CN109536497A

CN109536497A - The application of schistosoma japonicum infection and its component in human tumor prevention and treatment

Info

Publication number: CN109536497A
Application number: CN201811436581.8A
Authority: CN
Inventors: 潘卫庆; 张远斌; 林玉
Original assignee: Tongji University
Current assignee: Tongji University
Priority date: 2018-11-28
Filing date: 2018-11-28
Publication date: 2019-03-29

Abstract

The present invention relates to the application of schistosoma japonicum infection and its component in human tumor prevention and treatment.Blood fluke component includes but is not limited to worm's ovum, miRNAs, excretion body and protein etc..The present invention shows that Schistosoma japonicum component has the function of resisting a variety of host's tumours for the first time, these tumours include but is not limited to liver cancer etc..Blood fluke and its component play a role induction host specific and nonspecific immunity responsing reaction or by way of adjusting tumor-related gene and its signal path or direct killing tumour cell.The application value that there is human tumor to prevent and treat for blood fluke and its component.

Description

The application of schistosoma japonicum infection and its component in human tumor prevention and treatment

Technical field

The invention belongs to parasitology and oncology, more particularly, to schistosoma japonicum infection and its component in the mankind Application in tumor prevention and treatment.

Background technique

Snail fever is a kind of popular extensive, serious parasitic disease of harm.Schistosoma japonicum infection, adult colonize in Host's mesenteric vein generates worm's ovum there, and with blood flow to liver, causes the lesion of liver.It is well known that some cause of diseases Body-sensing dye can lead to the generation of tumour and promote the development of tumour, such as helicobacter pylori, human papillomavirus, hepatitis virus, In helminth, it has therefore proved that clonorchis sinensis and schistosoma hematobium infection can cause cholangiocarcinoma and bladder cancer respectively.But just Japanese blood For fluke (Schistosoma japonicum, S.japonicum) infection, it is deposited on the worm's ovum of liver, the inside is one Miracidium living, can secrete a large amount of protein, nucleic acid and excretion body etc., these factors itself or be produced by stimulation of host cell Raw all kinds of factor pair hosts generate pathogenic effects, such as cause the serious inflammatory reaction of liver and liver fibrosis.

Schistosoma japonicum infection leads to the serious inflammation of host's liver and liver fibrosis, and cirrhosis then occurs, these are It is proved to be the risk factor of liver neoplasm.However, domestic some epidemiological survey result prompts, the chronic sense of Schistosoma japonicum There is certain correlation with intestinal cancer in dye, but this relevance is still a kind of supposition so far, lack more convincing Experimental evidence.There is dispute in relation to the relevance between schistosoma japonicum infection and primary carcinoma of liver for a long time.Although some There are relevances between case-control study and mortality analysis result prompt infection by Schistosoma and liver cancer, but the overwhelming majority is popular Disease and clinical data do not support this relevance.Once carried out large-scale epidemiological survey on this question in China, this investigation relates to And the high popular counties of Japanese schistosomiasis 7, schistosoma japonicum infection and primary carcinoma of liver onrelevant as the result is shown.Blood fluke sense Dye causes the inflammatory reaction of host's liver, and liver fibrosis and cirrhosis then occurs, this is the typical path developed to liver cancer.

MicroRNA (miRNA) is the highly conserved endogenous minor adjustment RNA of a kind of eucaryote, length about 18~26 A nucleotide, by causing target mrna degradation or Translational repression, table after controlling gene transcription with the pairing of said target mrna specific base It reaches.MiRNA has the function of extensive Gene regulation, can be to each of Gene Activity (growth, differentiation, apoptosis and stress reaction etc.) Level is adjusted, and takes part in a series of important processes in life process, including early embryonic development, cell Proliferation, cell Apoptosis, cell death, fat metabolism and stem cell maintenance and differentiation etc..MiRNAs also influences the occurrence and development of human diseases, Including tumour.It has been confirmed that some miRNA imbalances of human body can promote the occurrence and development of various cancers, while other MiRNA has potential oncotherapy effect by adjusting tumor-related thus playing antitumor action.Especially in recent years Come, it is some researches show that the miRNA from plant or pathogen can be across the gene of species modulate host, thus influence host's Physiology and pathologic process, including the influence to tumour.Laboratory where inventor is that earliest discovery Schistosoma japonicum is deposited In miRNA, including the guard and special miRNA of blood fluke.Since japonice ovum is deposited on liver organization, worm's ovum secretion MiRNA can be directly entered the function that neighbouring host hepatocytes play modulate host cytogene, to influence host cell Phenotype, including the influence to tumour.And for many Mirnas of plant, playing a role need to be by gastrointestinal tract and across intestines Wall, the mechanism about this respect still have much unclear.

Summary of the invention

According to the record of background technique, the present invention speculates, liver extensive inflammation and fibrosis caused by infection by Schistosoma, this It should develop to primary carcinoma of liver direction, but since blood fluke is eucaryote pathogen, nearly 20,000 kinds of albumen can be encoded, and exist A large amount of non-coding RNAs, some of or anticancer factor by inducing host to generate may play the occurrence and development of tumour Inhibiting effect.Therefore, the present invention has inquired into the anti-tumor activity factor of schistosoma japonice ovum and non-coding tiny RNA etc. and its has divided Handset system.

It is an object of the present invention to overcome the above-mentioned drawbacks of the prior art and provide schistosoma japonicum infection and Application of its component in human tumor prevention and treatment.

The present invention has initially set up the mouse model of DEN induction liver cancer and schistosoma japonicum infection, evaluates on this basis Influence of the infection by Schistosoma to rat liver cancer occurrence and development.The present invention also passes through subcutaneous vaccination japonice ovum and tumour is thin Born of the same parents observe influence of the worm's ovum to cancer cell subcutaneous tumor formation and its growth.In addition, the present invention has screened in vitro can inhibit tumour The Schistosoma japonicum non-coding tiny RNA of cell growth, select it is some of can arresting cell cycles, inhibit growth of tumour cell and The non-coding tiny RNA of migration carries out follow-up study, including detects its intracorporal antitumor action.Expression Sja- can be stablized by constructing The stable cell strain of miR-3096 and liver original position and subcutaneous transplantation knurl model are inhaled using rat liver cancer animal model evaluation Japan's blood Inhibiting effect of the worm miRNAs to rat liver cancer occurrence and development.

The purpose of the present invention can be achieved through the following technical solutions:

In the first aspect of the present invention, using the method for schistosoma japonicum infection, the infection method includes:

(1) schistosoma japonicum cercariae being prepared by artificial challenge, this cercaria has infection human body or suitable animals host, Such as ability of mouse, rabbit and buffalo.

(2) entered in host with schistosoma japonicum cercariae by skin infection, and undergo virgin worm, Adult Development, and produce Worm's ovum；

(3) the worm's ovum part of output can be organized with blood distribution in liver, intestinal wall etc.；

Into Schistosoma japonicum each stage of development of host, inhibit by polypide self component and secretion or directly to swell Tumor generates special immune response, including the innate immunity, acquired immunity, activation antioncogene etc., hair by induction host Wave antitumor action.

The antitumor action includes to liver part, also includes the antitumor action of whole body other organs.

The second aspect of the present invention provides a kind of method for separating schistosoma japonice ovum, comprising the following steps:

(1) Cercariae of Schistosoma Japonicum Infection is suitable for host, and host includes but is not limited to rabbit；

(2) the host animal liver in 6 to 8 week of infection, the preparation for worm's ovum are taken

(3) separate and purify the worm's ovum of Schistosoma japonicum

(4) by the culture of worm's ovum, the culture supernatant containing worm's ovum secretion is generated.

The schistosoma japonice ovum, the treatment and prevention by subcutaneous or intravenous injection, for malignant tumour.

The third aspect of the present invention, provide one group of separation Schistosoma japonicum non-coding tiny RNA (Japanese blood fluke miRNAs, Referred to as Sja-miRNA), the miRNA has the property that

(1) Schistosoma japonicum is derived from；

(2) sequence miRNA as shown in SEQ ID NO:n, or the miRNA complementary with sequence shown in SEQ ID NO:n, or That there are several bases to replace, lacks etc. is anti-without influencing it for sequence of the miRNA outside core sequence as shown in SEQ ID NO:n The miRNA of function of tumor, or there are several for sequence of the miRNA complementary with sequence shown in SEQ ID NO:n outside core sequence The miRNA, n 1,2,3,4,5,6,7,8,9,10,11,12 without influencing its antitumor action such as base replacement, missing.

(3) it can show in vitro or in vivo and inhibit growth of tumour cell, including blocks tumor cells period The blocks tumor cells period inhibits tumor cell proliferation or inhibits tumor cell migration or promotion apoptosis of tumor cells etc..

Further, murine hepatocarcinoma cell system proliferation, migration or Cycle Arrest can be inhibited the present invention provides a series of Sja-miRNAs, sequence difference is as shown in table 1, meanwhile, Bel7402 can be inhibited to be proliferated, move the present invention provides a series of The Sja-miRNAs of shifting or Cycle Arrest, sequence difference is as shown in table 2,

Table 1. can inhibit the Sja-miRNAs of murine hepatocarcinoma cell system proliferation, migration or Cycle Arrest

Table 2. can inhibit people liver=cell line proliferation, migration or Cycle Arrest Sja-miRNAs

Sja-miRNAs title	Mature body sequence (5 ' → 3 ')
		Sja-miR-7-5p	UGGAAGACUGGUGAUAUGUUGUU
Sja-miR-124	UAAGGCACGCGGUGAAUGUCA
		Sja-miR-3005	AAGGAACAACUGCUUGAAGC
Sja-miR-71a	UGAAAGACGAUGGUAGUGAGAUG
		Sja-miR-3044	CGCGUGGAUCUGUCACACAUUA
Sja-miR-3006	AAGGUGUUUCCCUCGGACAAA

Note: overstriking font is to have cell-cycle arrest effect to murine hepatocarcinoma cell system, Bel7402 in table 2 Sja-miRNA.

Preferably, Sja-miRNA has: Sja-miR-3096, Sja-miR-7-5p, Sja-miR-124, Sja-miR-61, Sja-miR-3005 and Sja-miR-71a.

The present invention also provides the precursor of above-mentioned isolated Schistosoma japonicum Sja-miRNA, i.e. Sja-pre-miRNA, and its The pre-miRNA complementary with sequence shown in pre-miRNA.

The present invention also provides above-mentioned the maturation Sja-miRNA, i.e. Sja-miRNA mimics of a kind of synthesis.

The present invention also provides a kind of liposomes, include this above-mentioned maturation Sja-miRNA sequence.

The present invention also provides a kind of expression vectors, including above-mentioned Sja-pre-miRNA sequence.

The present invention also provides a kind of genetically engineered host cells, including above-mentioned liposome or expression vector, or dyeing Body is integrated with Sja-miRNA sequence described in the third aspect of the present invention.

The fourth aspect of the present invention provides a kind of excretion body (Exosome) of Schistosoma japonicum, has characteristics that

It (1) is the uniform vesica sample corpusculum of schistosoma japonice ovum, virgin worm or adult cells active secreting outside；

(2) a diameter of 40~100nm includes the various bioactive components such as non-coding tiny RNA, including can inhibit tumour Cell growth inhibits migration and promotes the Schistosoma japonicum non-coding RNA of apoptosis of tumor cells.

The fifth aspect of the present invention provides a kind of secretory protein of Schistosoma japonicum, has characteristics that

It (1) is the protein of schistosoma japonice ovum, virgin worm or adult cells active secreting outside；

(2) it is generally soluble protein；

(3) it can induce and activate the immune system of host, including specific immunity or innate immune cells, activation host is thin The antitumor signal path of born of the same parents generates anti-tumor factor, to inhibit growth of tumour cell or migration in vivo or promote tumour thin Born of the same parents' apoptosis etc..

The sixth aspect of the present invention provides schistosoma japonicum infection described in four aspect of the present invention or more, Japanese blood is inhaled The purposes of worm worm's ovum and Schistosoma japonicum non-coding tiny RNA:

(1) schistosoma japonicum infection is used to prepare treatment of cancer and/or prevents the application of the drug of cancer metastasis recurrence；

(2) schistosoma japonice ovum is used to prepare treatment of cancer and/or prevents the application of the drug of cancer metastasis recurrence；

(3) Japanese blood fluke miRNAs are used to prepare treatment of cancer and/or prevent the application of the drug of cancer metastasis recurrence；

(4) Schistosoma japonicum secretory protein is used to prepare treatment of cancer and/or prevents the drug of cancer metastasis recurrence Using；

(5) precursor of Japanese blood fluke miRNAs claimed in claim 4 is used to prepare treatment of cancer and/or pre- anti-cancer The application of the drug of transfer and relapse；

(6) liposome described in claim 5 is used to prepare treatment of cancer and/or prevents the drug of cancer metastasis recurrence Using；

(7) expression vector as claimed in claim 6 is used to prepare treatment of cancer and/or prevents the drug of cancer metastasis recurrence Application；

(8) host cell as claimed in claim 7 is used to prepare treatment of cancer and/or prevents the drug of cancer metastasis recurrence Application；

(9) the excretion body of Schistosoma japonicum according to any one of claims 8 is used to prepare treatment of cancer and/or prevention cancer metastasis The application of the drug of recurrence；

(10) the intracorporal immunocyte of tumor patient passes through schistosoma japonice ovum or the external thorn of Schistosoma japonicum component The treatment into patient's body, for malignant tumour is fed back after swashing；

The immunocyte includes but is not limited to macrophage, NK cell, T cell, DC cell.

The seventh aspect of the present invention provides a kind of composition for inhibiting tumour growth or oncotherapy, which is characterized in that The composition contains a effective amount of Japanese blood fluke miRNAs, the excretion body of Schistosoma japonicum or Schistosoma japonicum point The protein secreted；And pharmaceutically acceptable carrier.

Compared with prior art, present invention discover that schistosoma japonicum infection has the function of resisting a variety of host's tumours, simultaneously It was found that Schistosoma japonicum component, including worm's ovum and non-coding RNA, excretion body and protein etc. equally have and resist a variety of hosts The effect of tumour, these tumours include but is not limited to liver cancer etc..

Schistosoma japonicum infection or Schistosoma japonicum component or by induction host specific and nonspecific immunity responsing reaction, Or adjust tumor-related gene and its signal path or the mode of direct killing tumour cell plays a role.Therefore, Japanese blood is inhaled The application value that there is human tumor to prevent and treat for insect infection or Schistosoma japonicum component.It can be used for based on Schistosoma japonicum group The research and development of the anti-tumor drug divided.

The innovation of the invention consists in that:

(1) Schistosoma japonicum non-coding tiny RNA can be by modulate host tumor-related gene, to inhibit tumour cell Growth, migration etc..

(2) host immune cell of schistosoma japonicum infection induced activation and interstitial cell, which have, inhibits growth of tumour cell Effect.

(3) schistosoma japonice ovum immunity energy inhibits subcutaneous tumors growth.

(4) Japanese blood fluke miRNAs can process mature and effective inhibition growth of tumour cell and be moved in host cell It moves.

Detailed description of the invention

The detection of Fig. 1 each group mouse tumor marker AFP and GPC3.

The schistosoma japonice ovum and microscopy figure that Fig. 2 is isolated and purified.

The immune influence to the subcutaneous tumor formation of liver cancer cells of Fig. 3 worm's ovum.

Influence of Fig. 4 schistosoma japonicum infection to the subcutaneous tumor formation of liver cancer cells.

Influence of Fig. 5 infecting mouse interstitial cell culture supernatant to Hepa1-6 Proliferation of Tumor Cells In Vitro

Fig. 5 includes Fig. 5 A and Fig. 5 B；

Fig. 5 A: the liver interstitial cell CM influence to Hepa1-6 cell Proliferation；

Fig. 5 B: the hepatic stellate cells CM influence to Hepa1-6 cell Proliferation；

Data are indicated with Mean ± SD, are tested in triplicate, P < 0.01 * P < 0.05, * *.

Influence of Fig. 6 infecting mouse liver interstitial cell to Hepa1-6 cell growth in vivo

Fig. 6 includes Fig. 6 A, Fig. 6 B, Fig. 6 C；

Fig. 6 A: tumor growth curve when interstitial cell quantity is 20 times of Hepa1-6 cell quantity；

Fig. 6 B: tumor growth curve when interstitial cell quantity is 10 times of Hepa1-6 cell quantity；

Fig. 6 C: tumor weight；

Data indicate with Mean ± SEM, P < 0.01 * P < 0.05, * *.

Influence of Fig. 7 .Sja-miRNA to the liver cancer cells cell cycle

Compared with the control, Sja-miR-7-5p, Sja-miR-124, Sja-miR-61 and Sja-miR-3096 can effectively by Hepa1-6 liver cancer cells Cycle Arrest is in the G0/G1 phase

Data indicate with Mean ± SEM,^*P<0.05。

Influence of Fig. 8 Sja-miR-7-5p to the HepG2 liver cancer cells period

Fig. 8 includes Fig. 8 A, Fig. 8 B；

Fig. 8 A:FACS cell cycle schemes；

Fig. 8 B: cell cycle each period cell proportion statistics；

Data indicate with Mean ± SEM,^*P < 0.05,^**P<0.01。

Influence of Fig. 9 Sja-miRNA to tumor cell proliferation

Fig. 9 includes Fig. 9 A, Fig. 9 B, Fig. 9 C

The proliferation of Fig. 9 A:Sja-miR3096 inhibition Hepa1-6 tumour cell

The proliferation of Fig. 9 B:Sja-miR-7-5p inhibition Hepa1-6 tumour cell

The proliferation of Fig. 9 C:Sja-miR-7-5p inhibition HepG2 tumour cell

The migration of Figure 10 Sja-miR-3096 and Sja-miR-7-5p inhibition Hepa1-6 and HepG2 tumour cell

Figure 10 includes Figure 10 A, Figure 10 B, Figure 10 C, Figure 10 D

Figure 11 Sja-miRNA inhibits tumor cell clone to be formed

Figure 11 includes Figure 11 A, Figure 11 B, Figure 11 C

Figure 11 A:Sja-miR-3096 significantly inhibits Hepa1-6 tumor cell line Clone formation；

Figure 11 B:Sja-miR-7-5p significantly inhibits the Clone formation of Hepa1-6 tumor cell line；

Figure 11 C:B:Sja-miR-7-5p significantly inhibits the Clone formation of HepG2 tumor cell line.

Figure 12 Sja-miRNA inhibits the healing of tumour cell scratch

Figure 12 includes Figure 12 A, Figure 12 B

Figure 12 A:Sja-miR-3096 significantly inhibits the healing of Hepa1-6 tumor cell line scratch；

Figure 12 B:Sja-miR-7-5p significantly inhibits the healing of Hepa1-6 tumor cell line scratch.

Figure 13 Sja-miR-3096 inhibits the growth of Hepa1-6 subcutaneous tumors

Figure 13 includes Figure 13 A, Figure 13 B, Figure 13 C, Figure 13 D

Figure 14 Sja-miR-7-5p inhibits the growth of HepG2 subcutaneous tumors

Figure 14 includes Figure 14 A, Figure 14 B, Figure 14 C

Figure 15 miR-3096 surely turns a plant screening and identification

Figure 15 includes Figure 15 A, Figure 15 B, Figure 15 C

Figure 15 A:qPCR detection surely turns strain pri- and maturation sja-miR-3096

Figure 15 B: gel electrophoresis shows pri-sja-miR-3096

Figure 15 C: gel electrophoresis shows maturation sja-miR-3096

Figure 16 miR-3096 surely turns a plant characteristics of cell biology

Figure 16 includes Figure 16 A, Figure 16 B, Figure 16 C, Figure 16 D

Figure 16 A:miR-3096 surely turns a plant cell-cycle arrest

Figure 16 B:miR-3096 surely turns a plant Proliferation Ability

Figure 16 C&D:miR-3096 surely turns strain clone and forms inhibition

Figure 17 miR-3096 inhibits surely to turn the subcutaneous tumor formation of strain

Figure 17 includes Figure 17 A, Figure 17 B, Figure 17 C

Figure 18 Sja-miR-3096 inhibits surely to turn the original position tumor formation of strain liver

Figure 18 includes Figure 18 A, Figure 18 B, Figure 18 C, Figure 18 D

Inhibiting effect of the transfection miR-3096mimics to Hepa1-6 subcutaneous tumors in Figure 19 body

Figure 19 includes Figure 19 A, Figure 19 B, Figure 19 C, Figure 19 D, Figure 19 E, Figure 19 F；

The detection of miRNA in Figure 20 schistosoma japonice ovum exosome.

Specific embodiment

The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.

It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.

In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition such as Sambrook et al., Molecular cloning: described in lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) Condition, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.

Embodiment 1

Inhibiting effect of the schistosoma japonicum infection to DEN inducing mouse liver neoplasm

Experiment uses C57 mouse, male, week old 5-6W；Be divided into PBS group, PBS+ infected group (inf), DEN induction group and DEN+ infected group.

DEN inducing mouse tumor formation: using 0.25mg/100ul/ mouse, is injected intraperitoneally diethylnitrosamine (DEN)；

PBS group and the bis- property infected group mouse peritoneal injection 100ul PBS of PBS+ are as control；

Infection by Schistosoma: schistosoma japonicum cercariae is infected through skin of abdomen within the 8th week after DEN induction, cercaria is through sex identification Pairing infection afterwards, Infection burden 3-5 is right/only.

As a result: the 36th week execution mouse after DEN induction observes mouse tumor formation situation, records knurl quality, tumor formation quantity, Tumorous size, pathology and Molecular Detection etc..As a result as follows: PBS group and PBS+ infected group have no knurl, DEN group and DEN+ infection There is tumour in group, and tumor formation rate 64-100% is shown in Table 1, and table 1 is shadow of the schistosoma japonicum infection to rat liver cancer occurrence and development It rings, it is seen that there was no significant difference for two groups of average knurl numbers and maximum Tumor diameter.

Table 1: influence of the schistosoma japonicum infection to rat liver cancer occurrence and development

Liver knurl histotomy HE dyeing pathological examination results show that all knurls of DEN group (18) are diagnosable to be Hepatocellular carcinoma (HCC), and DEN+ infected group (13 knurls) only has an example and is diagnosed as HCC, remaining knurl cannot be diagnosed as HCC, according to pathological section diagnostic result are as follows: the knurl of DEN group 100% is diagnosed as HCC, and DEN+ infected group only has 7.69% Knurl be diagnosed as HCC.A group change detection is done using alpha-fetoprotein (AFP) specific antibody, the results show that all knurls of DEN group Visible AFP positive cell (100%), and DEN+inf group has no positive cell (0%)；It is analyzed using qPCR method two groups small Mouse knurl tissue HCC specificity marker molecule AFP and GPC3 expression, the results show that DEN group knurl tissue AFP and GPC3 Expression is significantly raised compared with DEN+inf group, specifically as shown in Figure 1.

Embodiment 2

Schistosoma japonice ovum isolation and purification

Schistosoma japonicum cercariae obtains and infection: schistosoma japonicum Chinese strain Snails are by Chinese Disease Control and Prevention Center Extra large institute of parasitic provides.Conventional ease larva of a tapeworm or the cercaria of a schistosome method escapes schistosoma japonicum cercariae, and illumination assembles cercaria emersion.Going chlorine water Middle adjustment cercaria quantity shaves hair in new zealand white rabbit (being purchased from Shanghai Slac Experimental Animal Co., Ltd.) abdomen Hair infects schistosoma japonicum cercariae about 800 in baring skin tile.Normal husbandry conditions raise white rabbit.

The separation of New Zealand White Rabbit liver and homogenate: 5mL air is injected by rabbit auricular vein after miracidium infection 56 days and is put to death White rabbit, aseptic operation take out rabbit liver in sterilizing utensil, remove bile duct, blood vessel and connective tissue.With high pressure sterilization and 4 DEG C pre- 0.9% cold physiological saline cleans blood stains, and liver is cut into fragment.The physiological saline of appropriate 4 DEG C of pre-coolings is added in liver fragment, It pours into high-speed homogenizer, 12,000rpm homogenate 3 times, each Homogenization time 1 minute, every time homogenate interval 1 minute.? To hepatic homogenate liquid.

Worm's ovum is classified isolation and purification: hepatic homogenate liquid is successively used the quasi- sub-sieve mistake of 80 mesh/120 mesh/180 targets Sieve collects filtrate after sieving every time, and with a small amount of 4 DEG C of pre-cooling brines filter residue 3 times, the filtrate of collection and washing lotion after Sub-sieve next time.All filtrate about 1000mL is obtained, is poured into 50mL sterile centrifugation tube, with 3 under the conditions of 4 DEG C, 500rpm is centrifuged 1 minute.Discard supernatant, with physiological saline be resuspended precipitate, and be added final concentration of 0.25% trypsase it is molten Liquid mixes precipitating, digests in 37 DEG C of incubators, is mixed by inversion every 15 minutes primary.After digesting about 2 hours, microscopy liver Tissue relic is sufficiently digested.Suspension will be digested again with the normal saline dilution of 4 DEG C of pre-coolings and cross 300 mesh sub-sieves, collected Worm's ovum on sub-sieve, and worm's ovum is resuspended with physiological saline, 3,500rpm centrifugations 1 minute precipitate again with physiological saline worm's ovum It is resuspended and washs and be centrifuged.After washing 4 times repeatedly, the worm's ovum of acquisition is with the resuspension of DMEM culture medium.The microscopy worm under microscope light microscopic Ovum purity and egg count.

The schistosoma japonice ovum and microscopy figure isolated and purified is as shown in Fig. 2, microscopic examination result shows to obtain by above method Worm's ovum it is very pure, microscopy is without liver organization relic, only broken worm's ovum fragment on a small quantity.The present embodiment is subsequent experimental Important experimental material is obtained, the present invention is in the examples below further to the relationship of worm's ovum and H22 cell one-tenth knurl ability It is studied.

Embodiment 3

The immune inhibiting effect to the subcutaneous tumor formation of mouse of schistosoma japonice ovum

C57BL/6 mouse is immunized in worm's ovum: fresh sterile schistosoma japonice ovum prepared by above-described embodiment 2 adjusts concentration To 1*10⁵A/mL takes 50 μ L worm's ovum re-suspension liquids (i.e. immune total quantity is 5000 worm's ovums), subcutaneous with No. 1.2 syringe needles of syringe It is injected to 6 week old male C57BL/6 mouse dorsal scapular portions.It needs to flick syringe before the injection of every mouse and mixes worm's ovum, and It is detained syringe needle about 30 seconds after injection, then slowly gently exits syringe needle.Simultaneously the small of 50 μ L blank DMEM culture mediums is subcutaneously injected Mouse, as a control group.

H22 tumour cell is inoculated with after worm's ovum is immune: in advance with H22 cell intraperitoneal inoculation to Kunming mouse, expanding H22 in vivo Cell.Ascites is detached after ascites is formed, and separates H22 cell.H22 cell is resuspended in DMEM culture medium, adjusts cell concentration For 2*10⁷A/mL, taking 50 μ L cell re-suspension liquids, (i.e. inoculation total quantity is 1*10⁶A cell), after pressing worm's ovum and being immunized one day after, After 7th day, after 16 days, it is subcutaneously injected respectively to the immune place of corresponding worm's ovum, i.e. the C57BL/6 mouse dorsal scapular of number of days Portion.4-6 experimental mice and 5 control group mices are respectively arranged in each worm's ovum immunization time point.3- after H22 cell inoculation 4 days, after mouse injection site has grown solid tumor mass, primary each knurl transverse diameter (a) and wide diameter (b) were measured every 3-4 days, And calculate each tumor volume (v=0.5*a*b*b).About 22 days or so after H22 cell inoculation, all mouse are put to death, to mouse Subcutaneous tumor formation carries out photograph and retains record, and records all mouse weights, tumorous size and weight, collects corresponding knurl sample, Extract RNA.

The immune influence to the subcutaneous tumor formation of liver cancer cells of worm's ovum is as shown in Figure 3, the results showed that, in worm's ovum immunization experiment mouse Afterwards, H22 one-tenth knurl ability significantly reduces, tumor formation difference curve significant difference (P=0.0318) between two groups of gross tumor volumes, and worm's ovum is exempted from The tumor weight of epidemic disease group is lower than DMEM immune group.

Embodiment 4

Inhibiting effect of the schistosoma japonicum infection to the subcutaneous tumor formation of mouse and its growth

Mice group: 5-6 week old C57 male mice is randomly divided into infected group and normal group；

Infection by cercariae of schistosoma: abdomen mouse hair exposed skin is shaved off with razor after mouse is fixed, is moistened, cercaria is in coverslip 10min on the skin is pasted after upper counting, removes coverslip after infection；

It plants tumor: the 42nd day after mouse infection blood fluke, inoculating 1*10 in mouse scapular region⁶A H22 tumour is thin Born of the same parents, measure a gross tumor volume daily after inoculation, record tumour growth situation, the 16th day execution mouse after inoculated tumour cell, Separation knurl weighs and takes pictures.

Influence of the schistosoma japonicum infection to the subcutaneous tumor formation of liver cancer cells is as shown in figure 4, as the result is shown: dynamic measures subcutaneous Knurl growth curve shows that the subcutaneous knurl speed of growth of infected group mouse is slow compared with normally group mouse, infected group mouse tumor weight Substantially less than it is uninfected by a group mouse.

Embodiment 5

Inhibiting effect of the infected liver interstitial cell to tumour

The preparation of Mouse Liver interstitial cell: (18-20 grams) of male C 57 BL/6 J mouse of 24 6 week old is purchased from the second medical university, army Experimental Animal Center is learned, wherein 12 are infected 16 schistosoma japonicum cercariaes through abdomen paster method, remaining 12 are not done and infect, Liver interstitial cell is separated after 56 days, and continues to separate sternzellen.Using He etc. document [He X, Hepatology 2015, 61 (6): 2008-2017], cell is separated by collagenase perfusion two-step method, and improved.Substantially process is as follows: (1) cervical vertebra After mouse is put to death in dislocation, liver total cell suspension is obtained using hepatocyte in situ perfusion type Ⅳ collagenase；(2) then through 50 × g from Heart 4min (4 DEG C) takes out supernatant and obtains purer liver interstitial cell after centrifuge washing again；(3) separation of hepatic stellate cells The 11.5%Optiprep of liver interstitial cell 10ml need to be resuspended, be then transferred to 15ml centrifuge tube, then layer is spread on it 2ml DMEM culture medium, then 1400 × g without acceleration and deceleration be centrifuged 20min (4 DEG C), centrifugation terminate take out 11.5%Optiprep and The cellular layer at DMEM culture medium interface, centrifuge washing obtain the sternzellen of preliminary purification.

After isolated cell count, and come preparation condition culture medium (CM) according to following cell quantity and culture medium: (1) Infection or Mice normal liver interstitial cell CM:1.2 × 10⁷cells+10ml DMEM；(2) infection or normal sternzellen CM:1 ×10⁶cells+1.5ml DMEM；(3) only DMEM-CM:10ml.

After DMEM culture medium (containing dual anti-) is added by respective condition in above-mentioned cell, it is put into cell incubator and cultivates for 24 hours, so After collect supernatant, filtered using 0.2 μm of filter, be placed in -80 DEG C of preservations (referred to as " Conditioned immunolresponse ").

Influence of the Conditioned immunolresponse to murine hepatocarcinoma cell system growth in vitro:

The cell Conditioned immunolresponse (CM) of above-mentioned preparation is taken out from -80 DEG C when use, is placed in 4 DEG C of refrigerators and is melted, presses Fetal calf serum is added in 10% volume, then co-cultures with murine hepatocarcinoma cell Hepa1-6.Using CCK-8 testing conditions culture Influence of the base (CM) to Hepa1-6 cell Proliferation.According to (2 × 10³Cells+0.1ml DMEM culture medium)/hole, 96 holes are added Tissue culture plate (Corning, USA), every group of 3 repetitions detect cell proliferative conditions when 72h.At the specified time point, to every 10 μ l Cell Counting Kit-8 reagents (CCK-8, Dojindo, Japan) are added in hole, and cell is incubated at 37 DEG C 1h is educated, then using the absorbance at Microplate reader (Bio-Tek, USA) measurement 450nm wavelength, and with 630nm Then wavelength calculates cell with respect to proliferation times as reference wavelength.

Cell is with respect to proliferation times=(experimental group OD value ﹣ background value)/(control group OD value ﹣ background value).

As shown in Figure 5A, the liver interstitial cell CM of infecting mouse can significantly inhibit the proliferation of Hepa1-6 cell, about normally 0.383 ± 0.007 times (P < 0.01) of the liver interstitial cell CM group of mouse.

As shown in Figure 5 B, the hepatic stellate cells CM of infecting mouse can significantly inhibit the proliferation of Hepa1-6 cell, about normally 0.301 ± 0.025 times (P < 0.01) of the hepatic stellate cells CM group of mouse.

Infect influence of the liver interstitial cell to murine hepatocarcinoma cell tumor growth:

Firstly, observe infection liver interstitial cell to Hepa1-6 liver cancer cells mouse tumor growth influence.25 4 The male BALB/c nude mice of week old is randomly divided into 5 groups, every group 5.With the infection liver interstitial cell and tumour cell of different proportion Mouse is injected in mixing, observes tumor formation situation.The ratio of infection or normal hepatocytes interstitial cell and tumour cell (Hepa1-6) is such as Under: (1) infect 20:1 group；(2) 10:1 group is infected；(3) normal 20:1 group；(4) normal 10:1 group；

(5) only tumour cell group.

Squeeze into that nude mice or so omoplate is subcutaneous after group of cells is mixed again, the major diameter of every 2 days measurement knurls and short after inoculation Diameter, the calculation formula of knurl are as follows: (L indicates the major diameter of knurl, unit mm to 1/2 × L × S2；S indicates the minor axis of knurl, unit It for mm), is cutd open when observing 12 days, the 12nd day in total and kills nude mice, taken out knurl weighing, then take pictures.

As shown in fig. 6, infection liver interstitial cell can significantly inhibit Hepa1-6 cell relative to normal hepatocytes interstitial cell group Growth (P < 0.05) in vivo, including 20:1 (Fig. 6 A) and 10:1 (Fig. 6 B) group.In terms of tumor weight, relative to normal small The liver interstitial cell in mouse source, from two groups of infecting mouse liver interstitial cell, knurl tumour is lighter, has conspicuousness Difference (P < 0.05), including 20:1 and 10:1 (Fig. 6 C) group.

Embodiment 6

Inhibit the screening and verifying of the Schistosoma japonicum non-coding tiny RNA of growth of tumour cell

132 Japanese blood fluke miRNAs s (Sja-miRNA) are had chosen, commission Shanghai Ji Ma pharmaceutical Co. Ltd synthesizes this A little miRNA mimics and control (NC) mimics.Using lipofectamine (lipo3000) by miRNA mimics by eventually The amount of concentration 40nM distinguishes in-vitro transfection murine hepatocarcinoma cell system Hepa1-6, and CCK8 kit detects cell Proliferation after 48h, and Cell cycle is detected using flow cytometer (FACS).

It is control that lipo3000 group (Blk), which is added, in the above experiment with NC group and only.

As shown in fig. 7, as the result is shown: filtering out 6 and significantly inhibit tumor cell proliferation and cell-cycle arrest can be made to exist The Japanese blood fluke miRNAs of G0/G1 retardance, i.e. Sja-miR-3096, Sja-miR-7-5p, Sja-miR-124, Sja-miR- 61, Sja-miR-3005 and Sja-miR-71.

On this basis, Validation in vitro is carried out to the anti-tumor activity of the Sja-miRNA partially screened, it is main to wrap It includes:

(1) influence of the Sja-miR-3096 and Sja-miR-7-5p to the liver cancer cell lines cell cycle: lipo3000 is utilized MiRNA mimics is transfected into Hepa1-6 and HepG2 by the amount of final concentration 40nM respectively, cell is collected after 48h and is consolidated Fixed plus PI dyestuff and filtering detect the cell cycle using FACS method.

As the result is shown: Sja-miR-7-5p can significantly block HepG2 human liver cancer cell in the G0/G1 phase, see Fig. 8, meanwhile, Sja-miR-3096 and Sja-miR-7-5p can be shown in Fig. 7 significantly by Hepa1-6 cell block in the G0/G1 phase.

(2) influence of the Sja-miR-3096 and Sja-miR-7-5p to liver cancer cell lines cell Proliferation: lipo3000 is utilized MiRNA mimics is transfected into Hepa1-6 and HepG2 by the amount of final concentration 40nM respectively, CCK8 examination is added in certain time point Agent, microplate reader measure OD (A450) value, draw cell Proliferation curve.

As the result is shown: Sja-miR-3096 can significantly inhibit Hepa1-6 cell Proliferation, and Sja-miR-7 can be significantly inhibited Hepa1-6 and HepG2 cell Proliferation, is shown in Fig. 9.

(3) influence of the Sja-miR-3096 and Sja-miR-7-5p to liver cancer cell lines cell migration: lipo3000 is utilized MiRNA mimics transfected into Hepa1-6 and HepG2 tumour cell by the amount of final concentration 40nM respectively, for 24 hours after adherent growth Cell is digested with pancreatin, and 1,000rpm is centrifuged 3min after neutralization.Cell precipitation is resuspended with not serum-containing media, after full and uniform It counts, takes 2*10⁴500 μ l complete mediums are added to the upper layer Transwell cell, in bottom chamber in/100 μ l cell suspensions, Upper layer cell is put down gently and is floated on lower layer's culture medium.The small indoor cell suspension in upper layer is sopped up afterwards for 24 hours, with PBS wash cell, After the fixed small ventricular cell 10min of methanol room temperature, cell is taken out, with violet staining 15min.PBS wash cell, with wet cotton swab The cell of careful wiping upper layer cell bottom surface attachment.

Microscopically observation simultaneously randomly selects 5 visuals field and is taken pictures and counted.

As the result is shown: Sja-miR-3096 and Sja-miR-7-5p can significantly inhibit Hepa1-6 and the cell of HepG2 moves It moves, with reference to Figure 10.

(4) influence of the Sja-miR-3096 and Sja-miR-7-5p to liver cancer cell lines Clone formation: lipo3000 is utilized MiRNA mimics is transfected into Hepa1-6 and HepG2 by the amount of final concentration 40nM respectively, for 24 hours the cell pancreas of rear adherent growth Enzymic digestion, 1,000rpm is centrifuged 3min after neutralization.1,000rpm is centrifuged 3min after cell is resuspended with PBS.200 cells/wells add To 24 porocyte culture plates, every hole complete medium containing 1ml repeats 6 holes.After 8~10 days, observation clone shape under inverted microscope At situation.Culture medium is abandoned, PBS washing, after methanol room temperature fixes cell 10min, PBS is washed after abandoning fixer, then with crystallization Purple dyeing 15min.Dye liquor is abandoned, is washed, is taken pictures with PBS, clone's number is counted under disecting microscope.

As the result is shown: Sja-miR-3096 can significantly inhibit Hepa1-6 cell clonal formation, and Sja-miR-7-5p can be significant Inhibit Hepa1-6 and HepG2 cell clonal formation, as a result as shown in figure 11.

(5) influence that Sja-miR-3096 and Sja-miR-7-5p heals to liver cancer cells scratch: utilize lipo3000 will MiRNA mimics transfects Hepa1-6 by the amount of final concentration 40nM.After transfection for 24 hours, with 200 μ l micropipettor Tip of sterilizing Head is crossed perpendicular to culture plate bottom, washs cell surface gently with PBS to remove the cell scraped.It is added and contains low serum (2% FBS) DMEM culture medium, microscopically observation cell state are simultaneously taken pictures, and are recorded as 0h, are continued to cultivate.For 24 hours, 48h takes out sight respectively Examine and take pictures, labeled as 24 hours, 48h.

As the result is shown: Sja-miR-3096 and Sja-miR-7-5p can significantly inhibit Hepa1-6 liver cancer cells scratch and be cured It closes, as a result such as Figure 12, shows that it can inhibit the migration of tumour cell.

Embodiment 7

Inhibit the effect of tumour growth in Japanese blood fluke miRNAs body

Its internal antineoplastic action is illustrated by taking Sja-miR-3096 and Sja-miR-7-5p as an example.

(1) influence to subcutaneous tumor formation:

MiRNA mimics is transfected into Hepa1-6 and HepG2 by the amount of final concentration 40nM respectively using lipo3000.Transfection Afterwards for 24 hours, trypsin digestion cell, 1,000rpm is centrifuged 3min after neutralization.Supernatant is sucked, PBS is resuspended cell and counts.Adjust cell Concentration, 1 × 10⁶/ 100 μ l PBS are inoculated at 4 week old male nude mouse two sides omoplates.It repeats to test 5 mouse every time, Middle left side is inoculated with miRNA group, and right side is inoculated with NC group.The 2nd after inoculation, 4,6,7 or 8 days measurement knurl long diameter and wide diameter, and calculate Gross tumor volume cutd open at the 7th or 8 day and kills mouse, and knurl is taken pictures, and it is to be measured to collect knurl respective sample.

As the result is shown: Sja-miR-3096 can significantly inhibit the subcutaneous tumor formation of Hepa1-6, see Figure 13, Sja-miR-7-5p energy The subcutaneous tumor formation of HepG2 is significantly inhibited, sees Figure 14.

(2) stablize the screening and identification of the murine hepatocarcinoma cell strain of expression Sja-miR-3096:

By Schistosoma japonicum pri-miR-3096 construct to be overexpressed miRNAs pLVX plasmid in: from Schistosoma japonicum at Pass through PCR amplification Schistosoma japonicum pri-miR-3096 sequence (about 450bp) in worm genome.Upstream and downstream primer contains BamH respectively I and Asc, I restriction enzyme site, restriction enzyme site both ends are the base with Veetor Homology.The seamless clone's system of PCR product is connected PLVX plasmid after to digestion is coated with ammonia benzyl resistant panel after transformed competence colibacillus bacterium.Selection positive colony conservation simultaneously extracts matter Grain.The pLVX-pri-3096 plasmid (0.8 hole μ g/) of building and empty plasmid pLVX are transfected into Hepa1-6 cell respectively, after transfection The complete medium of puromycin (3 μ g/ml) is added to kill the successful cell of untransfected in 48h.Persistently screening two is arrived after three weeks, Cell is collected, with green fluorescence and has the steady of puromycin drug resistance to turn cell with selected by flow cytometry apoptosis, and carry out Dan Ke Grand screening.The stable cell strain screened uses the complete medium containing 1.5 μ g/ml puromycins to maintain selection pressure culture, And experimental group is surely turned to strain and empty control plasmid and surely turns strain and be respectively designated as Hepa1-6/3096 surely to turn strain and Hepa1-6/pLVX Surely turn strain.

As the result is shown: compared with the control cell Hepa1-6/pLVX of stable transfection empty plasmid and blank Hepa1-6 cell, The expression quantity that Hepa1-6/3096 surely turns plant cell its pri-miR-3096 is significantly larger than cellular control unit, intracellular Sja- The relative expression quantity of miR-3096 maturation body is equally higher than cellular control unit, sees Figure 15 A.2% agarose gel electrophoresis results card A brighter pri-miR-3096 band can be seen at tangible 450bp, see that Figure 15 B, 12% polyacrylamide gel electrophoresis are aobvious Figure 15 C can be seen to a brighter Sja-miR-3096 maturation body band at 65bp by showing.

(3) Sja-miR-3096 stable cell strain biological characteristics:

Surely turn strain total serum IgE and reverse transcription as the above method extracts, it is mature to detect pri-miR-3096 and Sja-miR-3096 The expression of body, and pLVX/3096 is further verified by tiny RNA sequencing approach and surely turns whether express Sja-miR- in strain 3096 mature bodies.Using the cell cycle of same preceding method detection stable cell strain, cell Proliferation, Clone formation feature.

As the result is shown: compared with the control, the pLVX/3096 stable cell strain cell cycle was significantly blocked in G0/G1 phase, cell Proliferation slows down, clonality weakens, and sees Figure 16.

(4) the subcutaneous tumor formation of Sja-miR-3096 stable cell strain:

The male BALB/c nude mice of 12 4 week old establishes subcutaneous tumors model.Plant cell (5 × 10 will surely be turned⁶/ 100 μ l) it connects For kind to the left omoplate of mouse, the final volume of every side omoplate inoculation is 100 μ l.Reinstate within the 3rd day after inoculation the major diameter of measurement subcutaneous tumors With wide diameter, and the volume of tumour is calculated, every 2 days records draw tumor growth curve once to after being inoculated with 10 days.After inoculation It 10 days, puts to death mouse and removes tumour, photograph to record and weigh tumor weight.

As the result is shown: in the observation period, Hepa1-6/3096 group has no always obvious knurl, and Hepa1-6/pLVX is compareed Group knurl significantly increases, and sees Figure 17.

(5) Sja-miR-3096 surely turns a plant liver original position tumor formation:

The male C57BL/6J of every group of 55 week old establishes liver original position tumor formation model.Pancreatin digests stable cell strain respectively Hepa1-6/pLVX and Hepa1-6/3096,1,000rpm centrifugation 3min, discards supernatant.Cell precipitation is resuspended with DMEM, sufficiently It mixes and adjusts concentration after counting, 1 × 10⁶/ 25 μ l distinguish liver in-situ inoculating Hepa1-6/pLVX and Hepa1-6/3096 cell.3 Week post-processing mouse claims mouse weight, liver weight, takes knurl and measure long diameter and wide diameter, tumor weight, photograph to record.

As the result is shown: inoculation 3 weeks post-processing mouse, Hepa1-6/3096 group liver and it is intraperitoneal be showed no obvious knurl, And larger knurl has been formed in Hepa1-6/pLVX empty vector control group liver and abdominal cavity, see Figure 18.

(6) Synergistic action of the Japanese blood fluke miRNAs in tumour transplatation animal model:

The male BALB/c nude mice of every group of 34 week old establishes Hepa1-6 subcutaneous tumors model.With 2 × 10⁶/ 100 μ l are subcutaneous It is inoculated at the omoplate of nude mice two sides.2h after inoculation is dissolved in PBS's with transfection reagent in 25 Beijing μ l Ying Geen bodies and 40 μ g Sja-miR-3096mimics or NC mimics room temperature mixes, tail vein injection, then once a day, co-injection 4 times.Daily Observation mouse state simultaneously measures knurl long diameter and wide diameter, in the 5th day processing mouse, collects pattern detection analysis.As the result is shown: After Hepa1-6 is inoculated with subcutaneous transplantation tumor, using internal transfection reagent, the Sja-miR-3096 mimics energy through tail vein injection The tumor growth for inhibiting tumour, is shown in Figure 19.

Embodiment 8

The preparation of Schistosoma japonicum exosome and its interior non-coding RNA detection

(1) preparation of Schistosoma japonicum exosome

The extraction (being operated according to SBI ExoQuick-TC specification) of exosome in egg cultivation supernatant: by 6ml worm's ovum For culture supernatant first through 3,000 × g is centrifuged 15min to remove worm's ovum cell and cell fragment, and supernatant carefully drawn to Another cleaning centrifuge tube；SBI ExoQuick-TC reagent is added according to volume ratio 5:1 (sample: reagent), is mixed by inversion, 4 DEG C of mistakes Night；Next day, 500 × g was centrifuged 30min by mixed liquor (sample and reagent) 1, carefully sucked supernatant, and remaining sediment fraction 1,500 × G is centrifuged 5min again, carefully sucks supernatant, does not disturb precipitating, leaves and takes part supernatant as control, places -80 DEG C together with precipitating It is spare.

(2) in schistosoma japonice ovum exosome miRNAs detection: using Trizol extracting exosome and control on Clear total serum IgE；Stem ring reverse primer is designed, is detected in worm's ovum exosome and control supernatant respectively using qRT-PCR method Sja-miR-3096.As the result is shown: Sja-miR-3096 is present in worm's ovum exosome, and remaining after extracting exosome Then it is difficult to detect in supernatant.Illustrate special containing Schistosoma japonicum in the exosome of schistosoma japonice ovum secretion MiRNA is shown in Figure 20.

The above description of the embodiments is intended to facilitate ordinary skill in the art to understand and use the invention. Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein general Principle is applied in other embodiments without having to go through creative labor.Therefore, the present invention is not limited to the above embodiments, ability Field technique personnel announcement according to the present invention, improvement and modification made without departing from the scope of the present invention all should be of the invention Within protection scope.

Sequence table

<110>Tongji University

<120>application of schistosoma japonicum infection and its component in human tumor prevention and treatment

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> RNA

<213> Schistosoma japonicum

<400> 1

uuggaccacu gagccggcuc 20

<210> 2

<211> 23

<212> RNA

<213> Schistosoma japonicum

<400> 2

uggaagacug gugauauguu guu 23

<210> 3

<211> 21

<212> RNA

<213> Schistosoma japonicum

<400> 3

uaaggcacgc ggugaauguc a 21

<210> 4

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 4

ugacuagaaa gugcacucac uu 22

<210> 5

<211> 20

<212> RNA

<213> Schistosoma japonicum

<400> 5

aaggaacaac ugcuugaagc 20

<210> 6

<211> 21

<212> RNA

<213> Schistosoma japonicum

<400> 6

aagucguacu gcugacugca u 21

<210> 7

<211> 23

<212> RNA

<213> Schistosoma japonicum

<400> 7

ugaaagacga ugguagugag aug 23

<210> 8

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 8

uggcagauug ucuucggaau uu 22

<210> 9

<211> 20

<212> RNA

<213> Schistosoma japonicum

<400> 9

cuggcaggua gguuucccga 20

<210> 10

<211> 21

<212> RNA

<213> Schistosoma japonicum

<400> 10

agaagacugc cgcucguuuu a 21

<210> 11

<211> 22

<212> RNA

<213> Schistosoma japonicum

<400> 11

cgcguggauc ugucacacau ua 22

<210> 12

<211> 21

<212> RNA

<213> Schistosoma japonicum

<400> 12

aagguguuuc ccucggacaa a 21

Claims

1. the Japanese blood fluke miRNAs of one group of separation, which is characterized in that the miRNA has the property that

(1) Schistosoma japonicum is derived from；

(2) sequence miRNA as shown in SEQ ID NO:n, or the miRNA complementary with sequence shown in SEQ ID NO:n, or such as There are several bases to replace for sequence of the miRNA outside core sequence shown in SEQ ID NO:n, missing is antitumor without influencing its The miRNA of effect, or there are several bases for sequence of the miRNA complementary with sequence shown in SEQ ID NO:n outside core sequence Replacement, the miRNA, n 1,2,3,4,5,6,7,8,9,10,11 or 12 lacked without influencing its antitumor action；

(3) it can show in vitro or in vivo and inhibit growth of tumour cell.

2. the Japanese blood fluke miRNAs of one group of separation according to claim 1, which is characterized in that have and inhibit tumour cell raw Long effect includes inhibiting tumour cell cycle or inhibiting tumor cell proliferation or inhibit tumor cell migration or promote tumour Apoptosis.

3. the Japanese blood fluke miRNAs of one group of separation according to claim 1, which is characterized in that the tumour cell includes But liver cancer cells are not limited to,

Sequence miRNA as shown in SEQ ID NO:n can inhibit murine hepatocarcinoma cell system to be proliferated, migrate or Cycle Arrest, n 1, 2,3,4,5,6,7,8,9,10；

Sequence miRNA as shown in SEQ ID NO:n can inhibit Bel7402's proliferation, migration or Cycle Arrest, n 2,3, 5、7、11、12。

4. a kind of pre-miRNA, which is characterized in that for the Schistosoma japonicum of the separation as described in any one of claim 1-3 The precursor of miRNA.

5. a kind of liposome, which is characterized in that the Schistosoma japonicum comprising the separation as described in any one of claim 1-3 MiRNA sequence.

6. a kind of expression vector, which is characterized in that the Schistosoma japonicum comprising the separation as described in any one of claim 1-3 MiRNA sequence.

7. a kind of genetically engineered host cell, which is characterized in that include liposome as claimed in claim 5 or right It is required that expression vector described in 6 or chromosomal integration have the right to require the Schistosoma japonicum of separation described in any one of 1-3 MiRNA sequence.

8. a kind of excretion body of Schistosoma japonicum, which is characterized in that have characteristics that

(2) a diameter of 40~100nm includes non-coding tiny RNA protein, lipid, nucleic acid various bioactive components, including It can inhibit growth of tumour cell, or inhibit tumor cell migration, or promote the Schistosoma japonicum non-coding of apoptosis of tumor cells RNA。

9. the application of a kind of schistosoma japonicum infection or Schistosoma japonicum component characterized by comprising

(4) Schistosoma japonicum secretory protein is used to prepare treatment of cancer and/or prevents the application of the drug of cancer metastasis recurrence；

(5) precursor of Japanese blood fluke miRNAs claimed in claim 4 is used to prepare treatment of cancer and/or prevention cancer metastasis The application of the drug of recurrence；

(6) liposome described in claim 5 is used to prepare treatment of cancer and/or prevents answering for the drug of cancer metastasis recurrence With；

(7) expression vector as claimed in claim 6 is used to prepare treatment of cancer and/or prevents answering for the drug of cancer metastasis recurrence With；

(8) host cell as claimed in claim 7 is used to prepare treatment of cancer and/or prevents answering for the drug of cancer metastasis recurrence With；

(9) the excretion body of Schistosoma japonicum according to any one of claims 8 is used to prepare treatment of cancer and/or prevention cancer metastasis recurrence Drug application；

(10) the intracorporal immunocyte of tumor patient, by after the stimulated in vitro of schistosoma japonice ovum or Schistosoma japonicum component Feed back the treatment into patient's body, for malignant tumour；

10. a kind of composition for inhibiting tumour growth or oncotherapy, which is characterized in that the composition contains a effective amount of The excretion body of Schistosoma japonicum described in Japanese blood fluke miRNAs described in any one of claim 1-3 or claim 8；Or day Japonicum secretory protein；And pharmaceutically acceptable carrier.