CN111218408B

CN111218408B - Aspergillus niger strain for efficiently producing malic acid, construction method and application

Info

Publication number: CN111218408B
Application number: CN202010069216.9A
Authority: CN
Inventors: 刘浩; 徐永学; 徐晴; 黄和; 曹威
Original assignee: Nanjing Normal University; Tianjin University of Science and Technology
Current assignee: Nanjing Haohe Biotechnology Co.,Ltd.
Priority date: 2020-01-21
Filing date: 2020-01-21
Publication date: 2021-05-04
Anticipated expiration: 2040-01-21
Also published as: CN111218408A

Abstract

The invention relates to an Aspergillus niger genetic engineering strain for efficiently producing malic acid, wherein the Aspergillus niger genetic engineering strain is an Aspergillus niger genetic engineering strain which is knocked out of a citric acid transporter gene cexA and overexpresses a glucose transporter gene mstC, a hexokinase gene hxkA, a phosphofructokinase gene pfkA and a pyruvate kinase gene pkiA which are derived from Aspergillus niger. The efficiency of producing malic acid by the Aspergillus niger genetic engineering strain is obviously improved, the yield of the Aspergillus niger genetic engineering strain reaches 195.72-210 g/L in the eighth day of fed-batch fermentation in a fermentation tank, the conversion rate of the malic acid to glucose reaches 1.59-1.64 mol/mol, the fermentation period is shortened by one day compared with that of the original strain, and the fermentation period is shortened to 8 days from the original 9 days. Provides excellent strains for preparing malic acid by a microbial fermentation method.

Description

Aspergillus niger strain for efficiently producing malic acid, construction method and application

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to an aspergillus niger strain for efficiently producing malic acid, a construction method and application.

Background

Aspergillus niger has been used as an important cell factory for fermentative production of organic acids for over 100 years, not only for GRAS (genetically regulated safe) strains, but also for the utilization of inexpensive carbon sources. L-malic acid, also known as 2-hydroxysuccinic acid, is mainly used in the industries of food, medicine and the like. In the food industry, L-malic acid is mainly used as a food acid, has the characteristics of soft taste, large acidity, long retention time and the like compared with citric acid, does not damage oral teeth and accumulate fat, becomes a low-calorie food acid recognized by the international food industry as a safe food acid, and is one of organic acids with the largest dosage and better development prospect in the food industry in the world at present. In the pharmaceutical industry, L-malic acid is used for treating various diseases such as liver disease, anemia and uremia. Moreover, since L-malic acid is favorable for amino acid absorption in metabolism, it is often formulated into compound amino acid injection. Since L-malic acid has superior sour taste stimulating effect to citric acid and consumers in western developed countries are cautious and doubtful about chemically synthesized products, the range of application of fermentation-produced natural products L-malic acid in the fields of food and medicine is expanding, and the FDA in the United states bans the use of DL-malic acid in food and restricts the use of citric acid in children and elderly food, the application of L-malic acid in food industry has gradually replaced citric acid in recent years, and thus the demand for L-malic acid in international market is increasing day by day.

At present, the problems of low production efficiency, long fermentation production period, high accumulation of by-product citric acid and the like exist in the production of malic acid by applying aspergillus niger fermentation, so that the production cost is too high, and a subsequent complex malic acid separation and purification process is caused.

Through searching, no published patent literature relevant to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides an aspergillus niger strain for efficiently producing malic acid, a construction method and application.

The technical scheme adopted by the invention for solving the technical problems is as follows:

an Aspergillus niger (Aspergillus niger) genetic engineering strain for efficiently producing malic acid, wherein the Aspergillus niger genetic engineering strain is an Aspergillus niger genetic engineering strain which is knocked out of a citrate transporter gene cexA and overexpresses a glucose transporter gene mstC, a hexokinase gene hxkA, a phosphofructokinase gene pfkA and a pyruvate kinase gene pkiA which are derived from Aspergillus niger.

Furthermore, the cexA sequence of the Gene was 4989494 at NCBI-Gene ID, the mstC sequence was 4978840 at NCBI-Gene ID, the hxkA Gene was 4979978 at NCBI-Gene ID, the pfkA sequence was 4989727 at NCBI-Gene ID, and the pkiA sequence was 4982167 at NCBI-Gene ID.

The construction method of the aspergillus niger genetic engineering strain for efficiently producing malic acid comprises the following steps:

construction of Aspergillus niger genetic engineering strain for eliminating by-product citric acid

Step 1, constructing a gene cexA knockout plasmid: respectively amplifying by PCR reaction by using a wild type Aspergillus niger ATCC1015 genome as a template to obtain upstream and downstream homologous recombination sequence segments of a gene cexA; cloning the upstream and downstream homologous recombination sequence fragments of the gene cexA to a vector pLH594 to construct a gene cexA knockout plasmid pLH 623;

step 2, obtaining a cexA gene knockout strain: transforming the plasmid pLH623 into a host strain S575, and obtaining a cexA gene knockout strain S895 through transformant screening and hygromycin resistance gene recombination;

construction of Aspergillus niger genetically engineered strain for efficiently producing L-malic acid

Step 1, constructing an mstC gene overexpression plasmid: taking a wild type Aspergillus niger ATCC1015 genome as a template, and obtaining a gene mstC sequence fragment through PCR (polymerase chain reaction) amplification; cloning the sequence fragment of the gene mstC to a vector pLH509 to construct a gene mstC overexpression plasmid pLH 684; the gene mstC is controlled by an Aspergillus niger pyruvate kinase gene promoter PpkiA, the sequence of the promoter PpkiA is SEQ NO.4, and the length is 1035 bp;

step 2, obtaining of an mstC gene overexpression strain: transforming the plasmid pLH684 into a cexA gene knockout strain S895, and obtaining an mstC gene overexpression strain S1006 through transformant screening and hygromycin resistance gene recombination;

step 3, constructing pfkA gene overexpression plasmid: taking a wild type Aspergillus niger ATCC1015 genome as a template, and obtaining a gene pfkA sequence fragment by PCR reaction amplification; cloning the sequence fragment of the gene pfkA into a vector pLH454 to construct a gene pfkA overexpression plasmid pLH 473; the gene pfkA is controlled by an Aspergillus niger 3-phosphoglycerol dehydrogenase gene promoter PgpdA;

step 4, constructing hxkA gene overexpression plasmid: taking a wild type Aspergillus niger ATCC1015 genome as a template, and obtaining a gene hxkA sequence fragment by PCR reaction amplification; cloning the sequence fragment of the gene hxkA to a vector pLH509 to construct a gene hxkA overexpression plasmid pLH 667; the gene hxkA is controlled by an Aspergillus niger pyruvate kinase gene promoter PpkiA;

step 5, constructing pfkA gene and hxkA gene combination overexpression plasmids: respectively taking pfkA gene overexpression plasmid pLH473 and hxkA gene overexpression plasmid pLH667 as templates, and obtaining PgpdA-pfkA-Ttrpc sequence fragments and PpkiA-hxkA-Ttrpc sequence fragments through PCR amplification; cloning the PgpdA-pfkA-Ttrpc sequence fragment and the PpkiA-hxkA-Ttrpc sequence fragment into a vector pLH331 to construct a pfkA gene and hxkA gene combination overexpression plasmid pLH 727;

step 6, obtaining a cexA gene knockout and mstC, hxkA and pfkA gene overexpression strain: transforming the plasmid pLH727 into a cexA gene knockout and mstC gene overexpression strain S1006, and obtaining a cexA gene knockout and mstC, hxkA and pfkA gene overexpression strain S1078 through transformant screening and hygromycin resistance gene recombination;

step 7, constructing a pkiA gene overexpression plasmid: taking a wild type Aspergillus niger ATCC1015 genome as a template, and obtaining a gene pkiA sequence fragment through PCR (polymerase chain reaction) amplification; cloning the gene pkiA sequence fragment to a vector pLH509 to construct a gene hxkA overexpression plasmid pLH 683; the gene pkiA is controlled by an Aspergillus niger pyruvate kinase gene promoter PpkiA;

step 8, knockout of cexA gene and acquisition of mstC, hxkA, pfkA and pkiA gene overexpression strains:

and transforming the plasmid pLH683 to a cexA gene knockout and mstC, hxkA and pfkA gene overexpression strain S1078, and obtaining a cexA gene knockout and mstC, hxkA, pfkA and pkiA gene overexpression strain S1149 through transformant screening and hygromycin resistance gene recombination to obtain the Aspergillus niger genetic engineering strain for efficiently producing malic acid.

Moreover, the vector pLH594 was constructed as follows:

synthesizing a bialaphos resistance gene Bar gene, then simultaneously connecting a Bar gene sequence with a starting vector pLH577 subjected to EcoRI/BamHI double enzyme digestion linearization, and transforming a connecting product into escherichia coli JM109 competent cells to obtain a plasmid pLH 593;

taking plasmid pLH593 as a template, and amplifying a Ttrpc sequence of a promoter PgpdA of an Aspergillus niger 3-phosphoglycerol dehydrogenase gene, a bialaphos resistance gene Bar and a C terminator of an Aspergillus nidulans tryptophan synthesis gene by PCR; then the PgpdA promoter, the bar gene and the Ttrpc terminator sequence are simultaneously connected with the starting vector pLH334 which is linearized by KpnI/EcoRI double digestion, and the connection product is transformed into competent cells of Escherichia coli JM109 to obtain the plasmid pLH 594.

Moreover, the vector pLH509 was constructed as follows:

respectively taking genomes of Aspergillus niger and Aspergillus nidulans as templates, amplifying a promoter PpkiA of an Aspergillus niger pyruvate kinase gene and a terminator Ttrpc sequence of a tryptophan synthesis gene C of Aspergillus nidulans by PCR, after sequencing and confirming no mutation, simultaneously connecting the promoter PpkiA and the terminator sequence of the Ttrpc with a starting vector pLH419 which is linearized by XbaI/XhoI double enzyme digestion, and transforming a connecting product into competent cells of Escherichia coli JM109 to obtain a plasmid pLH 509.

Moreover, the construction method of the strain S1149 is as follows:

obtaining a cefA gene knockout strain:

electrically transferring a plasmid pLH623 to agrobacterium, co-culturing the agrobacterium containing the plasmid pLH623 and a host strain S575 on an IM (instant messaging) plate for agrobacterium-mediated transformation, transferring transformants to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for two days after co-culture until the transformants grow hyphae, randomly selecting 100 transformants for transferring to an MM plate containing 10 mu g/mL glufosinate, selecting a clone slowly growing on the plate containing glufosinate to extract a genome for PCR (polymerase chain reaction) screening verification, selecting one correct cexA knockout clone for hph marker induced recombination to obtain a cexA gene knockout strain S895 without hygromycin resistance;

obtaining a strain with cefA gene knockout and mstC gene overexpression:

electrically transferring a plasmid pLH684 to agrobacterium, then co-culturing the agrobacterium containing the plasmid pLH684 and a cexA gene knockout strain S895 on an IM (instant Messaging) plate for agrobacterium-mediated transformation, after co-culturing for two days, transferring a transformant to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening until the transformant grows out hyphae, then randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformant with the highest yield for hph marker induced recombination, and obtaining a hygromycin-sensitive cexA gene knockout and mstC gene overexpression strain S1006;

obtaining a cexA gene knockout and mstC, hxkA and pfkA gene overexpression strain:

electrically transferring plasmid pLH727 to agrobacterium, then performing overexpression on the agrobacterium containing the pLH727 and an mstC gene, performing agrobacterium-mediated transformation on a cexA gene knockout strain S1006 in an IM (instant Messaging) plate, transferring transformants to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening till hyphae grow out after co-culturing for two days, then randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformant with the highest yield for hph marker induced recombination, and obtaining a hygromycin-sensitive cexA gene knockout and mstC, hxkA and pfkA gene overexpression strain S1078;

knockout of the cexA gene and obtainment of mstC, hxkA, pfkA and pkiA gene overexpression strains:

electrically transferring plasmid pLH683 to agrobacterium, then performing overexpression of agrobacterium containing plasmid pLH683 and mstC gene overexpression and hxkA gene and pfkA gene combination overexpression and performing agrobacterium-mediated transformation on cexA gene knockout strain S1078 in an IM (instant Messaging) plate for coculture, transferring transformants to CM plates containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening until hyphae grow out after coculture for two days, then randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformant with the highest yield for hph marker induced recombination, and obtaining hygromycin sensitive cexA gene knockout and mstC, hxkA, pfkA and pkiA gene overexpression strain S1149;

the induced recombination method comprises the following steps: uniformly coating transformant spores and an MM plate containing 10 mu g/mL doxycycline until single clones grow out, randomly selecting 100 clones, simultaneously transferring the 100 clones to a PDA plate and a PDA plate containing hygromycin, wherein the clones which cannot grow in the PDA plate containing hygromycin but can normally grow in the PDA are hph marker induced recombination and show hygromycin sensitivity.

The Aspergillus niger genetically engineered strain for efficiently producing malic acid is applied to the preparation of malic acid.

The method for producing malic acid by fermenting the aspergillus niger genetic engineering strain capable of efficiently producing malic acid in a fermentation tank comprises the following steps:

firstly, inoculating Aspergillus niger genetic engineering strain for efficiently producing malic acid on a PDA culture plate, and culturing at 28 ℃ for 6 days until conidia are generated;

then, the spore powder was inoculated into shake flasks containing seed medium at a final spore concentration of 2X 10⁶Culturing at 28 deg.C and 220rpm for 20 hr;

and finally, inoculating the seed culture solution into a fermentation tank containing a fermentation culture medium for fed-batch fermentation, wherein the temperature is maintained at 28-32 ℃, the ventilation quantity is 0.5-1 vvm, and the stirring speed is 250-400 rpm. The glucose concentration is maintained to be higher than 15g/L in the whole fermentation process, and calcium carbonate is supplemented to maintain the pH value between 5.8 and 6.5 until the fermentation is finished; wherein the seed culture solution: volume ratio ml of fermentation medium: l is 140: 1.26.

furthermore, 40g/L glucose, 6g/L bactopeptone, 750mg/L anhydrous potassium dihydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

Moreover, the composition of the fermentation medium is: 100g/L glucose,80g/L calcium carbonate, 6g/L bactopeptone, 150mg/L anhydrous potassium dihydrogen phosphate, 150mg/L anhydrous dipotassium hydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

The invention has the advantages and positive effects that:

1. the invention overcomes the defects in the prior art, and the cost of the subsequent malic acid purification process is increased along with the generation of a main byproduct citric acid in the existing aspergillus niger fermentation production process.

2. According to the invention, on the basis of the natural characteristic of the aspergillus niger in producing malic acid, the physiological metabolic characteristic of the aspergillus niger is modified through genetic recombination, the glycolysis metabolic pathway and the glucose transport pathway in the aspergillus niger fermentation process are enhanced, so that the aspergillus niger genetic engineering strain is obtained, experiments prove that the efficiency of producing malic acid by the aspergillus niger genetic engineering strain is remarkably improved, the yield of the aspergillus niger genetic engineering strain in the eighth day of fed-batch fermentation in a fermentation tank can reach 195.72-210 g/L, the conversion rate of the malic acid to glucose reaches 1.59-1.64 mol/mol, the fermentation period is shortened by one day compared with that of the original strain, and the fermentation period is shortened from the original 9 days to 8 days. Provides excellent strains for preparing malic acid by a microbial fermentation method.

3. The construction method of the genetic engineering strain of the invention utilizes gene knockout technology to destroy Aspergillus niger citrate transporter gene (cexA), and overexpresses glucose transporter gene mstC, hexokinase gene hxkA, phosphofructokinase gene pfkA and pyruvate kinase gene pfiA which are derived from Aspergillus niger, thereby obtaining the malic acid strain S1149 with high efficiency. After 8 days of fed-batch fermentation in a fermentation tank, the content of L-malic acid can reach 195.72-210 g/L, and no citric acid byproduct is generated; compared with the starting strain S575, the fermentation period is shortened by one day, and the conversion rate is improved from 1.27mol/mol to 1.59-1.64 mol/mol, which reaches 79.5% of the theoretical highest conversion rate. The genetic engineering strain is applied to the fermentation production of the L-malic acid, can obviously improve the output of the malic acid, overcomes the problem of generating a large amount of by-product citric acid in the process of producing the malic acid by fermenting Aspergillus niger, and can greatly reduce the separation and purification cost of downstream fermentation product malic acid. The genetic engineering strain has good industrial application prospect.

Drawings

FIG. 1 is a map of knock-out plasmid pLH593 constructed in the present invention;

FIG. 2 is a double restriction enzyme digestion verification diagram of the knockdown plasmid pLH593 in the invention, wherein M is a DNA Marker, and 1 is a Kpn I and Xba I double restriction enzyme digestion verification plasmid;

FIG. 3 is a map of knock-out plasmid pLH594 constructed in the present invention;

FIG. 4 is a double restriction enzyme digestion verification diagram of a knock-out plasmid pLH594 constructed in the invention, wherein M is a DNA Marker, and 1, 2 and 3 are EcoRI and XbaI double restriction enzyme digestion verification plasmids;

FIG. 5 is a diagram of a plasmid pLH622 linked with a downstream homology arm of the cexA gene constructed in the present invention;

FIG. 6 is a diagram showing the double restriction enzyme digestion verification of the plasmid pLH622 for connecting the downstream homology arms of the cexA gene in the present invention, wherein M is DNA Marker, and 1 is SpeI and XbaI plasmid for verifying the downstream homology arms by double restriction enzyme digestion;

FIG. 7 is a map of a constructed cexA gene knockout plasmid pLH 623;

FIG. 8 is a diagram of dual restriction enzyme digestion verification of cexA gene knockout plasmid pLH623, wherein M is DNA Marker, and 1, 2 and 3 are SacI and SpeI dual restriction enzyme digestion verification plasmids;

FIG. 9 is a map of gene expression plasmid pLH509 constructed in the present invention;

FIG. 10 is a double restriction enzyme digestion verification diagram of gene expression plasmid pLH509 constructed in the present invention, wherein M is DNA Marker, 1 and 2 are Spe I and Kpn I double restriction enzyme digestion verification plasmids;

FIG. 11 is a map of plasmid pLH684 for overexpression of the mstC gene constructed in the present invention;

FIG. 12 is a diagram of double restriction enzyme digestion verification of plasmid pLH684 for overexpression of the mstC gene constructed in the present invention, wherein M is DNA Marker, 1 and 2 are EcoRI and SacI double restriction enzyme digestion verification plasmids;

FIG. 13 is a map of a pfkA gene overexpression plasmid pLH473 constructed in the present invention;

FIG. 14 is a diagram showing the double restriction enzyme digestion of pfkA gene overexpression plasmid pLH473 constructed in the present invention, wherein M is DNA Marker, 1 and 2 are SacI and BamHI double restriction enzyme digestion verification plasmids;

FIG. 15 is a map of hxkA gene overexpression plasmid pLH667 constructed in the present invention;

FIG. 16 is a double restriction enzyme digestion verification diagram of hxkA gene overexpression plasmid pLH667 constructed in the present invention, wherein M is DNA Marker, 1, 2 are SpeI and EcoRI double restriction enzyme digestion verification plasmids;

FIG. 17 is a map of plasmid pLH726 constructed in the present invention;

FIG. 18 is a diagram of double restriction enzyme validation of plasmid pLH726 constructed in the present invention, wherein M is DNA Marker, and 1 and 2 are Pst I single restriction enzyme validation plasmids;

FIG. 19 is a map of plasmid pLH727 for overexpression of the combination of pfkA gene and hxkA gene constructed in the present invention;

FIG. 20 is a diagram showing the double restriction enzyme digestion of plasmid pLH727 over-expression of pfkA gene and hxkA gene combination constructed in the present invention, wherein M is DNA Marker, 1 and 2 are EcoR V and Nhe I double restriction enzyme digestion verification plasmids;

FIG. 21 is a map of the over-expression plasmid pLH683 of the pkiA gene constructed in the present invention;

FIG. 22 is a diagram showing the double restriction enzyme digestion verification of pKIA gene overexpression plasmid pLH683 constructed in the present invention, wherein M is DNA Marker, 1 and 2 are EcoRI and KpnI double restriction enzyme digestion verification plasmids;

FIG. 23 shows PCR validation of the cexA gene knockout left homology arm of the present invention, i.e., P1949/1950 validation left arm and P1949/641 validation left arm-php, where M is DNA Marker and

boxes

3 and 4 are Aspergillus niger transformants with successful cexA gene knockout;

FIG. 24 shows PCR verification of the cexA gene knockout right homology arm of the present invention, i.e., verification of the right arm by P1951/1952 and verification of the right arm-php by P1951/642, wherein M is DNA Marker, and

boxes

3 and 4 are Aspergillus niger transformants which successfully knock out the cexA gene;

FIG. 25 is a HPLC analysis chart of fermentation broth of the genetically engineered strain of the present invention, wherein S575 is a HPLC analysis chart of the host strain, S895 is a HPLC analysis chart of the cexA knockout strain, and the boxes are marked by the peak emergence time and peak area of the by-product citric acid;

FIG. 26 is a line drawing of fed-batch fermentation data of a fermenter containing genetically engineered strains and host strains according to the present invention; wherein A is a line drawing of fed-batch fermentation data of a fermentation tank of a host strain S575, and B is a line drawing of fed-batch fermentation data of a fermentation tank of a genetic engineering strain S1149; ■ in the figure represents malic acid yield, t.represents glucose residual sugar content, x represents pH value, a-solidup represents fumaric acid yield, ● represents citric acid yield.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

Preferably, the cexA sequence of the Gene is 4989494 at NCBI-Gene ID, the mstC sequence is 4978840 at NCBI-Gene ID, the hxkA Gene is 4979978 at NCBI-Gene ID, the pfkA sequence of the Gene is 4989727 at NCBI-Gene ID, and the pkiA sequence is 4982167 at NCBI-Gene ID.

Preferably, the vector pLH594 is constructed as follows:

Preferably, the vector pLH509 is constructed as follows:

Preferably, the construction method of the strain S1149 is as follows:

obtaining a cefA gene knockout strain:

obtaining a strain with cefA gene knockout and mstC gene overexpression:

preferably, 40g/L glucose, 6g/L bacterial peptone, 750mg/L anhydrous potassium dihydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

Preferably, the composition of the fermentation medium is: 100g/L glucose,80g/L calcium carbonate, 6g/L bactopeptone, 150mg/L anhydrous potassium dihydrogen phosphate, 150mg/L anhydrous dipotassium hydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

Specifically, an Aspergillus niger (Aspergillus niger) genetic engineering strain for efficiently producing malic acid is constructed by the following steps:

1) constructing a gene knockout plasmid: the gene sequence of the bialaphos resistance gene Bar was synthesized by Beijing Huada Gene Co, and the bialaphos resistance gene Bar sequence was amplified by PCR (see Table 1 for primers). Then, a Novozan C113-Clon express-MultiS One Step Cloning Kit is used for simultaneously connecting the bar gene sequence with an original vector pLH577 which is linearized by two enzyme digestion of EcoRI/BamHI, a connecting product is transformed into competent cells of Escherichia coli JM109 to obtain a plasmid pLH593, the map of the plasmid pLH593 is shown in figure 1, and the two enzyme digestion verification of pLH593 is shown in figure 2. In order to amplify a gene sequence of a bialaphos resistance gene Bar, an upstream primer Bar-F and a downstream primer Bar-R (shown in Table 1) are designed, wherein the sequence of the gene Bar is SEQ NO.1 in a sequence table, and the length of the gene Bar is 552 bp.

The plasmid pLH593 is taken as a template, and the sequence of the Aspergillus niger 3-phosphoglycerol dehydrogenase gene promoter PgpdA, the bialaphos resistance gene Bar and the Aspergillus nidulans tryptophan synthesis gene C terminator Ttrpc is amplified through PCR. Then, the PgpdA promoter, the bar gene and the Ttrpc terminator sequence are simultaneously connected with the starting vector pLH334 after being linearized by KpnI/EcoRI double enzyme digestion by using a Novozan C113-Clon express-MultiS One Step Cloning Kit, the connection product is transformed into competent cells of Escherichia coli JM109 to obtain a plasmid pLH594, the map of which is shown in figure 3, and the double enzyme digestion verification of the pLH594 is shown in figure 4. To amplify the sequence of the A.niger 3-phosphoglycerate dehydrogenase gene promoter PgpdA, the bialaphos resistance gene Bar and the A.nidulans tryptophan synthesis gene C terminator Ttrpc, an upstream primer P951 and a downstream primer P952 were designed (shown in Table 1).

2) construction of cexA Gene knock-out plasmid:

in order to amplify the cexA downstream homologous recombination sequence fragment, primers P1751/P1752 (Table 1) are designed, the cexA downstream sequence fragment is obtained by PCR amplification, then the Novozac 113-Clon express-MultiS One Step Cloning Kit is used for simultaneously connecting the cexA downstream sequence fragment with an initial vector pLH594 linearized by XbaI/SpeI double digestion, the ligation product is transformed into an escherichia coli JM109 competent cell to obtain a plasmid pLH622, the map of the plasmid pLH622 is shown in FIG. 5, and the double digestion verification of the pLH622 is shown in FIG. 6. The downstream sequence of the gene cexA is SEQ NO.2 in the sequence table, and the length is 1318 bp.

In order to amplify the cexA upstream homologous recombination sequence fragment, a primer P1749/P1750 (Table 1) is designed, the cexA upstream sequence fragment is obtained by PCR amplification, then a Novozac 113-Clon express-MultiS One Step Cloning Kit is used for simultaneously connecting the cexA upstream sequence fragment with an original vector pLH622 after EcoRI/BamHI double digestion linearization, a connecting product is transformed into an escherichia coli JM109 competent cell to obtain a plasmid pLH623, the map of the plasmid pLH623 is shown in FIG. 7, and the double digestion verification of the pLH623 is shown in FIG. 8. The upstream sequence of the gene cexA is SEQ NO.3 in the sequence table, and the length is 1303 bp.

3) Construction of a Gene overexpression plasmid: the Aspergillus niger and Aspergillus nidulans genomes are respectively used as templates, and the sequences of the Aspergillus niger pyruvate kinase gene promoter PpkiA and the Aspergillus nidulans tryptophan synthesis gene C terminator Ttrpc (primers are shown in Table 1) are amplified by PCR and sent to Huada gene company for sequencing and confirmation without mutation. Then, PpkiA promoter and Ttrpc terminator sequences are simultaneously connected with an original vector pLH419 after being linearized by XbaI/XhoI double enzyme digestion by using a Novozan C113-Clon express-MultiS One Step Cloning Kit, the ligation product is transformed into competent cells of Escherichia coli JM109 to obtain a plasmid pLH509, the map of which is shown in FIG. 9, and the double enzyme digestion verification of the pLH509 is shown in FIG. 10. For amplifying the Ttrpc sequences of the promoter PpkiA of the Aspergillus niger pyruvate kinase gene and the C terminator of the tryptophan synthesis gene of Aspergillus nidulans, an upstream primer P1352 and a downstream primer P1353 of the PpkiA promoter, and an upstream primer Ttrpc-F and a downstream primer Ttrpc-R of the Ttrpc terminator are designed (shown in Table 1).

4) Construction of mstC overexpression plasmid

In order to amplify the mstC gene sequence, a primer P1977/P1978 (Table 1) is designed, an mstC gene sequence fragment is obtained through PCR amplification and sent to Huada gene company for sequencing to confirm no mutation, then the mstC sequence is simultaneously connected with an initial vector pLH509 which is linearized through EcoRI/SacI double enzyme digestion by using a Novozam C113-Clon express-MultiS One Step Cloning Kit, a connection product is transformed into escherichia coli JM109 competent cells, and the mstC overexpression plasmid pLH684 is obtained through colony PCR verification and double enzyme digestion verification. The map is shown in FIG. 11, and the double enzyme digestion verification of pLH684 is shown in FIG. 12.

The mstC sequence of the gene starts from an initiation codon ATG, comprises a coding sequence of the gene and a self terminator, is SEQ NO.6 in a sequence table, and has the length of 1683 bp.

5) Construction of pfkA overexpression plasmid

In order to amplify the pfkA gene sequence, primers P1981/P1982 (Table 1) are designed, a pfkA gene sequence fragment is obtained by PCR amplification, sent to Huada gene company for sequencing to confirm no mutation, then the pfk sequence is simultaneously connected with an original vector pLH454 linearized by SacI/BamHI double digestion by using a Novozam C113-Clon express-Multi One Step Cloning Kit, a ligation product is transformed into escherichia coli JM109 competent cells, and a pfkA overexpression plasmid pLH473 is obtained by PCR colony validation and double digestion validation. The map is shown in FIG. 13, and the double enzyme digestion verification of pLH473 is shown in FIG. 14.

The pfkA sequence of the gene starts from an initiation codon ATG, comprises a gene coding sequence and a self terminator, is SEQ NO.7 in a sequence table, and has the length of 1463 bp.

6) Construction of hxkA overexpression plasmid

In order to amplify the hxkA gene sequence, a primer P1937/P1938 (Table 1) is designed, an hxkA gene sequence fragment is obtained through PCR amplification, the hxkA gene sequence fragment is sent to Huada gene company for sequencing to confirm no mutation, then the hxkA sequence is simultaneously connected with an initial vector pLH509 which is linearized through EcoRI/BamHI double digestion by using a Novozan C113-Clon express-Multi One Step Cloning Kit, a connection product is transformed into escherichia coli JM109 competent cells, and the hxkA overexpression plasmid pLH667 is obtained through colony PCR verification and double digestion verification. The map is shown in FIG. 15, and the double enzyme digestion verification of pLH667 is shown in FIG. 16.

The hxkA sequence of the gene starts from an initiation codon ATG, comprises a gene coding sequence and a self terminator, is SEQ NO.8 in a sequence table, and has a length of 1479 bp.

7) Construction of pfkA and hxkA combined overexpression plasmid

In order to amplify PgpdA-pfkA-Ttrpc sequence fragments, primers P2743/P2744 (Table 1) are designed, plasmid pLH473 is used as a template, the PgpdA-pfkA-Ttrpc sequence fragments are obtained through PCR amplification and sent to Huada Gen company for sequencing to confirm no mutation, then Nozac 113-Clon express-MultiS One Step Cloning Kit is used for simultaneously connecting the PgpdA-pfkA-Ttrpc sequences with an EcoRI/SacI double-digestion linearized starting vector pLH331, a connection product is transformed into Escherichia coli JM109 competent cells, and plasmid pLH726 is obtained through colony PCR verification and double-digestion verification. The map is shown in FIG. 17, and the double enzyme digestion verification of pLH726 is shown in FIG. 18.

In order to amplify the PpkiA-hxkA-Ttrpc sequence fragment, primers P2745/P2746 (Table 1) are designed, a plasmid pLH667 is used as a template, the PpkiA-hxkA-Ttrpc sequence fragment is obtained through PCR amplification and sent to Huada GenBank to be sequenced and confirmed to be free of mutation, then a Nodezac 113-Clon express-MultiS One Step Cloning Kit is used for connecting the PpkiA-hxkA-Ttrpc sequence with a starting vector pLH726 which is linearized through XbaI/SpeI double digestion, a connection product is transformed into escherichia coli JM109 competent cells, and colony PCR verification and double digestion verification are carried out to obtain a pfkA and hxkA combined over-expression plasmid pLH 727. The map is shown in FIG. 19, and the double enzyme digestion verification of pLH727 is shown in FIG. 20.

8) Construction of the pkiA overexpression plasmid

In order to amplify the sequence of the pkiA gene, a primer P1979/P1980 (Table 1) is designed, a pkiA gene sequence fragment is obtained through PCR amplification, the pkiA gene sequence fragment is sent to Huada gene company for sequencing to confirm no mutation, then the pkiA sequence is simultaneously connected with an initial vector pLH509 which is linearized through EcoRI/KpnI double enzyme digestion by using a Novozam C113-Clon express-MultiS One Step Cloning Kit, a connection product is transformed into Escherichia coli JM109 competent cells, and the pkiA overexpression plasmid pLH683 is obtained through colony PCR verification and double enzyme digestion verification. The map is shown in FIG. 21, and the double enzyme digestion verification of pLH683 is shown in FIG. 22.

The gene pkiA sequence starts from an initiation codon ATG, comprises a gene coding sequence and a self terminator, is SEQ NO.9 in a sequence table, and has the length of 1581 bp.

TABLE 1 primer sequences used

9) The LB medium components described above:

tryptone 10.0g/L, yeast extract 5.0g/L, NaCl10.0g/L, pH adjusted to 7.0-7.2, solid medium added with 1.5% (W/T) agar powder. Sterilizing at 121 deg.C for 20 min. Kanamycin was added to a final concentration of 100. mu.g/mL after cooling to about 60 ℃ after sterilization.

10) Agrobacterium-mediated aspergillus niger transformation and cloning screening:

the overexpression is to integrate the related genes into the Aspergillus niger genome for expression. The transformation method of the expression gene and the knockout gene is an agrobacterium-mediated method. The agrobacterium is AGL-1 strain. Before agrobacterium-mediated transformation of aspergillus niger, the expression plasmid and the knockout plasmid are required to be firstly electrically transformed into agrobacterium. The electrotransfer conditions are: capacitnce 25uF, Voltage 2.5kV, Resistance 200. omega., Pulse: 5msec, i.e., capacitance: 25uF, voltage:2.5kV, resistance:200 Ω, pulse: 5 msec.

(1) Obtaining a cexA gene knockout strain:

plasmid pLH623 is electrically transferred to agrobacterium, agrobacterium containing plasmid pLH623 and host strain S575 are co-cultured on an IM plate for agrobacterium-mediated transformation, transformants are transferred to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening after two days of co-culture until hyphae grow out of the transformants, then 100 transformants are randomly picked and transferred to an MM plate containing 10 mu g/mL glufosinate, and clones growing slowly on the plate containing glufosinate are picked to extract genomes for PCR screening verification, and the verification primers are p1949/p1950, p641/p1951 and p 1952/642 (see Table 1). The diagram of the validation gel for the cexA gene knockout left homology arm is shown in figure 23, and the diagram of the validation gel for the cexA gene knockout right homology arm is shown in figure 24, since the knockout is the double crossover homologous recombination principle, cexA is replaced by loxP-hph-loxP. One of the correct cexA knock-out clones was picked for hph marker-induced recombination to obtain cexA knock-out strain S895, which did not have hygromycin resistance.

The induced recombination method comprises the following steps: uniformly coating about 300 transformant spores in an MM plate containing 10 mu g/mL doxycycline until single clones grow out, randomly selecting 100 clones, simultaneously transferring the 100 clones to a PDA plate and a PDA plate containing hygromycin, wherein the clone which cannot grow in the PDA plate containing hygromycin but can normally grow in the PDA is hph marker induced recombination and shows hygromycin sensitivity, and the strain is cexA gene knockout strain S895.

(2) Obtaining a cexA gene knockout and mstC gene overexpression strain:

and (2) electrically transferring the plasmid pLH684 to agrobacterium, co-culturing the agrobacterium containing the plasmid pLH684 and a cexA gene knockout strain S895 on an IM (instant Messaging) plate for agrobacterium-mediated transformation, after co-culturing for two days, transferring transformants to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening until the transformants grow hyphae, randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformants with the highest yield for hph marker induced recombination, and obtaining a hygromycin-sensitive cexA gene knockout and mstC gene overexpression strain S1006. The induced recombination method is the same as above.

(3) Obtaining of a strain with cexA gene knockout and mstC, hxkA and pfkA gene overexpression:

transferring plasmid pLH727 to agrobacterium, performing agrobacterium-mediated transformation on agrobacterium containing pLH727 and mstC gene overexpression and cefA gene knockout strain S1006 in an IM (instant Messaging) plate for agrobacterium-mediated transformation, transferring transformants to CM plates containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening till hyphae grow out after co-culture for two days, then randomly selecting 20 transformants for shake flask fermentation screening, selecting transformants with the highest yield for hph marker induced recombination, and obtaining hygromycin-sensitive cefA gene knockout and mstC, hxkA and pfkA gene overexpression strain S1078. The induced recombination method is the same as above.

(4) Knockout of cexA gene and obtainment of mstC, hxkA, pfkA and pkiA gene overexpression strains:

transferring plasmid pLH683 to agrobacterium, then performing overexpression of agrobacterium containing plasmid pLH683 and mstC gene overexpression and hxkA gene and pfkA gene combination overexpression, performing agrobacterium-mediated transformation on a cexA gene knockout strain in an IM (instant Messaging) plate for co-culture, transferring transformants to a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for co-culture for two days until hyphae grows out from the transformants, then randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformant with the highest yield for hph marker induced recombination, and obtaining a hygromycin sensitive cexA gene knockout and mstC, hxkA, pfkA and pkiA gene overexpression strain S1149. The induced recombination method is the same as above.

(5) The PDA culture medium comprises potato 200g, cutting into small pieces, adding 1000mL water, boiling for 30min, and filtering with double-layer gauze to obtain clear solution. Then 20g of glucose was added to completely dissolve the solution, and water was added to a constant volume of 1L. 20g of agar is added to the solid culture medium. Autoclaving at 121 deg.C for 20 min.

(3) IM medium composition:

15g of agar, adding water to 905.7ml, sterilizing at 121 ℃ for 20min, heating by microwave until the agar is completely dissolved, adding: k buffer 0.8mL, MN buffer 20mL, 1% CaCl₂·2H₂O 1mL，0.01％FeSO₄ 10mL，IM Trace elements 5mL，20％NH₄NO₃2.5mL, 10mL of 50% glycerol, 40mL of 1M MES, and 5mL of 20% glucose.

Preparation of required reagents in the IM medium:

1) k buffer: 1.25M K₂HPO₄Adding into 1.25M KH₂PO₄Resulting in a pH of 4.8.

(a)：1.25M KH₂PO₄：K₂HPO₄ 17.01g, adding deionized water to 100mL, and sterilizing at 121 ℃ for 20 min.

(b)：1.25M K₂HPO₄：K₂HPO₄21.77g, adding deionized water to 100mL, and sterilizing at 121 ℃ for 20 min.

2)MN buffer：MgSO₄·7H₂O3 g and NaCl 1.5g, adding deionized water to the volume of 100mL, and sterilizing at 121 ℃ for 20 min.

3)1％CaCl₂：CaCl₂·2H₂Adding deionized water into the mixture of O1 g, diluting to 100mL, and sterilizing at 121 ℃ for 20 min.

4)0.01％FeSO₄：FeSO₄·7H₂0.01g of O, adding deionized water to the solution until the volume is 100mL, and sterilizing the solution for 20min at 121 ℃.

5)IM Trace elements：ZnSO₄·7H₂O 10mg，CuSO₄·5H₂O 10mg，H₃BO₃ 10mg，MnSO₄·H₂O 10mg，Na₂MoO₄·2H₂O10 mg, adding deionized water to 100mL, and sterilizing at 121 ℃ for 20 min.

6)20％NH₄NO₃: addition of NH₄NO₃20g, adding deionized water to 100mL, and sterilizing at 121 ℃ for 20 min.

7) 50% of glycerin: adding 50mL of glycerol, adding deionized water to the volume of 100mL, and sterilizing at 121 ℃ for 20 min.

8)1 MMES: 19.524g of MES (namely 2- (N-morpholine) ethanesulfonic acid monohydrate), 100mL of deionized water is added, the pH is adjusted to 5.5 by adding NaOH, and filtration sterilization is carried out. Storing in dark for one month, or subpackaging and storing at-20 deg.C.

9) 20% glucose: glucose 20g, ddH added₂And (4) metering the volume of O to 100mL, and sterilizing at 115 ℃ for 20 min.

(6) CM medium components described above:

20g of agar, 897mL of water was added, and the mixture was sterilized at 121 ℃ for 20 min. After the agar is completely dissolved, adding the following components: ASP + N20mL, 50% glucose 20mL, 1M MgSO₄2mL, CM Trace elements 1mL, 10mL of 10% casein hydrolysate, and 50mL of 10% yeast extract.

Preparation of required reagents in the CM medium:

1)ASP+N：KCl(350mM)2.61g，KH₂PO₄(550mM)7.48g，NaNO₃(3.5M)29.75g, deionized water was added to 100mL pH 5.5(5MKOH), and sterilized at 121 ℃ for 20 min.

2) 50% glucose: glucose 50g, add ddH₂And (4) metering the volume of O to 100mL, and sterilizing at 115 ℃ for 20 min. 3)1M MgSO₄：MgSO₄24.648g, add ddH₂And (4) metering the volume of O to 100mL, and sterilizing at 121 ℃ for 20 min.

4)CM Trace elements：ZnSO₄·7H₂O(76mM)2.1g，H₃BO₃(178mM)1.1g，MnCl₂·4H₂O(25mM)0.5g，FeSO₄·7H₂O(18mM)0.5g，CoCl₂·6H₂O(7.1mM)0.17g，CuSO₄·5H₂O(6.4mM)0.16g，Na₂MoO₄·2H₂0.15g of O (6.2mM), 5.1g of EDTA (174mM), deionized water was added to the solution to 100mL, and the solution was sterilized at 121 ℃ for 20 min.

5) 10% casein hydrolysate: casein hydrolysate 10g, ddH₂And (4) metering the volume of O to 100mL, and sterilizing at 121 ℃ for 20 min.

6) 10% yeast extract: 10g of yeast extract, ddH was added₂And (4) metering the volume of O to 100mL, and sterilizing at 121 ℃ for 20 min.

(7) The MM medium comprises 20mL of Vogel's Salts, 15g of glucose and 15g of agar, and is dissolved in distilled water and is added to 1000 mL. Sterilizing at 121 deg.C for 20 min.

Preparation of required reagents in the MM medium:

1) vogel's 50X salts: 150g of sodium citrate KH₂PO₄ 250g，NH₄NO₃ 100gMgSO₄·7H ₂0 10g，CaCl₂·2H₂05 g. 5ml of trace elements and 2.5ml of biotin solution are dissolved in distilled water and the volume is determined to 1000ml, 0.2ml of chloroform is added as a preservative, and the mixture is preserved at room temperature.

2) Solution of trace elements: citric acid. H ₂0 5.00g，ZnSO₄·7H ₂0 5.00g，Fe(NH₄)₂(SO₄)₂·6H ₂0 1.00g，CuSO₄·5H ₂0 0.25g，MnSO₄·H ₂0 0.05g，H₃BO₃ 0.05g，Na₂MoO₄·2H₂00.05 g, dissolving in distilled water, diluting to 100ml, adding 1ml chloroform as preservative, and storing at room temperature.

3) 5.0mg of biotin, dissolving in distilled water, and fixing the volume to 50ml, and storing at-20 ℃.

The related detection and application of the engineering strain of the invention are as follows:

1. shake flask fermentation production of L-malic acid by cexA gene knockout strain

The method for producing malic acid by using the cexA gene knockout strain S895 constructed by the invention in the shake flask fermentation comprises the following specific steps:

firstly, inoculating the strain on a PDA culture plate, and culturing for 6 days at 28 ℃ until conidia are generated;

then, the spore powder is inoculated into the shake flask fermentation medium, and the final concentration of the spore is 2 multiplied by 10⁶Spores/ml, cultured at 220rpm for 3 days at 28 ℃. After sample preparation, the content of the by-product citric acid in the fermentation liquor is determined by an HPLC method. The results show that no citric acid was detected and the results are shown in figure 25, i.e. the citric acid by-product was completely eliminated.

The fermentation medium comprises the following components: 100g/L glucose,80g/L CaCO₃,6g/L Bacto Peptone,50mg/L KH₂PO₄,150mg/L K₂HPO₄,100mg/L MgSO4·7H₂O,100mg/L CaCl₂·2H₂O,5mg/LFeSO₄·7H₂O,5mg/LNaCl。

2. Fermentation production of L-malic acid by cexA gene knockout, mstC, hxkA, pfkA and pkiA gene overexpression strain S1149 in fermentation tank

The engineering strain S1149 constructed by the invention is used for fed-batch fermentation in a 2L fermentation tank (Shanghai Baoxin), and the method comprises the following specific steps:

the spore powder was then inoculated into shake flasks containing 50mL of seed mediumThe final concentration of spores was 2X 10⁶Pieces/ml, incubated at 28 ℃ for 20h at 220 rpm.

Finally, 140ml of the seed culture was inoculated into a 2L fermentor containing 1.26L of fermentation medium for fed-batch fermentation at 30 ℃ with an aeration rate of 1vvm and a stirring speed of 300 rpm. The initial sugar concentration was 100g/L, the concentration was maintained above 15g/L throughout the fermentation by feeding glucose (70% w/v) and calcium carbonate was added to maintain the pH between 5.8 and 6.5 until the end of the fermentation on day 8. After sample preparation, the content of L-malic acid in the fermentation liquor is determined by an HPLC method. The result shows that the content of the L-malic acid can reach 195.72-210 g/L after 8 days of fermentation, the period is shortened by one day compared with that of the starting bacterium S575, the result is shown in figure 26, and the conversion rate is increased from 1.27mol/mol to 1.59-1.64 mol/mol and reaches 79.5% of the theoretical highest conversion rate. In addition, the fermentation liquor of the genetic engineering strain S1149 has no by-product citric acid detected, and the citric acid content in the fermentation liquor of the starting strain S575 reaches 28.00 g/L.

The research result of the invention proves the excellent capability of producing malic acid by Aspergillus niger fermentation, and provides an excellent strain for industrial fermentation production of L-malic acid.

The seed culture medium comprises the following components: 40g/L glucose, 6g/L bacterial peptone, 750mg/L anhydrous potassium dihydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

The fermentation medium comprises the following components: 100g/L glucose,80g/L calcium carbonate, 6g/L bactopeptone, 150mg/L anhydrous potassium dihydrogen phosphate, 150mg/L anhydrous dipotassium hydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

Wherein, the preparation and detection of the L-malic acid fermentation sample are as follows:

sample preparation: shaking to homogenize the fermented suspension, adding 2MHCl dissolved organic acid calcium precipitate and residual CaCO into 1mL of fermented liquid₃After centrifugation, the solution was diluted 50 times and filtered through a 0.22 μm filter membrane, and the filtrate was used for HPLC detection.

Malic acid and by-product lemonThe acid determination method comprises the following steps: AminexHPX-87H column (300 mm. times.7.8 mm), UV detector. Mobile phase: 5mMH₂SO₄. The flow rate is 0.6mL/min, the column temperature is 65 ℃, the wavelength is 210nm, and the injection volume is 20 mu L.

Sequences used in the present invention:

552bp nucleotide sequence of Bar gene

atgagcccagaacgacgcccggccgacatccgccgtgccaccgaggcggacatgccggcggtctgcaccatcgtcaaccactacatcgagacaagcacggtcaacttccgtaccgagccgcaggaaccgcaggagtggacggacgacctcgtccgtctgcgggagcgctatccctggctcgtcgccgaggtggacggcgaggtcgccggcatcgcctacgcgggcccctggaaggcacgcaacgcctacgactggacggccgagtcaaccgtgtacgtctccccccgccaccagcggacgggactgggctccacgctctacacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcgctgtcatcgggctgcccaacgacccgagcgtgcgcatgcacgaggcgctcggatatgccccccgcggcatgctgcgggcggccggcttcaagcacgggaactggcatgacgtgggtttctggcagctggacttcagcctgccggtaccgccccgtccggtcctgcccgtcaccgagatgtga

Nucleotide sequence 1318bp of downstream sequence of cexA gene

accgctcatgcactggtaggctttggatgtatgtctggctcttatctggtcggctaccttatggattacaaccaccgtcttaccgaacgcgaatattgcgagaaacacggttatccggcaggcacacgtgtcaatctgaaatcacaccccgacttccccattgaggtcgcccggatgcgcaatacctggtgggtgattgcgatcttcatcgtgacagttgctttgtacggcgtgtctttgcggacacatctggcggtgcctatcattctgcagtacttcattgcgttctgctcaacaggactcttcaccatcaacagcgccctggtcatcgatctttacccaggtgctagcgccagtgcgacagcagtgaacaatctgatgcggtgcctgcttggagctggcggtgtggctatcgtgcaacctatcctggacgccttgaagccggattatactttcctcttgcttgccggcatcacccttgtgatgactccgttgctgtacgtcgaagatcgatggggtcctggctggcgacatgcccgcgaaaggagactcaaggccaaagccaacggcaactagggagagaaaggacttgaaaaaaaaaaggtgaagtgggactggtgaagtaaatgtttgattcttccccacactttcttgatatgggttttattttagcggcatttggcgataccactgttttgcaagcgataccagttagatttatagaagaattgatcagtttcatcggctatctcgctattacttcctcgtagctttttagcttcatatatgggtgagtgggaaaggtttgacatggtggttgagatagtatcatttggatggagatggaagtataaagcaagaagttctgttgtttggtgtttagactagactagacgtggccggtgaagtcacgagcctcagcttagataatctaatgcggctgatgtgactgaccgatggctttgttatatgaagacaggtcggtcaattagaagatgtcgccagcaaaagggtataataatggctattatagagataagaatgtagagtatccctgtttttaaggatcagtacgtagttttactataaaggtacccatatatatatttgcggaacacgaggaggtcgggagtacatacttgtagttactgtttgtttgtgacgaggaatgccagttaggtaagcaccacgtgatgcgtgacccaaacaagcgcccggtcgttgcttgaggaaccaatttctctgtttatcctccttcgaacaccacacttcgaccttctggacactgccgctatgagccttccatagccagcctgtt

Nucleotide sequence 1303bp of upstream sequence of cexA Gene

tggtgcctcaaatcctcacggcatcttcgtcatcactttctattattatgcatccctccctgttgaaatccccccatcttgtatttcctttgcttcacttccactgtgatcctgtttgcgcagctactcctttcctccctatccacctcccctgatggcaatttctacttgtctcatatttaagcttaccaactgttacgtagacctcccgcactgaccccaatcaggtgcaccttacctgtggagttgtggtttgcgactcccgtgggagctctctcaggatgtcttggtatagcttcactccacccccaattccgcaatctgcagccacggtggaaccagcccagcgaggctggccagcttgtcaaggatccatcccaagaagtttcgttgtctgggcgtcgcactcgattttttttggtcctcgcctcccatgcaatcatcctcccacaccccccttcttagtgcgtatgggcctgatgtagatccccgagatccatagtaacccactacacctgagcagttcgccaatcaggctgatctcagattgctcatactggtgcgcgtgcgtgctccctgtttcctacaactactcctcctgaagaggggggaatagggaccctggcgccctgagtcgtcaattgatgacctgccttgccgtctcgcgttgcatcgggcctctccgtgttgatcacagcttagcttctgcgtgggagacagccttctccgtcaacacatgtgggagatgttggctgagaagagtcgacggcctatctactccataccatgtagcccaacgctccgccacggcgccactgaatagcctgctcagctcccttatcacgggctccgcttccatctagacccttgcgcatgacaggcgtgcccggtccttcaaacacaccattcgctggaaatctgtatgctaagttgactaaatccgtcagctcttgaggtgcaggcgctagtcgtagtccaggatggcctggaaagcatgcttgttctggaatttcatcaccacgccgggcccacgtcatgtatgcagatcttggtagctccgcccttttgtcccttcaattttattttttttccctctttcttcgtcggctgcccgacggcttggactctctcggatgtgacctagactactagtcgccaagtaagaccggccgaagagaaactcctaaacccacgtctccgttcataccttggcgataacaccggctcttgccacccacatttgcccgctttgggaaggtcattgatgatggatagcccccccgtctgtccaagttgctccgca

4. 1035bp nucleotide sequence of pyruvate kinase gene promoter PpkiA

atggaagagaaaacctccgagtacttacttagggtccctgtctactgaccagagtctcgtcctcattactatgattaattacccactggacaaaaaaataaaataaaataaaaataaaaagggagacagcttctccataactggcaactgggtccgtccgagcagagcaaaattcagccttatgggttccgatggagtcagggaaatagttcttgcgaagggcattgggcttttttgcgaggagaaaattcagcaccgacaaagcatccaaatccacctcgctaggagagaatggatccgcgacgatgtggggtcaactggacagagtgagagggtatcatgtggtcctgccagatacttcgcagaatgttgtgtgggtgtctgattgtggcttgggcgtgaattgcttttggtcttcccaaccaattattattgcatgcggcgtatgaatgcctgagatgcgcggagggaaggtgcctgaggatgtagtggacaaatgctgctgatcgctgggcggaaacccttggctgaccagtgaaaagagcggacggaggcagcaggtgtatctacgatcaaagaatagtagcaaagcagtgaaaggtggatcacccagcaaataattgagttttgatacccagcgatagtgccgggggggagaaaaagtcattaataatgggaattatgtaggcgatgggaagtgtgattgtaactactccgtagctggaggcacaactaacaagccagctctcaacccgcggggaaccgaccgacagaaaaaagcgtcccaaagcaggaatcccaccaaaaagggccgatccagccaatcaccgccgccaacatttttccttcccgggcacccctcctctagtccaccatctctctcttctctcgctcaccggccccgtcttttccttccctattatctctccctcttctcctcccttctctccctccattctttctcccatcttcatcaatcccttctcttctgtcttcccccccggttcagtagagatcaatcatccgtcaagatgg

5. Nucleotide sequence 719bp of Tryptophan synthesis gene C terminator Ttrpc

cttaacgttactgaaatcatcaaacagcttgacgaatctggatataagatcgttggtgtcgatgtcagctccggagttgagacaaatggtgttcaggatctcgataagatacgttcatttgtccaagcagcaaagagtgccttctagtgatttaatagctccatgtcaacaagaataaaacgcgttttcgggtttacctcttccagatacagctcatctgcaatgcattaatgcattgactgcaacctagtaacgccttncaggctccggcgaagagaagaatagcttagcagagctattttcattttcgggagacgagatcaagcagatcaacggtcgtcaagagacctacgagactgaggaatccgctcttggctccacgcgactatatatttgtctctaattgtactttgacatgctcctcttctttactctgatagcttgactatgaaaattccgtcaccagcncctgggttcgcaaagataattgcatgtttcttccttgaactctcaagcctacaggacacacattcatcgtaggtataaacctcgaaatcanttcctactaagatggtatacaatagtaaccatgcatggttgcctagtgaatgctccgtaacacccaatacgccggccgaaacttttttacaactctcctatgagtcgtttacccagaatgcacaggtacacttgtttagaggtaatccttctttctagac

Nucleotide sequence 1683bp of mstC gene

atgggtgtctctaatatgatgtcccggttcaagcctcaggcggaccactctgagtcctccactgaggctcctactcctgctcgctccaactccgccgtcgagaaggacaatgtcttgctcgatgacagtcccgtcaagtacttgacctggcgctccttcatcctgggtatcgtcgtgtccatgggtggtttcatcttcggttactctactggtcaaatctctggtttcgagactatggatgacttcctccaacgtttcggtcaggaacaggcggatggatcctatgctttcagcaacgtccgtagtggtctcattgtcggtctgctgtgtatcggtactatgatcggtgccctggttgctgctcctatcgcagaccgcatgggccgcaagctctccatctgtctctggtctgtcatccacatcgtcggtatcatcattcagattgccaccgactccaactgggtccaggtcgctatgggtcgttgggttgccggtctgggtgttggtgccctctccagcattgtccccatgtaccagagtgaatctgctccccgtcaggtccgtggtgccatggtcagtgccttccagctgttcgttgccttcggtatcttcatctcctacatcatcaacttcggtaccgagagaatccagtcgactgcttcctggcgtatcaccatgggcattggcttcgcctggcccttgattctggctgttggctctctcttcctgcccgagtctcctcgtttcgcctaccgtcagggtcgtatcgatgaggcccgtgaggttatgtgcaagctgtacggtgtcagcccgaaccaccgcgtcatcgcccaggagatgaaggacatgaaggacaagctcgacgaggagaaggccgccggtcaggctgcctggcacgagctgttcaccggccctcgcatgctctaccgtaccctgctcggtattgctctgcagtccctccagcagctgaccggtgccaactttatcttctactacggaaacagtatcttcacctccactggtctgagcaacagctacgtcactcagatcattctgggtgctgtcaacttcggtatgaccctgcccggtctgtacgtcgtcgagcacttcggtcgtcgtaacagtctgatggttggtgctgcctggatgttcatttgcttcatgatctgggcttccgttggtcacttcgctctggatcttgccgaccctcaggccactcctgccgctggtaaggccatgatcatcttcacttgcttcttcattgtcggtttcgccaccacctggggtcctatcgtctgggccatctgtggtgagatgtaccccgcccgctaccgtgctctctgcattggtattgccaccgctgccaactggacctggaacttcctcatctccttcttcacccccttcatctctagctccattgacttcgcctacggctacgtctttgctggatgctgtttcgccgccatcttcgttgtcttcttcttcgtcaatgagacccagggtcgcactcttgaggaggttgacaccatgtacgtgctccacgtcaagccctggcagagtgccagctgggttcccccggagggcattgtccaggacatgcaccgccccccttcctcttccaagcaggagggtcaggctgagatggctgagcacaccgagcccactgagctccgcgagtaa

Nucleotide sequence 1463bp of pfkA gene

atggctcccccccaagctcccgtgcaaccgcccaagagacgccgcatcggtgtcttgacctctggtggcgatgctcccggtatgaacggtgtcgtccgggccgtcgtccggatggctatccactccgactgtgaggctttcgccgtctacgaaggttacgagggtctcgtcaatggcggcgacatgatccgtcagcttcactgggaggatgttcgcggctggttgtcccgtggtggtaccttgatcggttccgcccgctgcatggagttccgtgagcgccccggtcgtctgcgggctgccaagaacatggtcctccgtggcattgacgcccttgtcgtctgtggtggtgatggcagtttgactggtgccgacgtttttcgttccgagtggcccggtctgttgaaggaattggtcgagacgggcgagttgaccgaagagcaggtcaagccataccagattctgaacatcgtcggtttggtgggttcgatcgataacgacatgtccggcaccgacgccaccatcggttgctactcctccctcactcgcatctgtgacgccgtcgacgacgtcttcgatactgccttttcccaccagcgtggattcgtcattgaggtcatgggtcgtcactgcggttggctggccttgatgtctgctatcagtaccggtgccgactggctgttcgtgcccgagatgccgcccaaggacggatgggaggatgacatgtgcgctatcattaccaaggtgggttgatcggaacttggtggagagaactcagaggcatcactaactccccgcagaacagaaaggagcgtggaaagcgtaggacgatcgtcatcgtggccgagggtgcccaggatcgccatctcaacaagatctcgagttcgaagatcaaggatattttgacggagcggttgaacctggatacccgtgtgactgtgttgggtcacactcagagaggtggagccgcctgtgcgtacgaccgctggctgtccacactgcagggtgtcgaggctgtccgcgcggtgctggacatgaagcccgaagccccgtccccggtcatcaccatccgtgagaacaagatcttgcgcatgccgttgatggacgccgtgcagcacaccaagactgtcaccaagcacattcagaacaaggagttcgccgaagccatggccctccgcgactcggaattcaaagagtaccacttttcctacatcaacacttccacgcccgaccacccgaagctgctcctcccagagaacaaggtttgtcgccacagtagctgcttcggtgctgagctaacaaaaggcagagaatgcgcatcggtattattcacgttggcgcccccgctggtggtatgaaccaggctacccgcgcggccgttgcctactgcctgactcgtggccacacccccctggccattcacaacggtttccccggtctgtgccggcactatgatgggccctaag

Nucleotide sequence 1479bp of hxkA gene

atggttggaatcggtcctaagcgtcccccctcccgcaagggttccatggccgatgttccccagaacctcttgcagcagatcaaggacttcgaggaccaattcaccgtcgatcgctccaagctcaagcagattgtcaaccactttgtcaaggaattggaaaagggtctctctgtcgagggtggaaacatccctatgaacgtcacctgggttctgggattccccgatggcgacgaacagggtactttcctcgccctcgacatgggtggcaccaacctgcgtgtttgtgagatcaccctgacccaggagaagggtgccttcgacatcacccagtccaagtaccgcatgcccgaggaattgaagaccggtaccgccgaggagctgtgggaatacatcgccgactgcctgcagcaattcatcgagtcccaccacgagaacgagaagatctccaagctgcccctgggtttcaccttctcctaccccgccacccaggattacatcgaccacggtgtcctgcagcgctggaccaagggtttcgacattgatggtgtcgagggccacgacgtcgtcccgccgttggaggccatcctgcagaagcgcggcctgcccatcaaggtggctgcactgatcaacgacaccaccggaaccctcatcgcctcttcttacaccgactccgacatgaagatcggctgcatcttcggtaccggtgtcaacgccgcctacatggagaacgccggctccatccccaagctggctcacatgaacctgcccgccgacatgcccgtggctatcaactgcgagtacggtgctttcgacaacgagcacatcgtgctgcctctgaccaagtacgaccacatcatcgaccgcgactcgccccgtcccggtcagcaggccttcgagaagatgaccgccggtctgtacctgggtgagatcttccgtctggccctgatggacctggtggagaaccgccccggcctcatcttcaacggccaggacaccaccaagctgcgcaagccctacatcctggatgcctccttcctggcagccatcgaggaggacccctacgagaacctggaggagaccgaggagctcatggagcgcgagctcaacatcaaggccaccccggcggagctggagatgatccgccgcctggccgagctgatcggtacgcgtgccgctcgcctgtcggcctgcggtgttgccgccatttgcacgaagaagaagatcgactcgtgccacgttggtgccgacggctccgtcttcaccaagtaccctcacttcaaggcgcgcggagccaaggctctgcgcgagatcctggactgggctccggaggagcaggacaaggtgaccatcatggcggccgaggatggatctggtgtgggagctgcgctgattgcggcgctgaccctgaagcgggtcaaggccggcaacctggccggtatccgaaacatggctgacatgaagaccctgctataagagctc

Nucleotide sequence 1581bp of pkiA gene

atggccgccagctcttccctcgaccacctgagcaaccgcatgaagttggagtggcactccaagctcaacactgagatggtgccctccaagaacttccgccgcacctccatcatcggaaccatcggccccaagaccaactccgtggagaagatcaactctctccgcactgccggtcttaacgttgttcgcatgaacttctcccacggttcttatgagtaccaccaatctgttatcgacaacgcccgcgaggccgccaagacccaggtcggacgtcctctcgccattgctcttgataccaaaggacccgagatccgtaccggaaacacccccgatgataaggatatccctatcaagcagggccacgagctcaacatcaccaccgacgagcaatatgccaccgcctccgacgacaagaacatgtacctcgactacaagaacatcaccaaggtgatctctcctggcaagctcatctatgttgatgacggtatcctttccttcgaggtcctcgaagtcgtagatgacaagaccatccgcgtccggtgcttgaacaacggcaacatctcttcccgcaagggtgttaacttgcccggcactgacgttgacctccccgccctttccgagaaggacattgccgatctcaagttcggtgttaggaacaaggtcgacatggtcttcgcttctttcatccgccgcggtagcgacattcgccacatccgtgaggttctgggtgaggagggcaaggagatccagatcattgccaagattgagaaccagcagggtgtcaacaacttcgacgagatcctcgaagagactgacggtgtcatggttgcccgtggtgaccttggtatcgagatccccgcccccaaggtcttcatcgcccagaagatgatgatcgccaagtgtaacatcaagggtaagcccgtcatctgtgccactcagatgctcgagtccatgacatacaaccctcgtcctactcgtgccgaggtgtccgatgttgccaacgccgtccttgacggtgccgactgtgtcatgctgtcgggagagaccgccaagggtaactaccccaacgaggccgtcaagatgatgtccgagacctgcctgctcgccgaggttgccatcccccacttcaatgtgttcgatgagctccgcaaccttgctcctcgccccaccgacactgtcgagtccatcgccatggctgccgttagcgccagtctggaactcaacgctggtgccattgtcgtcttgactaccagcggtaaaactgctcgctacctttccaagtaccgccccgtctgccccattgtcatggttacccgtaaccccgctgcctcccggtactctcacctgtaccgtggtgtctggcccttcctcttccccgagaagaagcccgacttcaacgtcaaggtctggcaggaggatgttgaccgccgtctcaagtggggtatcaaccacgctcttaagctcggcatcatcaacaagggtgacaacatcgtctgtgtccagggatggcgcggcggtatgggccacaccaacaccgtccgtgtggtccctgctgaggagaaccttggcctggctgagtaa

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Tianjin science and technology university, Nanjing university

<120> Aspergillus niger strain for efficiently producing malic acid, construction method and application

<160> 39

<170> SIPOSequenceListing 1.0

<210> 1

<211> 552

<212> DNA/RNA

<213> sequence of Gene Bar (Unknown)

<400> 1

atgagcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcg 60

gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg 120

caggaaccgc aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc 180

gtcgccgagg tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc 240

aacgcctacg actggacggc cgagtcaacc gtgtacgtct ccccccgcca ccagcggacg 300

ggactgggct ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag 360

agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc 420

ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac 480

gtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc 540

accgagatgt ga 552

<210> 2

<211> 1318

<212> DNA/RNA

<213> downstream sequence of gene cexA (Unknown)

<400> 2

accgctcatg cactggtagg ctttggatgt atgtctggct cttatctggt cggctacctt 60

atggattaca accaccgtct taccgaacgc gaatattgcg agaaacacgg ttatccggca 120

ggcacacgtg tcaatctgaa atcacacccc gacttcccca ttgaggtcgc ccggatgcgc 180

aatacctggt gggtgattgc gatcttcatc gtgacagttg ctttgtacgg cgtgtctttg 240

cggacacatc tggcggtgcc tatcattctg cagtacttca ttgcgttctg ctcaacagga 300

ctcttcacca tcaacagcgc cctggtcatc gatctttacc caggtgctag cgccagtgcg 360

acagcagtga acaatctgat gcggtgcctg cttggagctg gcggtgtggc tatcgtgcaa 420

cctatcctgg acgccttgaa gccggattat actttcctct tgcttgccgg catcaccctt 480

gtgatgactc cgttgctgta cgtcgaagat cgatggggtc ctggctggcg acatgcccgc 540

gaaaggagac tcaaggccaa agccaacggc aactagggag agaaaggact tgaaaaaaaa 600

aaggtgaagt gggactggtg aagtaaatgt ttgattcttc cccacacttt cttgatatgg 660

gttttatttt agcggcattt ggcgatacca ctgttttgca agcgatacca gttagattta 720

tagaagaatt gatcagtttc atcggctatc tcgctattac ttcctcgtag ctttttagct 780

tcatatatgg gtgagtggga aaggtttgac atggtggttg agatagtatc atttggatgg 840

agatggaagt ataaagcaag aagttctgtt gtttggtgtt tagactagac tagacgtggc 900

cggtgaagtc acgagcctca gcttagataa tctaatgcgg ctgatgtgac tgaccgatgg 960

ctttgttata tgaagacagg tcggtcaatt agaagatgtc gccagcaaaa gggtataata 1020

atggctatta tagagataag aatgtagagt atccctgttt ttaaggatca gtacgtagtt 1080

ttactataaa ggtacccata tatatatttg cggaacacga ggaggtcggg agtacatact 1140

tgtagttact gtttgtttgt gacgaggaat gccagttagg taagcaccac gtgatgcgtg 1200

acccaaacaa gcgcccggtc gttgcttgag gaaccaattt ctctgtttat cctccttcga 1260

acaccacact tcgaccttct ggacactgcc gctatgagcc ttccatagcc agcctgtt 1318

<210> 3

<211> 1303

<212> DNA/RNA

<213> upstream sequence of gene cexA (Unknown)

<400> 3

tggtgcctca aatcctcacg gcatcttcgt catcactttc tattattatg catccctccc 60

tgttgaaatc cccccatctt gtatttcctt tgcttcactt ccactgtgat cctgtttgcg 120

cagctactcc tttcctccct atccacctcc cctgatggca atttctactt gtctcatatt 180

taagcttacc aactgttacg tagacctccc gcactgaccc caatcaggtg caccttacct 240

gtggagttgt ggtttgcgac tcccgtggga gctctctcag gatgtcttgg tatagcttca 300

ctccaccccc aattccgcaa tctgcagcca cggtggaacc agcccagcga ggctggccag 360

cttgtcaagg atccatccca agaagtttcg ttgtctgggc gtcgcactcg attttttttg 420

gtcctcgcct cccatgcaat catcctccca cacccccctt cttagtgcgt atgggcctga 480

tgtagatccc cgagatccat agtaacccac tacacctgag cagttcgcca atcaggctga 540

tctcagattg ctcatactgg tgcgcgtgcg tgctccctgt ttcctacaac tactcctcct 600

gaagaggggg gaatagggac cctggcgccc tgagtcgtca attgatgacc tgccttgccg 660

tctcgcgttg catcgggcct ctccgtgttg atcacagctt agcttctgcg tgggagacag 720

ccttctccgt caacacatgt gggagatgtt ggctgagaag agtcgacggc ctatctactc 780

cataccatgt agcccaacgc tccgccacgg cgccactgaa tagcctgctc agctccctta 840

tcacgggctc cgcttccatc tagacccttg cgcatgacag gcgtgcccgg tccttcaaac 900

acaccattcg ctggaaatct gtatgctaag ttgactaaat ccgtcagctc ttgaggtgca 960

ggcgctagtc gtagtccagg atggcctgga aagcatgctt gttctggaat ttcatcacca 1020

cgccgggccc acgtcatgta tgcagatctt ggtagctccg cccttttgtc ccttcaattt 1080

tatttttttt ccctctttct tcgtcggctg cccgacggct tggactctct cggatgtgac 1140

ctagactact agtcgccaag taagaccggc cgaagagaaa ctcctaaacc cacgtctccg 1200

ttcatacctt ggcgataaca ccggctcttg ccacccacat ttgcccgctt tgggaaggtc 1260

attgatgatg gatagccccc ccgtctgtcc aagttgctcc gca 1303

<210> 4

<211> 1035

<212> DNA/RNA

<213> Aspergillus niger pyruvate kinase gene promoter PpkiA sequence (Unknown)

<400> 4

atggaagaga aaacctccga gtacttactt agggtccctg tctactgacc agagtctcgt 60

cctcattact atgattaatt acccactgga caaaaaaata aaataaaata aaaataaaaa 120

gggagacagc ttctccataa ctggcaactg ggtccgtccg agcagagcaa aattcagcct 180

tatgggttcc gatggagtca gggaaatagt tcttgcgaag ggcattgggc ttttttgcga 240

ggagaaaatt cagcaccgac aaagcatcca aatccacctc gctaggagag aatggatccg 300

cgacgatgtg gggtcaactg gacagagtga gagggtatca tgtggtcctg ccagatactt 360

cgcagaatgt tgtgtgggtg tctgattgtg gcttgggcgt gaattgcttt tggtcttccc 420

aaccaattat tattgcatgc ggcgtatgaa tgcctgagat gcgcggaggg aaggtgcctg 480

aggatgtagt ggacaaatgc tgctgatcgc tgggcggaaa cccttggctg accagtgaaa 540

agagcggacg gaggcagcag gtgtatctac gatcaaagaa tagtagcaaa gcagtgaaag 600

gtggatcacc cagcaaataa ttgagttttg atacccagcg atagtgccgg gggggagaaa 660

aagtcattaa taatgggaat tatgtaggcg atgggaagtg tgattgtaac tactccgtag 720

ctggaggcac aactaacaag ccagctctca acccgcgggg aaccgaccga cagaaaaaag 780

cgtcccaaag caggaatccc accaaaaagg gccgatccag ccaatcaccg ccgccaacat 840

ttttccttcc cgggcacccc tcctctagtc caccatctct ctcttctctc gctcaccggc 900

cccgtctttt ccttccctat tatctctccc tcttctcctc ccttctctcc ctccattctt 960

tctcccatct tcatcaatcc cttctcttct gtcttccccc ccggttcagt agagatcaat 1020

catccgtcaa gatgg 1035

<210> 5

<211> 719

<212> DNA/RNA

<213> nucleotide sequence of Ttrpc terminator of Tryptophan synthesis Gene C (Unknown)

<400> 5

cttaacgtta ctgaaatcat caaacagctt gacgaatctg gatataagat cgttggtgtc 60

gatgtcagct ccggagttga gacaaatggt gttcaggatc tcgataagat acgttcattt 120

gtccaagcag caaagagtgc cttctagtga tttaatagct ccatgtcaac aagaataaaa 180

cgcgttttcg ggtttacctc ttccagatac agctcatctg caatgcatta atgcattgac 240

tgcaacctag taacgccttn caggctccgg cgaagagaag aatagcttag cagagctatt 300

ttcattttcg ggagacgaga tcaagcagat caacggtcgt caagagacct acgagactga 360

ggaatccgct cttggctcca cgcgactata tatttgtctc taattgtact ttgacatgct 420

cctcttcttt actctgatag cttgactatg aaaattccgt caccagcncc tgggttcgca 480

aagataattg catgtttctt ccttgaactc tcaagcctac aggacacaca ttcatcgtag 540

gtataaacct cgaaatcant tcctactaag atggtataca atagtaacca tgcatggttg 600

cctagtgaat gctccgtaac acccaatacg ccggccgaaa cttttttaca actctcctat 660

gagtcgttta cccagaatgc acaggtacac ttgtttagag gtaatccttc tttctagac 719

<210> 6

<211> 1683

<212> DNA/RNA

<213> nucleotide sequence of mstC Gene (Unknown)

<400> 6

atgggtgtct ctaatatgat gtcccggttc aagcctcagg cggaccactc tgagtcctcc 60

actgaggctc ctactcctgc tcgctccaac tccgccgtcg agaaggacaa tgtcttgctc 120

gatgacagtc ccgtcaagta cttgacctgg cgctccttca tcctgggtat cgtcgtgtcc 180

atgggtggtt tcatcttcgg ttactctact ggtcaaatct ctggtttcga gactatggat 240

gacttcctcc aacgtttcgg tcaggaacag gcggatggat cctatgcttt cagcaacgtc 300

cgtagtggtc tcattgtcgg tctgctgtgt atcggtacta tgatcggtgc cctggttgct 360

gctcctatcg cagaccgcat gggccgcaag ctctccatct gtctctggtc tgtcatccac 420

atcgtcggta tcatcattca gattgccacc gactccaact gggtccaggt cgctatgggt 480

cgttgggttg ccggtctggg tgttggtgcc ctctccagca ttgtccccat gtaccagagt 540

gaatctgctc cccgtcaggt ccgtggtgcc atggtcagtg ccttccagct gttcgttgcc 600

ttcggtatct tcatctccta catcatcaac ttcggtaccg agagaatcca gtcgactgct 660

tcctggcgta tcaccatggg cattggcttc gcctggccct tgattctggc tgttggctct 720

ctcttcctgc ccgagtctcc tcgtttcgcc taccgtcagg gtcgtatcga tgaggcccgt 780

gaggttatgt gcaagctgta cggtgtcagc ccgaaccacc gcgtcatcgc ccaggagatg 840

aaggacatga aggacaagct cgacgaggag aaggccgccg gtcaggctgc ctggcacgag 900

ctgttcaccg gccctcgcat gctctaccgt accctgctcg gtattgctct gcagtccctc 960

cagcagctga ccggtgccaa ctttatcttc tactacggaa acagtatctt cacctccact 1020

ggtctgagca acagctacgt cactcagatc attctgggtg ctgtcaactt cggtatgacc 1080

ctgcccggtc tgtacgtcgt cgagcacttc ggtcgtcgta acagtctgat ggttggtgct 1140

gcctggatgt tcatttgctt catgatctgg gcttccgttg gtcacttcgc tctggatctt 1200

gccgaccctc aggccactcc tgccgctggt aaggccatga tcatcttcac ttgcttcttc 1260

attgtcggtt tcgccaccac ctggggtcct atcgtctggg ccatctgtgg tgagatgtac 1320

cccgcccgct accgtgctct ctgcattggt attgccaccg ctgccaactg gacctggaac 1380

ttcctcatct ccttcttcac ccccttcatc tctagctcca ttgacttcgc ctacggctac 1440

gtctttgctg gatgctgttt cgccgccatc ttcgttgtct tcttcttcgt caatgagacc 1500

cagggtcgca ctcttgagga ggttgacacc atgtacgtgc tccacgtcaa gccctggcag 1560

agtgccagct gggttccccc ggagggcatt gtccaggaca tgcaccgccc cccttcctct 1620

tccaagcagg agggtcaggc tgagatggct gagcacaccg agcccactga gctccgcgag 1680

taa 1683

<210> 7

<211> 1463

<212> DNA/RNA

<213> nucleotide sequence of pfkA Gene (Unknown)

<400> 7

atggctcccc cccaagctcc cgtgcaaccg cccaagagac gccgcatcgg tgtcttgacc 60

tctggtggcg atgctcccgg tatgaacggt gtcgtccggg ccgtcgtccg gatggctatc 120

cactccgact gtgaggcttt cgccgtctac gaaggttacg agggtctcgt caatggcggc 180

gacatgatcc gtcagcttca ctgggaggat gttcgcggct ggttgtcccg tggtggtacc 240

ttgatcggtt ccgcccgctg catggagttc cgtgagcgcc ccggtcgtct gcgggctgcc 300

aagaacatgg tcctccgtgg cattgacgcc cttgtcgtct gtggtggtga tggcagtttg 360

actggtgccg acgtttttcg ttccgagtgg cccggtctgt tgaaggaatt ggtcgagacg 420

ggcgagttga ccgaagagca ggtcaagcca taccagattc tgaacatcgt cggtttggtg 480

ggttcgatcg ataacgacat gtccggcacc gacgccacca tcggttgcta ctcctccctc 540

actcgcatct gtgacgccgt cgacgacgtc ttcgatactg ccttttccca ccagcgtgga 600

ttcgtcattg aggtcatggg tcgtcactgc ggttggctgg ccttgatgtc tgctatcagt 660

accggtgccg actggctgtt cgtgcccgag atgccgccca aggacggatg ggaggatgac 720

atgtgcgcta tcattaccaa ggtgggttga tcggaacttg gtggagagaa ctcagaggca 780

tcactaactc cccgcagaac agaaaggagc gtggaaagcg taggacgatc gtcatcgtgg 840

ccgagggtgc ccaggatcgc catctcaaca agatctcgag ttcgaagatc aaggatattt 900

tgacggagcg gttgaacctg gatacccgtg tgactgtgtt gggtcacact cagagaggtg 960

gagccgcctg tgcgtacgac cgctggctgt ccacactgca gggtgtcgag gctgtccgcg 1020

cggtgctgga catgaagccc gaagccccgt ccccggtcat caccatccgt gagaacaaga 1080

tcttgcgcat gccgttgatg gacgccgtgc agcacaccaa gactgtcacc aagcacattc 1140

agaacaagga gttcgccgaa gccatggccc tccgcgactc ggaattcaaa gagtaccact 1200

tttcctacat caacacttcc acgcccgacc acccgaagct gctcctccca gagaacaagg 1260

tttgtcgcca cagtagctgc ttcggtgctg agctaacaaa aggcagagaa tgcgcatcgg 1320

tattattcac gttggcgccc ccgctggtgg tatgaaccag gctacccgcg cggccgttgc 1380

ctactgcctg actcgtggcc acacccccct ggccattcac aacggtttcc ccggtctgtg 1440

ccggcactat gatgggccct aag 1463

<210> 8

<211> 1479

<212> DNA/RNA

<213> nucleotide sequence of hxkA Gene (Unknown)

<400> 8

atggttggaa tcggtcctaa gcgtcccccc tcccgcaagg gttccatggc cgatgttccc 60

cagaacctct tgcagcagat caaggacttc gaggaccaat tcaccgtcga tcgctccaag 120

ctcaagcaga ttgtcaacca ctttgtcaag gaattggaaa agggtctctc tgtcgagggt 180

ggaaacatcc ctatgaacgt cacctgggtt ctgggattcc ccgatggcga cgaacagggt 240

actttcctcg ccctcgacat gggtggcacc aacctgcgtg tttgtgagat caccctgacc 300

caggagaagg gtgccttcga catcacccag tccaagtacc gcatgcccga ggaattgaag 360

accggtaccg ccgaggagct gtgggaatac atcgccgact gcctgcagca attcatcgag 420

tcccaccacg agaacgagaa gatctccaag ctgcccctgg gtttcacctt ctcctacccc 480

gccacccagg attacatcga ccacggtgtc ctgcagcgct ggaccaaggg tttcgacatt 540

gatggtgtcg agggccacga cgtcgtcccg ccgttggagg ccatcctgca gaagcgcggc 600

ctgcccatca aggtggctgc actgatcaac gacaccaccg gaaccctcat cgcctcttct 660

tacaccgact ccgacatgaa gatcggctgc atcttcggta ccggtgtcaa cgccgcctac 720

atggagaacg ccggctccat ccccaagctg gctcacatga acctgcccgc cgacatgccc 780

gtggctatca actgcgagta cggtgctttc gacaacgagc acatcgtgct gcctctgacc 840

aagtacgacc acatcatcga ccgcgactcg ccccgtcccg gtcagcaggc cttcgagaag 900

atgaccgccg gtctgtacct gggtgagatc ttccgtctgg ccctgatgga cctggtggag 960

aaccgccccg gcctcatctt caacggccag gacaccacca agctgcgcaa gccctacatc 1020

ctggatgcct ccttcctggc agccatcgag gaggacccct acgagaacct ggaggagacc 1080

gaggagctca tggagcgcga gctcaacatc aaggccaccc cggcggagct ggagatgatc 1140

cgccgcctgg ccgagctgat cggtacgcgt gccgctcgcc tgtcggcctg cggtgttgcc 1200

gccatttgca cgaagaagaa gatcgactcg tgccacgttg gtgccgacgg ctccgtcttc 1260

accaagtacc ctcacttcaa ggcgcgcgga gccaaggctc tgcgcgagat cctggactgg 1320

gctccggagg agcaggacaa ggtgaccatc atggcggccg aggatggatc tggtgtggga 1380

gctgcgctga ttgcggcgct gaccctgaag cgggtcaagg ccggcaacct ggccggtatc 1440

cgaaacatgg ctgacatgaa gaccctgcta taagagctc 1479

<210> 9

<211> 1581

<212> DNA/RNA

<213> nucleotide sequence of pkiA gene (Unknown)

<400> 9

atggccgcca gctcttccct cgaccacctg agcaaccgca tgaagttgga gtggcactcc 60

aagctcaaca ctgagatggt gccctccaag aacttccgcc gcacctccat catcggaacc 120

atcggcccca agaccaactc cgtggagaag atcaactctc tccgcactgc cggtcttaac 180

gttgttcgca tgaacttctc ccacggttct tatgagtacc accaatctgt tatcgacaac 240

gcccgcgagg ccgccaagac ccaggtcgga cgtcctctcg ccattgctct tgataccaaa 300

ggacccgaga tccgtaccgg aaacaccccc gatgataagg atatccctat caagcagggc 360

cacgagctca acatcaccac cgacgagcaa tatgccaccg cctccgacga caagaacatg 420

tacctcgact acaagaacat caccaaggtg atctctcctg gcaagctcat ctatgttgat 480

gacggtatcc tttccttcga ggtcctcgaa gtcgtagatg acaagaccat ccgcgtccgg 540

tgcttgaaca acggcaacat ctcttcccgc aagggtgtta acttgcccgg cactgacgtt 600

gacctccccg ccctttccga gaaggacatt gccgatctca agttcggtgt taggaacaag 660

gtcgacatgg tcttcgcttc tttcatccgc cgcggtagcg acattcgcca catccgtgag 720

gttctgggtg aggagggcaa ggagatccag atcattgcca agattgagaa ccagcagggt 780

gtcaacaact tcgacgagat cctcgaagag actgacggtg tcatggttgc ccgtggtgac 840

cttggtatcg agatccccgc ccccaaggtc ttcatcgccc agaagatgat gatcgccaag 900

tgtaacatca agggtaagcc cgtcatctgt gccactcaga tgctcgagtc catgacatac 960

aaccctcgtc ctactcgtgc cgaggtgtcc gatgttgcca acgccgtcct tgacggtgcc 1020

gactgtgtca tgctgtcggg agagaccgcc aagggtaact accccaacga ggccgtcaag 1080

atgatgtccg agacctgcct gctcgccgag gttgccatcc cccacttcaa tgtgttcgat 1140

gagctccgca accttgctcc tcgccccacc gacactgtcg agtccatcgc catggctgcc 1200

gttagcgcca gtctggaact caacgctggt gccattgtcg tcttgactac cagcggtaaa 1260

actgctcgct acctttccaa gtaccgcccc gtctgcccca ttgtcatggt tacccgtaac 1320

cccgctgcct cccggtactc tcacctgtac cgtggtgtct ggcccttcct cttccccgag 1380

aagaagcccg acttcaacgt caaggtctgg caggaggatg ttgaccgccg tctcaagtgg 1440

ggtatcaacc acgctcttaa gctcggcatc atcaacaagg gtgacaacat cgtctgtgtc 1500

cagggatggc gcggcggtat gggccacacc aacaccgtcc gtgtggtccc tgctgaggag 1560

aaccttggcc tggctgagta a 1581

<210> 10

<211> 34

<212> DNA/RNA

<213> Bar-F(Unknown)

<400> 10

cacatctaaa caatgatgag cccagaacga cgcc 34

<210> 11

<211> 34

<212> DNA/RNA

<213> Bar-R(Unknown)

<400> 11

tcagtaacgt taagttaaca tctcggtgac gggc 34

<210> 12

<211> 43

<212> DNA/RNA

<213> p951(Unknown)

<400> 12

cattattatg gagaaactcg agggactaac attattccag cac 43

<210> 13

<211> 40

<212> DNA/RNA

<213> p952(Unknown)

<400> 13

ttatggatcc gagctcgaat tctgggtgtt acggagcatt 40

<210> 14

<211> 46

<212> DNA/RNA

<213> p1751(Unknown)

<400> 14

tgtatgctat acgaagttat tctagaaccg ctcatgcact ggtagg 46

<210> 15

<211> 46

<212> DNA/RNA

<213> p1752(Unknown)

<400> 15

ttgcatgcct gcaggggccc actagtaaca ggctggctat ggaagg 46

<210> 16

<211> 40

<212> DNA/RNA

<213> p1749(Unknown)

<400> 16

tgaatgctcc gtaacaccca tggtgcctca aatcctcacg 40

<210> 17

<211> 40

<212> DNA/RNA

<213> p1750(Unknown)

<400> 17

catacattat acgaagttat tgcggagcaa cttggacaga 40

<210> 18

<211> 47

<212> DNA/RNA

<213> p1352(Unknown)

<400> 18

atggagaaac tcgagactag taaatggaag agaaaacctc cgagtac 47

<210> 19

<211> 42

<212> DNA/RNA

<213> p1353(Unknown)

<400> 19

tcagtaacgt taagtggatc cagatctctg cagggtaccg ag 42

<210> 20

<211> 58

<212> DNA/RNA

<213> Ttrpc-F(Unknown)

<400> 20

acaatggaat tcgagctcgg taccctgcag ggatccactt aacgttactg aaatcatc 58

<210> 21

<211> 50

<212> DNA/RNA

<213> Ttrpc-R(Unknown)

<400> 21

gtagggcccc ccgggtctag aaagaaggat tacctctaaa caagtgtacc 50

<210> 22

<211> 20

<212> DNA/RNA

<213> p1949(Unknown)

<400> 22

ccgacactcc atacacctcc 20

<210> 23

<211> 19

<212> DNA/RNA

<213> p1950(Unknown)

<400> 23

ccagaagtgc gaggccaat 19

<210> 24

<211> 22

<212> DNA/RNA

<213> p1951(Unknown)

<400> 24

ccagtaccac cgacctcttc ag 22

<210> 25

<211> 18

<212> DNA/RNA

<213> p1952(Unknown)

<400> 25

tcggtaacca cgggcaat 18

<210> 26

<211> 20

<212> DNA/RNA

<213> p641(Unknown)

<400> 26

caatatcagt taacgtcgac 20

<210> 27

<211> 20

<212> DNA/RNA

<213> p642(Unknown)

<400> 27

ggaaccagtt aacgtcgaat 20

<210> 28

<211> 50

<212> DNA/RNA

<213> p1977(Unknown)

<400> 28

tcatccgtca agatggaatt catgggtgtc tctaatatga tgtcccggtt 50

<210> 29

<211> 43

<212> DNA/RNA

<213> p1978(Unknown)

<400> 29

tctctgcagg gtaccgagct cttactcgcg gagctcagtg ggc 43

<210> 30

<211> 42

<212> DNA/RNA

<213> p1981(Unknown)

<400> 30

taaacaatgg aattcgagct catggatacc ctactaaccg cg 42

<210> 31

<211> 43

<212> DNA/RNA

<213> p1982(Unknown)

<400> 31

tcagtaacgt taagtggatc cctagacaac atcttccaca tgc 43

<210> 32

<211> 43

<212> DNA/RNA

<213> p1937(Unknown)

<400> 32

tcatccgtca agatggaatt catggttgga atcggtccta agc 43

<210> 33

<211> 48

<212> DNA/RNA

<213> p1938(Unknown)

<400> 33

tctctgcagg gtaccgagct cttatagcag ggtcttcatg tcagccat 48

<210> 34

<211> 42

<212> DNA/RNA

<213> p2743(Unknown)

<400> 34

ttattatgga gaaactcgag ggactaacat tattccagca cc 42

<210> 35

<211> 42

<212> DNA/RNA

<213> p2744(Unknown)

<400> 35

ttatacgaag ttatggatcc aagaaggatt acctctaaac aa 42

<210> 36

<211> 42

<212> DNA/RNA

<213> p2745(Unknown)

<400> 36

tgtatgctat acgaagttat atggaagaga aaacctccga gt 42

<210> 37

<211> 44

<212> DNA/RNA

<213> p2746(Unknown)

<400> 37

ttgcatgcct gcaggggccc ggattacctc taaacaagtg tacc 44

<210> 38

<211> 39

<212> DNA/RNA

<213> p1979(Unknown)

<400> 38

tcatccgtca agatggaatt catggccgcc agctcttcc 39

<210> 39

<211> 40

<212> DNA/RNA

<213> p1980(Unknown)

<400> 39

tccagatctc tgcagggtac cttactcagc caggccaagg 40

Claims

1. Aspergillus niger (A) for efficiently producing malic acidAspergillus niger) A genetically engineered strain characterized by: the Aspergillus niger genetic engineering strain is a strain with a citric acid transport protein gene knocked outcexAAnd overexpresses the glucose transporter gene derived from Aspergillus nigermstCHexokinase genehxkAPhosphofructokinase genepfkAAnd pyruvate kinase genepkiAThe Aspergillus niger genetically engineered strain of (1);

the genecexAThe sequence is 4989494 in NCBI-Gene IDmstCThe sequence is 4978840 in NCBI-Gene ID, saidhxkAThe Gene is 4979978 at NCBI-Gene IDpfkAThe sequence is 4989727 in NCBI-Gene IDpkiAThe sequence is 4982167 in NCBI-Gene ID.

2. The method for constructing the Aspergillus niger genetically engineered strain for efficient malic acid production according to claim 1, wherein the method comprises the following steps: the method comprises the following steps:

Step 1, construction of GenecexAKnockout plasmid: respectively amplifying genes by PCR reaction by using wild type Aspergillus niger ATCC1015 genome as templatecexAUpstream and downstream homologous recombination sequence segments of (a); the gene is introducedcexACloning the upstream and downstream homologous recombination sequence fragments to a vector pLH594 to construct a genecexAKnock-out plasmid pLH 623;

in the step 2, the step of mixing the raw materials,cexAobtaining of a knockout strain: the plasmid pLH623 is transformed into a host strain S575 and is obtained by screening a transformant and recombining a hygromycin resistance genecexAKnock-out strain S895;

construction of Aspergillus niger genetic engineering strain for efficiently producing L-malic acid

Step 1, constructionmstCGene overexpression plasmids: obtaining gene by PCR reaction amplification by using wild type Aspergillus niger ATCC1015 genome as templatemstCA sequence fragment; the gene is introducedmstCCloning the sequence fragment into vector pLH509 to construct genemstCOver-expression plasmid pLH 684; the genemstCThe promoter P of the pyruvate kinase gene of Aspergillus nigerpkiAControl of the promoter PpkiAThe sequence is SEQ NO.4, and the length is 1035 bp;

in the step 2, the step of mixing the raw materials,mstCacquisition of a Gene-overexpressing Strain: transformation of said plasmid pLH684 intocexAKnockout strain S895 is obtained by transformant screening and hygromycin resistance gene recombinationmstCGene-overexpressing strain S1006;

step 3, constructionpfkAGeneAn overexpression plasmid: obtaining gene by PCR reaction amplification by using wild type Aspergillus niger ATCC1015 genome as templatepfkAA sequence fragment; the gene is introducedpfkACloning the sequence fragment into vector pLH454 to construct genepfkAOver-expression plasmid pLH 473; the genepfkAFrom the Aspergillus niger glycerol-3-phosphate dehydrogenase gene promoter PgpdAControlling;

step 4, constructionhxkAGene overexpression plasmids: obtaining gene by PCR reaction amplification by using wild type Aspergillus niger ATCC1015 genome as templatehxkAA sequence fragment; the gene is introducedhxkACloning the sequence fragment into vector pLH509 to construct genehxkAOver-expression plasmid pLH 667; the genehxkAThe promoter P of the pyruvate kinase gene of Aspergillus nigerpkiAControlling;

step 5, constructionpfkAGenes andhxkAgene combination overexpression plasmids: are respectively provided withpfkAGene overexpression plasmids pLH473 andhxkAthe gene over-expression plasmid pLH667 is used as a template, and P is obtained by PCR reaction amplificationgpdA-pfkA-TtrpcSequence fragment and PpkiA-hxkA-TtrpcA sequence fragment; the P is addedgpdA-pfkA-TtrpcSequence fragment and PpkiA-hxkA-TtrpcCloning the sequence fragment into the vector pLH331 to constructpfkAGenes andhxkAgene combination over-expression plasmid pLH 727;

in the step 6, the step of,cexAis knocked out andmstC、 hxkAandpfkAacquisition of a Gene-overexpressing Strain: transformation of said plasmid pLH727 intocexAIs knocked out andmstCthe gene over-expression strain S1006 is obtained by transformant screening and hygromycin resistance gene recombinationcexAIs knocked out andmstC、 hxkAandpfkAgene over-expression strain S1078;

step 7, constructionpkiAGene overexpression plasmids: obtaining gene by PCR reaction amplification by using wild type Aspergillus niger ATCC1015 genome as templatepkiAA sequence fragment; the gene is introducedpkiACloning the sequence fragment into vector pLH509 to construct genepkiAOver-expression plasmid pLH 683; the genepkiAThe promoter P of the pyruvate kinase gene of Aspergillus nigerpkiAControl of；

In the step 8, the step of performing the step,cexAis knocked out andmstC、 hxkA、pfkAandpkiAacquisition of a Gene-overexpressing Strain:

transformation of said plasmid pLH683 intocexAIs knocked out andmstC、 hxkAandpfkAthe gene over-expression strain S1078 is obtained by screening transformant and recombining hygromycin resistance genecexAIs knocked out andmstC、 hxkA、pfkAandpkiAgene over-expression strain S1149 to obtain Aspergillus niger gene engineering strain for efficiently producing malic acid;

the construction method of the vector pLH594 is as follows:

synthesis of bialaphos resistance geneBarA gene, thenbarThe gene sequence is simultaneously with the channelEcoR Ⅰ/BamH I, connecting a starting vector pLH577 subjected to double enzyme digestion linearization, and transforming a connecting product into competent cells of Escherichia coli JM109 to obtain a plasmid pLH 593;

aspergillus niger 3-phosphoglycerol dehydrogenase gene promoter amplified by PCR using plasmid pLH593 as templatePgpdABialaphos resistance geneBarAnd Aspergillus nidulans tryptophan synthesis gene C terminatorTtrpcA sequence; then P is addedgpdA A promoter,barGenes and TtrpcThe terminator sequence is simultaneously with the amino acid sequenceKpn I/EcoR I, connecting the linearized starting vector pLH334 by double enzyme digestion, and transforming the connecting product into competent cells of Escherichia coli JM109 to obtain a plasmid pLH 594;

the construction method of the vector pLH509 is as follows:

respectively taking the genomes of Aspergillus niger and Aspergillus nidulans as templates, and amplifying the promoter P of the pyruvate kinase gene of Aspergillus niger by PCRpkiAAnd Aspergillus nidulans tryptophan synthesis gene C terminator TtrpcSequencing to confirm no mutation, and adding PpkiA Promoter and TtrpcThe terminator sequence is simultaneously with the amino acid sequenceXba I/Xho The starting vector pLH419 after the I double digestion linearization is connected, and the connected product is transformed into competent cells of Escherichia coli JM109 to obtain the plasmid pLH 509.

3. The method for constructing the Aspergillus niger genetically engineered strain for efficiently producing malic acid according to claim 2, wherein the method comprises the following steps: the construction method of the strain S1149 comprises the following steps:

cexAobtaining of a knockout strain:

electrically transferring plasmid pLH623 to agrobacterium, co-culturing agrobacterium containing plasmid pLH623 and host strain S575 in IM plate for agrobacterium mediated transformation, co-culturing for two days, transferring transformant to CM plate containing 200 μ M cefotaxime, 100 μ g/mL ampicillin, 100 μ g/mL streptomycin and 250 μ g/mL hygromycin B for screening until hyphae grows out from transformant, randomly picking 100 and transferring to MM plate containing 10 μ g/mL glufosinate-ammonium, picking clone slowly growing on glufosinate-ammonium containing plate, extracting genome for PCR screening and verification, picking one correct transformant, and culturingcexAKnockout cloninghphmarker induced recombination to obtain a protein without hygromycin resistancecexAKnock-out strain S895;

cexAis knocked out andmstCacquisition of a Gene-overexpressing Strain:

plasmid pLH684 is electroporated into Agrobacterium, which is then ligated with Agrobacterium containing plasmid pLH684cexACarrying out agrobacterium mediated transformation on the gene knockout strain S895 by IM plate co-culture, transferring transformants into a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening after co-culture for two days until the transformants grow hyphae, randomly selecting 20 transformants for shake flask fermentation screening, selecting the transformant with the highest yield for carrying out shake flask fermentation screeninghphmarker induced recombination to obtain hygromycin sensitivecexAIs knocked out andmstCgene-overexpressing strain S1006;

cexAis knocked out andmstC、hxkAandpfkAacquisition of a Gene-overexpressing Strain:

the plasmid pLH727 is electrically transferred to Agrobacterium, and then the Agrobacterium containing pLH727 is mixed withmstCThe gene is overexpressed andcexAcarrying out agrobacterium mediated transformation on the gene knockout strain S1006 in an IM plate co-culture, transferring transformants into a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening after the co-culture is carried out for two days until hyphae grow out from the transformants, then randomly picking 20 transformants for carrying out shake flask fermentation screening, selecting the transformant with the highest yield for carrying out shake flask fermentation screeninghphmarker induced recombination to obtain hygromycin sensitivecexAIs knocked out andmstC、hxkAandpfkAgene over-expression strain S1078;

cexAis knocked out andmstC、hxkA、pfkAandpkiAacquisition of a Gene-overexpressing Strain:

the plasmid pLH683 is electroporated into Agrobacterium, which is then ligated with the Agrobacterium containing plasmid pLH683mstCOver-expression of genes andhxkAgenes andpfkAthe gene combination is over-expressed andcexAcarrying out agrobacterium mediated transformation on the gene knockout strain S1078 in an IM (instant Messaging) plate for co-culture, transferring transformants into a CM plate containing 200 mu M cefotaxime, 100 mu g/mL ampicillin, 100 mu g/mL streptomycin and 250 mu g/mL hygromycin B for screening until the transformants grow hyphae, randomly selecting 20 transformants for shake flask fermentation screening, and selecting the transformant with the highest yield for carrying out shake flask fermentation screeninghphmarker induced recombination to obtain hygromycin sensitivecexAIs knocked out andmstC、hxkA、pfkAandpkiAgene-overexpressing strain S1149;

the induced recombination method comprises the following steps: transformant spores were evenly plated into MM plates containing 10. mu.g/mL doxycycline toGrowing single clone, randomly picking 100 clones, transferring to PDA plate and hygromycin-containing PDA plate, wherein the clone which can not grow in hygromycin-containing PDA plate but can normally grow in PDA ishphmarker induced recombination, which is shown to be hygromycin sensitive.

4. The use of the genetically engineered strain of aspergillus niger for efficient malic acid production according to claim 1 for malic acid production.

5. The method for producing malic acid by fermenting the aspergillus niger genetically engineered strain for efficiently producing malic acid in the fermentation tank according to claim 1, which comprises the following steps: the method comprises the following steps:

finally, inoculating the seed culture solution to a fermentation tank containing a fermentation culture medium for fed-batch fermentation, wherein the temperature is maintained at 28-32 ℃, the ventilation rate is 0.5-1 vvm, the stirring speed is 250-400 rpm, the glucose concentration is maintained to be higher than 15g/L in the whole fermentation process, and calcium carbonate is supplemented to maintain the pH value between 5.8-6.5 until the fermentation is finished; wherein the seed culture solution: volume ratio ml of fermentation medium: l is 140: 1.26.

6. a method of fermentative production of malic acid according to claim 5, characterised in that: the seed culture medium comprises the following components: 40g/L glucose, 6g/L bacterial peptone, 750mg/L anhydrous potassium dihydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.

7. A method of fermentative production of malic acid according to claim 5 or 6, characterised in that: the fermentation medium comprises the following components: 100g/L glucose,80g/L calcium carbonate, 6g/L bactopeptone, 150mg/L anhydrous potassium dihydrogen phosphate, 150mg/L anhydrous dipotassium hydrogen phosphate, 100mg/L magnesium sulfate heptahydrate, 100mg/L calcium chloride dihydrate, 5mg/L ferrous sulfate heptahydrate, and 5mg/L anhydrous sodium chloride.