CN108866179A - LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines - Google Patents
LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines Download PDFInfo
- Publication number
- CN108866179A CN108866179A CN201810663682.2A CN201810663682A CN108866179A CN 108866179 A CN108866179 A CN 108866179A CN 201810663682 A CN201810663682 A CN 201810663682A CN 108866179 A CN108866179 A CN 108866179A
- Authority
- CN
- China
- Prior art keywords
- scarna10
- liver
- liver fibrosis
- fibrosis
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Engineering & Computer Science (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses lncRNA-SCARNA10 in preparation liver fibrosis detection kit and treats the purposes of hepatic fibrosis medicines.It is preparing diagnosing liver fibrosis serum detection kit for the specific sequence of SCARNA10 and application of the specific sequence of interference SCARNA10 in the product of preparation treatment liver fibrosis can be targeted.Expression and its effect and mechanism in liver fibrosis process of the present invention by research SCARNA10 in human liver tissue and serum, obviously increase it was found that SCARNA10 is expressed in patients with liver fibrosis hepatic tissue and serum, and SCARNA10 can reduce the disease progression of liver fibrosis in inhibition hepatic stellate cells.The present invention has important references meaning to the selection of following early stage non-invasive diagnosis and therapeutic strategy for liver fibrosis.
Description
Technical field
The present invention relates to lncRNA-SCARNA10 in preparation liver fibrosis detection kit and to treat hepatic fibrosis medicines
Purposes.
Background technique
Liver fibrosis is a kind of common liver diseases, is one common pathologic process of chronic liver disease, is the one of liver
Kind reversible lesion-healing reaction, mainly by alcohol abuse, virus infection, obstruction of bile duct and HBV, HCV, non-alcoholic
The causes of disease such as fatty liver cause, and it is very universal for falling ill in Chinese and western crowd all.Its feature shows as extracellular matrix (ECM)
It is excessive generation and excessively deposited in liver, influence liver cell blood flow and hepatocyte function, be that liver function is damaged, lose
Basic biological metabolism function, finally progresses to cirrhosis, chronic liver failure.Advanced stage liver fibrosis and liver cancer are suffered from
Person, the only effective treatment method are exactly liver transfer operation.Currently, liver impedance rheograph is the goldstandard of diagnosis, the mirror of histology pathology
Surely the degree of liver fibrosis can be classified according to the situation of inflammation, necrosis, but due to its invasive bring pain,
And the randomness of materials causes its clinical application to have significant limitation, therefore the diagnosis liver for finding accurate Noninvasive is fine
The method of dimensionization is extremely urgent.
It is numerous about genome research shows that 98% gene cannot encode albumen, and 80% gene is considered as
With biological function, transcript is referred to as non-coding RNA, is broadly divided into according to the difference of length small less than 200bp
Non-coding RNA includes miRNAs, small nuclear rna s etc., and the long-chain non-coding RNA (lncRNAs) greater than 200bp etc..For a long time
Since lncRNAs be considered as by-product in transcription without biological function.Recently as grinding for miRNAs
Study carefully progress, discloses non-coding RNAs and adjusted after human gene transcription, play phase in cell growth, differentiation and breeding
Work as important role.It also prompts simultaneously, compared with miRNAs, transcribing the higher lncRNAs of ratio in the cell may possess more
Complicated and important biological function, and being no longer regarded as it is " dark matter ", is also increasingly closed to its function and mechanism of action
Note, therefore many researchs all focus herein in recent years.
Dissociate RNA, including miRNA, snoRNA, lncRNA and circRNA in blood plasma, serum, be the discovery that scientific development
An important breakthrough in history.Traditional concept thinks always, and free RNA can not be stable in the presence of blood plasma, in serum, because
RNA itself is extremely unstable and blood circulation present in a large amount of nucleases also will affect its stability.Until the 1980s
End, several reports clearly illustrate the presence of circulation RNA amplifiable in blood circulation.Circulation RNA is being recycled at present
It source in blood and its mechanism can be stabilized does not illustrate completely also.Previously research speculates that the source of circulation RNA includes passive mistake
Journey and active process, the RNA that dissociates after passive process, that is, disease cells necrosis enter in circulating；Active process refers to that circulation RNA is logical
It crosses and is discharged from cell in the form of apoptotic body or microsome.Separately being stabilized some studies pointed out that blood plasma RNA is due to it
It can be by being formed in conjunction with the substances such as hybrid or lipoprotein complexes with DNA, thus from the degradation of Rnase.Due to circulation
Biomarker collects convenient and relative non-invasive, enables it to the screening implement as disease.Therefore, identification and liver fiber
The directly related circulation ncRNA of change process, and may be used as the diagnostic marker of liver fibrosis, there is very far-reaching clinical meaning
Justice.
Summary of the invention
In order to solve the problems in the prior art, the present invention provides lncRNA-SCARNA10 in preparation liver fibrosis detection
Kit and the purposes for treating hepatic fibrosis medicines, liver fibrosis detection accuracy is not high in the prior art for solution, does not have special efficacy
The problem of drug effectively prevents or reverses liver fibrosis.
The technical scheme is that：
For lncRNA-SCARNA10 specific sequence in the purposes for preparing hepatic fibrosis serum detection kit.
Purposes of the specific sequence in preparation treatment hepatic fibrosis medicines of low lncRNA-SCARNA10 is struck in targeting.
The present invention provides serum detection SCARNA10 to prepare diagnosing liver fibrosis detection kit and be able to suppress
Application of the substance of SCARNA10 in the product that preparation can treat liver fibrosis.The present invention is by research SCARNA10 in people
Expression and its effect and mechanism in liver fibrosis process in hepatic tissue and serum find SCARNA10 in liver fibrosis
Expression is obviously increased in patient's hepatic tissue and serum, and SCARNA10 can reduce the disease of liver fibrosis in inhibition hepatic stellate cells
Feelings progress.The present invention has important references meaning to the selection of following early stage non-invasive diagnosis and therapeutic strategy for liver fibrosis.
Detailed description of the invention
Fig. 1：The determination of SCARNA10 full length sequence；Using human liver microsome proteins system LX-2 as research object, with the end cDNA
End rapid amplifying technology (RACE) determines the full length sequence of people SCARNA10；
Fig. 2：SCARNA10 is expressed in liver fibrosis/sclerosis patients hepatic tissue to be increased；(A) to 65 human liver tissues
(including normal person, liver fibrosis patient and patient with liver cirrhosis) slice carries out HE, Masson and sirius red is dyed and carried out
Histological grade；(B) total serum IgE of 65 human liver tissues is extracted, qRT-PCR technology detects the expression of SCARNA10；(C) 65
The expression of detection SCARNA10 and Col1 α 1 and related divide is carried out in example hepatic tissue (normal and fibrosis/hardening hepatic tissue)
Analysis, * p<0.05；
Fig. 3：SCARNA10 is expressed in liver fibrosis/sclerosis patients serum to be increased；Extract normal person, liver fibrosis disease
The serum total serum IgE of people and patient with liver cirrhosis, qRT-PCR technology detect the expression of SCARNA10, * p<0.05；
Fig. 4：SCARNA10 is overexpressed in mouse fibrosis hepatic tissue and the HSCs of activation；(A) after CCl4 being injected intraperitoneally
The total serum IgE of hepatic tissue is extracted after 0th, 2,4,6,8,10 week, qRT-PCR detects α-SMA (Acta2) and the expression of SCARNA10 becomes
Change；(B) total serum IgE of hepatic tissue, qRT-PCR detection are extracted within bile duct ligation (BDL) the 0th day afterwards, the 3rd day, the 14th day and the 21st day
The expression of α-SMA and SCARNA10 changes；(C) extract the primary HSCs's of normal mouse and liver fibrosis mouse respectively
The expression of RNA, qRT-PCR technology detection SCARNA10；(D) it extracts respectively the 3rd, 7,14 day that primary HSCs is cultivated in vitro
RNA, qRT-PCR technology detect α-SMA, SCARNA10 expression；(E) what primary HSCs was cultivated in vitro adds TGF β on the 3rd day
Stimulating factor detects the level of α-SMA, col1 α 1 and SCARNA10, * p with qRT-PCR technology after handling 24 hours<0.05；
Fig. 5：CCl can be inhibited by striking low SCARNA104The hepatic fibrosis in mice of induction；Mouse is divided into four groups:Control
Group, CCl4Group, interference SCARNA10 group, interference SCARNA10+CCl4Group；Pass through the interference of tail vein injection high titre
The slow virus (lenti-shSCARNA10) of SCARNA10 or control slow virus (lenti-NC), and CCl is constructed simultaneously4Induction
Hepatic fibrosis in mice model；(A) observe four groups of mouse liver appearances, HE dyeing, Sirius Red dyeing and α-SMA,
Col1 α 1, PCNA albumen IHC determine the state of liver fibrosis；(B) Western blot detects α-in different murine liver tissues
The expression of SMA, Col1 α 1, MMP2 and PCNA, GAPDH are control；(C) containing for hydroxyproline in different murine liver tissues is measured
Amount；(D, E) extracts the RNA of four groups of murine liver tissues, the table of qRT-PCR detection and liver fibrosis, inflammation-related gene respectively
It reaches.*/#p<0.05.*p<0.05vs control group；#p<0.05vs control+CCl4Group.
Specific embodiment
Below with reference to embodiment and attached drawing, the present invention is described in detail.
Embodiment 1
The sequence of SCARNA10
Using human liver microsome proteins system LX-2 as research object, with the end cDNA rapid amplifying technology (RACE), (purchase is certainly
Clontech companyThe kit of RACE 5 '/3 ') determine the full length sequence (SEQ ID NO.1) of people SCARNA10.
(as shown in Figure 1)
Method：3'RACE：Using gene specific primer GSP1 as upstream primer (3' Outside primer：GATTA
CGCCAAGCTTGGTCTGTAATCTTGGTGGGCGATACAGA(SEQ ID NO.2)；3' inner primer：
GATTACGCCAAGCTTTGTGTTCACTGTAAGGGCAGACCAAC (SEQ ID NO.3)), draw using universal primer UPM as downstream
Object (contains Partial joints sequence), and by the DNA fragmentation of the end PCR amplification target gene 3', upper figure is that PCR runs glue figure, then
Glue recycling send genome company to be sequenced；5'RACE：Using universal primer UPM as upstream primer, gene specific primer GSP2 draws for downstream
Object (5' Outside primer：GATTACGCCAAGCTTTAGGACCCTTGGCCCTGATACCCTG (SEQ ID NO.4)；Draw on the inside of 5'
Object：GATTACGCCAAGCTTTGCCCTGTTCCTACTCT CTCACTCC (SEQ ID NO.5)), pass through PCR amplification purpose base
Because the upper figure of cDNA segment of the end 5' is PCR schematic diagram, subsequent glue recycling send genome company to be sequenced.
Embodiment 2
In order to preferably study effect of the SCARNA10 in liver fibrosis, we have collected 65 human liver tissue marks respectively
This, firstly, we, which carry out pathological analysis to this 65 samples, passes through histology normal dyeing technology with general international standard
This 65 hepatic tissue samples are divided into 5 grades by (HE, Masson and sirius red dyeing).
HE staining procedure：
(1) it dewaxes：Paraffin section is first placed into dimethylbenzene I 20 minutes, is then placed in dimethylbenzene II and is stored at room temperature 20
Minute (can be put into dimethylbenzene in 37 DEG C of insulating boxs when room temperature is too low)；
(2) aquation：Take out paraffin section from dimethylbenzene II, be respectively put into rehydration 100% I in gradient dehydrated alcohol,
100% II, 95%, 90%, 80%, 70% each 5 minutes, per pass can be drained slightly；Then distillation washing 3 times, each 5min；
(3) nuclear targeting：Moisture around tissue block is blotted, glass slide is put into and fills hematoxylic 5 dyeing cups
In, it is totally submerged glass slide, is stored at room temperature 8min；
(4) indigo plant is returned：Prepare to fill in ten dye vats of tap water, after hematoxylin is rinsed, glass slide placed into 20min,
Nucleus will gradually become blue, carry out in next step after blue is obvious under the microscope；
(5) cytoplasm dyes：Moisture around tissue block is blotted, glass slide is put into the dyeing cup for filling Yihong, it is complete
Full submergence glass slide, is stored at room temperature 3min, and microscopically observation cytoplasm red is suitable for；
(6) transparent：The glass slide successively quick rinse in 70%, 80%, 90%, 95% ethyl alcohol is clamped with tweezers, so
1min, 3min are stood respectively in 100% dehydrated alcohol I, II afterwards；Glass slide is taken out from 100% dehydrated alcohol II, slightly
It is micro- drain after in dimethylbenzene I stand 5min and II in stand 8min；
(7) mounting：Glass slide is taken out, dimethylbenzene is dried, is horizontally arranged, appropriate resinene is added dropwise in glass slide side,
Coverslip is taken slowly to put down from resin side up to tissue block is all closed with tweezers；Tissue block is kept in all operations step
It is wet.
Sirius red staining procedure：
(1) conventional dewaxing, aquation paraffin section；
(2) piece is taken out from PBS, dries remaining PBS around tissue with paper handkerchief；
(3) sirius red dyeing drop contaminates 45 minutes；
(4) flowing water slightly rinses, and removes slice surface dye liquor；
(5) glass slide is washed in 70%, 80%, 90%, 95% graded ethanol middling speed, in 100% dehydrated alcohol I
2 minutes are stood, stands 3 minutes in 100% dehydrated alcohol II；
(6) transparent：Dimethylbenzene I 3~5 minutes, dimethylbenzene II 5~10 minutes
(7) neutral gum is added dropwise at tissue block, with coverslip mounting.It can be observed under the microscope after natural drying.
Then, we devise 2 pairs of specific primer (upstream primers 1 for SCARNA10：
CTTGGTGGGCGATACAGAGT(SEQ ID NO.6)；Downstream primer 1： CTTTAGGACCCTTGGCCCTG(SEQ ID
NO.7)；Upstream primer 2： AATCTTGGTGGGCGATACAG(SEQ ID NO.8)；Downstream primer 2：
CAGCAACTGGAAGAATCACC (SEQ ID NO.9)), and with qPCR technology detection SCARNA10 expression, discovery with just
Normal hepatic tissue is compared, and expression of the SCARNA10 in fibrosis, hardening hepatic tissue significantly increases.The table of Col1 α 1 is detected simultaneously
It reaches, and does correlation analysis with the expression of SCARNA10.The above result shows that SCARNA10 is closely related with degree of hepatic fibrosis.
As a result as shown in Fig. 2, SCARNA10 is expressed in liver fibrosis/sclerosis patients hepatic tissue increases (A) to 65
Human liver tissue (including normal person, liver fibrosis patient and patient with liver cirrhosis) slice carries out HE, Masson and sirius red dye
Color simultaneously carries out histological grade；(B) total serum IgE of 65 human liver tissues is extracted, qRT-PCR technology detects the expression of SCARNA10,
As a result confirm that SCARNA10 expression quantity in the hepatic tissue of liver fibrosis and liver cirrhosis patient increased significantly；(C) in 65 liver groups
It knits the expression of detection SCARNA10 and Col1 α 1 in (normal and fibrosis/hardening hepatic tissue) and carries out correlation analysis, find
SCARNA10 and hepatic fibrosis markers Col1 α 1 are significantly correlated.*p<0.05.
Embodiment 3
It is examined to preferably study effect of the SCARNA10 in liver fibrosis and inquire into it as liver fibrosis early stage
The potential of disconnected blood serum designated object, we have collected 35 normal human serums, 38 liver fibrosis patients serums and 45 livers respectively
The serum for hardening patient, therefrom extracts RNA, and with the expression of above-mentioned 3 pairs of specific primers detection SCARNA10, discovery with
Normal human serum is compared, and expression of the SCARNA10 in fibrotic disease human serum significantly increases, and in patient with liver cirrhosis serum
In expression be higher than liver fibrosis patient serum.The above result shows that SCARNA10 is closely related with degree of hepatic fibrosis, with
The occurrence and development of liver fibrosis gradually rise, disclosing SCARNA10 clinically has blood serum designated object as detection fibrosis
Potential, to take intervening measure to alleviate liver in time fine by the means early detection of Noninvasive and diagnosing liver fibrosis
The progress of dimensionization achievees the purpose that reverse liver fibrosis.
Increase as shown in figure 3, SCARNA10 is expressed in liver fibrosis/sclerosis patients serum.Extract normal person, liver fibre
The serum total serum IgE of dimensionization patient and patient with liver cirrhosis, qRT-PCR technology detect the expression of SCARNA10.*p<0.05.
Embodiment 4
Since the activation of HSCs is the core link of liver fibrosis, by activating HSCs that can promote the hair of liver fibrosis
Hair tonic exhibition.Therefore whether functional in HSCs activation we inquire into SCARNA10.We are respectively from healthy mice and disease first
Hepatic stellate cells is extracted in sick mouse liver, in the expression for extracting RNA detection α-SMA, SCARNA10 on the 1st day of culture.
The visible a large amount of fat drips of the primary HSCs of normal mouse are observed under the microscope before extracting, and show that it is quiescent condition, and fiber
Fat drips disappear in the primary HSCs of the mouse of change, show that it has been activated during liver fibrosis.QRT-PCR result is aobvious
Showing compared with the primary HSCs of normal mouse, α-SMA expresses significant raising in the primary HSCs of fibrosis mouse,
SCARNA10 expresses also apparent increase in the HSCs of fibrosis mouse, illustrates SCARNA10 in the HSCs of vivo activation state
Height expression.It can gradually be activated during being cultivated in vitro some researches show that the HSCs of tranquillization, in order to verify above-mentioned experiment knot
Fruit, we extract normal mouse primary HSCs carry out in vitro culture, respectively on day 3, the 7th day, the 14th day extraction RNA.It is logical
It spends these three time points and embodies the quiescent condition of primary HSCs, part state of activation and complete state of activation, qRT-PCR inspection
The expression of α-SMA, SCARNA10 are surveyed, as a result, it has been found that the expression of α-SMA was significantly higher than the 7th day at the 14th day, and the
It is significantly higher than within 7 days the 3rd day, illustrates that the expression of α-SMA increases (Fig. 4 (C)) with the activation of HSCs, with original reported in the literature
It was quiescent condition for the 3rd day that HSCs is cultivated in vitro, the 7th day is part state of activation, and the 14th day is complete state of activation phase
Unanimously.Our result indicate that the expression of SCARNA10 is consistent with the expression trend of α-SMA, it was significantly higher than the 7th at the 14th day
It, and be significantly higher than within the 7th day the 3rd day, illustrate the process that SCARNA10 level is gradually activated also with primary HSCs in vitro culture
And it increases.Further, since TGF β is an important cell factor of HSCs activation, can we further detect TGF β and adjust
Save the expression of SCARNA10.10ng/ml TGF is added when the primary HSCs of normal mouse that we separate is cultivated the 3rd day in vitro
β is handled 24 hours, extracts the expression of RNA detection α-SMA, col1 α 1, SCARNA10.The result shows that TGF β handles HSCs
After stimulate its activation, α-SMA, col1 α 1 etc. are increased with HSCs activation related gene expression, while the expression water of SCARNA10
It is flat to increased significantly, illustrate SCARNA10 may by TGF β adjusting and participate in promoting the activation of HSCs.
As shown in figure 4, CCl is injected intraperitoneally in (A)4The total serum IgE of hepatic tissue, qRT- are extracted after the 0th, 2,4,6,8,10 week afterwards
PCR detects the expression variation of α-SMA (Acta2) and SCARNA10；As a result confirm α-SMA and SCARNA10 in the liver group of fibrosis
Middle expression quantity is knitted gradually to increase；(B) hepatic tissue is extracted within bile duct ligation (BDL) the 0th day afterwards, the 3rd day, the 14th day and the 21st day
Total serum IgE, the expression that qRT-PCR detects α-SMA and SCARNA10 change；As a result confirm α-SMA and SCARNA10 in fibrosis
Expression quantity gradually increases in hepatic tissue.(C) RNA of the primary HSCs of normal mouse and liver fibrosis mouse is extracted respectively,
The expression of qRT-PCR technology detection SCARNA10；As a result confirm that SCARNA10 expression quantity in the HSCs of activation significantly increases.
(D) the 3rd, 7, the 14 day RNA that primary HSCs is cultivated in vitro is extracted respectively, and qRT-PCR technology detects α-SMA, SCARNA10
Expression；As a result confirm the expression quantity of α-SMA and SCARNA10 as the culture activation of HSCs gradually increases.(E) primary HSCs
α-SMA, 1 and of col1 α are detected with qRT-PCR technology after the 3rd day cultivated in vitro plus the processing of TGF β stimulating factor 24 hours
The level of SCARNA10；As a result confirm that SCARNA10 expression quantity in the HSCs that TGF β is stimulated significantly increases.*p<0.05.
Embodiment 5
In order to probe into relationship of the SCARNA10 in vivo with liver fibrosis occurrence and development.Experimental animal is divided by we first
Four groups, respectively negative control group, CCl4Group, interference SCARNA10 group, interference SCARNA10+CCl4Group.Negative control group abdomen
Chamber injects olive oil, tail vein injection negative control slow virus (lenti-NC)； CCl4Group mouse peritoneal injects 5%CCl4,
Tail vein injection compares slow virus (lenti-NC)；It interferes SCARNA10 group mouse peritoneal to inject olive oil, produces high titre
Interfere the slow virus (lenti-shSCARNA10 of lnc-SCARNA10：SiRNA sequence 1：GGGACCUUUGGCCUGUUAA(SEQ
ID NO.10)；SiRNA sequence 2：CACAGAUCUUUGGUAAUCU(SEQ ID NO.11)；SiRNA sequence 3：
CCAAGGGUCCUAAAGGACU (SEQ ID NO.12)) mouse tail vein injection afterwards；Interfere SCARNA10+CCl4Group abdominal cavity note
Penetrate 5%CCl4, the slow virus of the interference lnc-SCARNA10 of tail vein injection high titre.CCl4Group and interference lnc-
SCARNA10+CCl4The slow virus that group carries out tail vein injection phase again after carbon tetrachloride is injected intraperitoneally 14 days is primary, then
Continue to inject CCl46 weeks, twice a week, to end time after anesthesia put to death hepatic tissue taken to freeze and paraffin embedding.
By observing hepatic tissue general appearance, CCl compared with the control group is found4Group mouse liver rough surface and
Color is dark and gloomy, tubercle increases, and interferes SCARNA10+CCl4 group and CCl4Group is more smooth compared to liver surface and color is fine,
Tubercle is reduced.Then hepatic tissue section is subjected to HE dyeing, it is seen that CCl4Group mouse liver is destructurized, necrosis of liver cells,
Liver rope is disorganized.Interfere SCARNA10+CCl4Group and CCl4Group is obviously restored compared to liver structure, and necrosis of liver cells is reduced, liver
Rope is arranged radially around central vein.Hepatic tissue section is subjected to sirius red dyeing and α-SMA, Col1 α 1 and PCNA
Immunohistochemical staining, to result carry out it has been observed that CCl4Group mouse liver extracellular matrix, collagenous fibres increased significantly,
HSCs proliferation marker is obvious, and degree of hepatic fibrosis is obvious, and interferes SCARNA10+CCl4The degree of fibrosis of group is obviously delayed
Solution, with CCl4Group is significantly reduced compared to mouse liver extracellular matrix, collagenous fibres, HSCs proliferation marker lowers.In addition, I
By measurement liver in hydroxyproline amount come judge collagen amount and indirectly reflection liver fibrosis state, as the result is shown
CCl4Group mouse hydroxyproline content significantly increases, and interferes SCARNA10+CCl4Group and CCl4Group is compared, hydroxyproline content
It is substantially reduced.The above morphological result may indicate that interference SCARNA10+CCl4The degree of fibrosis of group is substantially reduced.
Hydroxyproline content measurement experiment step：
(1) weight in wet base is weighed：From -80 DEG C of taking-up tissues, the scissors tweezers crossed with high pressure sterilization shred tissue block, then quasi-
Tissue wet really is weighed, and is transferred in test tube；
(2) basic hydrolysis：1ml alkaline hydrolyzate is accurately added with the liquid-transfering gun of 1ml, mixes, be put into 95 DEG C after preservative film sealing
Water-bath in, hydrolyze 20 minutes, during which mix successively；
(3) pH to 6.0~6.8 is adjusted：A drop indicator is added dropwise, solution becomes red at this time；PH solution A 1ml is added dropwise, this
When solution be still red；PH second liquid is slowly added dropwise, every drop that is added dropwise is both needed to mix, until solution becomes yellow green, i.e., it is red rigid
When disappearance；Add distilled water 8ml into solution, mix；
(4) activated carbon adsorption：The active carbon for taking the above-mentioned hydrolyzate of 4ml, and 30mg being added or so；
(5) 3500rpm, room temperature are centrifuged 10 minutes；
(6) preparation of test sample
Blank tube：One+0.5ml reagent of 1ml distilled water+0.5ml reagent, two+0.5ml reagent three
Standard pipe：One+0.5ml reagent of standard items+0.5ml reagent, the two+0.5ml reagent three of 1ml
Measurement pipe：One+0.5ml reagent of 1ml supernatant+0.5ml reagent, two+0.5ml reagent three
Hydroxyproline assay is used for after mixing；
(7) it detects：The absorbance of every pipe is surveyed at wavelength 550nm, and performs record；
(8) it calculates.
In addition, we have also carried out the detection of molecular biology related gene.It is extracted the RNA of four groups of murine liver tissues,
Gene relevant to liver fibrosis, inflammation is detected by qRT-PCR technology, as the result is shown CCl4α-SMA in group murine liver tissue,
The expression of Col1 α 1, Mmp2, Timp1, Ctgf, Tnf α, IL-1 β, Mcp-1 are significantly raised, and after striking the expression of low SCARNA10
CCl is injected again4, with CCl4Group is compared, and the expression of these genes is substantially reduced.Then the albumen of different murine liver tissues is separated, is led to
The detection of protein electrophorese technology is crossed, inhibits CCl after interfering SCARNA10 as the result is shown4Caused by with fibrosis associated genes α-
The high expression of SMA, Col1 α 1, MMP2, PCNA.
As shown in figure 5, CCl can be inhibited by striking low SCARNA104The hepatic fibrosis in mice of induction
Mouse is divided into four groups:Control group, CCl4Group, interference SCARNA10 group, interference SCARNA10+CCl4Group.Pass through
The slow virus (lenti-shSCARNA10) or control slow virus of the interference SCARNA10 of tail vein injection high titre
(lenti-NC), CCl and is simultaneously constructed4The hepatic fibrosis in mice model of induction.(A) four groups of mouse liver appearances, HE dye are observed
Color, Sirius Red dyeing and α-SMA, Col1 α 1, PCNA albumen IHC determine the state of liver fibrosis；As a result confirmation pair
According to+CCl4The fibrosis severity of group is greater than interference SCARNA10+CCl4Group.(B) Western blot examines different Mouse Livers
The expression of α-SMA, Col1 α 1, MMP2 and PCNA in tissue, GAPDH are control；As a result confirm α-SMA, Col1 α 1, MMP2 and
The protein content of PCNA is control+CCl4Group>Interfere SCARNA10+CCl4Group.(C) hydroxyproline in different murine liver tissues is measured
Content；As a result control+CCl is confirmed4The content of hydroxyproline in the murine liver tissue of group>Interfere SCARNA10+CCl4Group contains
Amount.(D, E) extracts the RNA of four groups of murine liver tissues, the table of qRT-PCR detection and liver fibrosis, inflammation-related gene respectively
It reaches；As a result it confirms to promote fibrosis and promote the expression quantity of inflammation-related gene to be control+CCl4Group>Interfere SCARNA10+CCl4
Group.*/#p<0.05.*p<0.05vs control group.#p<0.05vs control+CCl4Group.
Sequence table
<110>Medical University Of Tianjin
<120>LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 330
<212> RNA
<213>Gene order ()
<400> 1
gccacatgat gatatcaagg ctgttgtgat tcagttggtt tggctaagcc cagggacctt 60
tggcctgtta aaggtctgta atcttggtgg gcgatacaga gttatgtgtg ttcactgtaa 120
gggcagacca acaagaactt tttcctactt ttgagctacc tctttttaat aggggtgatt 180
cttccagttg ctggagagaa attgtggtaa ctggagtgag agagtaggaa cagggcatgt 240
tcagggtatc agggccaagg gtcctaaagg acttagcttg tgttatggcc actgagagat 300
gaaacacaga tctttggtaa tctgatggct 330
<210> 2
<211> 43
<212> DNA
<213>Artificial sequence ()
<400> 2
gattacgcca agcttggtct gtaatcttgg tgggcgatac aga 43
<210> 3
<211> 41
<212> DNA
<213>Artificial sequence ()
<400> 3
gattacgcca agctttgtgt tcactgtaag ggcagaccaa c 41
<210> 4
<211> 40
<212> DNA
<213>Artificial sequence ()
<400> 4
gattacgcca agctttagga cccttggccc tgataccctg 40
<210> 5
<211> 40
<212> DNA
<213>Artificial sequence ()
<400> 5
gattacgcca agctttgccc tgttcctact ctctcactcc 40
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 6
cttggtgggc gatacagagt 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 7
ctttaggacc cttggccctg 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 8
aatcttggtg ggcgatacag 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 9
cagcaactgg aagaatcacc 20
<210> 10
<211> 19
<212> RNA
<213>Artificial sequence ()
<400> 10
gggaccuuug gccuguuaa 19
<210> 11
<211> 19
<212> RNA
<213>Artificial sequence ()
<400> 11
cacagaucuu ugguaaucu 19
<210> 12
<211> 19
<212> RNA
<213>Artificial sequence ()
<400> 12
ccaagggucc uaaaggacu 19
Claims (2)
1. being directed to the specific sequence of lncRNA-SCARNA10 in the purposes for preparing hepatic fibrosis serum detection kit.
2. purposes of the specific sequence in preparation treatment hepatic fibrosis medicines that low lncRNA-SCARNA10 is struck in targeting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663682.2A CN108866179A (en) | 2018-06-25 | 2018-06-25 | LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663682.2A CN108866179A (en) | 2018-06-25 | 2018-06-25 | LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108866179A true CN108866179A (en) | 2018-11-23 |
Family
ID=64294782
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810663682.2A Pending CN108866179A (en) | 2018-06-25 | 2018-06-25 | LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108866179A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110646615A (en) * | 2019-08-27 | 2020-01-03 | 南方医科大学 | Biological marker and treatment target of hepatic fibrosis and application thereof |
| CN112553322A (en) * | 2020-12-25 | 2021-03-26 | 深圳市人民医院 | Osteoporosis diagnosis marker and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105664178A (en) * | 2015-09-24 | 2016-06-15 | 洪健 | Application of SYK as hepatic fibrosis/cirrhosis therapeutic target |
| WO2018048257A1 (en) * | 2016-09-09 | 2018-03-15 | 서울대학교 산학협력단 | Use of akap12 as hepatic fibrosis diagnostic marker |
-
2018
- 2018-06-25 CN CN201810663682.2A patent/CN108866179A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105664178A (en) * | 2015-09-24 | 2016-06-15 | 洪健 | Application of SYK as hepatic fibrosis/cirrhosis therapeutic target |
| WO2018048257A1 (en) * | 2016-09-09 | 2018-03-15 | 서울대학교 산학협력단 | Use of akap12 as hepatic fibrosis diagnostic marker |
Non-Patent Citations (1)
| Title |
|---|
| 韩晓辉: "与肝纤维化发病相关的长链非编码 RNAs的筛选鉴定及功能的初步研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110646615A (en) * | 2019-08-27 | 2020-01-03 | 南方医科大学 | Biological marker and treatment target of hepatic fibrosis and application thereof |
| CN112553322A (en) * | 2020-12-25 | 2021-03-26 | 深圳市人民医院 | Osteoporosis diagnosis marker and application thereof |
| CN112553322B (en) * | 2020-12-25 | 2022-07-05 | 深圳市人民医院 | Osteoporosis diagnosis marker and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110791501B (en) | Long-chain non-coding RNA and application of interference RNA thereof in treatment of atherosclerosis | |
| CN112274108B (en) | CKIP-1-targeted fluorescent probe for detecting osteoporosis and application of probe in-vivo detection | |
| CN107419004A (en) | LncRNA RP11 290F20.3 and its siRNA application | |
| CN108866179A (en) | LncRNA-SCARNA10 is in preparation liver fibrosis detection kit and the purposes for the treatment of hepatic fibrosis medicines | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN111455056A (en) | lncRNA marker derived from adipose cell exosome and application and product thereof | |
| CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
| CN109536497A (en) | The application of schistosoma japonicum infection and its component in human tumor prevention and treatment | |
| CN109097358A (en) | A kind of lncRNA is preventing or is treating the application in hypertension | |
| CN106540274B (en) | A kind of application of miRNA in preparation treatment silicosis drug | |
| CN109234381A (en) | Application of the miR-2682-5p as kidney fibrosis marker | |
| CN109136165A (en) | A kind of application that self-assembled short peptide is quickly repaired in skin histology wound | |
| CN108714149A (en) | Purposes of the garden burnet active constituent in preparing anti-tumor drug | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| CN114134195A (en) | Screening method of medicament for preventing prostate cancer and application of nitazoxanide in pharmacy | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application | |
| CN112206231A (en) | Application of matrine derivative in treating non-alcoholic steatohepatitis | |
| CN105497916B (en) | Small molecule non-coding RNA miR-125b is preparing the application in the drug for treating the wrap-around vascular group liver cancer of tumour | |
| CN116042624A (en) | Medical application of knockdown or inhibition of cyclic RNA circ0030586 | |
| CN117398478B (en) | Use of MKP5 in the treatment of diabetic nephropathy | |
| CN106754908A (en) | Prepare diagnosis and molecular target and its application for the treatment of colon cancer drug | |
| CN116590398A (en) | Application of ATF7 gene in preparing heart disease diagnosis product and medicine | |
| CN108283722B (en) | Application of the SPECC1L in treatment liver cancer and/or the postoperative drug for preventing liver cancer recurrence | |
| HE et al. | Analysis of the pedigreed population genetics of SPF Yorkshire and Landrace pigs imported from Canada | |
| CN117679514A (en) | Application of circSLC8A1 in preparation of medicine for treating chronic kidney disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181123 |