CN110923230A - sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof - Google Patents
sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof Download PDFInfo
- Publication number
- CN110923230A CN110923230A CN201911080516.0A CN201911080516A CN110923230A CN 110923230 A CN110923230 A CN 110923230A CN 201911080516 A CN201911080516 A CN 201911080516A CN 110923230 A CN110923230 A CN 110923230A
- Authority
- CN
- China
- Prior art keywords
- ndm
- bla
- sgrna
- gene
- crispr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/02—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amides (3.5.2)
- C12Y305/02006—Beta-lactamase (3.5.2.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof, and provides targeted knockout blaNDM‑1The sgRNA sequence of the gene can specifically target blaNDM‑1Genes, and construction thereof into CRISPR/Cas9 vector system, wherein the system can specifically target to knock out blaNDM‑1Gene to obtain a knockout blaNDM‑1Strains of genes, thereby facilitating the study of bla in the strainsNDM‑1The mechanism of action of (c). CRISPR/Cas9 targeted knockout Klebsiella oxytoca blaNDM‑1The gene system can effectively knock out carbapenem drug-resistant genes of strains, and has the advantages of high specificity, simple method and easy popularization.
Description
Technical Field
The invention belongs to the field of genetic engineering, and particularly relates to a sgRNA sequence for targeted knockout of a blaNDM-1 gene, a CRISPR/Cas9 plasmid vector system and application thereof.
Background
In recent years, the drug resistance of bacteria in China is becoming more complex, and new problems are continuously appearing, and the multiple drug-resistant and even pan-drug-resistant bacteria of ESKAPE become important causes of the death of patients caused by infection. The current incidence of carbapenem drug-resistant enterobacteriaceae is dry, the mortality rate caused by infection is high, and the harm is serious. At present, hydrolase production, membrane permeability reduction, outer membrane protein change and deletion of active efflux system overexpression play important roles in drug resistance, and the carbapenem drug resistance genes can mediate bacteria to generate drug resistance to carbapenem which is a 'last-pass' drug.
In 2009, the university of kadifco Timothy r.walsh research team in england discovered for the first time a novel metal β -lactamase in klebsiella pneumoniae that can water release all β -lactam drugs except aztreonam, mediating the strains' tolerance to penicillin, cephalosporin and carbapenem antibiotics, since this strain was isolated from patients who had been treated in the indian capital New delry, researchers named this novel metal β -lactamase as New Delhi metallo- β -lactamase 1, that is, NDM-1, and named blaNDM-1 for the gene encoding NDM-1. strains carrying the blablndm-1 gene were called "NDM super drug-resistant bacteria" which was detected in many strains in our country.
In 1928, the discovery of penicillin thoroughly changes the treatment method of bacterial infection, and scientists have continuously searched for novel antibiotics to solve the problems of various infections and the rise of antibiotic resistance faced by human beings since then, however, the research and development of the novel antibiotics are very difficult, and only two types of novel antibiotics come into the market in the last 40 years; still, scientists continue to move on the way to develop new antibiotics with a great deal of human and financial investment.
The CRISPR-Cas system is an RNA-mediated adaptive immune system, present in about 48% of bacteria and 95% of archaea, and provides sequence-specific protection against foreign DNA and even RNA, and when viral DNA illegally enters bacteria and invades their genome, bacteria use this defense mechanism to kill them. At present, the CRISPR/Cas system has been developed into a high-efficiency gene editing tool, and the application of the system to the field of bacterial drug resistance is still in the primary stage. Therefore, the CRISPR technology has good application prospect in the field of reversing bacterial drug resistance.
Disclosure of Invention
The invention aims to provide a sgRNA sequence for targeted knockout of a blaNDM-1 gene, a CRISPR/Cas9 plasmid vector system and application thereof aiming at the defects of the prior art.
Targeted bla knockout methodNDM-1sgRNA sequence of a gene, the sequence comprising blaNDM-1sgRNA-F and blaNDM- 1sgRNA-R, wherein blaNDM-1sgRNA-F is SEQ ID NO.1, blaNDM-1sgRNA-R is SEQ ID NO. 2.
Targeted bla knockout methodNDM-1The CRISPR/Cas9 plasmid vector system of the gene is the targeted knockout blaNDM-1The sgRNA sequence of the gene and the recombinant expression plasmid vector of the CRISPR/cas9 vector have the sequences as follows: SEQ ID NO. 3.
Targeted bla knockout methodNDM-1The construction method of the CRISPR/Cas9 plasmid vector system of the gene specifically comprises the following steps:
(1) carrying out enzyme digestion on a CRISPR/Cas9 plasmid vector pcas9 by using BamHI to obtain an enzyme digested CRISPR/Cas9 vector;
(2) knocking out the targeted blaNDM-1Bla of sgRNA sequence of GeneNDM-1sgRNA-F and blaNDM- 1Annealing sgRNA-R to obtain a double-stranded DNA sequence, connecting the double-stranded DNA sequence with the enzyme-cut CRISPR/Cas9 plasmid vector to obtain the targeted knockout blaNDM-1CRISPR/Cas9 plasmid vector system of genes.
The CRISPR/Cas9 plasmid vector system is used for targeted knockout of Klebsiella oxytoca blaNDM-1Application of the gene.
The invention has the following beneficial effects:
the sgRNA sequence of the targeted knockout blaNDM-1 gene provided by the invention can specifically target blaNDM-1Genes, and construction thereof into CRISPR/Cas9 vector system, wherein the system can specifically target to knock out blaNDM-1Gene to obtain a knockout blaNDM-1Strains of genes, thereby facilitating the study of bla in the strainsNDM-1The mechanism of action of (c).
CRISPR/Cas9 targeted knockout Klebsiella oxytoca blaNDM-1The gene system can effectively knock out carbapenem drug-resistant genes of strains, and has the advantages of high specificity, simple method and easy popularization.
Drawings
FIG. 1 is a plasmid map of the vector plasmid pcas9 used in the examples of the present invention.
FIG. 2 is a diagram showing the result of PCR in the embodiment of the present invention.
Detailed Description
The present invention will be described in detail below with reference to the accompanying drawings and preferred embodiments, and the objects and effects of the invention will become more apparent. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Targeted knock-out blasNDM-1The principle of sgRNA sequence of the gene is as follows:
providing a sgRNA sequence, the sgRNA being in blaNDM-1The target sequence on the gene conforms to the sequence arrangement rule of 5' -N (19) G, and the sgRNA conforms to the sequence arrangement rule of blaNDM-1The target sequence on the gene is located in a conserved region of the gene, the sgRNA is in blaNDM-1The target sequence on the gene is located in the shared region of different subtypes of the gene, and the sgRNA is located in blaNDM-1The target sequence on the gene is unique, and the sgRNA is in blaNDM-1The sequence of the target site is shown as a sequence of SEQ ID NO.1 in a sequence table, and the sgRNA is positioned on blaNDM-1Adding CACCG sequence to the 5' -end of the target site sequence to synthesize forward oligonucleotide, i.e. Forwardoligo; obtaining sgRNA in blaNDM-1The complementary strand of the target site sequence of (a), and the 5 'end of the complementary strand is added with the 3' end of the AAAC sequenceAdding C, synthesizing to obtain Reverse oligonucleotide, i.e. Reverse oligo.
The Forward oligo and Reverse oligo of the two synthesized complementary sgRNA oligonucleotides are denatured and annealed in pairs, and then a double-stranded sgRNA oligonucleotide that can be ligated into a plasmid vector is formed.
Connecting the annealed double-stranded sgRNA oligonucleotide with a linearized vector pcas9 carrying a Cas9 gene to obtain an expression vector pcas9-CRISPR-NDM plasmid carrying the sgRNA oligonucleotide containing a corresponding target sequence and the Cas9 gene, transforming competent bacteria DH5 α and inoculating the transformed competent bacteria onto a chloramphenicol plate, selecting a monoclonal and performing PCR amplification by using a chloramphenicol drug-resistant gene cat, identifying a positive clone by sequencing, shaking the positive clone, and extracting the plasmid;
transfecting target bacteria by using the plasmid carrying both sgRNA and Cas9, adding chloramphenicol resistance for screening, selecting monoclonal bacteria, extracting genomic DNA, carrying out PCR amplification on a gene fragment containing the target sequence by using the genomic DNA as a template, and confirming bla through whole genome sequencingNDM-1The gene has been knocked out and a knockout bacterium is obtained. The preparation method comprises the following steps:
s1: 10 MHA solid plates containing 25. mu.g/ml chloramphenicol were prepared
S1.1: weighing 7.6 g of Mueller-Hinton Agar (MHA) culture medium, autoclaving at 121 deg.C for 21 min in 200ml distilled water, and placing in 60 deg.C water bath after autoclaving;
s1.2: accurately weighing 0.005g of chloramphenicol into 1ml of ethanol solution with volume fraction ratio of 95 percent to obtain chloramphenicol ethanol solution;
s1.3: the ethanol solution of chloramphenicol prepared in S1.2 was added to 200ml of the MHA culture solution prepared in S1.1, mixed well, and poured into sterile 90 mm-diameter petri dishes, about 20ml each.
S1.4: standing at room temperature for 2h, solidifying MHA culture medium, air drying, and storing at 4 deg.C for use.
S2: making competent bacteria
S2.1: the Columbia blood plate solid culture medium is streaked with target bacteria in 3 zones.
S2.2: weigh 1.9g of Mueller-Hinton (MH) medium in 50ml of distilled water and autoclave for 21 minutes at 121 ℃. After the high pressure is finished, putting the mixture into a refrigerator at 4 ℃ for standby;
s2.3: single colonies were picked in 5ml liquid medium, amplified at 220rpm and 37 ℃ for 12h, and 5. mu.L of the extract was added to 50ml MH liquid medium, amplified at 220rpm and 37 ℃ for 6h to culture bacteria.
S2.4: centrifuging and collecting thalli by using a centrifuge, wherein the centrifuge sets the condition of 5000rpm for 5 minutes;
s2.5: 3ml of double distilled water (ddH) precooled at 4 ℃ was used2O) washing the bacteria and resuspending the bacteria.
S2.6: step S2.5 is repeated.
S2.7: the cells were collected by centrifugation again using the same centrifugation conditions as in S2.4, and the bacteria were washed with 2ml of a 10% glycerol solution by volume and resuspended.
S2.8: step S2.7 is repeated.
S2.9: subpackaging into 1.5ml plastic test tubes, each tube with 100 μ L, and storing at-80 deg.C for use.
S3: constructing pcas9-sgRNA plasmid:
s3.1: synthesis of the following two sgRNA sequences
(1)blaNDM-1sgRNA-F：AAACGCCGCTGCATTGATGCTGAGCGGG
(2)blaNDM-1sgRNA-R:：AAAACCCGCTCAGCATCAATGCAGCGGC
S3.2: according to the concentration of synthesis, ddH is used2The two sequences were diluted to a concentration of 100. mu. mol/l.
S3.3: annealing was performed according to the following conditions to form two sgRNA sequences into one double-stranded sgRNA.
(1) Adding the a, the b and the c into a 0.2ml PCR test tube, heating for 5 minutes at 95 ℃ in a thermal cycler, then placing the PCR test tube on a workbench at room temperature, cooling for 1 hour, and automatically connecting the two sequences into a double-stranded sgRNA;
a.1. mu.l sgRNA-F solution
b.1. mu.l sgRNA-R solution
c.8μl ddH2O
(2) Placing the double-stranded sgRNA annealed in (1) at 4 ℃ for later use.
S3.4: the pcas9 plasmid is digested with Bsal endonuclease, which specifically comprises the following steps:
a system of a-f is prepared and mixed on a centrifuge at low speed for 1000rpn s and 10 s. Then, the plasmid vector is purified by using a DNA purification kit after the water bath is finished for 10 hours at the constant temperature of 37 ℃ and is stored for later use.
S3.5: connecting the enzyme-digested pcas plasmid vector in S3.4 and the double-stranded sgRNA in S3.3 by using T4 DNA ligase, which specifically comprises the following steps:
a system of the following a-e was prepared and mixed on a centrifuge at low speed, 1000rpn, 10 s. Then, the plasmid pcas9-sgRNA was obtained in a thermostatic water bath at 16 ℃ for 10 hours.
S4: the pcas9-sgRNA plasmid was electrically transformed into the target bacteria.
S4.1: the prepared competent bacteria, stored at-80 ℃, were thawed on ice.
S4.2: add 3. mu.l of ligated pcas9-sgRNA plasmid and mix gently. Note that the mixed cells cannot be shaken vigorously.
S4.3: using a Berle electrotransformation apparatus, pcas9-sgRNA plasmid was transferred into competent bacteria (conditions: voltage 1800V)
S4.4: SOC (super Optimal Broth) medium (preincubated at 37 ℃) was added rapidly at 300. mu.l.
S4.5; the culture was carried out at 37 ℃ for 1 hour (200rpm) with shaking.
S4.6: an appropriate amount of 50. mu.l was plated on MHA solid plate medium containing 25. mu.g/ml chloramphenicol.
S4.7: the culture was carried out overnight at 37 ℃.
S5: PCR verification of target Gene knockout
S5.1: selecting single colony cultured by MHA solid culture medium containing 25 microgram/ml of chloramphenicol,
s5.2: the blaNDM-1 gene is amplified by PCR,
s5.3: and detecting the PCR result by using agarose gel electrophoresis after the PCR is finished, adding gelred nucleic acid dye, and obtaining PCR negative by no-band imaging.
S5.4: the PCR negative strain is a knockout strain, and a single colony is selected to be stored in a glycerol broth culture medium with the volume ratio of 30 percent and stored at the temperature of minus 80 ℃ for standby.
FIG. 2 shows the results of PCR in the electrophoresis detection of this example, where M is marker, 1, 3, and 5 are original strains, and 2, 4, and 6 are knockout strains, respectively. The PCR amplified band electrophoresis of the original strain is positive, and the electrophoresis of the knocked-out strain is negative.
S6: drug sensitivity verification
S6.1: the Columbia blood plate solid culture medium is streaked with target bacteria in 3 zones.
S6.2: weighing 7.6 g of Mueller-Hinton Agar (MHA) culture medium, autoclaving at 121 deg.C for 21 min in 200ml distilled water, and placing in 60 deg.C water bath after autoclaving;
s6.3: accurately weighing 5.12mg of meropenem and culturing the meropenem in 2ml of double-distilled water solution to obtain a meropenem solution;
s6.4: the meropenem solution was diluted 2-fold and 10 gradients were diluted.
S6.5 respectively sucking 1ml of meropenem with different concentrations and 19ml of MHA culture medium solution, uniformly mixing, and pouring the mixture into sterile culture dishes with the diameter of 90mm, wherein 20ml of each culture dish is used.
S6.5: standing at room temperature for 2h, allowing MHA medium to solidify, air drying, and preparing into culture medium containing meropenem with different concentrations (mass to volume ratio concentration of 128 μ g/ml,64 μ g/ml,32 μ g/ml,16 μ g/ml,8 μ g/ml,4 μ g/ml,2 μ g/ml,1 μ g/ml,0.5 μ g/ml,0.24 μ g/ml, respectively). And preserving at 4 ℃ for later use.
S6.6 picking up the single colony in the step S6.1 and sterile physiological saline, adjusting the turbidity to be 0.5 McLeod turbidity, diluting by 10 times, sucking 1 mu L of solution and adding the solution into the MHA culture medium with different concentrations.
And S6.737 ℃, culturing overnight for 24h, observing all culture mediums with grown colonies, wherein the minimum concentration of the colonies grown on the culture mediums carrying meropenem is the Minimum Inhibitory Concentration (MIC) of the colonies. And (5) the MIC of the strain after knockout is less than 4 mug/ml, namely the strain after knockout is obtained.
Similarly, the drug sensitivity verification procedure for imipenem and ertapenem is exactly the same as for meropenem. Table 1 shows the sensitivity of the drugs to the three common carbapenem drugs before and after the strain knockout. As can be seen from the results in Table 1, the strains became sensitive to these drugs after the knockdown, and the knockdown was successful.
TABLE 1 susceptibility of drugs to three common carbapenem drugs before and after strain knockout
| Medicine | MIC values before knockdown | Explanation of the invention | MIC value after knock out | Explanation of the invention |
| Imipenem | 16μg/ml | Drug resistance | 0.5μg/ml | Sensitivity of |
| Meropenem | 16μg/ml | Drug resistance | 1μg/ml | Sensitivity of |
| Ertapenem | 16μg/ml | Drug resistance | 1μg/ml | Sensitivity of |
It will be understood by those skilled in the art that the foregoing is only a preferred embodiment of the present invention, and is not intended to limit the invention, and although the invention has been described in detail with reference to the foregoing examples, it will be apparent to those skilled in the art that various changes in the form and details of the embodiments may be made and equivalents may be substituted for elements thereof. All modifications, equivalents and the like which come within the spirit and principle of the invention are intended to be included within the scope of the invention.
Sequence listing
<110> Zhejiang university
<120> sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aaacgccgct gcattgatgc tgagcggg 28
<210>2
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
aaaacccgct cagcatcaat gcagcggc 28
<210>3
<211>9341
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt 60
gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt 120
ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga 180
tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga 240
aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt 300
ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc 360
ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat 420
ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt 480
gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg 540
acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact 600
ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa 660
aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc 720
actgactcgc tacgctcggt cgttcgactg cggcgagcgg aaatggctta cgaacggggc 780
ggagatttcc tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa 840
agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc 900
agtggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc 960
tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc 1020
gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac1080
tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt 1140
gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt 1200
agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg 1260
tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt 1320
cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc 1380
aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca 1440
atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc 1500
atgtttgaca gcttatcatc gataagcttt aatgcggtag tttatcacag ttaaattgct 1560
aacgcagtca ggcaccgtgt atgaaatcta acaatgcgct catcgtcatc ctcggcaccg 1620
tcaccctgga tgctgtaggc ataggcttgg ttatgccggt actgccgggc ctcttgcggg 1680
attacgaaat catcctgtgg agcttagtag gtttagcaag atggcagcgc ctaaatgtag 1740
aatgataaaa ggattaagag attaatttcc ctaaaaatga taaaacaagc gttttgaaag 1800
cgcttgtttt tttggtttgc agtcagagta gaatagaagt atcaaaaaaa gcaccgactc 1860
ggtgccactt tttcaagttg ataacggact agccttattt taacttgcta tgctgttttg 1920
aatggttcca acaagattat tttataactt ttataacaaa taatcaagga gaaattcaaa 1980
gaaatttatc agccataaaa caatacttaa tactatagaa tgataacaaa ataaactact 2040
ttttaaaaga attttgtgtt ataatctatt tattattaag tattgggtaa tattttttga 2100
agagatattt tgaaaaagaa aaattaaagc atattaaact aatttcggag gtcattaaaa 2160
ctattattga aatcatcaaa ctcattatgg atttaattta aactttttat tttaggaggc 2220
aaaaatggat aagaaatact caataggctt agatatcggc acaaatagcg tcggatgggc 2280
ggtgatcact gatgaatata aggttccgtc taaaaagttc aaggttctgg gaaatacaga 2340
ccgccacagt atcaaaaaaa atcttatagg ggctctttta tttgacagtg gagagacagc 2400
ggaagcgact cgtctcaaac ggacagctcg tagaaggtat acacgtcgga agaatcgtat 2460
ttgttatcta caggagattt tttcaaatga gatggcgaaa gtagatgata gtttctttca 2520
tcgacttgaa gagtcttttt tggtggaaga agacaagaag catgaacgtc atcctatttt 2580
tggaaatata gtagatgaag ttgcttatca tgagaaatat ccaactatct atcatctgcg 2640
aaaaaaattg gtagattcta ctgataaagc ggatttgcgc ttaatctatt tggccttagc 2700
gcatatgatt aagtttcgtg gtcatttttt gattgaggga gatttaaatc ctgataatag 2760
tgatgtggac aaactattta tccagttggt acaaacctac aatcaattat ttgaagaaaa 2820
ccctattaac gcaagtggag tagatgctaa agcgattctt tctgcacgat tgagtaaatc 2880
aagacgatta gaaaatctca ttgctcagct ccccggtgag aagaaaaatg gcttatttgg 2940
gaatctcatt gctttgtcat tgggtttgac ccctaatttt aaatcaaatt ttgatttggc 3000
agaagatgct aaattacagc tttcaaaaga tacttacgat gatgatttag ataatttatt 3060
ggcgcaaatt ggagatcaat atgctgattt gtttttggca gctaagaatt tatcagatgc 3120
tattttactt tcagatatcc taagagtaaa tactgaaata actaaggctc ccctatcagc 3180
ttcaatgatt aaacgctacg atgaacatca tcaagacttg actcttttaa aagctttagt 3240
tcgacaacaa cttccagaaa agtataaaga aatctttttt gatcaatcaa aaaacggata 3300
tgcaggttat attgatgggg gagctagcca agaagaattt tataaattta tcaaaccaat 3360
tttagaaaaa atggatggta ctgaggaatt attggtgaaa ctaaatcgtg aagatttgct 3420
gcgcaagcaa cggacctttg acaacggctc tattccccat caaattcact tgggtgagct 3480
gcatgctatt ttgagaagac aagaagactt ttatccattt ttaaaagaca atcgtgagaa 3540
gattgaaaaa atcttgactt ttcgaattcc ttattatgtt ggtccattgg cgcgtggcaa 3600
tagtcgtttt gcatggatga ctcggaagtc tgaagaaaca attaccccat ggaattttga 3660
agaagttgtc gataaaggtg cttcagctca atcatttatt gaacgcatga caaactttga 3720
taaaaatctt ccaaatgaaa aagtactacc aaaacatagt ttgctttatg agtattttac 3780
ggtttataac gaattgacaa aggtcaaata tgttactgaa ggaatgcgaa aaccagcatt 3840
tctttcaggt gaacagaaga aagccattgt tgatttactc ttcaaaacaa atcgaaaagt 3900
aaccgttaag caattaaaag aagattattt caaaaaaata gaatgttttg atagtgttga 3960
aatttcagga gttgaagata gatttaatgc ttcattaggt acctaccatg atttgctaaa 4020
aattattaaa gataaagatt ttttggataa tgaagaaaat gaagatatct tagaggatat 4080
tgttttaaca ttgaccttat ttgaagatag ggagatgatt gaggaaagac ttaaaacata 4140
tgctcacctc tttgatgata aggtgatgaa acagcttaaa cgtcgccgtt atactggttg 4200
gggacgtttg tctcgaaaat tgattaatgg tattagggat aagcaatctg gcaaaacaat 4260
attagatttt ttgaaatcag atggttttgc caatcgcaat tttatgcagc tgatccatga 4320
tgatagtttg acatttaaag aagacattca aaaagcacaa gtgtctggac aaggcgatag 4380
tttacatgaa catattgcaa atttagctgg tagccctgct attaaaaaag gtattttaca 4440
gactgtaaaa gttgttgatg aattggtcaa agtaatgggg cggcataagc cagaaaatat 4500
cgttattgaa atggcacgtg aaaatcagac aactcaaaag ggccagaaaa attcgcgaga 4560
gcgtatgaaa cgaatcgaag aaggtatcaa agaattagga agtcagattc ttaaagagca 4620
tcctgttgaa aatactcaat tgcaaaatga aaagctctat ctctattatc tccaaaatgg 4680
aagagacatg tatgtggacc aagaattaga tattaatcgt ttaagtgatt atgatgtcga 4740
tcacattgtt ccacaaagtt tccttaaaga cgattcaata gacaataagg tcttaacgcg 4800
ttctgataaa aatcgtggta aatcggataa cgttccaagt gaagaagtag tcaaaaagat 4860
gaaaaactat tggagacaac ttctaaacgc caagttaatc actcaacgta agtttgataa 4920
tttaacgaaa gctgaacgtg gaggtttgag tgaacttgat aaagctggtt ttatcaaacg 4980
ccaattggtt gaaactcgcc aaatcactaa gcatgtggca caaattttgg atagtcgcat 5040
gaatactaaa tacgatgaaa atgataaact tattcgagag gttaaagtga ttaccttaaa 5100
atctaaatta gtttctgact tccgaaaaga tttccaattc tataaagtac gtgagattaa 5160
caattaccat catgcccatg atgcgtatct aaatgccgtc gttggaactg ctttgattaa 5220
gaaatatcca aaacttgaat cggagtttgt ctatggtgat tataaagttt atgatgttcg 5280
taaaatgatt gctaagtctg agcaagaaat aggcaaagca accgcaaaat atttctttta 5340
ctctaatatc atgaacttct tcaaaacaga aattacactt gcaaatggag agattcgcaa 5400
acgccctcta atcgaaacta atggggaaac tggagaaatt gtctgggata aagggcgaga 5460
ttttgccaca gtgcgcaaag tattgtccat gccccaagtc aatattgtca agaaaacaga 5520
agtacagaca ggcggattct ccaaggagtc aattttacca aaaagaaatt cggacaagct 5580
tattgctcgt aaaaaagact gggatccaaa aaaatatggt ggttttgata gtccaacggt 5640
agcttattca gtcctagtgg ttgctaaggt ggaaaaaggg aaatcgaaga agttaaaatc 5700
cgttaaagag ttactaggga tcacaattat ggaaagaagt tcctttgaaa aaaatccgat 5760
tgacttttta gaagctaaag gatataagga agttaaaaaa gacttaatca ttaaactacc 5820
taaatatagt ctttttgagt tagaaaacgg tcgtaaacgg atgctggcta gtgccggaga 5880
attacaaaaa ggaaatgagc tggctctgcc aagcaaatat gtgaattttt tatatttagc 5940
tagtcattat gaaaagttga agggtagtcc agaagataac gaacaaaaac aattgtttgt 6000
ggagcagcat aagcattatt tagatgagat tattgagcaa atcagtgaat tttctaagcg 6060
tgttatttta gcagatgcca atttagataa agttcttagt gcatataaca aacatagaga 6120
caaaccaata cgtgaacaag cagaaaatat tattcattta tttacgttga cgaatcttgg 6180
agctcccgct gcttttaaat attttgatac aacaattgat cgtaaacgat atacgtctac 6240
aaaagaagtt ttagatgcca ctcttatcca tcaatccatc actggtcttt atgaaacacg 6300
cattgatttg agtcagctag gaggtgactg aagtatattt tagatgaaga ttatttctta 6360
ataactaaaa atatggtata atactcttaa taaatgcagt aatacagggg cttttcaaga 6420
ctgaagtcta gctgagacaa atagtgcgat tacgaaattt tttagacaaa aatagtctac 6480
gaggttttag agctatgctgttttgaatgg tcccaaaact gagaccaaac gccgctgcat 6540
tgatgctgag cgggcaaagg tctcgtttta gagctatgct gttttgaatg gtcccaaaac 6600
ttcagcacac tgagacttgt tgagttccat gttttagagc tatgctgttt tgaatggact 6660
ccattcaaca ttgccgatga taacttgaga aagagggtta ataccagcag tcggatacct 6720
tcctattctt tctgttaaag cgttttcatg ttataatagg caaaagaaga gtagtgtgat 6780
cgtccattcc gacagcatcg ccagtcacta tggcgtgctg ctagcgctat atgcgttgat 6840
gcaatttcta tgcgcacccg ttctcggagc actgtccgac cgctttggcc gccgcccagt 6900
cctgctcgct tcgctacttg gagccactat cgactacgcg atcatggcga ccacacccgt 6960
cctgtggatc ctctacgccg gacgcatcgt ggccggcatc accggcgcca caggtgcggt 7020
tgctggcgcc tatatcgccg acatcaccga tggggaagat cgggctcgcc acttcgggct 7080
catgagcgct tgtttcggcg tgggtatggt ggcaggcccc gtggccgggg gactgttggg 7140
cgccatctcc ttgcatgcac cattccttgc ggcggcggtg ctcaacggcc tcaacctact 7200
actgggctgc ttcctaatgc aggagtcgca taagggagag cgtcgaccga tgcccttgag 7260
agccttcaac ccagtcagct ccttccggtg ggcgcggggc atgactatcg tcgccgcact 7320
tatgactgtc ttctttatca tgcaactcgt aggacaggtg ccggcagcgc tctgggtcat 7380
tttcggcgag gaccgctttc gctggagcgc gacgatgatc ggcctgtcgc ttgcggtatt 7440
cggaatcttg cacgccctcg ctcaagcctt cgtcactggt cccgccacca aacgtttcgg 7500
cgagaagcag gccattatcg ccggcatggc ggccgacgcg ctgggctacg tcttgctggc 7560
gttcgcgacg cgaggctgga tggccttccc cattatgatt cttctcgctt ccggcggcat 7620
cgggatgccc gcgttgcagg ccatgctgtc caggcaggta gatgacgacc atcagggaca 7680
gcttcaagga tcgctcgcgg ctcttaccag cctaacttcg atcattggac cgctgatcgt 7740
cacggcgatt tatgccgcct cggcgagcac atggaacggg ttggcatgga ttgtaggcgc 7800
cgccctatac cttgtctgcc tccccgcgtt gcgtcgcggt gcatggagcc gggccacctc 7860
gacctgaatg gaagccggcg gcacctcgct aacggattca ccactccaag aattggagcc 7920
aatcaattct tgcggagaac tgtgaatgcg caaaccaacc cttggcagaa catatccatc 7980
gcgtccgcca tctccagcag ccgcacgcgg cgcatctcgg gcagcgttgg gtcctggcca 8040
cgggtgcgca tgatcgtgct cctgtcgttg aggacccggc taggctggcg gggttgcctt 8100
actggttagc agaatgaatc accgatacgc gagcgaacgt gaagcgactg ctgctgcaaa 8160
acgtctgcga cctgagcaac aacatgaatg gtcttcggtt tccgtgtttc gtaaagtctg 8220
gaaacgcgga agtcccctac gtgctgctga agttgcccgc aacagagagt ggaaccaacc 8280
ggtgatacca cgatactatg actgagagtc aacgccatga gcggcctcat ttcttattct 8340
gagttacaac agtccgcacc gctgtccggt agctccttcc ggtgggcgcg gggcatgact 8400
atcgtcgccg cacttatgac tgtcttcttt atcatgcaac tcgtaggaca ggtgccggca 8460
gcgcccaaca gtcccccggc cacggggcct gccaccatac ccacgccgaa acaagcgccc 8520
tgcaccatta tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct 8580
acatctgtat taacgaagcg ctaaccgttt ttatcaggct ctgggaggca gaataaatga 8640
tcatatcgtc aattattacc tccacgggga gagcctgagc aaactggcct caggcatttg 8700
agaagcacac ggtcacactg cttccggtag tcaataaacc ggtaaaccag caatagacat 8760
aagcggctat ttaacgaccc tgccctgaac cgacgaccgg gtcgaatttg ctttcgaatt 8820
tctgccattc atccgcttat tatcacttat tcaggcgtag caccaggcgt ttaagggcac 8880
caataactgc cttaaaaaaa ttacgccccg ccctgccact catcgcagta ctgttgtaat 8940
tcattaagca ttctgccgac atggaagcca tcacagacgg catgatgaac ctgaatcgcc 9000
agcggcatca gcaccttgtc gccttgcgta taatatttgc ccatggtgaa aacgggggcg 9060
aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac ccagggattg 9120
gctgagacga aaaacatatt ctcaataaac cctttaggga aataggccag gttttcaccg 9180
taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc gtggtattca 9240
ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca 9300
ctatcccata tcaccagctc accgtctttc attgccatac g 9341
<210>4
<211>9326
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt 60
gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt 120
ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga 180
tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga 240
aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt 300
ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc 360
ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat 420
ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt 480
gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg 540
acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact 600
ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa 660
aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc 720
actgactcgc tacgctcggt cgttcgactg cggcgagcgg aaatggctta cgaacggggc 780
ggagatttcc tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa 840
agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc 900
agtggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc 960
tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc 1020
gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac 1080
tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt 1140
gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt 1200
agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg 1260
tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt 1320
cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc 1380
aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca 1440
atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc 1500
atgtttgaca gcttatcatc gataagcttt aatgcggtag tttatcacag ttaaattgct 1560
aacgcagtca ggcaccgtgt atgaaatcta acaatgcgct catcgtcatc ctcggcaccg 1620
tcaccctgga tgctgtaggc ataggcttgg ttatgccggt actgccgggc ctcttgcggg 1680
attacgaaat catcctgtgg agcttagtag gtttagcaag atggcagcgc ctaaatgtag 1740
aatgataaaa ggattaagag attaatttcc ctaaaaatga taaaacaagc gttttgaaag 1800
cgcttgtttt tttggtttgc agtcagagta gaatagaagt atcaaaaaaa gcaccgactc 1860
ggtgccactt tttcaagttg ataacggact agccttattt taacttgcta tgctgttttg 1920
aatggttcca acaagattat tttataactt ttataacaaa taatcaagga gaaattcaaa 1980
gaaatttatc agccataaaa caatacttaa tactatagaa tgataacaaa ataaactact 2040
ttttaaaaga attttgtgtt ataatctatt tattattaag tattgggtaa tattttttga 2100
agagatattt tgaaaaagaa aaattaaagc atattaaact aatttcggag gtcattaaaa 2160
ctattattga aatcatcaaa ctcattatgg atttaattta aactttttat tttaggaggc 2220
aaaaatggat aagaaatact caataggctt agatatcggc acaaatagcg tcggatgggc 2280
ggtgatcact gatgaatata aggttccgtc taaaaagttc aaggttctgg gaaatacaga 2340
ccgccacagt atcaaaaaaa atcttatagg ggctctttta tttgacagtg gagagacagc 2400
ggaagcgact cgtctcaaac ggacagctcg tagaaggtat acacgtcgga agaatcgtat 2460
ttgttatcta caggagattt tttcaaatga gatggcgaaa gtagatgata gtttctttca 2520
tcgacttgaa gagtcttttt tggtggaaga agacaagaag catgaacgtc atcctatttt 2580
tggaaatata gtagatgaag ttgcttatca tgagaaatat ccaactatct atcatctgcg 2640
aaaaaaattg gtagattcta ctgataaagc ggatttgcgc ttaatctatt tggccttagc 2700
gcatatgatt aagtttcgtg gtcatttttt gattgaggga gatttaaatc ctgataatag 2760
tgatgtggac aaactattta tccagttggt acaaacctac aatcaattat ttgaagaaaa 2820
ccctattaac gcaagtggag tagatgctaa agcgattctt tctgcacgat tgagtaaatc 2880
aagacgatta gaaaatctca ttgctcagct ccccggtgag aagaaaaatg gcttatttgg 2940
gaatctcatt gctttgtcat tgggtttgac ccctaatttt aaatcaaatt ttgatttggc 3000
agaagatgct aaattacagc tttcaaaaga tacttacgat gatgatttag ataatttatt 3060
ggcgcaaatt ggagatcaat atgctgattt gtttttggca gctaagaatt tatcagatgc 3120
tattttactt tcagatatcc taagagtaaa tactgaaata actaaggctc ccctatcagc 3180
ttcaatgatt aaacgctacg atgaacatca tcaagacttg actcttttaa aagctttagt 3240
tcgacaacaa cttccagaaa agtataaaga aatctttttt gatcaatcaa aaaacggata 3300
tgcaggttat attgatgggg gagctagcca agaagaattt tataaattta tcaaaccaat 3360
tttagaaaaa atggatggta ctgaggaatt attggtgaaa ctaaatcgtg aagatttgct 3420
gcgcaagcaa cggacctttg acaacggctc tattccccat caaattcact tgggtgagct 3480
gcatgctatt ttgagaagac aagaagactt ttatccattt ttaaaagaca atcgtgagaa 3540
gattgaaaaa atcttgactt ttcgaattcc ttattatgtt ggtccattgg cgcgtggcaa 3600
tagtcgtttt gcatggatga ctcggaagtc tgaagaaaca attaccccat ggaattttga 3660
agaagttgtc gataaaggtg cttcagctca atcatttatt gaacgcatga caaactttga 3720
taaaaatctt ccaaatgaaa aagtactacc aaaacatagt ttgctttatg agtattttac 3780
ggtttataac gaattgacaa aggtcaaata tgttactgaa ggaatgcgaa aaccagcatt 3840
tctttcaggt gaacagaaga aagccattgt tgatttactc ttcaaaacaa atcgaaaagt 3900
aaccgttaag caattaaaag aagattattt caaaaaaata gaatgttttg atagtgttga 3960
aatttcagga gttgaagata gatttaatgc ttcattaggt acctaccatg atttgctaaa 4020
aattattaaa gataaagatt ttttggataa tgaagaaaat gaagatatct tagaggatat 4080
tgttttaaca ttgaccttat ttgaagatag ggagatgatt gaggaaagac ttaaaacata 4140
tgctcacctc tttgatgata aggtgatgaa acagcttaaa cgtcgccgtt atactggttg 4200
gggacgtttg tctcgaaaat tgattaatgg tattagggat aagcaatctg gcaaaacaat 4260
attagatttt ttgaaatcag atggttttgc caatcgcaat tttatgcagc tgatccatga 4320
tgatagtttg acatttaaag aagacattca aaaagcacaa gtgtctggac aaggcgatag 4380
tttacatgaa catattgcaa atttagctgg tagccctgct attaaaaaag gtattttaca 4440
gactgtaaaa gttgttgatg aattggtcaa agtaatgggg cggcataagc cagaaaatat 4500
cgttattgaa atggcacgtg aaaatcagac aactcaaaag ggccagaaaa attcgcgaga 4560
gcgtatgaaa cgaatcgaag aaggtatcaa agaattagga agtcagattc ttaaagagca4620
tcctgttgaa aatactcaat tgcaaaatga aaagctctat ctctattatc tccaaaatgg 4680
aagagacatg tatgtggacc aagaattaga tattaatcgt ttaagtgatt atgatgtcga 4740
tcacattgtt ccacaaagtt tccttaaaga cgattcaata gacaataagg tcttaacgcg 4800
ttctgataaa aatcgtggta aatcggataa cgttccaagt gaagaagtag tcaaaaagat 4860
gaaaaactat tggagacaac ttctaaacgc caagttaatc actcaacgta agtttgataa 4920
tttaacgaaa gctgaacgtg gaggtttgag tgaacttgat aaagctggtt ttatcaaacg 4980
ccaattggtt gaaactcgcc aaatcactaa gcatgtggca caaattttgg atagtcgcat 5040
gaatactaaa tacgatgaaa atgataaact tattcgagag gttaaagtga ttaccttaaa 5100
atctaaatta gtttctgact tccgaaaaga tttccaattc tataaagtac gtgagattaa 5160
caattaccat catgcccatg atgcgtatct aaatgccgtc gttggaactg ctttgattaa 5220
gaaatatcca aaacttgaat cggagtttgt ctatggtgat tataaagttt atgatgttcg 5280
taaaatgatt gctaagtctg agcaagaaat aggcaaagca accgcaaaat atttctttta 5340
ctctaatatc atgaacttct tcaaaacaga aattacactt gcaaatggag agattcgcaa 5400
acgccctcta atcgaaacta atggggaaac tggagaaatt gtctgggata aagggcgaga 5460
ttttgccaca gtgcgcaaag tattgtccat gccccaagtc aatattgtca agaaaacaga 5520
agtacagaca ggcggattct ccaaggagtc aattttacca aaaagaaatt cggacaagct 5580
tattgctcgt aaaaaagact gggatccaaa aaaatatggt ggttttgata gtccaacggt 5640
agcttattca gtcctagtgg ttgctaaggt ggaaaaaggg aaatcgaaga agttaaaatc 5700
cgttaaagag ttactaggga tcacaattat ggaaagaagt tcctttgaaa aaaatccgat 5760
tgacttttta gaagctaaag gatataagga agttaaaaaa gacttaatca ttaaactacc 5820
taaatatagt ctttttgagt tagaaaacgg tcgtaaacgg atgctggcta gtgccggaga 5880
attacaaaaa ggaaatgagc tggctctgcc aagcaaatat gtgaattttt tatatttagc 5940
tagtcattat gaaaagttga agggtagtcc agaagataac gaacaaaaac aattgtttgt 6000
ggagcagcat aagcattatt tagatgagat tattgagcaa atcagtgaat tttctaagcg 6060
tgttatttta gcagatgcca atttagataa agttcttagt gcatataaca aacatagaga 6120
caaaccaata cgtgaacaag cagaaaatat tattcattta tttacgttga cgaatcttgg 6180
agctcccgct gcttttaaat attttgatac aacaattgat cgtaaacgat atacgtctac 6240
aaaagaagtt ttagatgcca ctcttatcca tcaatccatc actggtcttt atgaaacacg 6300
cattgatttg agtcagctag gaggtgactg aagtatattt tagatgaaga ttatttctta 6360
ataactaaaa atatggtata atactcttaa taaatgcagt aatacagggg cttttcaaga 6420
ctgaagtcta gctgagacaa atagtgcgat tacgaaattt tttagacaaa aatagtctac 6480
gaggttttag agctatgctg ttttgaatgg tcccaaaact gagaccagtc tcggaagctc 6540
aaaggtctcg ttttagagct atgctgtttt gaatggtccc aaaacttcag cacactgaga 6600
cttgttgagt tccatgtttt agagctatgc tgttttgaat ggactccatt caacattgcc 6660
gatgataact tgagaaagag ggttaatacc agcagtcgga taccttccta ttctttctgt 6720
taaagcgttt tcatgttata ataggcaaaa gaagagtagt gtgatcgtcc attccgacag 6780
catcgccagt cactatggcg tgctgctagc gctatatgcg ttgatgcaat ttctatgcgc 6840
acccgttctc ggagcactgt ccgaccgctt tggccgccgc ccagtcctgc tcgcttcgct 6900
acttggagcc actatcgact acgcgatcat ggcgaccaca cccgtcctgt ggatcctcta 6960
cgccggacgc atcgtggccg gcatcaccgg cgccacaggt gcggttgctg gcgcctatat 7020
cgccgacatc accgatgggg aagatcgggc tcgccacttc gggctcatga gcgcttgttt 7080
cggcgtgggt atggtggcag gccccgtggc cgggggactg ttgggcgcca tctccttgca 7140
tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac ctactactgg gctgcttcct 7200
aatgcaggag tcgcataagg gagagcgtcg accgatgccc ttgagagcct tcaacccagt 7260
cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc gcacttatga ctgtcttctt 7320
tatcatgcaa ctcgtaggac aggtgccggc agcgctctgg gtcattttcg gcgaggaccg 7380
ctttcgctgg agcgcgacga tgatcggcct gtcgcttgcg gtattcggaa tcttgcacgc 7440
cctcgctcaa gccttcgtca ctggtcccgc caccaaacgt ttcggcgaga agcaggccat 7500
tatcgccggc atggcggccg acgcgctggg ctacgtcttg ctggcgttcg cgacgcgagg 7560
ctggatggcc ttccccatta tgattcttct cgcttccggc ggcatcggga tgcccgcgtt 7620
gcaggccatg ctgtccaggc aggtagatga cgaccatcag ggacagcttc aaggatcgct 7680
cgcggctctt accagcctaa cttcgatcat tggaccgctg atcgtcacgg cgatttatgc 7740
cgcctcggcg agcacatgga acgggttggc atggattgta ggcgccgccc tataccttgt 7800
ctgcctcccc gcgttgcgtc gcggtgcatg gagccgggcc acctcgacct gaatggaagc 7860
cggcggcacc tcgctaacgg attcaccact ccaagaattg gagccaatca attcttgcgg 7920
agaactgtga atgcgcaaac caacccttgg cagaacatat ccatcgcgtc cgccatctcc 7980
agcagccgca cgcggcgcat ctcgggcagc gttgggtcct ggccacgggt gcgcatgatc 8040
gtgctcctgt cgttgaggac ccggctaggc tggcggggtt gccttactgg ttagcagaat 8100
gaatcaccga tacgcgagcg aacgtgaagc gactgctgct gcaaaacgtc tgcgacctga 8160
gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa gtctggaaac gcggaagtcc 8220
cctacgtgct gctgaagttg cccgcaacag agagtggaac caaccggtga taccacgata 8280
ctatgactga gagtcaacgc catgagcggc ctcatttctt attctgagtt acaacagtcc 8340
gcaccgctgt ccggtagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt 8400
atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgcc caacagtccc 8460
ccggccacgg ggcctgccac catacccacg ccgaaacaag cgccctgcac cattatgttc 8520
cggatctgca tcgcaggatg ctgctggcta ccctgtggaa cacctacatc tgtattaacg 8580
aagcgctaac cgtttttatc aggctctggg aggcagaata aatgatcata tcgtcaatta 8640
ttacctccac ggggagagcc tgagcaaact ggcctcaggc atttgagaag cacacggtca 8700
cactgcttcc ggtagtcaat aaaccggtaa accagcaata gacataagcg gctatttaac 8760
gaccctgccc tgaaccgacg accgggtcga atttgctttc gaatttctgc cattcatccg 8820
cttattatca cttattcagg cgtagcacca ggcgtttaag ggcaccaata actgccttaa 8880
aaaaattacg ccccgccctg ccactcatcg cagtactgtt gtaattcatt aagcattctg 8940
ccgacatgga agccatcaca gacggcatga tgaacctgaa tcgccagcgg catcagcacc 9000
ttgtcgcctt gcgtataata tttgcccatg gtgaaaacgg gggcgaagaa gttgtccata 9060
ttggccacgt ttaaatcaaa actggtgaaa ctcacccagg gattggctga gacgaaaaac 9120
atattctcaa taaacccttt agggaaatag gccaggtttt caccgtaaca cgccacatct 9180
tgcgaatata tgtgtagaaa ctgccggaaa tcgtcgtggt attcactcca gagcgatgaa 9240
aacgtttcag tttgctcatg gaaaacggtg taacaagggt gaacactatc ccatatcacc 9300
agctcaccgt ctttcattgc catacg 9326
Claims (4)
1. Targeted bla knockout methodNDM-1sgRNA sequence of a gene, the sequence comprising blaNDM-1sgRNA-F and blaNDM- 1sgRNA-R, wherein blaNDM-1sgRNA-F is SEQ ID NO.1, blaNDM-1sgRNA-R is SEQ ID NO. 2.
2. Targeted bla knockout methodNDM-1A CRISPR/Cas9 plasmid vector system of genes, which is the targeted knockout bla of claim 1NDM-1The sgRNA sequence of the gene and the recombinant expression plasmid vector of the CRISPR/cas9 vector have the sequences as follows: SEQ ID NO. 3.
3. Targeted bla knockout methodNDM-1The construction method of the CRISPR/Cas9 plasmid vector system of the gene is characterized by comprising the following steps:
(1) and (3) carrying out enzyme digestion on the CRISPR/Cas9 plasmid vector pcas9 by using BamHI to obtain the enzyme digested CRISPR/Cas9 vector.
(2) The method of claim 1Targeted knock-out blasNDM-1Bla of sgRNA sequence of GeneNDM-1sgRNA-F and blaNDM- 1Annealing sgRNA-R to obtain a double-stranded DNA sequence, connecting the double-stranded DNA sequence with the enzyme-cut CRISPR/Cas9 plasmid vector to obtain the targeted knockout blaNDM-1CRISPR/Cas9 plasmid vector system of genes.
4. The CRISPR/Cas9 plasmid vector system of claim 2 for targeted knockout of Klebsiella oxytoca blaNDM-1Application of the gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911080516.0A CN110923230A (en) | 2019-11-07 | 2019-11-07 | sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911080516.0A CN110923230A (en) | 2019-11-07 | 2019-11-07 | sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110923230A true CN110923230A (en) | 2020-03-27 |
Family
ID=69853655
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911080516.0A Pending CN110923230A (en) | 2019-11-07 | 2019-11-07 | sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923230A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103310104A (en) * | 2013-06-14 | 2013-09-18 | 浙江大学 | Drug resistance monitoring system for bacteria |
| CN107208070A (en) * | 2014-11-26 | 2017-09-26 | 技术创新动力基金（以色列）有限合伙公司 | The targeting of bacterial gene is eliminated |
| CN107384926A (en) * | 2017-08-13 | 2017-11-24 | 中国人民解放军疾病预防控制所 | A kind of CRISPR Cas9 systems for targetting bacteria removal Drug Resistance Plasmidss and application |
| CN108949797A (en) * | 2018-07-26 | 2018-12-07 | 昆明医科大学第附属医院 | Enterobacter cloacae blaNDM-1The method and application of gene knockout |
-
2019
- 2019-11-07 CN CN201911080516.0A patent/CN110923230A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103310104A (en) * | 2013-06-14 | 2013-09-18 | 浙江大学 | Drug resistance monitoring system for bacteria |
| CN107208070A (en) * | 2014-11-26 | 2017-09-26 | 技术创新动力基金（以色列）有限合伙公司 | The targeting of bacterial gene is eliminated |
| CN107384926A (en) * | 2017-08-13 | 2017-11-24 | 中国人民解放军疾病预防控制所 | A kind of CRISPR Cas9 systems for targetting bacteria removal Drug Resistance Plasmidss and application |
| CN108949797A (en) * | 2018-07-26 | 2018-12-07 | 昆明医科大学第附属医院 | Enterobacter cloacae blaNDM-1The method and application of gene knockout |
Non-Patent Citations (4)
| Title |
|---|
| JEFFREY R. STRICH等: "CRISPR-Cas Biology and Its Application to Infectious Diseases", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| LIU YANG等: "Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria", 《NATURE COMMUNICATIONS》 * |
| 姜童童: "代谢工程改造产酸克雷伯氏菌生产丙酮酸", 《万方学位论文数据库》 * |
| 王祖华等: "部分发酵类肠杆菌科细菌耐药性及耐碳青霉烯类基因检测分析", 《中国病原生物学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106318934B (en) | Gene complete sequence of carrot β (1,2) xylose transferase and plasmid construction of CRISPR/CAS9 for transfecting dicotyledonous plants | |
| CN106755091A (en) | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods | |
| CN109161480B (en) | Preparation method and gene knockout method of protoplast of phomopsis | |
| CN110241249B (en) | Primer and method for rapidly detecting pathogen of agaricus bisporus wart spongiform in covering soil | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN111849979A (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| Ianiri et al. | Approaches for genetic discoveries in the skin commensal and pathogenic Malassezia yeasts | |
| Zhang et al. | Development of an Agrobacterium-mediated transformation system for the cold-adapted fungi Pseudogymnoascus destructans and P. pannorum | |
| CN101979598B (en) | Method for constructing HSV-1 BAC system carrying luciferase report genes | |
| CN110079470B (en) | Pseudomonas with antibacterial activity | |
| CN108148866A (en) | A kind of HCBP6 Knockout cells system and its construction method | |
| CN110016519B (en) | Banana fusarium wilt bacterium No. 4 physiological race DCL gene deletion mutant and small RNA thereof | |
| CN106939320A (en) | A kind of 2012 plants of infective cloned plasmids of Pseudorabies virus JS, construction method and application | |
| CN110923230A (en) | sgRNA sequence for targeted knockout of blaNDM-1 gene and application thereof | |
| CN114107304B (en) | Recombinant coccidium vector for expressing alpha toxin protein and fluorescent tag protein and detection method thereof | |
| Rita Costa et al. | Synthetic biology to engineer bacteriophage genomes | |
| CN104894081A (en) | Alkaline thermal-stability SGNH family esterase EstD1 and gene thereof | |
| TWI643951B (en) | Gene editing system of synechococcus elongates pcc 7942 and application thereof | |
| CN1989255A (en) | Reduction of spontaneous mutation rates in cells | |
| CN102839190A (en) | Method for shortening plant cell suspension culture period | |
| CN106939317A (en) | It is a kind of to improve the method that plant resists the ability of RNA virus | |
| CN114277053A (en) | Application of rice susceptibility gene OsHPP04 in cultivation of root-knot nematode resistant rice | |
| CN105177049B (en) | A kind of method of transformed bacillus Bacillus strain | |
| JP6979484B2 (en) | Recombinant microorganisms for producing 2,3-butanediol and methods for producing 2,3-butanediol | |
| WO2019237391A1 (en) | Crispr/cas9 targeted knockout of human txgp1 gene and specific grna thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200327 |
|
| RJ01 | Rejection of invention patent application after publication |