttaatgca ccgtataata aaattaatca gcgtattctg 720

gtggttgatc cggtgacctc cgaacatgaa ctgacctgcc aggccgaagg ctatccgaaa 780

gccgaagtga tttggaccag cagcgatcat caggtgctga gcggtaaaac caccaccacc 840

aatagcaaac gtgaagaaaa actgtttaat gttaccagca ccctgcgtat taataccacc 900

accaatgaaa tcttttattg cacctttcgc cgtctggatc cggaagaaaa tcataccgca 960

gaactggtta ttccggaact gccgctggcc catccgccga atgaacgcac ccatcaccat 1020

catcatcatt aa 1032

<210>2

<211>981

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tcccacaagg atgaggtgat taaggaagtc caggagtttt acaaggacac ctacaacaag 60

ctgaaaacca aggatgagcc ccagcgggaa acgctgaaag ccatccacta tgcgttgaac 120

tgctgtggtt tggctggggg cgtggaacag tttatctcag acatctgccc caagaaggac 180

gtactcgaaa ccttcaccgt gaagtcctgt cctgatgcca tcaaagaggt cttcgacaat 240

aaattccaca tcggtggtgg tggtagcggt ggtggcggta gtggtggtgg tggtagcttt 300

accgtgaccg tgccgaaaga tctgtatgtt gttgaatatg gtagcaatat gacaattgaa 360

tgtaaatttc cggtggaaaa acagctggat ctggcagcgc tgattgttta ttgggaaatg 420

gaagataaaa acattattca gtttgtgcat ggtgaagaag atctgaaagt gcagcatagc 480

tcatatcgcc agcgtgcccg tctgctgaaa gatcagctga gcctgggcaa tgccgcctta 540

cagattaccg atgttaaatt gcaggatgcg ggtgtgtatc gttgcatgat tagctatggt 600

ggcgcagatt ataaacgcat taccgtgaaa gttaatgcac cgtataataa aattaatcag 660

cgtattctgg tggttgatcc ggtgacctcc gaacatgaac tgacctgcca ggccgaaggc 720

tatccgaaag ccgaagtgat ttggaccagc agcgatcatc aggtgctgag cggtaaaacc 780

accaccacca atagcaaacg tgaagaaaaa ctgtttaatg ttaccagcac cctgcgtatt 840

aataccacca ccaatgaaat cttttattgc acctttcgcc gtctggatcc ggaagaaaat 900

cataccgcag aactggttat tccggaactg ccgctggccc atccgccgaa tgaacgcacc 960

catcaccatc atcatcatta a 981

<210>3

<211>996

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tttgtcaaca aggaccagat cgccaaggat gtgaagcagt tctatgacca ggccctacag 60

caggccgtgg tggatgatga cgccaacaac gccaaggctg tggtgaagac cttccacgag 120

acgcttgact gctgtggctc cagcacactg actgctttga ccacctcagt gctcaagaac 180

aatttgtgtc cctcgggcag caacatcatc agcaacctct tcaaggagga ctgccaccag 240

aagatcgatg acctcttctc cgggaagggt ggtggtggta gcggtggtgg cggtagtggt 300

ggtggtggta gctttaccgt gaccgtgccg aaagatctgt atgttgttga atatggtagc 360

aatatgacaa ttgaatgtaa atttccggtg gaaaaacagc tggatctggc agcgctgatt 420

gtttattggg aaatggaaga taaaaacatt attcagtttg tgcatggtga agaagatctg 480

aaagtgcagc atagctcata tcgccagcgt gcccgtctgc tgaaagatca gctgagcctg 540

ggcaatgccg ccttacagat taccgatgtt aaattgcagg atgcgggtgt gtatcgttgc 600

atgattagct atggtggcgc agattataaa cgcattaccg tgaaagttaa tgcaccgtat 660

aataaaatta atcagcgtat tctggtggtt gatccggtga cctccgaaca tgaactgacc 720

tgccaggccg aaggctatcc gaaagccgaa gtgatttgga ccagcagcga tcatcaggtg 780

ctgagcggta aaaccaccac caccaatagc aaacgtgaag aaaaactgtt taatgttacc 840

agcaccctgc gtattaatac caccaccaat gaaatctttt attgcacctt tcgccgtctg 900

gatccggaag aaaatcatac cgcagaactg gttattccgg aactgccgct ggcccatccg 960

ccgaatgaac gcacccatca ccatcatcat cattaa 996

<210>4

<211>343

<212>PRT

<213>CD63-PD-L1(CD63-PD-L1)

<400>4

Ala Gly Tyr Val Phe Arg Asp Lys Val Met Ser Glu Phe Asn Asn Asn

1 5 10 15

Phe Arg Gln Gln Met Glu Asn Tyr Pro Lys Asn Asn His Thr Ala Ser

20 25 30

Ile Leu Asp Arg Met Gln Ala Asp Phe Lys Cys Cys Gly Ala Ala Asn

35 40 45

Tyr Thr Asp Trp Glu Lys Ile Pro Ser Met Ser Lys Asn Arg Val Pro

50 55 60

Asp Ser Cys Cys Ile Asn Val Thr Val Gly Cys Gly Ile Asn Phe Asn

65 70 75 80

Glu Lys Ala Ile His Lys Glu Gly Cys Val Glu Lys IleGly Gly Trp

85 90 95

Leu Arg Lys Asn Val Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

100 105 110

Gly Gly Gly Ser Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val

115 120 125

Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu Lys

130 135 140

Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu Met Glu Asp Lys

145 150 155 160

Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp Leu Lys Val Gln His

165 170 175

Ser Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu

180 185 190

Gly Asn Ala Ala Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly

195 200 205

Val Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile

210 215 220

Thr Val Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu

225 230 235 240

Val Val Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln AlaGlu

245 250 255

Gly Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln Val

260 265 270

Leu Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu

275 280 285

Phe Asn Val Thr Ser Thr Leu Arg Ile Asn Thr Thr Thr Asn Glu Ile

290 295 300

Phe Tyr Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala

305 310 315 320

Glu Leu Val Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg

325 330 335

Thr His His His His His His

340

<210>5

<211>326

<212>PRT

<213>CD9-PD-L1(CD9-PD-L1)

<400>5

Ser His Lys Asp Glu Val Ile Lys Glu Val Gln Glu Phe Tyr Lys Asp

1 5 10 15

Thr Tyr Asn Lys Leu Lys Thr Lys Asp Glu Pro Gln Arg Glu Thr Leu

20 25 30

Lys Ala Ile His Tyr Ala Leu Asn Cys Cys Gly Leu Ala Gly Gly Val

35 40 45

Glu Gln Phe Ile Ser Asp Ile Cys Pro Lys Lys Asp Val Leu Glu Thr

50 55 60

Phe Thr Val Lys Ser Cys Pro Asp Ala Ile Lys Glu Val Phe Asp Asn

65 70 75 80

Lys Phe His Ile Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

85 90 95

Gly Gly Ser Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu

100 105 110

Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu Lys Gln

115 120 125

Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu Met Glu Asp Lys Asn

130 135 140

Ile Ile Gln Phe Val His Gly Glu Glu Asp Leu Lys Val Gln His Ser

145 150 155 160

Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly

165 170 175

Asn Ala Ala Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly Val

180 185 190

Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr

195 200 205

Val Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn Gln Arg Ile Leu Val

210 215 220

Val Asp Pro Val Thr Ser Glu His Glu Leu Thr Cys Gln Ala Glu Gly

225 230 235 240

Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser Asp His Gln Val Leu

245 250 255

Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu Phe

260 265 270

Asn Val Thr Ser Thr Leu Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe

275 280 285

Tyr Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu

290 295 300

Leu Val Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg Thr

305 310 315 320

His His His His His His

325

<210>6

<211>331

<212>PRT

<213>CD81-PD-L1(CD81-PD-L1)

<400>6

Phe Val Asn Lys Asp Gln IleAla Lys Asp Val Lys Gln Phe Tyr Asp

1 5 10 15

Gln Ala Leu Gln Gln Ala Val Val Asp Asp Asp Ala Asn Asn Ala Lys

20 25 30

Ala Val Val Lys Thr Phe His Glu Thr Leu Asp Cys Cys Gly Ser Ser

35 40 45

Thr Leu Thr Ala Leu Thr Thr Ser Val Leu Lys Asn Asn Leu Cys Pro

50 55 60

Ser Gly Ser Asn Ile Ile Ser Asn Leu Phe Lys Glu Asp Cys His Gln

65 70 75 80

Lys Ile Asp Asp Leu Phe Ser Gly Lys Gly Gly Gly Gly Ser Gly Gly

85 90 95

Gly Gly Ser Gly Gly Gly Gly Ser Phe Thr Val Thr Val Pro Lys Asp

100 105 110

Leu Tyr Val Val Glu Tyr Gly Ser Asn Met Thr Ile Glu Cys Lys Phe

115 120 125

Pro Val Glu Lys Gln Leu Asp Leu Ala Ala Leu Ile Val Tyr Trp Glu

130 135 140

Met Glu Asp Lys Asn Ile Ile Gln Phe Val His Gly Glu Glu Asp Leu

145 150 155 160

Lys Val Gln His Ser Ser Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp

165 170 175

Gln Leu Ser Leu Gly Asn Ala Ala Leu Gln Ile Thr Asp Val Lys Leu

180 185 190

Gln Asp Ala Gly Val Tyr Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp

195 200 205

Tyr Lys Arg Ile Thr Val Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn

210 215 220

Gln Arg Ile Leu Val Val Asp Pro Val Thr Ser Glu His Glu Leu Thr

225 230 235 240

Cys Gln Ala Glu Gly Tyr Pro Lys Ala Glu Val Ile Trp Thr Ser Ser

245 250 255

Asp His Gln Val Leu Ser Gly Lys Thr Thr Thr Thr Asn Ser Lys Arg

260 265 270

Glu Glu Lys Leu Phe Asn Val Thr Ser Thr Leu Arg Ile Asn Thr Thr

275 280 285

Thr Asn Glu Ile Phe Tyr Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu

290 295 300

Asn His Thr Ala Glu Leu Val Ile Pro Glu Leu Pro Leu Ala His Pro

305 310 315 320

Pro Asn Glu Arg Thr His His His His His His

325 330

Claims

1. A method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles is characterized by comprising the following steps: the specificity of an anti-CD 63 antibody, an anti-CD 9 antibody or an anti-CD 81 antibody is used for capturing extracellular vesicles, the level of PD-L1 protein in the extracellular vesicles is detected by using an anti-PD-L1 antibody, and the constructed corresponding CD63-PD-L1 fusion protein, CD9-PD-L1 fusion protein or CD81-PD-L1 fusion protein is used as a standard substance to realize the quantitative detection of PD-L1 in the extracellular vesicles.

2. The method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles according to claim 1, wherein: the nucleic acid sequence of the CD63-PD-L1 fusion protein is shown as SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-L1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-L1 fusion protein is shown as SEQ ID No: 3, respectively.

3. The method for efficiently and quantitatively detecting the level of PD-L1 in extracellular vesicles according to claim 1, wherein: the extracellular vesicle is derived from any one of blood, saliva, urine, cerebrospinal fluid, abdominal cavity hydrops, pleural effusion, sweat, semen, lymph fluid and cell culture supernatant.

4. An ELISA kit for efficiently and quantitatively detecting the PD-L1 level in extracellular vesicles is characterized in that: the kit comprises an ELISA plate, a sealing plate membrane, standard protein diluent, sample diluent, concentrated washing liquid, an ELISA antibody A, an ELISA antibody B, a color developing agent A liquid, a color developing agent B liquid and stop solution;

5. The ELISA kit for high-efficiency quantitative detection of the PD-L1 level in extracellular vesicles according to claim 4, characterized in that: the anti-CD 63 antibody is an anti-CD 63 antibody from Thermo Fisher, cat # TJ 26539346; the anti-CD 9 antibody is an anti-CD 9 antibody from Thermo Fisher, cat # TL 2686763; the anti-CD 81 antibody is an anti-CD 81 antibody from Novus, cat No. 531413.

6. The ELISA kit for high-efficiency quantitative detection of the PD-L1 level in extracellular vesicles according to claim 4, characterized in that: the nucleic acid sequence of the CD63-PD-L1 fusion protein is shown as SEQ ID No: 1, the nucleic acid sequence of the CD9-PD-L1 fusion protein is shown as SEQ ID No: 2, the nucleic acid sequence of the CD81-PD-L1 fusion protein is shown as SEQ ID No: 3, respectively.

7. The ELISA kit for high-efficiency quantitative detection of the PD-L1 level in extracellular vesicles according to claim 4, characterized in that: the concentrated washing solution is an aqueous solution containing 0.01-0.05mol/L PBS and 1-5 per mill of Tween-20 in mass percentage; the enzyme-labeled antibody A is a1 mu g/mL PD-L1 detection antibody, and the enzyme-labeled antibody B is a1 mu g/mL horseradish peroxidase-coupled chromogenic antibody.

8. The ELISA kit for high-efficiency quantitative detection of the PD-L1 level in extracellular vesicles according to claim 4, characterized in that: the color developing agent A liquid comprises 2.72% of sodium acetate, 0.32% of citric acid and 0.02% of hydrogen peroxide by mass percent, and is configured in distilled water; the color developing agent B liquid comprises 0.04% of disodium ethylene diamine tetraacetate, 0.19% of citric acid, 9% of glycerol and 0.03% of 3,3 ', 5, 5' -tetramethyl benzidine in percentage by mass, and is configured in distilled water; the stop solution is 2mol/L dilute sulfuric acid.

9. The use method of the ELISA kit for the high-efficiency quantitative detection of the PD-L1 level in the extracellular vesicles according to any one of claims 4 to 8, is characterized by comprising the following steps:

(6) and observing the standard sample hole, after the color gradient changes within 10-30 minutes, adding 50 mu L of stop solution to stop color development, shaking until the color in the hole is yellow, measuring the OD value of each hole at the wavelength of 450nm and 570nm within 15 minutes, calculating the final OD value of the sample by subtracting the OD value at the wavelength of 570nm from the OD value at the wavelength of 450nm, and calculating the concentration of the sample to be measured.

10. The use method of the ELISA kit for high-efficiency quantitative detection of the PD-L1 level in the extracellular vesicles according to claim 9, characterized in that: in the step (1), the concentration gradient of the standard substance is eight concentration gradients of 16ng/mL, 12ng/mL, 8ng/mL, 4ng/mL, 2ng/mL, 1ng/mL, 0.5ng/mL and 0ng/mL, and 100 mu.L of the standard substance is added into each standard hole.