CN111718948B - Gene and application thereof in production of mannich - Google Patents
Gene and application thereof in production of mannich Download PDFInfo
- Publication number
- CN111718948B CN111718948B CN202010736326.6A CN202010736326A CN111718948B CN 111718948 B CN111718948 B CN 111718948B CN 202010736326 A CN202010736326 A CN 202010736326A CN 111718948 B CN111718948 B CN 111718948B
- Authority
- CN
- China
- Prior art keywords
- mannich
- gene
- saccharomyces cerevisiae
- seq
- gal1p
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/06—Hydroxylating
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
- C12Y504/99034—Germanicol synthase (5.4.99.34)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a gene and application thereof in producing mannich, belonging to the technical field of biology. The invention provides a saccharomyces cerevisiae engineering bacterium BY4742/GAL1p-GES-ADH1t capable of highly producing a Mannich alcohol, which is obtained BY integrating a gene of a coding Mannich alcohol synthase with a nucleotide sequence shown as SEQ ID NO.1 into a genome of saccharomyces cerevisiae BY 4742; the saccharomyces cerevisiae engineering bacteria are inoculated into a fermentation medium for fermentation for 48 hours, so that the yield of the mannich in the fermentation liquid can reach 45.31 mg/L.
Description
Technical Field
The invention relates to a gene and application thereof in producing mannich, belonging to the technical field of biology.
Background
The mannich is an oleanane pentacyclic triterpenoid compound, and has the effects of resisting tumor, HIV, oxidation, inflammation, bacteria and the like, so the mannich has wide application in the fields of medicines, foods, cosmetics and the like.
At present, the methods for producing the Mannich alcohol mainly comprise a plant extraction method and a chemical synthesis method. Among them, the plant extraction method produces the mannich mainly by extracting a plant containing the mannich, but since the mannich content in the plant is very low, the production of the mannich by using the method is inefficient, and the production of the mannich by using the method consumes a large amount of plant raw materials, thus causing adverse effects on the ecological environment. The chemical synthesis method is mainly used for producing the mannich through oxidation-reduction reaction, but the mannich produced by the chemical synthesis method has the problems of complex operation, high pollution, high cost, low safety and the like.
The above disadvantages severely limit the large-scale commercial production of the mannich. Therefore, it is urgently needed to find a method for producing the mannich, which is simple to operate, environment-friendly, low in cost and high in safety, so as to overcome the defects.
Disclosure of Invention
[ problem ] to
The invention aims to provide a method for producing mannich, which is simple to operate, environment-friendly, low in cost and high in safety.
[ solution ]
In order to solve the technical problem, the invention provides a gene, and the nucleotide sequence of the gene is shown as SEQ ID NO. 4.
The invention also provides a gene expression cassette, and the gene expression cassette carries the gene.
In one embodiment of the present invention, the gene expression cassette comprises a promoter, the above gene, and a terminator connected in this order.
In one embodiment of the invention, the promoter is GAL1p promoter.
In one embodiment of the invention, the nucleotide sequence of the GAL1p promoter is shown in SEQ ID NO. 2.
In one embodiment of the invention, the terminator is the ADH1t terminator.
In one embodiment of the invention, the nucleotide sequence of the ADH1t terminator is shown in SEQ ID NO. 3.
The invention also provides a host cell, wherein the genome of the host cell is integrated with the gene or the gene expression cassette.
In one embodiment of the invention, the host cell is Saccharomyces cerevisiae.
In one embodiment of the invention, the saccharomyces cerevisiae is saccharomyces cerevisiae BY 4742.
In one embodiment of the present invention, the above gene or the above gene expression cassette is integrated into the 308a locus of the s.cerevisiae genome.
The invention also provides a method for producing the mannich, which comprises the steps of inoculating the host cell into a fermentation medium for fermentation to obtain fermentation liquor containing the mannich, and then separating the fermentation liquor containing the mannich to obtain the mannich.
In one embodiment of the present invention, the fermentation medium is a YPD liquid medium or a YPG liquid medium.
In one embodiment of the invention, the temperature of the fermentation is 30 ℃ and the rotation speed is 200 rpm.
The invention also provides the application of the gene or the gene expression cassette or the host cell or the method in producing the mannich.
[ advantageous effects ]
(1) The invention provides a saccharomyces cerevisiae engineering bacterium BY4742/GAL1p-GES-ADH1t capable of highly producing a Mannich alcohol, which is obtained BY integrating a gene of a coding Mannich synthase (GES) with a nucleotide sequence shown as SEQ ID NO.1 into the genome of saccharomyces cerevisiae BY 4742; the saccharomyces cerevisiae engineering bacteria are inoculated into a fermentation medium for fermentation for 48 hours, so that the yield of the mannich in the fermentation liquid can reach 45.31 mg/L.
(2) The invention provides a method for producing mannich BY fermentation through a microbiological method, which can be completed BY inoculating saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1t into a fermentation medium for fermentation, and can enable the yield of the mannich in fermentation liquor to reach 45.31mg/L BY fermenting for 48 hours.
Drawings
FIG. 1: PCR verification results of first colonies of saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t; wherein M is Marker, and 1-4 are Saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
FIG. 2: performing PCR verification on a second colony of the saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t; wherein M is Marker, and 1 is Saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
FIG. 3: and (3) a gas chromatogram of a fermentation liquid obtained BY fermenting saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
FIG. 4: and (3) a mass spectrum of fermentation liquor obtained BY fermenting saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
FIG. 5: the content of the mannich in fermentation liquor obtained by fermenting different saccharomyces cerevisiae engineering bacteria.
Detailed Description
Coli (Escherichia coli) BL21 and Saccharomyces cerevisiae BY4742, referred to in the examples below, were obtained from Jinzhi Biotech, Inc., Suzhou; SC-URA solid medium referred to in the following examples was purchased from Exieti Biotech (Shanghai) Co., Ltd.
The yeast gene expression episomal vector pRS426-308a involved in the following examples was constructed as follows: synthesizing a Cas9 gene (SEQ ID No.19), an ADH1 promoter (SEQ ID No.20), a CYC1 terminator (SEQ ID No.21), sgRNAs (SEQ ID No.22), a tyrosine promoter (SEQ ID No.23), and an SNR52 terminator (SEQ ID No. 24); sequentially connecting an ADH1 promoter, a Cas9 gene and a CYC1 terminator through overlap extension PCR to obtain a gene fragment 1; sequentially connecting a tyrosine promoter, an sgRNA and an SNR52 terminator by overlapping extension PCR to obtain a gene fragment 2; carrying out SacI enzyme digestion on the gene fragment 1 and pRS426 plasmid (purchased from biological air company) and then connecting to obtain a recombinant plasmid; the gene fragment 2 and the recombinant plasmid are cut by KpnI enzyme and then are connected to obtain the yeast gene expression addition type vector pRS426-308 a.
The media involved in the following examples are as follows:
YPD liquid medium: 10g/L of yeast extract, 20g/L of tryptone and 20g/L of glucose.
YPD solid Medium: 10g/L of yeast extract, 20g/L of tryptone, 20g/L of glucose and 20g/L of agar.
YPG liquid medium: 10g/L of yeast extract, 20g/L of tryptone and 20g/L of galactose.
The detection methods referred to in the following examples are as follows:
determination of the mannich content:
centrifuging the fermentation liquor at 8000rpm for 5min to obtain precipitate; resuspending the precipitate with 50% (v/v) anhydrous ethanol containing 200g/L potassium hydroxide in the same volume to obtain a resuspension solution; carrying out boiling water bath on the heavy suspension for 10min to crack cells to obtain a cracking solution; adding equal volume of n-hexane into the lysate for extraction to obtain a supernatant; after 200. mu.L of the supernatant was transferred to a gas phase vial, 200. mu.L of pyridine and 200. mu. L N, O-bis (trimethylsilyl) trifluoroacetamide were added to the gas phase vial, and reacted at 55 ℃ for 1 hour to obtain a reaction solution; after the reaction has cooled to room temperature (25 ℃), the reaction solution is analyzed by a gas chromatograph-mass spectrometer;
wherein, the calculation formula of the content of the mannich in the fermentation liquor is as follows: the content of mannich in the fermentation broth is sample peak area/standard concentration.
Example 1: construction of Saccharomyces cerevisiae engineering bacteria
The method comprises the following specific steps:
a gene (SEQ ID NO.1) which is derived from apple and codes Malus domestica beta-amyrin synthase-like (NCBI Reference Sequence: NM-001328982.1) is used as a template, a gene with a nucleotide Sequence shown as SEQ ID NO.4 is designed and synthesized through codon optimization, and the gene can be used for synthesizing mannich due to the later verification, so that the protein coded by the gene is named as mannich synthase (GES), and the gene is named as a gene which codes mannich synthase (GES).
Carrying out PCR amplification BY using a genome of Saccharomyces cerevisiae BY4742 as a template and GAL1P-F, GAL1P-P as a primer to obtain a GAL1P promoter (SEQ ID NO. 2); obtaining an ADH1t terminator (SEQ ID NO.3) BY PCR amplification BY taking the genome of the saccharomyces cerevisiae BY4742 as a template and ADH1t-F, ADH1t-P as a primer; an upstream homology arm (SEQ ID NO.5) is obtained BY PCR amplification BY taking the genome of the Saccharomyces cerevisiae BY4742 as a template and F1 and P1 as primers; obtaining a downstream homology arm (SEQ ID NO.6) BY PCR amplification BY taking a genome of Saccharomyces cerevisiae BY4742 as a template and F2 and P2 as primers;
wherein, the primers used in the PCR are as follows:
GAL1p-F:TAACTTCGAATTTTTTTCTTTTTATCTAAACATGGCATTACCACCATATACATATCCA(SEQ ID NO.7)；
GAL1p-P:CGTCAGCAACCTTCAACTTCCACATTATAGTTTTTTCTCCTTGACGTTAAAGTATAGAGG(SEQ ID NO.8)；
ADH1t-F:AGGCTTAAGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAA(SEQ ID NO.9)；
ADH1t-P:TAGAAGTGGTAGCAATATGTAGCAAAGAGGAGTTAGCATATCTACAATTGGGTGAA(SEQ ID NO.10)；
F1:TATTTCAGAAAAATTATTCAAAACTAAGAAGAATGAGATG(SEQ ID NO.11)；
P1:ATGGTGGTAATGCCATGTTTAGATAAAAAGAAAAAAATTCGAAGTTAATGTTGAAATTTC(SEQ ID NO.12)；
F2:TTCACCCAATTGTAGATATGCTAACTCCTCTTTGCTACATATTGCTACCACTTCTATTAC(SEQ ID NO.13)；
P2:TGATAGAACGAGTACAACACCCGA(SEQ ID NO.14)。
the gene coding the mannich synthase, the GAL1p promoter, the ADH1t terminator, the upstream homology arm, the downstream homology arm and a yeast gene expression additional vector pRS426-308a with the nucleotide sequence shown as SEQ ID NO.4 are co-transferred into Saccharomyces cerevisiae BY4742, the yeast gene expression additional vector pRS426-308a carries a gene expressing Cas9 protein and gRNA, the gene coding the mannich synthase, the GAL1p promoter, the ADH1t terminator, the upstream homology arm and the downstream homology arm with the nucleotide sequence shown as SEQ ID NO.4 are integrated into a 308a site of a Saccharomyces cerevisiae BY4742 genome through a CRISPR/Cas9 technology to obtain a transformation product (in the integration process, the gene coding the mannich synthase, the GAL1p promoter, the ADH1t terminator, the upstream homology arm and the downstream homology arm with the nucleotide sequence shown as SEQ ID NO.4 are recombined in yeast body, forming a gene expression cassette formed by sequentially connecting an upstream homology arm, a GAL1p promoter, a gene which has a nucleotide sequence shown as SEQ ID NO.4 and encodes the Mannich synthase, an ADH1t terminator and a downstream homology arm); coating the transformation product on an SC-URA solid culture medium, and carrying out inverted culture in a constant-temperature incubator at 30 ℃ for 48h to obtain a transformant; streaking the transformant on a YPD solid culture medium, carrying out inversion culture in a constant temperature incubator at 30 ℃ for 48h, and then carrying out primary colony PCR verification (the verification result is shown in figure 1); inoculating a transformant which is verified to be correct by colony PCR into 10mL YPD liquid culture medium, and culturing at 30 ℃ for 12h to obtain a bacterial liquid 1; transferring the bacterial liquid 1 into a fresh 10mL YPD liquid culture medium according to the inoculation amount of 2% (v/v), and culturing at 30 ℃ for 12h to eliminate plasmids to obtain bacterial liquid 2; streaking the bacterial liquid 2 on an YPD solid culture medium, and carrying out inverted culture in a constant-temperature incubator at 30 ℃ for 48h to obtain a single bacterial colony; and (3) selecting a single colony, streaking on a YPD solid culture medium (normal growth) and an SC-URA solid culture medium (no growth), carrying out reverse culture in a constant temperature incubator at 30 ℃ for 48h, then carrying out second colony PCR verification on the colony which normally grows on the YPD solid culture medium (the verification result is shown in figure 2), and obtaining the saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
Example 2: production of mannich
The method comprises the following specific steps:
the engineering strain of Saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t obtained in example 1 was streaked on YPD solid medium with Saccharomyces cerevisiae BY4742 as control, and cultured at 30 ℃ for 48h to obtain single colony; inoculating the single colony into 10mL YPD liquid culture medium, and culturing at 30 deg.C and 200rpm for 12h to obtain seed solution; inoculating the seed solution into 50mL YPD liquid culture medium at an inoculation amount of 2% (v/v), and culturing at 30 deg.C and 200rpm for 24h to obtain culture solution; centrifuging the culture solution, and collecting thalli; transferring all the cells into 50mL YPG liquid culture medium, fermenting at 30 deg.C and 200rpm for 48h to obtain fermentation liquid.
Detecting the content of the mannich in fermentation liquor obtained BY fermenting saccharomyces cerevisiae BY4742 and saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1t (the detection result is shown in a figure 3-4).
According to the detection result, no mannich can be detected in the fermentation liquor obtained BY fermenting saccharomyces cerevisiae BY 4742; the content of the mannich in a fermentation liquid obtained BY fermenting saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1t is 45.31 mg/L.
Comparative example 1: construction of Saccharomyces cerevisiae engineering bacteria
The method comprises the following specific steps:
using a gene (SEQ ID NO.15) which is derived from white pear and codes Pyrus x bretschneideri beta-amyrin synthase-like (NCBI Reference Sequence: XM _018650195.1) as a template, and designing and synthesizing a gene which codes a Mannich synthase and has a nucleotide Sequence shown as SEQ ID NO.16 through codon optimization; a gene encoding Mannich synthase having a nucleotide Sequence shown in SEQ ID NO.18 was designed and synthesized by codon optimization using a gene (SEQ ID NO.17) encoding Rosa chinensis beta-amyrin synthase-like (NCBI Reference Sequence: XM-024327323.1) derived from a China rose as a template.
On the basis of example 1, the gene encoding the mannich synthase shown in the nucleotide sequence of example 1 as SEQ ID No.4 was replaced with the gene encoding the mannich synthase shown in the nucleotide sequence of SEQ ID No.16 and the gene encoding the mannich synthase shown in the nucleotide sequence of SEQ ID No.18, respectively, to obtain engineered saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t1 and engineered saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t 2.
Comparative example 2: production of mannich
The method comprises the following specific steps:
in addition to example 2, engineered Saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t in example 2 was used as a control, and engineered Saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t in example 2 was replaced with engineered Saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t1 and engineered Saccharomyces cerevisiae BY4742/GAL1p-GES-ADH1t2, respectively, to obtain fermentation broths 1-2.
And detecting the content of the mannich in the fermentation liquor 1-2 (the detection result is shown in figure 5).
According to the detection result, the content of the mannich in the fermentation liquor 1-2 is respectively 1.12mg/L and 3.45mg/L, which is far lower than that of the mannich in the fermentation liquor (45.31mg/L) obtained BY fermenting saccharomyces cerevisiae engineering bacteria BY4742/GAL1p-GES-ADH1 t.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> university of south of the Yangtze river
<120> gene and application thereof in production of mannich
<160> 24
<170> PatentIn version 3.3
<210> 1
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 1
atgtggaagc ttaaggtcgc agatgggggc aatgatccat acatctacag cacaaacaac 60
ttcgtgggaa ggcagatatt tgagtttgat cctgaagcag gaactactga agagagagct 120
gaggtggaag aagctcgtct tcatttctac aataaccgct atcaggttaa gcccagtggt 180
gacttcctat ggcgaatgca gttcctaagg gagaagaact ttaaacaaac aattccccca 240
attaaagttg aggatggaga ggaaatcaca catgaaaagg ccacagcttc attgagaagg 300
tctgtccact tcttttcagc gttgcaggct agcgatggcc attggcctgc cgaaaatgcc 360
ggcccgttgt ttttccttcc tcctttggta atgtgtgttt acattacagg gcatcttaac 420
actgtattcc atgcagaaca ccgtaaagaa attctgcgtt acatatacta tcatcagaac 480
caagatggtg gttggggatt acacattgaa ggacacagca ctatgttctg cacagctctc 540
agctacattt gtatgcgtat tcttggagaa ggacctgatg gtggccaaga caatgcttgt 600
gcaagagcta gaaagtggat tcttgatcat ggcagtgtta cccacatccc ctcatggggt 660
aaaacttggc tttcgatact tggtgtgttt gagtggtccg gaagcaaccc aatgccccca 720
gagttttgga ttctgccttc atttcttccc atgcatccag caaaaatgtg gtgctactgt 780
aggatggttt acatgcctat gtcatattta tatgggaaaa gatttgttgg tccaatcaca 840
cctctcatac tacaattaag ggaagaactc tatgctcagc cttatgacga aattaactgg 900
aagggagtgc gtcatcactg tgctaaagag gacatctact accctcatcc ttggatacag 960
gactttctat gggatagtct gtacatatgt acggagcctc ttcttactcg ctggccattt 1020
aacaagatga tcaggaaaag ggctctcgaa gtaacaatga agcacattca ttatgaagat 1080
gaaaacagca gatacattac cattggatgt gtcgaaaagg tgttatgcat gctggcttgt 1140
tgggctgaag acccaaatgg tgattatttt aaaaagcatc ttgccaggat accagattat 1200
ttatgggttg ctgaggatgg gatgaagatg caaagttttg gcagtcaaca gtgggatact 1260
ggttttgcca ttcaagcttt gcttgcttcc aatctaaccg atgaaatagc acccacactt 1320
gctagaggac atgacttcgt caagaaatcc caggttaagg acaatccatc gggtgacttc 1380
aaaagcatgc accgccacat ttccaaagga tcgtggactt tctctgatca agaccatgga 1440
tggcaagttt ctgattgcac tgcagagggt ttaaagtgtt gcctgctttt atcgatgatg 1500
ccaccggagc tggttggtga aaaaatggaa cctgagcggt tatacgatgc tgtcaatgtc 1560
ctaatttccc tgcagagtaa aaatggtggt ttagcagcct gggaaccagc tggagcagca 1620
gaatggttag aaatgttgaa tcccacggaa ttcttcgcgg acattgttgt tgagcatgaa 1680
tatgttgaat gcacttcatc agcaattcag gctttagttt tgtttaagaa gttgtaccct 1740
ggccacagga agaaagagat agatcaattt attaccaatg ctgcacagta ccttgaaaat 1800
atacaaatgg aagatggttc atggtacggg aattggggag tttgcttcac atatggtacc 1860
tggtttgctc ttggagggtt aacagctgct ggcaagactt tcaacaactg tgcagttata 1920
cgcaaagcta ttaattttct actcacaatc cagaaagaga acggtggttg gggagagagc 1980
tacctttcat gtccaaaaaa ggagtatgtt cctcttgaag gaaaccgatc aaatttagta 2040
cacacagctt gggctatgat gggtttgatt tatgcaggac aggccgaaag agaccccgca 2100
cctcttcatc gtgcagcaaa gttgataatg aactctcaga tggaaaatgg tgatttttct 2160
cagcaggaaa tcactggagt gttcaataag aattgtatgc tacattatgc agcttataga 2220
aacatctacc ccctgtgggc tcttgcagaa taccgcaagt gggttccatt gccttccaaa 2280
gcgtga 2286
<210> 2
<211> 442
<212> DNA
<213> Artificial sequence
<400> 2
cggattagaa gccgccgagc gggcgacagc cctccgacgg aagactctcc tccgtgcgtc 60
ctcgtcttca ccggtcgcgt tcctgaaacg cagatgtgcc tcgcgccgca ctgctccgaa 120
caataaagat tctacaatac tagcttttat ggttatgaag aggaaaaatt ggcagtaacc 180
tggccccaca aaccttcaaa ttaacgaatc aaattaacaa ccataggatg ataatgcgat 240
tagtttttta gccttatttc tggggtaatt aatcagcgaa gcgatgattt ttgatctatt 300
aacagatata taaatggaaa agctgcataa ccactttaac taatactttc aacattttca 360
gtttgtatta cttcttattc aaatgtcata aaagtatcaa caaaaaattg ttaatatacc 420
tctatacttt aacgtcaagg ag 442
<210> 3
<211> 188
<212> DNA
<213> Artificial sequence
<400> 3
gcgaatttct tatgatttat gatttttatt attaaataag ttataaaaaa aataagtgta 60
tacaaatttt aaagtgactc ttaggtttta aaacgaaaat tcttattctt gagtaactct 120
ttcctgtagg tcaggttgct ttctcaggta tagcatgagg tcgctcttat tgaccacacc 180
tctaccgg 188
<210> 4
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 4
atgtggaagt tgaaggttgc tgacggtggt aacgacccat acatctactc tactaacaac 60
ttcgttggta gacaaatctt cgaattcgac ccagaagctg gtactactga agaaagagct 120
gaagttgaag aagctagatt gcacttctac aacaacagat accaagttaa gccatctggt 180
gacttcttgt ggagaatgca attcttgaga gaaaagaact tcaagcaaac tatcccacca 240
atcaaggttg aagacggtga agaaatcact cacgaaaagg ctactgcttc tttgagaaga 300
tctgttcact tcttctctgc tttgcaagct tctgacggtc actggccagc tgaaaacgct 360
ggtccattgt tcttcttgcc accattggtt atgtgtgttt acatcactgg tcacttgaac 420
actgttttcc acgctgaaca cagaaaggaa atcttgagat acatctacta ccaccaaaac 480
caagacggtg gttggggttt gcacatcgaa ggtcactcta ctatgttctg tactgctttg 540
tcttacatct gtatgagaat cttgggtgaa ggtccagacg gtggtcaaga caacgcttgt 600
gctagagcta gaaagtggat cttggaccac ggttctgtta ctcacatccc atcttggggt 660
aagacttggt tgtctatctt gggtgttttc gaatggtctg gttctaaccc aatgccacca 720
gaattctgga tcttgccatc tttcttgcca atgcacccag ctaagatgtg gtgttactgt 780
agaatggttt acatgccaat gtcttacttg tacggtaaga gattcgttgg tccaatcact 840
ccattgatct tgcaattgag agaagaattg tacgctcaac catacgacga aatcaactgg 900
aagggtgtta gacaccactg tgctaaggaa gacatctact acccacaccc atggatccaa 960
gacttcttgt gggactcttt gtacatctgt actgaaccat tgttgactag atggccattc 1020
aacaagatga tcagaaagag agctttggaa gttactatga agcacatcca ctacgaagac 1080
gaaaactcta gatacatcac tatcggttgt gttgaaaagg ttttgtgtat gttggcttgt 1140
tgggctgaag acccaaacgg tgactacttc aagaagcact tggctagaat cccagactac 1200
ttgtgggttg ctgaagacgg tatgaagatg caatctttcg gttctcaaca atgggacact 1260
ggtttcgcta tccaagcttt gttggcttct aacttgactg acgaaatcgc tccaactttg 1320
gctagaggtc acgacttcgt taagaagtct caagttaagg acaacccatc tggtgacttc 1380
aagtctatgc acagacacat ctctaagggt tcttggactt tctctgacca agaccacggt 1440
tggcaagttt ctgactgtac tgctgaaggt ttgaagtgtt gtttgttgtt gtctatgatg 1500
ccaccagaat tggttggtga aaagatggaa ccagaaagat tgtacgacgc tgttaacgtt 1560
ttgatctctt tgcaatctaa gaacggtggt ttggctgctt gggaaccagc tggtgctgct 1620
gaatggttgg aaatgttgaa cccaactgaa ttcttcgctg acatcgttgt tgaacacgaa 1680
tacgttgaat gtacttcttc tgctatccaa gctttggttt tgttcaagaa gttgtaccca 1740
ggtcacagaa agaaggaaat cgaccaattc atcactaacg ctgctcaata cttggaaaac 1800
atccaaatgg aagacggttc ttggtacggt aactggggtg tttgtttcac ttacggtact 1860
tggttcgctt tgggtggttt gactgctgct ggtaagactt tcaacaactg tgctgttatc 1920
agaaaggcta tcaacttctt gttgactatc caaaaggaaa acggtggttg gggtgaatct 1980
tacttgtctt gtccaaagaa ggaatacgtt ccattggaag gtaacagatc taacttggtt 2040
cacactgctt gggctatgat gggtttgatc tacgctggtc aagctgaaag agacccagct 2100
ccattgcaca gagctgctaa gttgatcatg aactctcaaa tggaaaacgg tgacttctct 2160
caacaagaaa tcactggtgt tttcaacaag aactgtatgt tgcactacgc tgcttacaga 2220
aacatctacc cattgtgggc tttggctgaa tacagaaagt gggttccatt gccatctaag 2280
gcttaa 2286
<210> 5
<211> 1000
<212> DNA
<213> Artificial sequence
<400> 5
tatttcagaa aaattattca aaactaagaa gaatgagatg ataagaaaaa cagttaccaa 60
tttagtagct gtaagattaa aaaacttatc ccacgaattt gatgtaatag agaattatct 120
gcgctatata gctagcacca gtgaacatct atttactgct attaagcgcc actttaacaa 180
atgtgccaga aaacttttga aagaagcaat cgactccaaa tcaaactcag aaactgctac 240
ggtggttctg caagaaggat tttctggcat ttgcttattg aaagcgtctt caattatatt 300
aaaactaaaa ttgaagtttc caaaaaagaa agatagaact gatattagca aattgtgtga 360
caagaaagaa cggatgacac agtggttaga aatttcaatt ttgatgaact gagaataata 420
atattatgct cccctggatt ttatgcgaag acactgctga aaaaatttct gatatatgca 480
gagaaggagc aaataagcca gttttaagga accgagataa gctgttttcg cccattgttc 540
tagttctaca aaatatctac agggaatcga tgaggttgta agaaatcctg aatactctat 600
gatagtgcat aacactaaaa agttgaaaga atcccgtatc atggacgatt tccttgaaca 660
tttgagcaaa gacgataaca aagcatggta tggcgcggaa gaaaccgaga gagctgcaaa 720
attagatgca atagaaacac tacttattac agatagtgta ctaaaaagga acgacgtgaa 780
aaaacgtgaa aaatacctag acctaataga gaatagtgga aacaacaatg gcaaaatatt 840
cgtactcagt acttcaaaaa tcacagtgag caacttgaca aaccaacaga tataggctgt 900
gtcttaaaat ataccatcca ataccttgat gaacttttca aagatgacta aaataagtga 960
aatttcaaca ttaacttcga atttttttct ttttatctaa 1000
<210> 6
<211> 1000
<212> DNA
<213> Artificial sequence
<400> 6
tctttgctac atattgctac cacttctatt acacaatagt ttcaatagct tgcagcgtag 60
ctaaactcta aaatttatct aaatcactca tataaaccga acccttcccc ttccgcttat 120
agtacagtac ctatacattt cataaacatg gcatggcgat cagcgccaaa caatatggaa 180
aatccacaga aagctattca ttgaaaaaat agtacaaata agtcacatga tgatatttga 240
ttttattata tttttaaaaa aagtaaaaaa taaaaagtag tttattttta aaaaataaaa 300
tttaaaatat tagtgtattt gatttccgaa agttaaaaaa gaaatagtaa gaaatatata 360
tttcattgaa tggatatatg aaacgtttac tggtggaagt tttgctcata tattattatt 420
caatagaagt aataaagaaa aagttggtaa agcaacttaa cagtaaaaag gtaatgattg 480
aaaaagtttt tgaacatcta agctatatgt tgatgggttt acaattttac cattagtact 540
catgcctata cttttctgtt cgtccttaat gtccgcgatt tagagcaatc attgaaagta 600
ctagatacat tttagccaga gaggactcgt tgacgtagaa ttaaaattca aatgaatttc 660
cgccccattc atatacccca aataacaaac atattaaaac ttcataatta ttcaaaatgt 720
ggagtagtat agaagagcag taccttcaaa attgatttct tcagtttccc acccgggatc 780
cacttgtcat gcggtgagaa tcgtatattg cgtataatcc gtgtttcatc acccacatta 840
tagtacaaac ctactggtgt aaccattatc atattcatga cttgtagtta aaaatctttc 900
acgataaatt gaggaaaaaa tcacgttaaa tagtttcata tcattcttta gttaaagtct 960
gtgcataaaa agaggatcgg gtgttgtact cgttctatca 1000
<210> 7
<211> 58
<212> DNA
<213> Artificial sequence
<400> 7
taacttcgaa tttttttctt tttatctaaa catggcatta ccaccatata catatcca 58
<210> 8
<211> 60
<212> DNA
<213> Artificial sequence
<400> 8
cgtcagcaac cttcaacttc cacattatag ttttttctcc ttgacgttaa agtatagagg 60
<210> 9
<211> 60
<212> DNA
<213> Artificial sequence
<400> 9
aggcttaagc gaatttctta tgatttatga tttttattat taaataagtt ataaaaaaaa 60
<210> 10
<211> 56
<212> DNA
<213> Artificial sequence
<400> 10
tagaagtggt agcaatatgt agcaaagagg agttagcata tctacaattg ggtgaa 56
<210> 11
<211> 40
<212> DNA
<213> Artificial sequence
<400> 11
tatttcagaa aaattattca aaactaagaa gaatgagatg 40
<210> 12
<211> 60
<212> DNA
<213> Artificial sequence
<400> 12
atggtggtaa tgccatgttt agataaaaag aaaaaaattc gaagttaatg ttgaaatttc 60
<210> 13
<211> 60
<212> DNA
<213> Artificial sequence
<400> 13
ttcacccaat tgtagatatg ctaactcctc tttgctacat attgctacca cttctattac 60
<210> 14
<211> 24
<212> DNA
<213> Artificial sequence
<400> 14
tgatagaacg agtacaacac ccga 24
<210> 15
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 15
atgtggaagc ttaaggtcgc agatggtggc aatgatccat acatctacag cacaaacaac 60
ttcgtgggaa ggcagatatt tgagtttgac cctgaagcag gaactaccga agagcgagct 120
gaggtggaag aagctcgtct tcatttctac aacaaccgct accaggttaa gcccagtggt 180
gatctcctat ggcgaatgca gttcctaagg gagaagaact tcaaacagac aaatccccca 240
attaaagttg aggatggaga ggaaatcaca catgaaaagg ccacaacttc attgagaagg 300
tctgtccact tcttttcagc attgcaggct agcgatggcc attggcctgc cgaaaatgcc 360
ggcccattgt ttttccttcc tcctttggtt atgtgtgttc acattacaga gcatcttaac 420
actatatttc atgcagaaca ccgcaaagaa attctgcgtt acatatactg tcatcagaac 480
caagatggtg gttggggatt acacattgaa ggacacagca ccatgttctg cacagctctc 540
agctatattt gtatgcgtat tcttggagaa ggacctgatg gtggccaaga caatgcttgt 600
gcaagagcta gaaagtggat tcttgatcat ggtagtgtta cccacatccc ctcatggggt 660
aaaacttggc tttcgatact tggtgtgttt gagtggtccg gaagcaaccc aatgccccca 720
gagttttgga ttctgccttc atttcttcct atgcatccag caaaaatgtg gtgttactgt 780
aggatggttt atatgcctat gtcatattta tatgggaaaa gatttgttgg tccaatcaca 840
cctctcatac tacaattaag ggaagaactc tatgctcagc cttatgacga aattaactgg 900
aagggagtgc gtcatcactg tgctaaagag gacatctact accctcatcc ttggatacag 960
gactttctgt gggatagtct gtacatatgt acggagcctc ttcttactcg ctggccattt 1020
aacaagctga tcaggaaaag ggctctcgaa gtaacaatgg agcatattca ttatgaagat 1080
gaaaacagca gatacattac cattggatgt gtcgaaaagg tgttatgcat gctggcttgt 1140
tgggctgaag atccaaatgg tgattatttt aaaaagcatc ttgccaggat accagattat 1200
ttatgggttg ctgaggatgg gatgaagatg caaagttttg gcagtcaaca gtgggatact 1260
ggttttgcca ttcaagcttt gcttgcttcc aatctaaccg atgaaattgc acccacactt 1320
gctagaggac atgacttcgt caagaactct caggttaagg acaatccatc gggtgacttc 1380
aaaagcatgc atcgccacat ttccaaagga tcgtggactt tctctgatca agaccatgga 1440
tggcaagttt ctgattgcac tgcagagggt ttaaagtgtt gcctgctttt atcgatgatg 1500
ccaccggagc tggttggtga aaaaatggaa cctgagcggt tatacgatgc tgtcaatgtc 1560
ctaattaccc tacagagtaa aaatggtggt ttagcagcct gggaaccagc tggagcagca 1620
gaatggttag aaatgttgaa tcccacggaa ttcttcgcag acattgttgt tgagcatgaa 1680
tatgttgagt gcacttcatc tgcaattcag gctttagttt tgtttaagaa gttgtaccct 1740
ggccacagga acaaagaaat agatcaattt attaccaatg cagcacagta ccttgaaaat 1800
atacaaatgg aagatggttc atggtacggg aattggggtg tttgcttcac atatggtacc 1860
tggtttgctc ttggagggtt aacagctgct ggcaagactt tcaacaattg tgcagttata 1920
cgcaaagcta ttaatttttt actcacaatc cagaaagaga acggtggctg gggagagagc 1980
tacctttcat gtccaaaaaa ggagtacgtt cctcttgaag gaaaccgatc aaatttagta 2040
cacacagctt gggctatgat gggtttgatt tatgcaggac aggccgaaag agaccccgca 2100
cctcttcatc gtgcagcaaa gttgataatc aactctcaga tggaaaatgg tgattttcct 2160
cagcaggaaa tcactggagt gttcatgaag aattgtatgc tacattatgc agcttataga 2220
aacatctacc ccctgtgggc tcttgcagaa taccgcaagt gggttccatt gccttccaag 2280
gcgtga 2286
<210> 16
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 16
atgtggaagt tgaaggttgc tgacggtggt aacgacccat acatctactc tactaacaac 60
ttcgttggta gacaaatctt cgaattcgac ccagaagctg gtactactga agaaagagct 120
gaagttgaag aagctagatt gcacttctac aacaacagat accaagttaa gccatctggt 180
gacttgttgt ggagaatgca attcttgaga gaaaagaact tcaagcaaac taacccacca 240
atcaaggttg aagacggtga agaaatcact cacgaaaagg ctactacttc tttgagaaga 300
tctgttcact tcttctctgc tttgcaagct tctgacggtc actggccagc tgaaaacgct 360
ggtccattgt tcttcttgcc accattggtt atgtgtgttc acatcactga acacttgaac 420
actatcttcc acgctgaaca cagaaaggaa atcttgagat acatctactg tcaccaaaac 480
caagacggtg gttggggttt gcacatcgaa ggtcactcta ctatgttctg tactgctttg 540
tcttacatct gtatgagaat cttgggtgaa ggtccagacg gtggtcaaga caacgcttgt 600
gctagagcta gaaagtggat cttggaccac ggttctgtta ctcacatccc atcttggggt 660
aagacttggt tgtctatctt gggtgttttc gaatggtctg gttctaaccc aatgccacca 720
gaattctgga tcttgccatc tttcttgcca atgcacccag ctaagatgtg gtgttactgt 780
agaatggttt acatgccaat gtcttacttg tacggtaaga gattcgttgg tccaatcact 840
ccattgatct tgcaattgag agaagaattg tacgctcaac catacgacga aatcaactgg 900
aagggtgtta gacaccactg tgctaaggaa gacatctact acccacaccc atggatccaa 960
gacttcttgt gggactcttt gtacatctgt actgaaccat tgttgactag atggccattc 1020
aacaagttga tcagaaagag agctttggaa gttactatgg aacacatcca ctacgaagac 1080
gaaaactcta gatacatcac tatcggttgt gttgaaaagg ttttgtgtat gttggcttgt 1140
tgggctgaag acccaaacgg tgactacttc aagaagcact tggctagaat cccagactac 1200
ttgtgggttg ctgaagacgg tatgaagatg caatctttcg gttctcaaca atgggacact 1260
ggtttcgcta tccaagcttt gttggcttct aacttgactg acgaaatcgc tccaactttg 1320
gctagaggtc acgacttcgt taagaactct caagttaagg acaacccatc tggtgacttc 1380
aagtctatgc acagacacat ctctaagggt tcttggactt tctctgacca agaccacggt 1440
tggcaagttt ctgactgtac tgctgaaggt ttgaagtgtt gtttgttgtt gtctatgatg 1500
ccaccagaat tggttggtga aaagatggaa ccagaaagat tgtacgacgc tgttaacgtt 1560
ttgatcactt tgcaatctaa gaacggtggt ttggctgctt gggaaccagc tggtgctgct 1620
gaatggttgg aaatgttgaa cccaactgaa ttcttcgctg acatcgttgt tgaacacgaa 1680
tacgttgaat gtacttcttc tgctatccaa gctttggttt tgttcaagaa gttgtaccca 1740
ggtcacagaa acaaggaaat cgaccaattc atcactaacg ctgctcaata cttggaaaac 1800
atccaaatgg aagacggttc ttggtacggt aactggggtg tttgtttcac ttacggtact 1860
tggttcgctt tgggtggttt gactgctgct ggtaagactt tcaacaactg tgctgttatc 1920
agaaaggcta tcaacttctt gttgactatc caaaaggaaa acggtggttg gggtgaatct 1980
tacttgtctt gtccaaagaa ggaatacgtt ccattggaag gtaacagatc taacttggtt 2040
cacactgctt gggctatgat gggtttgatc tacgctggtc aagctgaaag agacccagct 2100
ccattgcaca gagctgctaa gttgatcatc aactctcaaa tggaaaacgg tgacttccca 2160
caacaagaaa tcactggtgt tttcatgaag aactgtatgt tgcactacgc tgcttacaga 2220
aacatctacc cattgtgggc tttggctgaa tacagaaagt gggttccatt gccatctaag 2280
gcttaa 2286
<210> 17
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 17
atgtggaagc ttaaggttgc agaaggtggg gattcctcgg cttacattta cagcacaaac 60
aactttgtcg gaaggcagac atgggagttt gattcggatg caggaactcc tgaagagcga 120
gctgaggttg aagaggcccg tcttcatttc tacaacaacc gctatcaggt caagcccagt 180
ggtgacattc tttggcgtat gcagttccta agggagaaga agttcaaaca gacaattact 240
ccagtaaaaa ttgaagatgg cgaggttatc acacatgaaa aaaccacaga tgcactgaga 300
aggtctgtcc acttcttttc agcgttgcag gcaagcgatg gccattggcc tgcggaaaat 360
gccggccctt tgtttttcct tcctcccttg gtcatatgta tgtacattac tggccatctt 420
aacagtgtat tccctgaaga gcatcgcaaa gaaattctgc gttacatata ctatcatcag 480
aatgaagatg gtggttgggg actacacgtc gaaggtcaca gcaccatgtt cagcacagct 540
ctcagctaca tttgtatgcg tattctcgga gaaggacctg atgatggtgg ccaagacaat 600
gcttgtccaa gagcaagaaa gtggattctt gatcacggtg gtgtcacaca cataccctct 660
tggggaaaga cttggctttc gatacttggt ctgtttgatt ggtctggaag caaccctatg 720
cccccagagt tttggattct tccttcgttt cttcctatgc atccagcaaa aatgtggtgc 780
tattgtagga tggtttacat gccaatgtca tacctatatg gaaaaaggtt tgttggccca 840
attacacctc tcattcttaa attgagggag gaacttttta ttcaacctta caatcaaatc 900
aattggaaga aagtacgcca tctatgtgcc aaagaggaca tctactatcc tcatccttgg 960
atacaggatc tcctatggga tagcctctac atttccacag agcctattct tactcgttgg 1020
cccttcaaca aattgatcag agaaaaggct cttcaagtga cgatgaagca tattcattac 1080
gaagatgaga acagtcgata cattaccatt gggtgtgtgg aaaaggtgtt atgtatgctt 1140
gcctgttggg ttgaagatcc aaatggggac tatttcaaga agcatctggc aagggtcccg 1200
gattatttat gggttgctga agatggaatg aagatgcaaa gttttggcag tcaggagtgg 1260
gatactggtt ttgccattca agctttgctt gctactaatc taacggacga aattggaaca 1320
acgctcgcta gaggacatga cttcataaag aaatctcagg tcaaagacaa cccatctggt 1380
gacttcaata gcatgcaccg ccacatttcc aaaggatcgt ggactttctc cgatcaagat 1440
catggatggc aagtttctga ttgcactgca gaaggtttaa agtgttgcct tctattgtcg 1500
atgatgtcat cggagatagt tggtgaaaaa atggaacctg agcgcttgta cgattctgtc 1560
aatgttctac tttccctaca gagcaagaat ggtggtttgt cagcctggga accagcaggg 1620
gcagcagagt ggttagaact attaaatccg acagagttct tcgcagacat agtaattgag 1680
catgaatatg ttgagtgcac ttcatctgca atccaggctt tagtactgtt taagaagcta 1740
cacccaggac accggaagaa agagattgaa catttcatca ccaatgctat acactacctt 1800
gaaaatatac aaatgccgga tggttcatgg tatggaaact ggggagtttg cttcacatat 1860
ggtacctggt ttgcagtagg aggattggca gcagctggca agactttcag cacttgtgca 1920
gccatgcgca aagcggttag ttttctcctc acaacgcaga gagagaatgg tggttgggga 1980
gagagctatc tttcatgtcc gcaagagaca tacattcctc tcgaaggaaa tcgatccaat 2040
ttagtacata ctgcttgggc tatgatgggt ctcattcatg cgggacaggc agaaagagac 2100
ccaacacctc ttcatcgtgc agcaaagttt ataattaatt ctcaaatgga aaatggtgat 2160
tttccccagc aggaaatcac tggagtcttc atgaagaact gcatgctaca ttatgcagct 2220
tatagaaata tatacccact ctgggctctt gcagaatacc gcaagcgggt tccattgcct 2280
tcctag 2286
<210> 18
<211> 2286
<212> DNA
<213> Artificial sequence
<400> 18
atgtggaagt tgaaggttgc tgaaggtggt gactcttctg cttacatcta ctctactaac 60
aacttcgttg gtagacaaac ttgggaattc gactctgacg ctggtactcc agaagaaaga 120
gctgaagttg aagaagctag attgcacttc tacaacaaca gataccaagt taagccatct 180
ggtgacatct tgtggagaat gcaattcttg agagaaaaga agttcaagca aactatcact 240
ccagttaaga tcgaagacgg tgaagttatc actcacgaaa agactactga cgctttgaga 300
agatctgttc acttcttctc tgctttgcaa gcttctgacg gtcactggcc agctgaaaac 360
gctggtccat tgttcttctt gccaccattg gttatctgta tgtacatcac tggtcacttg 420
aactctgttt tcccagaaga acacagaaag gaaatcttga gatacatcta ctaccaccaa 480
aacgaagacg gtggttgggg tttgcacgtt gaaggtcact ctactatgtt ctctactgct 540
ttgtcttaca tctgtatgag aatcttgggt gaaggtccag acgacggtgg tcaagacaac 600
gcttgtccaa gagctagaaa gtggatcttg gaccacggtg gtgttactca catcccatct 660
tggggtaaga cttggttgtc tatcttgggt ttgttcgact ggtctggttc taacccaatg 720
ccaccagaat tctggatctt gccatctttc ttgccaatgc acccagctaa gatgtggtgt 780
tactgtagaa tggtttacat gccaatgtct tacttgtacg gtaagagatt cgttggtcca 840
atcactccat tgatcttgaa gttgagagaa gaattgttca tccaaccata caaccaaatc 900
aactggaaga aggttagaca cttgtgtgct aaggaagaca tctactaccc acacccatgg 960
atccaagact tgttgtggga ctctttgtac atctctactg aaccaatctt gactagatgg 1020
ccattcaaca agttgatcag agaaaaggct ttgcaagtta ctatgaagca catccactac 1080
gaagacgaaa actctagata catcactatc ggttgtgttg aaaaggtttt gtgtatgttg 1140
gcttgttggg ttgaagaccc aaacggtgac tacttcaaga agcacttggc tagagttcca 1200
gactacttgt gggttgctga agacggtatg aagatgcaat ctttcggttc tcaagaatgg 1260
gacactggtt tcgctatcca agctttgttg gctactaact tgactgacga aatcggtact 1320
actttggcta gaggtcacga cttcatcaag aagtctcaag ttaaggacaa cccatctggt 1380
gacttcaact ctatgcacag acacatctct aagggttctt ggactttctc tgaccaagac 1440
cacggttggc aagtttctga ctgtactgct gaaggtttga agtgttgttt gttgttgtct 1500
atgatgtctt ctgaaatcgt tggtgaaaag atggaaccag aaagattgta cgactctgtt 1560
aacgttttgt tgtctttgca atctaagaac ggtggtttgt ctgcttggga accagctggt 1620
gctgctgaat ggttggaatt gttgaaccca actgaattct tcgctgacat cgttatcgaa 1680
cacgaatacg ttgaatgtac ttcttctgct atccaagctt tggttttgtt caagaagttg 1740
cacccaggtc acagaaagaa ggaaatcgaa cacttcatca ctaacgctat ccactacttg 1800
gaaaacatcc aaatgccaga cggttcttgg tacggtaact ggggtgtttg tttcacttac 1860
ggtacttggt tcgctgttgg tggtttggct gctgctggta agactttctc tacttgtgct 1920
gctatgagaa aggctgtttc tttcttgttg actactcaaa gagaaaacgg tggttggggt 1980
gaatcttact tgtcttgtcc acaagaaact tacatcccat tggaaggtaa cagatctaac 2040
ttggttcaca ctgcttgggc tatgatgggt ttgatccacg ctggtcaagc tgaaagagac 2100
ccaactccat tgcacagagc tgctaagttc atcatcaact ctcaaatgga aaacggtgac 2160
ttcccacaac aagaaatcac tggtgttttc atgaagaact gtatgttgca ctacgctgct 2220
tacagaaaca tctacccatt gtgggctttg gctgaataca gaaagagagt tccattgcca 2280
tcttaa 2286
<210> 19
<211> 4104
<212> DNA
<213> Artificial sequence
<400> 19
atggacaaga agtactccat tgggctcgat atcggcacaa acagcgtcgg ttgggccgtc 60
attacggacg agtacaaggt gccgagcaaa aaattcaaag ttctgggcaa taccgatcgc 120
cacagcataa agaagaacct cattggcgcc ctcctgttcg actccgggga gacggccgaa 180
gccacgcggc tcaaaagaac agcacggcgc agatataccc gcagaaagaa tcggatctgc 240
tacctgcagg agatctttag taatgagatg gctaaggtgg atgactcttt cttccatagg 300
ctggaggagt cctttttggt ggaggaggat aaaaagaacg agcgccaccc aatctttggc 360
aatatcgtgg acgaggtggc gtaccatgaa aagtacccaa ccatatatca tctgaggaag 420
aagcttgtag acagtactga taaggctgac ttgcggttga tctatctcgc gctggcgcat 480
atgatcaaat ttcggggaca cttcctcatc gagggggacc tgaacccaga caacagcgat 540
gtcgacaaac tctttatcca actggttcag acttacaatc agcttttcga agagaacccg 600
atcaacgcat ccggagttga cgccaaagca atcctgagcg ctaggctgtc caaatcccgg 660
cggctcgaaa acctcatcgc acagctccct ggggagaaga agaacggcct gtttggtaat 720
cttatcgccc tgtcactcgg gctgaccccc aactttaaat ctaacttcga cctggccgaa 780
gatgccaagc ttcaactgag caaagacacc tacgatgatg atctcgacaa tctgctggcc 840
cagatcggcg accagtacgc agaccttttt ttggcggcaa agaacctgtc agacgccatt 900
ctgctgagtg atattctgcg agtgaacacg gagatcacca aagctccgct gagcgctagt 960
atgatcaagc gctatgatga gcaccaccaa gacttgactt tgctgaaggc ccttgtcaga 1020
cagcaactgc ctgagaagta caaggaaatt ttcttcgatc agtctaaaaa tggctacgcc 1080
ggatacattg acggcggagc aagccaggag gaattttaca aatttattaa gcccatcttg 1140
gaaaaaatgg acggcaccga ggagctgctg gtaaagctta acagagaaga tctgttgcgc 1200
aaacagcgca ctttcgacaa tggaagcatc ccccaccaga ttcacctggg cgaactgcac 1260
gctatcctca ggcggcaaga ggatttctac ccctttttga aagataacag ggaaaagatt 1320
gagaaaatcc tcacatttcg gataccctac tatgtaggcc ccctcgcccg gggaaattcc 1380
agattcgcgt ggatgactcg caaatcagaa gagaccatca ctccctggaa cttcgaggaa 1440
gtcgtggata agggggcctc tgcccagtcc ttcatcgaaa ggatgactaa ctttgataaa 1500
aatctgccta acgaaaaggt gcttcctaaa cactctctgc tgtacgagta cttcacagtt 1560
tataacgagc tcaccaaggt caaatacgtc acagaaggga tgagaaagcc agcattcctg 1620
tctggagagc agaagaaagc tatcgtggac ctcctcttca agacgaaccg gaaagttacc 1680
gtgaaacagc tcaaagaaga ctatttcaaa aagattgaat gtttcgactc tgttgaaatc 1740
agcggagtgg aggatcgctt caacgcatcc ctgggaacgt atcacgatct cctgaaaatc 1800
attaaagaca aggacttcct ggacaatgag gagaacgagg acattcttga ggacattgtc 1860
ctcaccctta cgttgtttga agatagggag atgattgaag aacgcttgaa aacttacgct 1920
catctcttcg acgacaaagt catgaaacag ctcaagaggc gccgatatac aggatggggg 1980
cggctgtcaa gaaaactgat caatgggatc cgagacaagc agagtggaaa gacaatcctg 2040
gattttctta agtccgatgg atttgccaac cggaacttca tgcagttgat ccatgatgac 2100
tctctcacct ttaaggagga catccagaaa gcacaagttt ctggccaggg ggacagtctt 2160
cacgagcaca tcgctaatct tgcaggtagc ccagctatca aaaagggaat actgcagacc 2220
gttaaggtcg tggatgaact cgtcaaagta atgggaaggc ataagcccga gaatatcgtt 2280
atcgagatgg cccgagagaa ccaaactacc cagaagggac agaagaacag tagggaaagg 2340
atgaagagga ttgaagaggg tataaaagaa ctggggtccc aaatccttaa ggaacaccca 2400
gttgaaaaca cccagcttca gaatgagaag ctctacctgt actacctgca gaacggcagg 2460
gacatgtacg tggatcagga actggacatc aatcggctct ccgactacga cgtggatcat 2520
atcgtgcccc agtcttttct caaagatgat tctattgata ataaagtgtt gacaagatcc 2580
gataaaaata gagggaagag tgataacgtc ccctcagaag aagttgtcaa gaaaatgaaa 2640
aattattggc ggcagctgct gaacgccaaa ctgatcacac aacggaagtt cgataatctg 2700
actaaggctg aacgaggtgg cctgtctgag ttggataaag ccggcttcat caaaaggcag 2760
cttgttgaga cacgccagat caccaagcac gtggcccaaa ttctcgattc acgcatgaac 2820
accaagtacg atgaaaatga caaactgatt cgagaggtga aagttattac tctgaagtct 2880
aagctggtct cagatttcag aaaggacttt cagttttata aggtgagaga gatcaacaat 2940
taccaccatg cgcatgatgc ctacctgaat gcagtggtag gcactgcact tatcaaaaaa 3000
tatcccaagc ttgaatctga atttgtttac ggagactata aagtgtacga tgttaggaaa 3060
atgatcgcaa agtctgagca ggaaataggc aaggccaccg ctaagtactt cttttacagc 3120
aatattatga attttttcaa gaccgagatt acactggcca atggagagat tcggaagcga 3180
ccacttatcg aaacaaacgg agaaacagga gaaatcgtgt gggacaaggg tagggatttc 3240
gcgacagtcc ggaaggtcct gtccatgccg caggtgaaca tcgttaaaaa gaccgaagta 3300
cagaccggag gcttctccaa ggaaagtatc ctcccgaaaa ggaacagcga caagctgatc 3360
gcacgcaaaa aagattggga ccccaagaaa tacggcggat tcgattctcc tacagtcgct 3420
tacagtgtac tggttgtggc caaagtggag aaagggaagt ctaaaaaact caaaagcgtc 3480
aaggaactgc tgggcatcac aatcatggag cgatcaagct tcgaaaaaaa ccccatcgac 3540
tttctcgagg cgaaaggata taaagaggtc aaaaaagacc tcatcattaa gcttcccaag 3600
tactctctct ttgagcttga aaacggccgg aaacgaatgc tcgctagtgc gggcgagctg 3660
cagaaaggta acgagctggc actgccctct aaatacgtta atttcttgta tctggccagc 3720
cactatgaaa agctcaaagg gtctcccgaa gataatgagc agaagcagct gttcgtggaa 3780
caacacaaac actaccttga tgagatcatc gagcaaataa gcgaattctc caaaagagtg 3840
atcctcgccg acgctaacct cgataaggtg ctttctgctt acaataagca cagggataag 3900
cccatcaggg agcaggcaga aaacattatc tacttgttta ctctgaccaa cttgggcgcg 3960
cctgcagcct tcaagtactt cgacaccacc atagacagaa agcggtacac ctctacaaag 4020
gaggtcctgg acgccacact gattcatcag tcaattacgg ggctctatga aacaagaatc 4080
gacctctctc agctcggtgg agac 4104
<210> 20
<211> 705
<212> DNA
<213> Artificial sequence
<400> 20
atccttttgt tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca 60
tacatcggga ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga 120
gatatacaat agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt 180
acactgcctc attgatggtg gtacataacg aactaatact gtagccctag acttgatagc 240
catcatcata tcgaagtttc actacccttt ttccatttgc catctattga agtaataata 300
ggcgcatgca acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca 360
tatccgcaat gacaaaaaaa tgatggaaga cactaaagga aaaaattaac gacaaagaca 420
gcaccaacag atgtcgttgt tccagagctg atgaggggta tctcgaagca cacgaaactt 480
tttccttcct tcattcacgc acactactct ctaatgagca acggtatacg gccttccttc 540
cagttacttg aatttgaaat aaaaaaaagt ttgctgtctt gctatcaagt ataaatagac 600
ctgcaattat taatcttttg tttcctcgtc attgttctcg ttccctttct tccttgtttc 660
tttttctgca caatatttca agctatacca agcatacaat caact 705
<210> 21
<211> 248
<212> DNA
<213> Artificial sequence
<400> 21
tcatgtaatt agttatgtca cgcttacgtt cacgccctcc ccccacatcc gctctaaccg 60
aaaaggaagg agttagacaa cctgaagtct aggtccctat ttattttttt atagttatgt 120
tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac agacgcgtgt 180
acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt 240
taatttgc 248
<210> 22
<211> 76
<212> DNA
<213> Artificial sequence
<400> 22
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60
ggcaccgagt cggtgc 76
<210> 23
<211> 209
<212> DNA
<213> Artificial sequence
<400> 23
agtatactct ttcttcaaca attaaatact ctcggtagcc aagttggttt aaggcgcaag 60
actgtaattt atcactacga aatcttgaga tcgggcgttc gactcgcccc cgggagagat 120
ggccggcatg gtcccagcct cctcgctggc gccggctggg caacaccttc gggtggcgaa 180
tgggactttc acttgtcaaa cagaatata 209
<210> 24
<211> 85
<212> DNA
<213> Artificial sequence
<400> 24
tttttttatt ttttgtcact attgttatgt aaaatgccac ctctgacagt atggaacgca 60
aacttctgtc tagtggatag tcgac 85
Claims (10)
1. A gene is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 4.
2. A gene expression cassette carrying the gene of claim 1.
3. The gene expression cassette according to claim 2, comprising a promoter, the gene according to claim 1, and a terminator, which are connected in this order.
4. A gene expression cassette as claimed in claim 3 wherein the promoter is GAL1p promoter.
5. A gene expression cassette according to claim 3 or 4, wherein the terminator is the ADH1t terminator.
6. A recombinant cell having the gene of claim 1 integrated into its genome or the gene expression cassette of any one of claims 2 to 5 integrated into its genome.
7. The recombinant cell of claim 6, wherein the recombinant cell is derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae)Saccharomyces cerevisiae) Is a host cell.
8. The recombinant cell of claim 7, wherein the gene of claim 1 or the gene expression cassette of any one of claims 2-5 is integrated at position 308a of the s.cerevisiae BY4742 genome.
9. A method for producing mannich, which is characterized in that the recombinant cells of claim 8 are inoculated into a fermentation medium for fermentation to obtain fermentation liquor containing the mannich, and then the fermentation liquor containing the mannich is separated to obtain the mannich; the recombinant cell is the recombinant cell of which the gene expression cassette of any one of claims 2-5 is integrated at the position 308a of the saccharomyces cerevisiae BY4742 genome.
10. Use of the gene of claim 1 or the gene expression cassette of any one of claims 2 to 5 or the recombinant cell of any one of claims 6 to 8 or the method of claim 9 for the production of mannich.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010736326.6A CN111718948B (en) | 2020-07-28 | 2020-07-28 | Gene and application thereof in production of mannich |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010736326.6A CN111718948B (en) | 2020-07-28 | 2020-07-28 | Gene and application thereof in production of mannich |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111718948A CN111718948A (en) | 2020-09-29 |
| CN111718948B true CN111718948B (en) | 2022-02-01 |
Family
ID=72573742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010736326.6A Active CN111718948B (en) | 2020-07-28 | 2020-07-28 | Gene and application thereof in production of mannich |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111718948B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987533A (en) * | 2017-03-23 | 2017-07-28 | 石河子大学 | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone |
| CN109988722A (en) * | 2017-12-29 | 2019-07-09 | 中国科学院天津工业生物技术研究所 | A kind of method of recombinant Saccharomyces cerevisiae bacterial strain and its application and production tyrosol and/or rhodioside |
| CN110628805A (en) * | 2019-09-19 | 2019-12-31 | 天津大学 | Recombinant bacterium for finely regulating expression of saccharomyces cerevisiae ERG7 and construction method |
-
2020
- 2020-07-28 CN CN202010736326.6A patent/CN111718948B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987533A (en) * | 2017-03-23 | 2017-07-28 | 石河子大学 | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone |
| CN109988722A (en) * | 2017-12-29 | 2019-07-09 | 中国科学院天津工业生物技术研究所 | A kind of method of recombinant Saccharomyces cerevisiae bacterial strain and its application and production tyrosol and/or rhodioside |
| CN110628805A (en) * | 2019-09-19 | 2019-12-31 | 天津大学 | Recombinant bacterium for finely regulating expression of saccharomyces cerevisiae ERG7 and construction method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111718948A (en) | 2020-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117602B (en) | Maitake mushroom UDP-glucose pyrophosphorylase and application thereof | |
| CN112195110B (en) | Recombinant aspergillus oryzae strain and kojic acid fermentation method and application thereof | |
| CN111548979B (en) | Recombinant escherichia coli for synthesizing lactoyl N-neotetraose and construction method and application thereof | |
| CN114480240A (en) | Genetic engineering bacterium for producing fucosyllactose and production method thereof | |
| CN113755354B (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof | |
| CN114150012B (en) | Recombinant saccharomyces cerevisiae for heterogeneously synthesizing ginsenoside F2 and construction method thereof | |
| CN109337932B (en) | Method for increasing yield of monascus pigment | |
| TW201437367A (en) | Yeast strain for lactic acid production by using pentose and hexose | |
| CN112501095B (en) | Construction method and application of recombinant escherichia coli for synthesizing 3-fucose | |
| CN112175848B (en) | Yeast strain for producing patchouli alcohol and construction method and application thereof | |
| CN111718948B (en) | Gene and application thereof in production of mannich | |
| CN115948265A (en) | Kluyveromyces marxianus haploid yeast and construction method and application thereof | |
| CN114736918B (en) | Recombinant escherichia coli for producing salidroside by integrated expression and application thereof | |
| CN113817757B (en) | Recombinant yeast engineering strain for producing cherry glycoside and application thereof | |
| CN113249240B (en) | Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof | |
| CN114717124A (en) | Saccharomyces cerevisiae engineering strain for high yield of ergosterol, construction method and application | |
| CN109371053B (en) | Construction method of monascus pigment producing strain | |
| CN112852847A (en) | Recombinant saccharomyces cerevisiae strain and construction method and application thereof | |
| CN114196641B (en) | Steroid C14 alpha hydroxylase, expression vector, engineering bacteria and application thereof | |
| CN112322514B (en) | Method for enhancing tolerance and yield of glycerol-producing candida 2-phenethyl alcohol | |
| CN114634883B (en) | Recombinant engineering bacterium for producing 2' -fucosyllactose and construction method and application thereof | |
| CN114752543B (en) | Gluconobacter oxydans for synthesizing 2-keto-L-gulonic acid by taking glucose as substrate through one-step fermentation and application thereof | |
| CN115322975B (en) | Mutant of enterobacter ludwigii oxidoreductase and application thereof | |
| CN112538437B (en) | Method for improving biosynthesis of pinene through metabolic engineering modification | |
| KR102253701B1 (en) | Hybrid type glycolysis pathway |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |