CN109682973B - Tumor detection method and kit based on nucleic acid aptamer - Google Patents

Tumor detection method and kit based on nucleic acid aptamer Download PDF

Info

Publication number
CN109682973B
CN109682973B CN201910001280.0A CN201910001280A CN109682973B CN 109682973 B CN109682973 B CN 109682973B CN 201910001280 A CN201910001280 A CN 201910001280A CN 109682973 B CN109682973 B CN 109682973B
Authority
CN
China
Prior art keywords
aptamer
alkaline phosphatase
kit
cells
expressing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910001280.0A
Other languages
Chinese (zh)
Other versions
CN109682973A (en
Inventor
上官棣华
邴涛
沈璐瑶
汪俊彦
肖潇
刘祥军
张楠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Chemistry CAS
Original Assignee
Institute of Chemistry CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Chemistry CAS filed Critical Institute of Chemistry CAS
Priority to CN201910001280.0A priority Critical patent/CN109682973B/en
Priority to PCT/CN2019/072749 priority patent/WO2019149115A1/en
Priority to US16/967,102 priority patent/US20200362349A1/en
Publication of CN109682973A publication Critical patent/CN109682973A/en
Application granted granted Critical
Publication of CN109682973B publication Critical patent/CN109682973B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57411—Specifically defined cancers of cervix
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966—Animal cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57438—Specifically defined cancers of liver, pancreas or kidney

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a tumor detection method and a kit based on a nucleic acid aptamer. The invention provides a kit, which comprises a nucleic acid aptamer or a derivative thereof and a carrier for fixing or coupling the nucleic acid aptamer or the derivative thereof, wherein the nucleic acid aptamer is a single-stranded DNA molecule shown in a sequence 1. The invention relates to a method for capturing and detecting circulating tumor cells, exosomes and free alkaline phosphatase with high expression of alkaline phosphatase in peripheral blood based on a nucleic acid aptamer magnetic nanoparticle technology, which can realize high-selectivity capture and detection of target cells, exosomes or free proteins. The magnetic nano-particles can play a role in size amplification, are used for enrichment, and can also be used for magnetic separation to realize high-efficiency capture. The target object obtained by separation is visually detected by utilizing the enzyme reaction of the alkaline phosphatase and the chromogenic substrate, so that the signal amplification is realized, and the sensitivity is improved.

Description

Tumor detection method and kit based on nucleic acid aptamer
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a tumor detection method and a tumor detection kit based on an aptamer.
Background
Alkaline phosphatase (ALP or AKP) is an enzyme widely distributed in human liver, bone, intestine, kidney, placenta and other tissues and excreted to the outside of the gallbladder through the liver, can directly participate in phosphorus metabolism, and plays an important role in the processes of calcium and phosphorus digestion, absorption, secretion and ossification. This enzyme catalyzes the removal of the 5' phosphate group from the nucleic acid molecule, thereby converting the 5' -P terminus of the DNA or RNA fragment to a 5' -OH terminus. It is not a single enzyme, but a group of isoenzymes. Currently known human isoenzymes include: tissue non-specific alkaline phosphatase (TNAP), Intestinal Alkaline Phosphatase (IAP), placental alkaline phosphatase (PALP) and placental-like alkaline phosphatase (GCAP). The alkaline phosphatase in serum of normal serum is mainly from liver and bone, and the determination of alkaline phosphatase is mainly used for diagnosing diseases of liver, gall and bone systems, and is an important index for reflecting extrahepatic biliary obstruction, intrahepatic space occupying lesion and rickets.
The alkaline phosphatase heterodimer is highly expressed in tumor tissues of colorectal cancer, breast cancer, hepatocellular carcinoma, cervical cancer and the like. Free alkaline phosphatase heterodimers, exosomes containing alkaline phosphatase heterodimers, or circulating tumor cells can be released into the bloodstream from a primary tumor or metastatic focus. Thus, detection of free alkaline phosphatase heterodimers, exosomes or circulating tumor cells would be useful for early diagnosis and screening of tumors, monitoring recurrence and metastasis of postoperative patient tumors, assessing sensitivity to anti-tumor drugs and patient prognosis, and selecting strategies for individualized treatment.
Circulating tumor cells refer to tumor cells in which malignant tumors spread during development and survive in peripheral blood, and are closely related to tumor metastasis and prognosis. The detection of the circulating tumor cells refers to a method for analyzing the circulating tumor cells in peripheral blood of a tumor patient, the detection of the circulating tumor cells in the peripheral blood is the most direct and important method for indicating tumor metastasis, and the method has important significance in the aspects of clinical diagnosis, prognosis judgment, curative effect monitoring and the like of early tumor metastasis. The discovery of circulating tumor cells is expected to change the current situation that the clinic still depends on imaging examination and traditional tumor markers. Since the number of circulating tumor cells in peripheral blood is extremely rare, extremely high demands are placed on the sensitivity and selectivity of the detection technique. At present, a plurality of methods are used for detecting the circulating tumor cells, the circulating tumor cells are firstly obtained by separating and enriching methods such as a density gradient centrifugation method, a cell filtration or adhesion technology, an immunomagnetic bead separation technology, a microfluidic chip technology and the like, and then the circulating tumor cells are detected by an immunocytochemistry technology, a reverse transcription polymerase chain reaction, a flow cytometry and the like. Currently, the only approved method for detecting circulating tumor cells by the U.S. Food and Drug Administration (FDA) is the CellSearch system, which can capture and detect circulating tumor cells, but still further improve the sensitivity and specificity, and achieve fast, simple and high throughput of the method.
The exosome is a nano-scale lipid inclusion structure with the diameter of 30-100nm, and substances such as protein, mRNA, microRNA and the like are wrapped inside the exosome. Almost all types of cells, including tumor cells, can produce and release exosomes. Exosomes are secreted and released by cells, spread in body fluids such as blood and finally phagocytosed by other cells, and are important mediators of intercellular communication. More and more researches show that exosomes secreted by host cells or tumor cells are involved in tumorigenesis, growth, invasion and metastasis, and the detection and research of exosomes are receiving more and more attention.
Disclosure of Invention
It is an object of the present invention to provide a kit.
The kit provided by the invention comprises the nucleic acid aptamer or the derivative thereof and a carrier for fixing or coupling the nucleic acid aptamer or the derivative thereof,
the aptamer or the derivative thereof is any one of the following 1) to 7):
1) a single-stranded DNA molecule shown in sequence 1;
2) deleting or adding one or more nucleotides to the aptamer shown in 1) to obtain a derivative of the aptamer with the same function as the aptamer;
3) carrying out nucleotide substitution or modification on the aptamer shown in 1) to obtain a derivative of the aptamer with the same function as the aptamer;
4) transforming the skeleton of the aptamer shown in 1) into a phosphorothioate skeleton to obtain a derivative of the aptamer with the same function as the aptamer;
5) an RNA molecule coded by the aptamer shown in 1) to obtain an aptamer derivative with the same function as the aptamer;
6) peptide nucleic acid encoded by the aptamer shown in 1), and obtaining a derivative of the aptamer with the same function as the aptamer;
7) adding a signal molecule and/or an active molecule and/or a functional group and/or a radionuclide to one or more ends of the aptamer shown in 1) to 6) to obtain a derivative of the aptamer having the same function as the aptamer.
In the above-mentioned kit, the kit further comprises,
the kit has at least one function of the following 1) to 4):
1) detecting or capturing the tumor or tumor cell expressing or highly expressing alkaline phosphatase in a sample to be detected;
2) detecting or capturing circulating tumor cells expressing or highly expressing alkaline phosphatase in a sample to be detected;
3) detecting or capturing exosomes expressing or highly expressing alkaline phosphatase in a sample to be detected;
4) detecting or capturing soluble alkaline phosphatase in a test sample;
or, the derivative of the aptamer is 1-7 nucleotides of which the nucleotide sequence of the aptamer shown in the sequence 1 is removed or changed and comprises the first nucleotide residue at the 5 'end from the 1 st nucleotide at the 5' end; and/or, removing 1-7 nucleotides of the nucleotide sequence of the aptamer shown in the sequence 1, wherein the 1 st nucleotide from the 3 'end comprises the first nucleotide residue from the 3' end;
or the derivative of the aptamer is the aptamer formed by adding a plurality of nucleotides or modification groups to the 5 'end or the 3' end of the aptamer nucleotide sequence shown in the sequence 1 without influencing the structure formed at the 10 th to 36 th positions of the sequence 1and reserving nucleotide residues.
In the above-mentioned kit, the kit further comprises,
the derivative of the aptamer is any one of the following 1) to 6):
1) a single-stranded DNA molecule shown in sequence 2;
2) a single-stranded DNA molecule shown in sequence 3;
3) a single-stranded DNA molecule shown in sequence 4;
4) a single-stranded DNA molecule shown in sequence 5;
5) a single-stranded DNA molecule shown in sequence 6;
6) a single-stranded DNA molecule shown in sequence 7.
In the above-mentioned kit, the kit further comprises,
7) the aptamer derivative is characterized in that the 5 'end or the 3' end of any aptamer shown in 1) -6) is labeled with a fluorescent group, a biotin group or a radionuclide.
In the above-mentioned kit, the kit further comprises,
the carrier for fixing or coupling the aptamer or the derivative thereof is a nano-particle, a micro-particle or a chip. The carrier in the embodiment is magnetic nanoparticles, the surface of the carrier is provided with streptavidin modified magnetic nanoparticles (200nm) with superparamagnetism, the size amplification effect is achieved, the carrier can also be used for magnetic separation operation, and high-efficiency capture is achieved. The magnetic balls are not limited to the magnetic balls, and may be a substrate such as a chip.
The immobilized or coupled nucleic acid aptamer or derivative thereof is coupled by covalent coupling, hydrophobic interaction or intermolecular interaction, in this example, streptavidin and biotin are involved in the coupling.
In the above-mentioned kit, the kit further comprises,
the nano particles are nano/micro particles modified by modifiers;
the modifier is streptavidin, carboxyl, amino or sulfhydryl.
In the above-mentioned kit, the kit further comprises,
the tumor or the tumor cell expressing or highly expressing the alkaline phosphatase is a human cervical cancer cell, a human breast cancer cell, a human colorectal cancer cell or a human hepatocellular carcinoma cell;
or the circulating tumor cell expressing or highly expressing the alkaline phosphatase is a human cervical cancer circulating tumor cell, a human breast cancer circulating tumor cell, a human colorectal cancer circulating tumor cell or a human hepatocellular carcinoma circulating tumor cell.
In the above-mentioned kit, the kit further comprises,
the kit further comprises a chromogenic substrate that reacts with alkaline phosphatase;
the chromogenic substrate is a fluorescent substrate molecule, a chemiluminescent substrate molecule or a visible light-emitting substrate molecule or other alkaline phosphatase substrate. The present embodiments relate to disodium p-nitrophenylphosphate (pNPP), which reacts with alkaline phosphatase to produce p-nitrophenol, which is yellow under alkaline conditions and can be detected at an absorbance of 405 nm. It also relates to the blue-purple precipitate produced by the reaction of BCIP/NBT with alkaline phosphatase.
The kit also comprises erythrocyte lysate and a magnetic separation frame; if the sample to be detected is whole blood, the sample to be detected comprises erythrocyte lysate, and if the sample to be detected is serum or plasma or saliva, the lysate is not needed.
The kit or the nucleic acid aptamer or the derivative thereof, and a carrier for fixing or coupling the nucleic acid aptamer or the derivative thereof are applied to the preparation of products for capturing and/or detecting tumors or tumor cells expressing or highly expressing alkaline phosphatase in a sample to be detected;
or the kit or the aptamer or the derivative thereof, and a carrier for fixing or coupling the aptamer or the derivative thereof in preparation of a product for capturing and/or detecting circulating tumor cells expressing or highly expressing alkaline phosphatase in a sample to be detected;
or the kit or the aptamer or the derivative thereof, and a carrier for fixing or coupling the aptamer or the derivative thereof in preparation of a product for capturing and/or detecting an exosome expressing or highly expressing alkaline phosphatase in a sample to be detected;
or the kit or the nucleic acid aptamer or the derivative thereof and the application of the carrier for fixing or coupling the nucleic acid aptamer or the derivative thereof in preparing a product for capturing and/or detecting the soluble alkaline phosphatase in a sample to be detected.
Or the nucleic acid aptamer or the derivative thereof and the application of the carrier for fixing or coupling the nucleic acid aptamer or the derivative thereof in preparing a product for capturing and/or detecting circulating tumor cells in a sample to be detected;
the sample to be detected corresponding to the circulating tumor cells expressing or highly expressing alkaline phosphatase is peripheral blood whole blood;
the sample to be detected corresponding to the exosome expressing or highly expressing alkaline phosphatase is peripheral blood serum or plasma;
the sample to be tested corresponding to the free protein expressing or highly expressing alkaline phosphatase is peripheral blood serum or plasma, or saliva.
The invention provides a method for capturing and/or detecting whether a sample to be detected contains tumor cells expressing or highly expressing alkaline phosphatase, which comprises the following steps:
1) preparing aptamer magnetic nanoparticles and removing red blood cells of peripheral blood whole blood of a sample to be detected;
the nucleic acid aptamer magnetic nanoparticles are prepared by coupling the streptavidin-modified magnetic nanoparticles with the biotin-labeled alkaline phosphatase nucleic acid aptamers to obtain nucleic acid aptamer magnetic nanoparticles;
2) combining the whole blood sample with the erythrocyte-removed peripheral blood with the aptamer magnetic nanoparticles, then carrying out magnetic separation, and removing non-specific cells to obtain a product containing circulating tumor cells;
3) detecting the product containing the circulating tumor cells, and judging whether the sample to be detected contains the tumor cells expressing or highly expressing the alkaline phosphatase by detecting the circulating tumor cells.
The method for detecting the product containing the circulating tumor cells comprises the following steps A or B:
A. the product containing the circulating tumor cells is stained and developed by pNPP, and then the absorbance is detected; taking the comparison nucleic acid aptamer sequence as a comparison, and if the absorbance value of the sample is different from that of the comparison nucleic acid aptamer sequence after capture, determining that the sample to be detected contains or is candidate to contain tumor cells expressing or highly expressing alkaline phosphatase; if the absorbance value is not different from the absorbance value obtained after the capture of the control sequence, the sample to be detected does not contain or is candidate to contain tumor cells expressing or highly expressing alkaline phosphatase;
B. observing the product containing the circulating tumor cells by a microscope after BCIP/NBT staining, wherein if cells with bluish purple precipitates on the surface are observed, the sample to be detected contains or is candidate to contain tumor cells containing the expressed or high-expressed alkaline phosphatase; if there are no superficial bluish purple cells, the test sample does not contain or is not candidate to contain tumor cells that express or highly express alkaline phosphatase.
The invention provides a method for capturing and/or detecting whether a sample to be detected contains an exosome expressing or highly expressing alkaline phosphatase, which comprises the following steps:
1) preparing nucleic acid aptamer magnetic nanoparticles and collecting tumor cell exosomes of a sample to be detected;
the nucleic acid aptamer magnetic nanoparticles are prepared by coupling the streptavidin-modified magnetic nanoparticles with the biotin-labeled alkaline phosphatase nucleic acid aptamers to obtain nucleic acid aptamer magnetic nanoparticles;
the tumor cell exosome for collecting the sample to be detected is a tumor cell exosome collected from serum or plasma of the sample to be detected;
2) combining the exosome with the aptamer magnetic nanoparticle, then performing magnetic separation, and removing non-specific cells to obtain an exosome-containing product;
3) detecting the product containing the exosome, and judging whether the sample to be detected contains tumor cells expressing or highly expressing alkaline phosphatase by detecting the product containing the exosome.
The method for detecting the product containing the exosome is A or B as follows:
A. coloring the product containing the exosome by pNPP (pNPP), and then detecting the absorbance; taking the comparison nucleic acid aptamer sequence as a comparison, and if the absorbance value of the sample is different from that of the comparison nucleic acid aptamer sequence after capture, determining that the sample to be detected contains or is candidate to contain an exosome expressing or highly expressing alkaline phosphatase; if the absorbance value is not different from the absorbance value obtained after the capture of the control sequence, the sample to be detected does not contain or is candidate to contain exosomes of expressed or high-expressed alkaline phosphatase;
B. observing the product by a microscope after BCIP/NBT staining, and if the surface of the product is observed to have a bluish purple precipitate, determining that the sample to be detected contains or is candidate to contain an exosome of the expression or high expression alkaline phosphatase; if there is no bluish purple precipitate, the test sample contains no or candidate exosomes expressing or highly expressing alkaline phosphatase.
The invention provides a method for capturing and/or detecting whether the free protein of a sample to be detected contains alkaline phosphatase, which comprises the following steps:
1) preparing aptamer magnetic nanoparticles and collecting free protein of a sample to be detected;
the nucleic acid aptamer magnetic nanoparticles are prepared by coupling the streptavidin-modified magnetic nanoparticles with the biotin-labeled alkaline phosphatase nucleic acid aptamers to obtain nucleic acid aptamer magnetic nanoparticles;
the free protein of the sample to be detected is collected from serum or plasma of the sample to be detected;
2) combining the free protein with the aptamer magnetic nanoparticles, and then performing magnetic separation to remove non-specific protein to obtain a product containing the free protein;
3) detecting the product containing the free protein, and judging whether the free protein of the sample to be detected contains alkaline phosphatase or not by detecting the product containing the free protein.
The method for detecting the product containing the free protein comprises the following steps A or B:
A. the product containing the free protein is dyed and developed by pNPP, and then the absorbance is detected; taking the reference nucleic acid aptamer sequence as a reference, and if the absorbance value of the sample is different from that of the reference nucleic acid aptamer sequence after capture, determining that the free protein of the sample to be detected contains or is candidate to contain alkaline phosphatase; if the absorbance value is not different from the absorbance value obtained after the capture of the control sequence, the free protein of the sample to be detected does not contain or candidate does not contain alkaline phosphatase;
B. the product is developed by fluorescein diphosphate, then the fluorescence of the product is measured, if the generation of the fluorescence is observed, the free protein of the sample to be measured contains or is candidate to contain alkaline phosphatase; if no fluorescence or no obvious fluorescence is generated, the free protein of the sample to be detected does not contain or does not contain the candidate alkaline phosphatase.
Wherein the alkaline phosphatase is an alkaline phosphatase heterodimer; in particular IAP/PALP or IAP/GCAP heterodimers.
The method for capturing and detecting the circulating tumor cells highly expressing alkaline phosphatase in peripheral blood based on the aptamer magnetic particle technology can realize the high-selectivity capture and detection of target cells. The magnetic particles can play a role in size amplification, are used for enriching circulating tumor cells, and can also be used for magnetic separation to realize high-efficiency capture. The circulating tumor cells obtained by separation are visually detected by utilizing the enzyme reaction of the alkaline phosphatase and a chromogenic substrate, so that the signal amplification is realized, and the sensitivity is improved. The capturing and detecting method does not need complex modification and operation processes, has simple steps, high efficiency, rapidness and low cost, and can be used for detecting clinical samples. The captured tumor cells can be used for further culture or gene detection, etc.
Drawings
FIG. 1 shows the binding of aptamer BG2 following knockdown of placental type alkaline phosphatase (PALP) and intestinal type alkaline phosphatase (IAP), respectively.
FIG. 2 shows the binding of aptamer BG2 after the expression of placental alkaline phosphatase (PALP), Intestinal Alkaline Phosphatase (IAP), Germ Cell Alkaline Phosphatase (GCAP) or their heterodimeric proteins on the cell surface of PC-3.
FIG. 3 is a diagram of an aptamer capture heterodimer.
FIG. 4 shows the competition of aptamer 1 with its derivatives 2-7.
FIG. 5 shows the result of capturing and detecting target cells by aptamer magnetic nanoparticles.
FIG. 6 shows the result of capturing and detecting target cells in nonspecific cells by aptamer magnetic nanoparticles.
FIG. 7 shows the result of capturing and detecting target cells in human whole blood by the aptamer magnetic nanoparticles.
FIG. 8 shows the results of capture and microscopic examination of target cells by aptamer magnetic nanoparticles in human whole blood.
FIG. 9 shows the result of capture and microscopic examination of target cells by aptamer magnetic nanoparticles in exosomes.
FIG. 10 shows the results of detection of soluble alkaline phosphatase by aptamer magnetic nanoparticles.
FIG. 11 shows the results of detection of soluble alkaline phosphatase in cell culture medium by aptamer glycospheres.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The biotin-labeled alkaline phosphatase aptamers in the following examples were synthesized by Shanghai Biotechnology, Inc., wherein the alkaline phosphatase aptamers were of the following sequence: CAAGGAATAGGGGTCGGTGTGGG TGGTTATGATTGGCTTCCTTG, biotin or Fluorescein (FAM) labeling at the 5' end of the alkaline phosphatase aptamer;
the control aptamer sequences were as follows: TTTgTATCTATCtaTCaGcaGTCTCTATGTTCTAtCTAT TTCCTaTTT, biotin is labeled at the 5' end of the control aptamer.
The streptavidin-modified magnetic nanoparticles in the following examples are a product of Xiamen Borui Meger Biotech Co., Ltd at a concentration of 10 mg/mL.
Human colorectal cancer cells (LoVo) in the following examples were purchased from the cell bank of the culture collection committee of the national academy of sciences, and human prostate cancer cells (PC3) and human acute T cell leukemia cells (Jurkat) were purchased from the cell resource center of the institute of basic medicine of the national academy of medical sciences.
PBS buffer in the following examples: containing 12mM NaH2PO4、8mM Na2HPO4122mM NaCl and 5mM KCl, the remainder being water.
PBST buffer in the following examples: containing 12mM NaH2PO4、8mM Na2HPO4122mM NaCl, 5mM KCl, and 0.01% (v/v, volume percent) Tween-80, the balance being water.
The following examplesBinding buffer of (1): containing 12mM NaH2PO4、8mM Na2HPO4122mM NaCl, 5mM KCl, 1 ug/ml bovine serum albumin, 0.1 ug/ml herring sperm DNA and 0.01% (v/v, volume percent) Tween-80, and the balance water.
Working buffer in the following examples (pH 9.5): containing 100mM Tris-HCl, 100mM NaCl and 5mM MgCl2。
The erythrocyte lysate in the following examples is a product of Roche, Catalogue No. 11814389001.
The following examples of p-nitrophenylphosphate disodium salt hexahydrate (pNPP), 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP), and nitrotetrazolium chloride (NBT), are available from Prochloraz technology, Inc. under the product catalog numbers 254303, 338560, and 151804, respectively. Fluorescein Diphosphate (FDP) is a product of Thermo Fisher Scientific, Inc., under the product designation F2999.
The red blood cell lysate of the following examples is a product of the sigma aldrich trade company ltd, catalog No. 11814389001.
Example 1 study of binding of aptamer BG2 to alkaline phosphatase heterodimer
Preparation of aptamer BG2 and derivatives thereof
1. Synthesis of aptamer BG2
The aptamer BG2 was synthesized by a DNA synthesizer, and the nucleotide sequence of the aptamer BG2 was as follows: 5'-CAAGGAATAGGGGTCGGTGTGGGTGGTTATGATTGGCTTCCTTG-3' (SEQ ID NO: 1), the aptamer BG2 can be labeled with different molecules as required. In this example, Fluorescein (FAM) or a biotin-labeled aptamer BG2 containing a disulfide bond was selected.
2. And (3) DNA deprotection: deprotecting with cold ammonia, and then dissolving the DNA in a TEAA solution;
3. DNA purification: purifying by PAGE or high performance liquid chromatography;
4. and (3) DNA drying: concentrating and drying by centrifugation;
5. the concentration of the dissolved solution is measured for later use.
The nucleotide sequence of the derivative of aptamer BG2 can be shown as sequence 2-sequence 7 respectively.
Secondly, preparation of fluorescein labeled aptamer BG2 solution (BG2-FAM)
1. Fluorescein-labeled aptamer BG2-FAM
The fluorescein-labeled aptamer BG2 is obtained by coupling a fluorescein group FAM at the 5' end of aptamer BG2, BG2-FAM is dissolved by a binding buffer solution, the concentration (200nM) is calibrated according to ultraviolet absorption, then the mixture is heated at 95 ℃ for 5min, placed on ice for 5min, and placed at room temperature for 15 min.
2. Preparation of fluorescein-labeled control nucleic acid sequence solution (L45-FAM) (200nM)
The fluorescein-labeled control nucleic acid sequence L45(L45-FAM) was obtained by coupling a fluorescein group FAM to the 5' -end of the control nucleic acid sequence L45, dissolving L45-FAM in a binding buffer, calibrating the concentration (100nM) based on the UV absorption, heating at 95 ℃ for 5min, standing on ice for 5min, and standing at room temperature for 15 min.
Nucleotide sequence of control nucleic acid sequence L45: TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN are provided.
Alkaline phosphatase knock-down assay
1. One day before transfection, about 3X 105Individual LoVo cells were seeded in 6-well plates containing 2mL of FBS and double antibody 1640 medium.
2. When the cells grow to 70-90%, 2mL of a double-antibody-free 1640 complete culture medium is replaced.
3. According to
Figure BDA0001933647610000081
Description of the RNAimax reagent (Cat. No.: 13778-075) 40pmol of siRNA (wherein the siRNA for ALPI is ALPI-homo-1288, sense sequence (5 '-3'): GCAAAGCCUACACGUCCAUTT, antisense sequence (5 '-3'): AUGGACGUGUAGGCUUUGCTT; the siRNA for PALP is PALP-homo-947, sense sequence (5 '-3'): GAGACAUGAAAUACGAGAUTT, antisense sequence (5 '-3'): AUCUCGUAUUUCAUGUCUCTT) was added to 125. mu.l of serum-free Opti-MEM medium and mixed well。
4、8μL
Figure BDA0001933647610000091
125. mu.L of serum-free Opti-MEM medium was added to the RNAImax reagent and mixed well.
5. Respectively mixing the diluted 2 kinds of alkaline phosphatase siRNA with
Figure BDA0001933647610000092
RNAiMAX reagent 1: 1, mixing and blending, and standing at room temperature for 5 minutes.
6. 250 μ L of siRNA and
Figure BDA0001933647610000093
the RNAiMAX mixture is added to the wells of a plate containing cells and medium and the plate is shaken back and forth.
7. Cells in CO2The culture was carried out in an incubator at 37 ℃ for 72 hours.
8. After digesting the cells into a monodisperse cell suspension with 5mM EDTA in PBS, the cells were washed 2 times with the washing buffer. Then respectively adding 200nM BG2 into the cells, incubating the mixed solution on ice for 30min, washing twice with a washing buffer solution, sieving with a 400-mesh sieve, and detecting by an up-flow cytometer; another part of the cells were incubated for 30min with 10. mu.g/mL anti-IAP antibody (cat # GTX60746, GeneTex) or 10ug/mL anti-PALP antibody (cat # MA1-20245, Thermo Fisher Scientific), washed once, incubated for 30min with 4. mu.g/mL anti-mouse m-IgG kappa BP-PE antibody (sc-516141), washed once, resuspended, and examined by flow cytometry.
The results are shown in figure 1, and the binding of aptamer BG2 to the target cell LoVo was decreased after knockdown with sirna for IAP protein (siiap) or sirna for PALP protein (sipalp), respectively.
IV, alkaline phosphatase overexpression experiment
1. One day before transfection, about 4X 105Individual PC-3 cells were seeded in 6-well plates containing 2mL of FBS and double-antibody 1640 medium.
2. When the cells grow to 80-90%, 2mL of a double-antibody-free 1640 complete culture medium is replaced.
3. According to
Figure BDA0001933647610000094
3000 reagents (cat # L3000008) instructions that 3ug of IAP, PALP or GCAP plasmids (IAP (P09923, ID of uniprot database gene) and PALP (P05187, ID of uniprot database gene) sequences were inserted between the Xho1and EcoR1 cleavage sites of pCMV-myc vector; GCAP (P10696, ID of uniprot database gene) sequences were inserted between the Xho1and BamH1 cleavage sites of pcDNA3.1(-) vector) and 5ul of P3000 were added to 125. mu.l of serum-free Opti-MEM mediumTMAnd (5) uniformly mixing the reagents.
4、5μL
Figure BDA0001933647610000095
The reagent 3000 was diluted with 125. mu.L of serum-free Opti-MEM medium and mixed well.
5. Mixing the diluted plasmids with
Figure BDA0001933647610000096
3000 reagent 1: 1, mixing and blending, and standing at room temperature for 5 minutes.
6. 250 μ L of plasmid and
Figure BDA0001933647610000097
3000 the reagent mixture is added to the wells of a culture plate containing cells and medium and the cell culture plate is shaken back and forth.
7. Cells in CO2The culture was carried out in an incubator at 37 ℃ for 48 hours.
8. After digesting the cells into a monodisperse cell suspension with 5mM EDTA in PBS, the cells were washed 2 times with the washing buffer. Then respectively adding 200nM BG2 into the cells, incubating the mixed solution on ice for 30min, washing twice with a washing buffer solution, sieving with a 400-mesh sieve, and detecting by an up-flow cytometer; another part of the cells were incubated for 30min with 10. mu.g/mL anti-IAP antibody (cat # GTX60746, GeneTex) or 10ug/mL anti-PALP antibody (cat # MA1-20245, Thermo Fisher Scientific), washed once, incubated for 30min with 4. mu.g/mL anti-mouse m-IgG kappa BP-PE antibody (sc-516141), washed once, resuspended, and examined by flow cytometry.
As shown in FIG. 2, after negative cells were transfected with the PALP, IAP or GCAP plasmids, respectively, their proteins were expressed on the cell membrane surface as measured by their antibodies, but aptamer BG2 was not yet bound to the cells, and only when the IAP and PALP proteins or the IAP and GCAP proteins were expressed simultaneously, the aptamer was able to bind to BG 2. It is shown that the aptamer BG2 can bind to IAP/PALP or IAP/GCAP heterodimers.
Alkaline phosphatase in situ crosslinking-Capture experiment
1. Take 5X 106LOVO cells in exponential growth phase were digested with PBS containing 5mM EDTA and washed 2 times with PBS solution.
2. 200nM of the double-stranded biotin-labeled BG2 sequence was added and incubated on ice for 30 min.
3. Then 25. mu.L of 100mM of the double cross-linker disuccinimidyl suberate (DSS, Thermo Fisher Scientific) was added and incubated on ice.
4. After 2h incubation, the crosslinking reaction was stopped by adding 25. mu.L of 1M Tris-HCl buffer (pH 7.0).
5. After washing with PBS 2 times, 0.3mL of cell lysate (Sigma Co.) was added to lyse the cells.
6. The precipitate was removed by centrifugation at 2000rpm, the supernatant was collected, and streptavidin-modified agarose beads (GE, cat # 17-5113-01) were added thereto, followed by incubation for 1 hour to extract the target protein.
7. The above extract was denatured by adding 4 XSDS loading buffer (Bio-Rad) at 60 ℃ for 10 min.
8. Then separated by 6% SDS-PAGE.
9. The membrane was transferred to PVDF membrane ((Millipore, Inc.), and then blocked with 5% skim milk (Shanghai Producer) and 0.1% Tween-20 in PBS for 1h at room temperature.
10. 1:5000 of anti-IAP antibody (ab186422, Abcam) or anti-PALP antibody (ab133602, Abcam) was added to the cells, respectively, and incubated overnight at 4 ℃.
11. The membrane was washed 5 times with PBST, and HRP-labeled secondary antibody (1:5000 dilution, Santa corporation) was added and incubated at room temperature for 1 hour.
12. The membrane was washed 5 times with PBST, and SuperSignal West Femto Maximum Sensitivity Substrate reagent (Thermo Fisher Scientific) was added and imaged with a full-automatic chemiluminescence image analysis system (Tianneng).
As shown in FIG. 3, the aptamer can capture in situ cross-linked alkaline phosphatase heterodimers.
The above experiments indicate that the aptamer BG2 can bind to IAP/PALP or IAP/GCAP heterodimers.
Sixth, competitive assay of aptamer BG2 with its derivatives
A dish of colorectal cancer cells LoVo in the logarithmic growth phase was digested into a monodisperse cell suspension with PBS containing 0.2% EDTA. The fluorescein-labeled aptamer BG2(BG2-FAM, 100nM) was mixed with the unlabeled fluorescent molecule BG2 aptamer or its derivative (SEQ ID Nos. 2-7) (4. mu.M), respectively, and about 5X 10 was added4And (4) obtaining a mixed solution by LoVo cells, incubating the mixed solution on ice for 30min, washing twice by using a washing buffer solution, sieving by using a 400-mesh sieve, and detecting by using an up-flow cytometer.
As a result, as shown in fig. 4, both the unlabeled fluorescent BG2 aptamer (seq id No. 1) and representative derivatives thereof (seq id nos. 2-7) were able to compete with the fluorescein-labeled BG2 aptamer, indicating that the derivative of BG2 has the same function as the BG2 aptamer.
Example 2 aptamer magnetic nanoparticle Capture and detection of target cells
The method comprises the following steps:
target cell capture:
(1) preparation of magnetic nanoparticles coupled with BG2 aptamer
Adding 1 mu L of streptavidin modified magnetic nanoparticles (200nm) with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin labeled BG2 aptamer solution (the solvent is PBS) into 1mL of PBST buffer solution, shaking and incubating for 30min at room temperature, carrying out magnetic separation for 1min, washing for 2 times with the PBST buffer solution, and carrying out magnetic separation to obtain magnetic nanoparticles coupled with BG2 aptamer, namely the aptamer magnetic nanoparticles.
(2) Incubation of aptamer magnetic nanoparticles with cells:
after the cultured LoVo cells are digested by EDTA, the cells are washed for 2 times by PBST buffer solution, different numbers of the cells (25, 50, 100, 200, 400 and 600) are taken, 1mL of binding buffer solution is added, 10 mu L of the nucleic acid aptamer magnetic nanoparticles in the step (1) are added, and the mixture is incubated for 30min at 4 ℃ with shaking.
(3) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation to further remove nonspecific cells, washing the product for 2 times by using a PBST buffer solution, and performing magnetic separation to obtain the required circulating tumor cells.
(II) detecting target cells:
to the circulating tumor cells obtained in the above (one), 10. mu.L of a chromogenic substrate pNPP was added in a working buffer, and the mixture was incubated at 37 ℃ for 2 hours and then the absorbance was measured at 405nm with a microplate reader (SpectraMax M5). The result of establishing a positive correlation between the absorbance and the number of cells is shown in FIG. 5 a. As can be seen from FIG. 5a, the absorbance increases with the increase of the number of cells, and a positive correlation is formed, which proves the feasibility of the method, and the detection limit is 5 cells.
Or the circulating tumor cells obtained in the above (one) were directly observed under a microscope, and the results are shown in FIG. 5 (b). The target cell LoVo cell surface is wrapped by the aptamer magnetic nanoparticles as can be seen in FIG. 5(b), demonstrating the effectiveness of the capture method.
Example 3 capture and detection of aptamer magnetic nanoparticles in non-specific cells
Target cell capture:
(1) preparation of magnetic nanoparticles coupled with BG2 aptamer:
and (3) taking 1 mu L of streptavidin-modified 200nm magnetic nanoparticles with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin-labeled BG2 aptamer, performing shaking incubation for 30min at room temperature in 1mL of PBST buffer solution, performing magnetic separation for 1min, washing for 2 times with the PBST buffer solution, and collecting the precipitate to obtain the aptamer magnetic nanoparticles.
(2) Incubation of aptamer magnetic nanoparticles with cells:
taking cultured LoVo cells, digesting the cells by EDTA, washing the cells for 2 times by PBST buffer solution, and taking different numbers of cells; get 106Cultured Jurkat cells or PC3 cells were centrifuged and washed 2 times with PBST buffer, 1mL of binding buffer was added, LoVo cells were added to Jurkat cells or PC3 cells, 10. mu.L of the above aptamer magnetic nanoparticles were added, and incubated with shaking at 4 ℃ for 30 min.
(3) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation to further remove nonspecific cells, washing the product for 2 times by using a PBST buffer solution, and performing magnetic separation to obtain the required circulating tumor cells.
(II) detecting target cells:
to the circulating tumor cells obtained in the above (a), 10 μ L of chromogenic substrate pNPP was added, the mixture was incubated at 37 ℃ for 2 hours in a working buffer, the absorbance was measured at 405nm with a microplate reader (SpectraMax M5), and the capture rate (%): absorbance value resulting from the reaction of the captured cells with the chromogenic substrate/absorbance value resulting from the reaction of the pure cells with the chromogenic substrate × 100) was calculated.
The results are shown in FIG. 6a at 10650, 100, 500 and 1000 target cells LoVo are added into each nonspecific cell Jurkat cell, and the obtained capture rate is about 90 percent.
Or the circulating tumor cell obtained in the step (one) is directly placed under a microscope for observation, and the result is shown in fig. 6b, and it can be seen that after the LoVo cell (blue after being dyed by the dye 4', 6-diamidino-2-phenylindole) and the PC3 cell (green after being dyed by the dye fluorescein diacetate) are mixed, the aptamer magnetic nanoparticles are wrapped on the surface of the LoVo cell, and the non-magnetic nanoparticles on the surface of the non-specific cell PC 3. The specificity of the method was demonstrated.
Example 4 capture and detection of target cells in human Whole blood by aptamer magnetic nanoparticles
Target cell capture:
(1) the streptavidin-modified magnetic nanoparticles were coupled to recognition BG2 aptamers:
and (3) taking 1 mu L of streptavidin-modified 200nm magnetic nanoparticles with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin-labeled BG2 aptamer, performing shaking incubation for 30min at room temperature in 1mL of PBST buffer solution, performing magnetic separation for 1min, and washing for 2 times with the PBST buffer solution to obtain the aptamer magnetic nanoparticles.
(2) Incubation of aptamer magnetic nanoparticles with cells:
taking cultured LoVo cells, digesting with EDTA, washing with PBST buffer solution for 2 times, taking different numbers of cells, adding LoVo cells into 1mL of whole blood, adding 2mL of erythrocyte lysate, gently blowing and uniformly mixing, cracking at room temperature for 10min, centrifuging for 5min at 500g, discarding red supernatant, repeating for 1-2 times if incomplete erythrocyte lysis is found, washing with PBST buffer solution for 2 times, retaining sediment as cells, adding 1mL of binding buffer solution into the sediment, adding 10 mu L of the nucleic acid aptamer magnetic nanoparticles, and shaking and incubating at 4 ℃ for 30 min.
(3) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation to further remove nonspecific cells, washing the product for 2 times by using a PBST buffer solution, and performing magnetic separation to obtain the required circulating tumor cells.
(II) detecting target cells:
to the circulating tumor cells obtained in the above (a), 10 μ L of chromogenic substrate pNPP was added, the mixture was incubated at 37 ℃ for 2 hours in a working buffer, the absorbance was measured at 405nm with a microplate reader (SpectraMax M5), and the capture rate (%): absorbance value resulting from the reaction of the captured cells with the chromogenic substrate/absorbance value resulting from the reaction of the pure cells with the chromogenic substrate × 100) was calculated.
As shown in FIG. 7, when 200, 500, and 1000 target cells LoVo were added to 1mL of whole blood, the trapping rate was 85% or more. The method is proved to be effective for capturing and detecting in human whole blood samples.
Example 5 capture of aptamer magnetic nanoparticles in human Whole blood and microscopy of target cells
BCIP/NBT working fluid in the following examples: BCIP concentration of 50mg/mL is dissolved in 100% dimethylformamide, NBT concentration of 50mg/mL is dissolved in 70% dimethylformamide, 4 muL NBT is added into each 1mL of working buffer solution, 4 muL BCIP is added after mixing uniformly, mixing uniformly again, the reagent is used within 1h after being prepared, and after the reaction with alkaline phosphatase, a bluish purple precipitate is generated.
Target cell capture:
(1) the streptavidin-modified magnetic nanoparticles were coupled to recognition BG2 aptamers:
and taking 1 mu L of streptavidin modified 200nm magnetic nanoparticles (combined with biotin labeled oligonucleotides 300pmol/mg) with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin labeled BG2 aptamer, shaking and incubating for 30min at room temperature in 1mL of PBST buffer solution, carrying out magnetic separation for 1min, and washing for 2 times with the PBST buffer solution to obtain the aptamer magnetic nanoparticles.
(2) Incubation of aptamer magnetic nanoparticles with cells:
taking cultured LoVo cells, digesting with EDTA, washing with PBST buffer solution for 2 times, adding 50 LoVo cells into 1mL of whole blood, adding 2mL of erythrocyte lysate, gently blowing and uniformly mixing, lysing at room temperature for 10min, centrifuging for 5min at 500g, discarding red supernatant, repeating for 1-2 times if incomplete erythrocyte lysis is found, washing with PBST buffer solution for 2 times, adding 1mL of binding buffer solution, adding 10 mu L of the nucleic acid aptamer magnetic nanoparticles, and shaking and incubating at 4 ℃ for 30 min.
After the cultured LoVo cells are digested by EDTA, the cells are washed for 2 times by PBST buffer solution, 10 LoVo cells are added into 1mL of serum or plasma, the nucleic acid aptamer magnetic nanoparticles are added, and the cells are incubated for 30min at 4 ℃ with shaking.
(4) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation to further remove nonspecific cells, washing the product for 2 times by using a PBST buffer solution, and performing magnetic separation to obtain the required circulating tumor cells.
(II) detecting target cells:
and (3) adding 10 mu L of BCIP/NBT working solution into the circulating tumor cells obtained in the step (I), standing and incubating at room temperature for 30min, and directly placing under a microscope for observation.
As shown in FIG. 8, in FIG. 8(a), the circulating tumor cells obtained by capturing whole blood, in FIG. 8(b), the circulating tumor cells obtained by capturing plasma, and in FIG. 8(c), the circulating tumor cells obtained by capturing serum, it can be seen that after the circulating tumor cells highly expressed by alkaline phosphatase react with BCIP/NBT, bluish purple deposits are generated on the cell surface, and no obvious phenomenon appears in the white blood cells, thus proving that the method is expected to realize the microscopic examination of the actual sample. Therefore, the method with high efficiency, high selectivity and rapid capture is expected to be used for detecting circulating tumor cells in clinical samples, thereby being beneficial to early diagnosis and prognosis evaluation of cancers.
The result shows that the aptamer and the magnetic nanoparticles can be used for detecting whether the sample to be detected contains circulating tumor cells, and the kit for detection comprises the following substances:
the magnetic nanoparticle modified by streptavidin and the BG2 aptamer marked by biotin, wherein the nucleotide of the BG2 aptamer is a sequence 1 in a sequence table;
other substances used for capturing circulating tumor cells, such as PBST buffer solution, binding buffer solution, erythrocyte lysate and magnetic separation frame;
other substances for the detection of circulating tumor cells are also included, such as for example dyes which bind alkaline phosphatase (e.g.chromogenic substrate pNPP or BCIP/NBT), fluorescent substrates, spectrophotometers or microscopes.
The detection method comprises the following specific steps:
1) coupling the streptavidin-modified magnetic nanoparticles with the biotin-labeled BG2 aptamer to obtain aptamer magnetic nanoparticles;
2) combining a sample to be detected with the aptamer magnetic nanoparticles, then carrying out magnetic separation, and removing non-specific cells to obtain a product containing circulating tumor cells;
3) detecting the product containing the circulating tumor cells to capture and/or detect the circulating tumor cells in the sample to be detected.
The method for detecting the product containing the circulating tumor cells comprises the following steps A or B:
A. the product containing the circulating tumor cells is stained and developed by pNPP, and then the absorbance is detected; taking the comparison nucleic acid aptamer sequence as a comparison, and if the absorbance value is different from the absorbance value of the comparison nucleic acid aptamer sequence after capture, determining that the sample to be detected contains or is candidate to contain the circulating tumor cells; if the absorbance value is not different from the absorbance value obtained after the capture of the control sequence, the sample to be detected does not contain or candidate does not contain circulating tumor cells;
B. observing the product containing the circulating tumor cells by using a microscope after BCIP/NBT staining, wherein if cells with bluish purple precipitates on the surface are observed, the sample to be detected contains or is candidate to contain the circulating tumor cells; if the sample does not contain superficial bluish purple cells, the sample does not contain circulating tumor cells or the candidate does not contain circulating tumor cells.
Example 6 capture and detection of exosomes by aptamer magnetic nanoparticles
(I) capture of exosomes:
(1) the streptavidin-modified magnetic nanoparticles were coupled to recognition BG2 aptamers:
and (3) taking 1 mu L of streptavidin-modified 200nm magnetic nanoparticles with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin-labeled BG2 aptamer, performing shaking incubation for 30min at room temperature in 1mL of PBST buffer solution, performing magnetic separation for 1min, and washing for 2 times with the PBST buffer solution to obtain the aptamer magnetic nanoparticles.
(2) Preparation of exosomes
The exosome is prepared by a commonly used ultra-high speed centrifugation method, LoVo cells are cultured in a culture medium normally containing serum, after the cell density reaches 70-80%, the original culture medium is removed and replaced by a serum-free culture medium, after the culture is continued for 48 hours, cell supernatant is collected, 800 Xg is centrifuged for 10 minutes at 4 ℃, the supernatant is carefully sucked, 2000 Xg is centrifuged for 20 minutes at 4 ℃, the supernatant is collected, 10000 Xg is centrifuged for 30 minutes at 4 ℃, the supernatant is collected, the cells or cell debris are completely removed, the supernatant is centrifuged for 120000 Xg and 120 minutes at 4 ℃, the supernatant is discarded, PBS buffer solution is used for resuspension and precipitation, 120000 Xg is centrifuged for 120 minutes at 4 ℃, and 200 mu L of PBS buffer solution is used for dispersing the obtained exosome.
(3) Incubating aptamer magnetic nanoparticles with exosomes: and (3) adding 1mL of binding buffer solution into the exosomes obtained in the step (2) with different concentrations (0.25, 0.5, 1, 2, 4 and 8 mu g/mL), adding the aptamer magnetic nanoparticles in the step (1), and performing shaking incubation at 4 ℃ for 30 min.
(4) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation, washing for 2 times by using PBS (phosphate buffer solution), and obtaining the required exosome after magnetic separation.
(II) detecting exosome:
10 μ L of chromogenic substrate pNPP was added to the exosomes obtained in the above (one) and incubated in working buffer at 37 ℃ for 2h, absorbance was measured at 405nm with an enzyme-linked immunosorbent assay (SpectraMax M5), and a positive correlation was established between the absorbance and the exosome concentration, with the results shown in FIG. 9. As can be seen from FIG. 9, the absorbance value increases with the increase of the exosome concentration, and a positive correlation is formed, so that the feasibility of the method is proved, and the detection limit is 0.03 mu g/mL.
Example 7 free protein detection of plasma/serum samples from tumor patients
(one) capture of free protein:
(1) the streptavidin-modified magnetic nanoparticles were coupled to recognition BG2 aptamers:
and taking 1 mu L of streptavidin modified 200nm magnetic nanoparticles (combined with biotin labeled oligonucleotides 300pmol/mg) with the concentration of 10mg/mL and 10 mu L of 1 mu M biotin labeled BG2 aptamer, shaking and incubating for 30min at room temperature in 1mL of PBST buffer solution, carrying out magnetic separation for 1min, and washing for 2 times with the PBST buffer solution to obtain the aptamer magnetic nanoparticles.
(2) Aptamer magnetic nanoparticles were incubated with human serum/plasma samples:
alkaline phosphatase (10, 20, 40, 80, 160U/L) was added to 1mL of the binding buffer, the aptamer magnetic nanoparticles (1) were added, and incubation was performed with shaking at 4 ℃ for 30 min.
In 1mL serum/plasma sample, the aptamer magnetic nanoparticles of (1) above were directly added and incubated with shaking at 4 ℃ for 30 min.
(4) Magnetic separation:
and (3) placing the incubated product on a magnetic separation frame for magnetic separation to further remove non-specific protein, washing for 2 times by using a PBST buffer solution, and obtaining the required cell soluble alkaline phosphatase after magnetic separation.
(II) detection of soluble alkaline phosphatase:
10. mu.L of a chromogenic substrate pNPP was added to the soluble alkaline phosphatase obtained in the above (I) and incubated at 37 ℃ for 2 hours in a working buffer, the absorbance was measured at 405nm with a microplate reader (SpectraMax M5), and a positive correlation was established between the absorbance and the concentration of the soluble alkaline phosphatase, and the results are shown in FIG. 10. As can be seen from FIG. 10, the absorbance value increases with the increase of the concentration of the soluble alkaline phosphatase, and the absorbance value is in a positive correlation relationship, thereby proving the feasibility of the method, and the detection limit is 2.4U/L.
The absorbance value measured for 1mL of the serum/plasma sample was substituted into the above standard curve to obtain a concentration of 155U/L of soluble alkaline phosphatase in the serum/plasma.
Example 8 detection of free alkaline phosphatase heterodimer protein in cell culture Medium
(1) 1mL of culture medium of LOVO cells in exponential growth phase and 1mL of culture solution of PC-3 cells in exponential growth phase are respectively taken, centrifuged at 1000rpm for 5min to remove cell debris, and respectively shake-incubated with 10nM biotin-labeled BG2 aptamer or biotin-labeled control nucleic acid sequence (4 ℃) for 30 min.
(2) Then, 10. mu.L of streptavidin-modified agarose microspheres (GE, cat # 17-5113-01) were added thereto, and incubated at 4 ℃ for 60 minutes with shaking.
(3) The supernatant was removed by centrifugation at 2000rpm and washed 2 times with PBST buffer.
(4) To the soluble alkaline phosphatase obtained above, 10. mu.L of a chromogenic substrate pNPP was added in a working buffer, and the mixture was incubated at 37 ℃ for 2 hours and then the absorbance was measured at 405nm with a microplate reader (SpectraMax M5), as shown in FIG. 11 a.
Alternatively, 100. mu.L of 10. mu.M fluorescein diphosphate was added to the product obtained in (3) and incubated at 37 ℃ for 1 hour with standing, and the emission at 530nm was measured by excitation at 488nm using a microplate reader (SpectraMax M5), as shown in FIG. 11 b.
As can be seen from FIG. 11, alkaline phosphatase was captured in the culture broth of the alkaline phosphatase-expressing cell line (LoVo), but not in the culture broth of the negatively expressing cell (PC 3). This demonstrates that the method can be used for capture and detection of free alkaline phosphatase heterodimers in real samples.
Sequence listing
<110> chemical research institute of Chinese academy of sciences
<120> aptamer-based tumor detection method and kit
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 44
<212> DNA
<213> Artificial sequence
<400> 1
caaggaatag gggtcggtgt gggtggttat gattggcttc cttg 44
<210> 2
<211> 86
<212> DNA
<213> Artificial sequence
<400> 2
acgctcggat gccactacag tcaaggaata ggggtcggtg tgggtggtta tgattggctt 60
ccttgtctca tggacgtgct ggtgac 86
<210> 3
<211> 27
<212> DNA
<213> Artificial sequence
<400> 3
ggggtcgg tgtgggtggt tatgattgg 27
<210> 4
<211> 44
<212> DNA
<213>Artificial sequence
<400> 4
taagaaatag gggtcggtgt gggtggttat gattggcttt ctta 44
<210> 5
<211> 44
<212> DNA
<213> Artificial sequence
<400> 5
gataacatag gggtcggtgt gggtggttat gattggctgt tatc 44
<210> 6
<211> 44
<212> DNA
<213>Artificial sequence
<400> 6
caaggaatag gggtcggtgt gggtggttat gattggcttc cttg 44
<210> 7
<211> 30
<212> DNA
<213> Artificial sequence
<400> 7
taggggtcgg tgtgggtggt tatgattggc 30

Claims (9)

1. A kit comprising an aptamer or a derivative thereof and, immobilized or coupled to said aptamer or derivative thereof, a carrier,
the aptamer or the derivative thereof is any one of the following 1) to 7):
1) a single-stranded DNA molecule shown in sequence 1;
2) a single-stranded DNA molecule shown in sequence 2;
3) a single-stranded DNA molecule shown in sequence 3;
4) a single-stranded DNA molecule shown in sequence 4;
5) a single-stranded DNA molecule shown in sequence 5;
6) a single-stranded DNA molecule shown in sequence 6;
7) a single-stranded DNA molecule shown in sequence 7.
2. The kit of claim 1, wherein:
the kit has at least one function of the following 1) to 4):
1) detecting or capturing the tumor or tumor cell expressing or highly expressing alkaline phosphatase in a sample to be detected;
2) detecting or capturing circulating tumor cells expressing or highly expressing alkaline phosphatase in a sample to be detected;
3) detecting or capturing exosomes expressing or highly expressing alkaline phosphatase in a sample to be detected;
4) detecting or capturing soluble alkaline phosphatase in the sample to be tested.
3. The kit according to claim 1 or 2, characterized in that:
the aptamer derivative is characterized in that the 5 'end or the 3' end of any aptamer shown in 1) -7) is labeled with a fluorescent group, a biotin group or a radionuclide.
4. The kit according to claim 1 or 2, characterized in that:
the carrier for fixing or coupling the aptamer or the derivative thereof is a nano-particle, a micro-particle or a chip.
5. The kit of claim 4, wherein:
the nano particles are nano/micro particles modified by modifiers;
the modifier is streptavidin, carboxyl, amino or sulfhydryl.
6. The kit of claim 2, wherein:
the tumor or the tumor cell expressing or highly expressing the alkaline phosphatase is a human cervical cancer cell, a human breast cancer cell, a human colorectal cancer cell or a human hepatocellular carcinoma cell;
or the circulating tumor cell expressing or highly expressing the alkaline phosphatase is a circulating tumor cell of human cervical cancer, a circulating tumor cell of human breast cancer, a circulating tumor cell of human colon cancer or a circulating tumor cell of human hepatocellular carcinoma.
7. The kit according to claim 1 or 2, characterized in that:
the kit further comprises a chromogenic substrate that reacts with alkaline phosphatase;
the chromogenic substrate is a fluorescent substrate molecule, a chemiluminescent substrate molecule or a visible light-emitting substrate molecule.
8. Use of a kit according to any one of claims 1 to 7 for the preparation of a product for capturing and/or detecting in a test sample a tumor or tumor cell expressing or overexpressing alkaline phosphatase;
or the use of a kit according to any one of claims 1 to 7, for the preparation of a product for capturing and/or detecting in a test sample circulating tumor cells expressing or overexpressing alkaline phosphatase;
or the use of a kit according to any one of claims 1 to 7, for the preparation of a product for capturing and/or detecting the presence of exosomes expressing or overexpressing alkaline phosphatase in a test sample;
or, use of the kit of any one of claims 1 to 7 for the preparation of a kit for capturing and/or detecting the presence of a soluble alkaline phosphatase product in a test sample.
9. Use according to claim 8, characterized in that:
the sample to be detected is peripheral blood whole blood or serum or plasma or cell culture fluid or saliva.
CN201910001280.0A 2018-02-02 2019-01-02 Tumor detection method and kit based on nucleic acid aptamer Active CN109682973B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201910001280.0A CN109682973B (en) 2019-01-02 2019-01-02 Tumor detection method and kit based on nucleic acid aptamer
PCT/CN2019/072749 WO2019149115A1 (en) 2018-02-02 2019-01-23 Use of nucleic acid aptamer in alkaline phosphatase heterodimer recognition and binding or in tumor detection
US16/967,102 US20200362349A1 (en) 2018-02-02 2019-01-23 Application of aptamer in recognition and binding of alkaline phosphatase heterodimer or tumor detection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910001280.0A CN109682973B (en) 2019-01-02 2019-01-02 Tumor detection method and kit based on nucleic acid aptamer

Publications (2)

Publication Number Publication Date
CN109682973A CN109682973A (en) 2019-04-26
CN109682973B true CN109682973B (en) 2021-11-02

Family

ID=66190405

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910001280.0A Active CN109682973B (en) 2018-02-02 2019-01-02 Tumor detection method and kit based on nucleic acid aptamer

Country Status (1)

Country Link
CN (1) CN109682973B (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110387403B (en) * 2019-06-18 2020-12-15 中国科学院化学研究所 Tumor marker detection kit based on force coding and application thereof
CN112126649B (en) * 2019-06-25 2022-04-19 中国科学院苏州纳米技术与纳米仿生研究所 Screening and application of N-cadherin aptamer based on engineered cell
CN110607270B (en) * 2019-10-23 2021-08-03 中国科学院化学研究所 Method for jointly characterizing exosome membrane marker and RNA (ribonucleic acid) based on aptamer immune PCR (polymerase chain reaction)
CN110780079A (en) * 2019-11-28 2020-02-11 南京迪安医学检验所有限公司 Squamous cell carcinoma antigen detection reagent
CN111024945B (en) * 2019-12-19 2023-03-17 郑州大学 Method for synchronously detecting VEGF and CEA by using chemiluminescence enzyme-linked aptamer
CN113430203A (en) * 2020-03-23 2021-09-24 华东理工大学 Novel RNA detection and quantification method
CN112695037B (en) * 2020-11-24 2023-04-07 江苏为真生物医药技术股份有限公司 EGFR-specific nucleic acid aptamer and application thereof
CN114085911B (en) * 2022-01-19 2022-05-17 珠海圣美生物诊断技术有限公司 Method for detecting tumor cells or tumor cell fragments
CN114457159B (en) * 2022-02-24 2023-09-19 珠海圣美生物诊断技术有限公司 Method for detecting tumor cells or tumor cell fragments
WO2024096642A1 (en) * 2022-11-02 2024-05-10 건국대학교 산학협력단 Dna aptamer for diagnosis or treatment of colorectal cancer

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101782570A (en) * 2008-12-25 2010-07-21 国家纳米技术与工程研究院 Biomolecule competition analysis method and application thereof
CN103667299B (en) * 2012-09-24 2017-08-25 杭州耀洲生物科技有限公司 Aptamer for combining people source beta-2 microglobulin
US9753030B2 (en) * 2013-03-06 2017-09-05 University of Pittsburgh—of the Commonwealth System of Higher Education Degradable carbon nanotube-containing biosensors and methods for target clinical marker detection
CN204330778U (en) * 2014-09-22 2015-05-13 西南大学 A kind of alkaline phosphatase detects immunity test strip fast

Also Published As

Publication number Publication date
CN109682973A (en) 2019-04-26

Similar Documents

Publication Publication Date Title
CN109682973B (en) Tumor detection method and kit based on nucleic acid aptamer
Yu et al. An aptamer-based new method for competitive fluorescence detection of exosomes
US20220236281A1 (en) Method, structures and system for nucleic acid sequence topology assembly for multiplexed profiling of proteins
CN109652504B (en) Method for simultaneously detecting exosome membrane protein and mRNA
CN104673905B (en) Nucleic acid in detection individual cells and the method for rare cells in the heterogeneous maxicell group of qualification
EP2279266B1 (en) A method for detecting igf1r aberrations in circulating tumor cells using fish
ES2719502T3 (en) Nucleic acid in situ detection methods
CN107893101A (en) A kind of kit, method and application for tumor disease early diagnosis
ES2886923T3 (en) Methods and composition for generating single-sequence DNA probes, labeling of DNA probes, and the use of these probes
ES2954456T3 (en) Digital analysis of circulating tumor cells in blood samples
US20200362349A1 (en) Application of aptamer in recognition and binding of alkaline phosphatase heterodimer or tumor detection
CN102498211B (en) Nucleic acid aptamer specifically binding to pancreatic cancer cells or tissues and use thereof
WO2022095141A1 (en) Gpc1 dna aptamer and use thereof
KR101320633B1 (en) Method of providing information for diagnosis of cancer using quantitative realtime PCR and diagnostic kit comprising thereof
EP4060047A1 (en) Method for detecting or quantifying oligonucleotide
CN109507416A (en) A kind of quick detection kit of excretion body tumor markers PDL1
CN105120986B (en) A step program for nucleic acid purification
CN110004147B (en) Aptamer of epithelial cell adhesion molecule EpCAM screened from human plasma and preparation method and application thereof
US6620586B2 (en) Methods and compositions for analyzing nucleic acids
KR101704828B1 (en) Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid
Li et al. Biofluid-based circulating tumor molecules as diagnostic tools for use in personalized medicine
JP4677254B2 (en) Cell separation method, cell identification method and cell inspection method
US20080286788A1 (en) Nucleic acid ligands to complex targets and uses thereof
TWI642778B (en) Aptamer specific to ovarian cancer and detection method for ovarian cancer
CN110938675B (en) siRNA directed self-assembled quantum dot biosensor and detection method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant