CN108395473B

CN108395473B - Plant carotenoid synthesis related protein and coding gene and application thereof

Info

Publication number: CN108395473B
Application number: CN201810148402.4A
Authority: CN
Inventors: 林浩; 王作以; 孟颖颖; 牛丽芳; 刘欢
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2018-02-13
Filing date: 2018-02-13
Publication date: 2020-03-27
Anticipated expiration: 2038-02-13
Also published as: CN108395473A

Abstract

The invention discloses a plant carotenoid synthesis related protein, and a coding gene and application thereof. The invention provides a protein which is (a1) or (a 2): (a1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table; (a2) and (b) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table, has the same function as the protein derived from the sequence 2. The inventor of the invention clones WF1 gene from medicago truncatula, successfully constructs a plant complementary vector, adopts an agrobacterium-mediated leaf disc method to transform the medicago truncatula white flower mutant, and compared with a control, the medicago truncatula flower with the transferred WF1 gene is yellow. The content disclosed by the invention can lay a foundation for researching the regulation and control of carotenoid synthesis in plants by the gene.

Description

Plant carotenoid synthesis related protein and coding gene and application thereof

Technical Field

The invention relates to a plant carotenoid synthesis related protein, and a coding gene and application thereof.

Background

Leguminous (Leguminosae) plants are about 700 species 18000, which are the third major family next to the family of Compositae and Orchidaceae, are widely distributed all over the world, are important sources of human food and oil as well as pasture, green manure, medicinal materials, wood and the like, and have important economic, ecological and biological values. However, the research of functional genomics of leguminous plants is limited due to the factors that most leguminous crops have large genomes, and genetic transformation systems are not mature. The medicago truncatula (medicago truncatula) is an annual herbaceous plant and grazing pasture, and is an ideal model plant for leguminous plant genetics and genomics research due to the characteristics of short growth cycle, small ploidy, small genome, self-pollination, nitrogen fixation and the like.

Carotenoids are a generic name of a class of C40 terpenoids and derivatives thereof, are basic components of all photosynthetic organisms, are widely present in animals, plants, algae, bacteria and fungi, but cannot be synthesized by the animals themselves and can only be taken in from the outside. The carotenoid is a precursor of vitamin A which is necessary for human bodies, plays the functions of resisting oxidation, eliminating free radicals and the like in vivo, and is related to yellow to red colors and the like in flowers and fruits of plants. Carotenoids which are recognized at present are classified into hydrocarbon carotenoids according to different structures, and are orange and red; alcohol carotene, yellow; carotenes, both ketones and acids, are red in color.

Disclosure of Invention

The invention aims to provide a plant carotenoid synthesis related protein, and a coding gene and application thereof.

The invention provides a protein (named as WF1 protein) obtained from medicago truncatula, which is (a1) or (a 2):

(a1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;

(a2) and (b) the protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table, has the same function as the protein derived from the sequence 2.

In order to facilitate purification and detection of WF1 protein of (a1), a tag as shown in Table 1 may be attached to the amino terminus or the carboxyl terminus of a protein consisting of the amino acid sequence shown in SEQ ID No. 1 of the sequence Listing.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly--Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The WF1 protein of (a2) above may be synthesized artificially, or may be obtained by synthesizing the encoding gene and then performing biological expression. The gene encoding WF1 protein of (a2) above can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in sequence No. 1 of the sequence Listing, and/or by carrying out missense mutation of one or several base pairs, and/or by attaching a coding sequence of the tag shown in Table 1 to the 5 'end and/or 3' end thereof.

The gene encoding the WF1 protein (WF1 gene) also falls within the scope of the present invention.

The gene is a DNA molecule as described in any one of (b1) to (b4) below:

(b1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

(b2) a DNA molecule shown in a sequence 5 of a sequence table;

(b3) a DNA molecule which hybridizes under stringent conditions to the DNA sequence defined in (b1) or (b2) and which encodes the protein of claim 1;

(b4) a DNA molecule derived from medicago truncatula and having more than 90% homology with the DNA sequence defined in (b1) or (b2) or (b3) and encoding the protein of claim 1.

The stringent conditions can be hybridization and washing with 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution at 65 ℃ in DNA or RNA hybridization experiments.

The recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant strain containing the WF1 gene belong to the protection scope of the invention.

The recombinant expression vector can be specifically a recombinant plasmid obtained by inserting a DNA fragment shown in a sequence 3 in a sequence table into a KpnI enzyme cutting site of a pCAMBIA2300 plasmid and inserting a DNA fragment shown in a sequence 4 in the sequence table into a PstI enzyme cutting site.

The recombinant expression vector can be specifically an expression vector containing a double-stranded DNA molecule shown in a sequence 5 of a sequence table.

The invention also protects the application of the WF1 protein or the WF1 gene in regulating and controlling the carotenoid content of plants.

The present invention also provides a method of breeding a transgenic plant (method 1), comprising the steps of: inhibiting expression of WF1 gene in the target plant to obtain the transgenic plant with reduced carotenoid content.

The invention also provides a method (method 2) for reducing the carotenoid content of a plant, which comprises the following steps: inhibiting the activity and/or expression of WF1 protein in the target plant to obtain the transgenic plant with reduced carotenoid content.

The present invention also provides a method (method 3) for breeding a transgenic plant, comprising the steps of: the WF1 gene is introduced into a target plant to obtain a transgenic plant with improved carotenoid content.

In the method, the WF1 gene may be introduced into a target plant by a recombinant expression vector. The recombinant expression vector can be transformed into plant cells or tissues by conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, Agrobacterium mediation and the like.

The invention also provides a method for increasing the carotenoid content of a plant (method 4), which comprises the following steps: improving the activity and/or expression level of WF1 protein in the target plant to obtain the transgenic plant with improved carotenoid content.

The invention also protects the application of the WF1 protein or the WF1 gene or the method of any one of the above in plant breeding.

The aim of such breeding is to develop plants with high carotenoids (method 3 or method 4) or low carotenoids (method 1 or method 2).

Any of the above target plants is a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plant is a plant of the order Rosales, and the plant of the order Rosales is a plant of the family Leguminosae. The Leguminosae plant is Medicago plant. The Medicago plant is Medicago truncatula. In the method 1 or the method 2, the target plant can be medicago truncatula R108. In method 3 or method 4, The plant of interest may be more specifically wf1 mutant (The Nobel Foundation, accession number: NF 4496).

Any of the above carotenes may specifically be lutein.

Any of the above plants is a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plant is a plant of the order Rosales, and the plant of the order Rosales is a plant of the family Leguminosae. The Leguminosae plant is Medicago plant. The Medicago plant is Medicago truncatula, more specifically Medicago truncatula R108.

The inventor of the invention clones WF1 gene from medicago truncatula, successfully constructs a plant complementary vector, adopts an agrobacterium-mediated leaf disc method to transform the medicago truncatula white flower mutant, and compared with a control, the medicago truncatula flower with the transferred WF1 gene is yellow. The content disclosed by the invention can lay a foundation for researching the regulation and control of carotenoid synthesis in plants by the gene.

Drawings

FIG. 1 is a set of phenotypes of Medicago truncatula R108 wild type flowers and Medicago truncatula wf1 white flower mutants.

FIG. 2 shows the determination of carotenoid content and components in R108 flower and wf1 flower.

FIG. 3 is an analysis of the linkage between WF1 and white flower phenotype.

FIG. 4 shows the flower color phenotype analysis of wf1 mutant complementation transgenic plant and the molecule detection of wf1 mutant complementation transgenic plant.

FIG. 5 is the expression analysis of genes related to carotenoid synthesis of wf1 mutant complementation transgenic plants.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Medicago truncatula R108 (wild type): the Nobel Foundation.

wf1 mutant: the Nobel Foundation, No.: NF 4496.

wf1-2 mutant: the Nobel Foundation, No.: NF 10625.

wf1-3 mutant: the Nobel Foundation, No.: NF 10301.

pCAMBIA2300 plasmid: wuhanzhongliyuan biotechnology, Inc., Cat number: p0283.

Agrobacterium AGL 1: biomed, cat no: BC 302-01.

YEP solid medium: 10g of peptone, 10g of yeast extract, 5g of sodium chloride, 10g of agar powder and distilled water to a constant volume of 1L.

YEP liquid medium: 10g of peptone, 10g of yeast extract, 5g of sodium chloride and distilled water to a constant volume of 1L.

Callus induction liquid medium (PH 5.8): 100mL of macroelement mother liquor, 1mL of microelement mother liquor, 1mL of organic element mother liquor, 140mg of iron salt mother liquor, 100mg of inositol, 30g of sucrose, 4mg of auxin, 0.5mg of cytokinin, 200mg of cephalosporins, 250mg of timentin and 2mg of glufosinate, and the volume is up to 1L.

Callus induction solid medium (PH 5.8): 100mL of macroelement mother liquor, 1mL of microelement mother liquor, 1mL of organic element mother liquor, 140mg of iron salt mother liquor, 100mg of inositol, 30g of sucrose, 4mg of auxin, 0.5mg of cytokinin, 200mg of cephalosporins, 250mg of timentin, 2mg of glufosinate and 3.2g of Phytagel, and the volume is up to 1L.

Differentiation medium (PH 5.8): 100mL of macroelement mother liquor, 1mL of microelement mother liquor, 1mL of organic element mother liquor, 140mg of iron salt mother liquor, 100mg of inositol, 20g of cane sugar, 200mg of cephalosporin, 250mg of timentin, 2mg of glufosinate-ammonium and 3.2g of Phytagel, and the volume is up to 1L.

Rooting medium (PH 5.8): murashige & Skoog basic Medium with Vitamins 2.215g/L (company: Phytotechnology Laboratories, cat. No.: 16B0519138A)

Mother liquor of iron salt: 37.3mg of disodium ethylene diamine tetraacetate and 27.8mg of ferrous sulfate heptahydrate.

Macroelement mother liquor: magnesium sulfate heptahydrate 1.85g, potassium nitrate 28.3g, ammonium sulfate 4.63g, calcium chloride dihydrate 1.66g, potassium dihydrogen phosphate 4g, distilled water to constant volume of 1L.

And (3) a microelement mother solution: 1g of manganese sulfate monohydrate, 500mg of boric acid, 100mg of zinc sulfate heptahydrate, 100mg of potassium iodide, 10mg of sodium molybdate dihydrate, 20mg of copper sulfate pentahydrate and 10mg of cobalt chloride hexahydrate, and distilled water is added to a constant volume of 1L.

Organic element mother liquor: 500mg of nicotinic acid, 500mg of thiamine hydrochloride, 500mg of pyridoxine hydrochloride and distilled water to a constant volume of 1L.

Example 1 discovery of WF1 and gene encoding WF1

Mutant acquisition and phenotypic analysis

An extremely abnormal mutant with a flower color changed from yellow of a wild type to white is obtained by screening Medicago truncatula Tnt1 and inserting the mutant into a mutant library, and is named white flower1(wf 1).

Observations of floral phenotypes of the wf1 mutant and Medicago truncatula R108 (wild type) are shown in FIG. 1. In fig. 1, a: wild type R108 floral face; b: wild type R108 flag petal; c: wild-type R108 flower fused petals and keel petals; d: wild-type R108 flower stamen; e: wf1 floral face; f: wf1 flag petals; g: wf1 flower fused petals and keel petals; h: wf1 flower a two-body stamen. The flower front, the flag flower and the petal-fused syngnathic petal of the wild type R108 are all yellow; wf1 flower front, flag, flower fused petal and keel petal are all white.

Second, measurement of anthocyanidin component

And (3) the plant to be detected: medicago truncatula R108 (wild type) and wf1 mutant.

Analyzing pigment components in the plant flowers to be detected, and the steps are as follows:

1. cleaning the mortar and the medicine spoon, pouring a proper amount of absolute ethyl alcohol, igniting and burning, cooling at room temperature for 1h, and freezing with liquid nitrogen for 2-3 times before putting the sample.

2. Taking about 20mg (about 8-9 leaves, removing petioles, sepals and stamens) of completely opened plant petals to be detected in consistent growth state, accurately weighing, and rapidly freezing in liquid nitrogen.

3. After completing step 2, the petals are ground in the mortar treated in

step

1, 100 μ l of 6% (w/v) KOH methanol solution is added after grinding is finished, vortex for 10s and mix evenly, and then the mixture is heated for 1h at 60 ℃ in the dark.

4. After completion of step 3, 100. mu.l Tris-HCl buffer (50mM, pH7.5, containing 1M NaCl) was added, inverted 8-10 times, mixed well and left on ice for 10 min.

5. After completion of step 4, 400. mu.L of chloroform was added, mixed by inversion, and then placed on ice for 10 min.

6. After completion of step 5, the supernatant was centrifuged at 3000g for 5min at 4 ℃ and the supernatant was removed.

7. Extracting the residual liquid on the upper layer again according to the steps 5 and 6, mixing the lower layer liquid obtained 2 times, drying by nitrogen, dissolving by 100 mu L ethyl acetate, and detecting the pigment component by HPLC.

And (3) standard substance: lutein Lutein (carotenure, NO. 0133);

a chromatographic column: YMC 5. mu. m C₃₀The columns (250X 4.6mm) are connected in series with 20X 4.6mmC₃₀A column;

sample introduction amount: 10 mu L of the solution;

flow rate: 1.0 mL/min^-1；

Column temperature: 25 ℃;

detection wavelength: 450 nm;

mobile phase: a: methanol; b: water/methanol (1/4 vol, 0.2% ammonium acetate); c: tert-methyl butyl ether

Gradient elution: 95% A, 5% B isocratically for 12 minutes, 80% A, 5% B, 15% C for 12 minutes, followed by 30% A, 5% B, 65% C for 30 minutes.

The results are shown in FIG. 2. The results show that the main pigment in the alfalfa R108 (wild type) flower of the Tribulus terrestris is Lutein (Lutein), and the content of Lutein in the flower of the wf1 mutant is far lower than that of the wild type.

Thirdly, confirmation of the linkage relationship between WF1 and white flower phenotype and acquisition of encoding gene WF1

1. According to the flanking sequence of Tnt1 retrotransposon Insertion sites provided by the Medicago truncatula mutant database (https:// media at. noble. org/mutant /), corresponding primers WF1-Insertion-6-F and WF1-Insertion-6-R are designed to be combined with the primer of Tnt1 (LTR6 or LTR31), respectively, and Tnt1 Insertion sites which are co-separated with the phenotype of WF1 mutant are screened to primarily lock the target gene.

LRT31-F(5’-3’)：CTCCTCTCGGGGTCGTGGTT

LTR6-R(5’-3’)：GCTACCAACCAAACCAAGTCAA

WF1-Insertion-6-F(5’-3’)：GGTGTTGCATGGACAGAA

WF1-Insertion-6-R(5’-3’)：GCCCATGCCTAGTTGTTA

2. Extracting total RNA of yellow flowers completely opened by medicago truncatula R108 (wild type), carrying out reverse transcription to obtain cDNA serving as a template, and amplifying WF1-F/WF1-R by adopting a primer to obtain a PCR amplification product. Sequencing to obtain a coding region sequence of the target gene, wherein the coding region sequence is represented by a sequence 1 in a sequence table, and the coding region sequence is represented by a sequence 2 in the sequence table. The protein shown in the sequence 2 of the sequence table is named as WF1 and consists of 230 amino acid residues. The gene encoding WF1 was designated as WF1 gene.

3. Further, the Zygophylli alfalfa Tnt1 retrotransposon insertion mutant library was screened reversely, and two other WF1Tnt1 insertion mutants WF1-2 and WF1-3 were obtained. The alfalfa R108 (wild type), wf1 mutant, wf1-2 and wf1-3 mutants were subsequently analyzed for genomic and transcriptional levels and for the phenotype of fully open flowers in depth.

4. Extracting genome DNA of medicago truncatula R108 (wild type) and three mutants as templates, designing primers according to Tnt1 retrotransposon insertion site sequences provided by medicago truncatula mutant databases (https:// media ago-mutant. noble. org/mutant /), analyzing the insertion of Tnt1 retrotransposon in wf1-1, wf1-2 and wf1-3 respectively, and showing that Tnt1 in wf1-1 and wf1-2 is inserted into the second exon and the third exon respectively, which causes the flower color to change from yellow of wild type to white, and Tnt1 in wf1-3 mutant is inserted into 3' region of genome thereof, which causes the flower color to change from yellow of wild type to light yellow (FIG. 3A). The expression quantity of WF1 gene in the three mutants is further analyzed on the transcription level, total RNA of wild type R108 and the three mutants is respectively extracted, cDNA formed by reverse transcription is used as a template, a primer pair consisting of WF1 CDS amplification primers WF1-F/WF1-R is used for amplifying WF1 gene, a primer pair consisting of primer MtActin-F/MtActin-R is used for amplifying reference gene MtActin in the medicago truncatula, and RT-PCR is carried out, the result of amplification products shows that the target segment of WF1 gene in WF1-1 is smaller than that of the wild type, the sequencing result of the segment shows that the second exon is deleted, 130bp base deletion of WF1 gene is caused, and the gene generates frame shift mutation to cause functional deletion (figure 3B). By sequencing, the WF1 gene was misspliced in the WF1-1 mutant (FIG. C). Total RNAs of a wild type R108 and three mutants are respectively extracted, cDNA formed by reverse transcription is used as a template, a primer pair consisting of WF1 specific primers qWF1-F/qWF1-R is used for amplifying a WF1 gene, a primer pair consisting of primers qMtActin-F/qMtActin-R is used for amplifying a reference gene MtActin in the medicago truncatula, and Real-time PCR is carried out, so that the expression water average of the WF1 gene in the three mutants is obviously lower than that of the wild type (figure 3D), and the fact that the color of the medicago truncatula is changed from yellow to white due to deletion of the WF1 gene is further verified, and the fact that WF1 plays an important role in the regulation of the color of the medicago truncatula. FIG. 3E: wild type R108 floral face; FIG. 3F: wf1 floral face; FIG. 3G: wf1-2 flower front; FIG. 3H: wf1-3 flower front. The flower front of wild type R108 is yellow; the front faces of the wf1 flowers and the front faces of the wf1-2 flowers are white, and the front faces of the wf1-3 flowers are light yellow.

WF1-F(5’-3’)：CAAAAAAGCAGGCTTCATGGGTGGTGTTGCATGGAC

WF1-R(5’-3’)：CAAGAAAGCTGGGTCCTAAGAAAAACCATTATATAGATCC

MtActin-F：TCTTACTCTCAAGTACCCCATTGAGC

MtActin-R：GTGGGAGTGCATAACCCTCATAGATT

Example 2 functional verification of WF1 Gene

To further verify the role of WF1 in regulation of carotenoid synthesis, functional verification was performed by performing WF1 genome complementation experiments in WF1 mutants.

First, construction of complementary expression vector

Inserting a DNA fragment shown in a sequence 3 in a sequence table into a KpnI enzyme cutting site of the pCAMBIA2300 plasmid, and inserting a DNA fragment shown in a sequence 4 in the sequence table into a PstI enzyme cutting site to obtain a recombinant plasmid pWF1 pro: : WF1gDNA-1.5KASC (verified by sequencing).

The sequence 3 of the sequence table is an upstream 3K promoter segment of WF1 gene and a gDNA segment of WF1 gene, and the sequence 4 of the sequence table is a downstream 1.5K termination region segment of WF1 gene. The sequence 5 in the sequence table is a complete sequence of an upstream 3K promoter segment of WF1 gene, a gDNA segment of WF1 gene, a vector intermediate segment and a downstream 1.5K termination region segment of WF1 gene.

Second, obtaining complementary mutant plants

1. The recombinant plasmid pWF1pro prepared in step one: : WF1gDNA-1.5KASC transforms Agrobacterium AGL1 to obtain recombinant AGL1/pWF1 pro: : WF1gDNA-1.5 KASC.

2. And (3) carrying out reaction on the recombinant bacterium AGL1/pWF1pro obtained in the step 1: : WF1gDNA-1.5KASC was inoculated on YEP solid medium containing 50mg/mL rifampicin antibiotic and 50mg/mL kanamycin antibiotic, cultured at 28 ℃ until a single colony grew, picked up into YEP liquid medium, and cultured overnight at 28 ℃ with shaking at 200 rpm.

3. After completing step 2, inoculating 500 μ L of bacterial solution into 5mLYEP liquid culture medium, adding 5 μ L of 100mg/mL acetosyringone, performing shake culture at 28 deg.C and 200rpm to OD_600nmThe bacterial solution was centrifuged at 3800rpm for 15min at 0.8 to collect the bacterial cells.

4. Suspending the thallus obtained in step 3 with SH3a liquid culture medium containing 100mg/L acetosyringone, and adjusting OD_600nmAnd (5) obtaining the staining solution when the concentration is 0.2.

5. Taking the first compound leaf of the wf1 mutant growing for about 4 weeks, washing the first compound leaf with 75% ethanol for about 10s, then disinfecting the first compound leaf with 5% sodium hypochlorite for 5min, washing the first compound leaf with sterile water for at least 5 times on a super clean bench, cutting the leaf, then placing the cut leaf into the staining solution obtained in the step (4), and infecting the cut leaf for 15 min.

6. After completion of step 5, the infected leaves were transferred to SH3a solid medium and cultured for four weeks until white embryogenic callus appeared (medium was changed once in two weeks).

7. After completion of step 6, the white embryogenic callus was transferred to differentiation medium and cultured for four weeks until a green embryoid body was differentiated (medium was changed once for two weeks).

8. And (4) after the step 7 is completed, transferring the green embryoid to a rooting culture medium, replacing the culture medium once in two weeks, and transferring the green embryoid to vermiculite after rooting and leaf growing until the green embryoid is grown into seedlings to obtain T0 generation complementary mutant plants.

T1 generation is obtained by T0 generation selfing, and T2 generation is obtained by T1 generation selfing.

9. The pCAMBIA2300 plasmid was used instead of the recombinant plasmid pWF1 pro: : WF1gDNA-1.5KASC, was manipulated according to steps 1-8 to obtain a transgenic empty vector plant (pCAMBIA2300-GFP-HA/WF 1).

Third, phenotype of complementary mutant plants

And (3) the plant to be detected: medicago truncatula R108 (wild type), WF1 mutant, complementary mutant plant (generation F2) (pWF 1: WF1gDNA-GFP-HA/WF1), and empty vector-transferred plant (pCAMBIA2300-GFP-HA/WF 1).

Observing the completely opened flower phenotype of the plant to be detected. The results are shown in FIGS. 4A to 4D. The results show that the flower color of the complementary mutant plants changes from white of the wf1 mutant to yellow similar to the wild type. The flower color of the control vector plant was the same white as the wf1 mutant. The flower color of the transferred empty carrier plant is still white, and the influence of the carrier on the flower color is eliminated.

Fourth, analysis of expression quantity of carotenoid synthetic gene of complementary mutant plant

And (3) the plant to be detected: medicago truncatula R108 (wild type), WF1 mutant, empty vector transformed plant (generation F2) (pCAMBIA2300/WF1-7), complementary mutant plant (generation F2) (pWF 1: WF1gDNA-GFP-HA/WF 1-1).

1. And extracting the total RNA of the flower completely opened by the plant to be detected, and inverting the total RNA into cDNA.

2. And (2) detecting the expression of carotenoid synthesis related genes in wild type R108, wf1 mutant, wf1-2 and wf1-3 mutant flowers by using cDNA obtained in the step (1) as a template and utilizing qRT-PCR, wherein the detected genes and detection primers thereof are as follows (MtActin is an internal reference gene):

qMtActin-F(5’-3’)：TCAATGTGCCTGCCATGTATGT

qMtActin-R(5’-3’)：ACTCACACCGTCACCAGAATCC

qMtWF1-F(5’-3’)：CTAGAAGCTGATCAAGATAGGTCAC

qMtWF1-R(5’-3’)：CTTGGCTCCTTCTCTTCACTG

qMtPSY-F(5’-3’)：ATGACTCCTGAAAGGCGAAG

qMtPSY-R(5’-3’)：TGATTCCCACCTATCCATTGC

qMtPDS-F(5’-3’)：TTCTACCTTTCGTGCTTCTCC

qMtPDS-R(5’-3’)：TTTCCACCTAGAACGTCTCTTG

qMtZDS-F(5’-3’)：CCTCCCGTTTTACTAAGACTCG

qMtZDS-R(5’-3’)：CTCGATAATGTTCAGGCTCCG

qMtCRTISO-F(5’-3’)：CTCTCCCTTTCTAACCACACC

qMtCRTISO-R(5’-3’)：TTTCACCGCCACCCTTTT

qMtLYCE-F(5’-3’)：AGCATGTTTGGAAGGATACCG

qMtLYCE-R(5’-3’)：GAGCCAAGATATGAGACACCTG

qMtLYCB-F(5’-3’)：TGTGGATCTTGTCGTTGTCG

qMtLYCB-R(5’-3’)：CCTCAAATTCATCCACCCAAAC

qMtECH-F(5’-3’)：GGCTGTTCAAATTGGTGCTG

qMtECH-R(5’-3’)：TCCACAGCTCCATTACCTTTC

qMtBCHa-F(5’-3’)：TTTGCTCTATCAGTGGGTGC

qMtBCHa-R(5’-3’)：CACAAGGAAGCATGCCAAAG

qMtBCHb-F(5’-3’)：TCACTTACCTAGTTGCAGCTG

qMtBCHb-R(5’-3’)：GCCAAACATTTCAGACCAAGG

qMtVDE-F(5’-3’)：ACCAGAGCCTTCCATTGTG

qMtVDE-R(5’-3’)：CCTTCTCCAAATCCTTCTCCAC

qMtZEP-F(5’-3’)：AGTGGTCTTGGATAATGGTCAG

qMtZEP-R(5’-3’)：CCCGAGTATGTAGCTTCTGTTG

qMtNXS-F(5’-3’)：ACCAAACTTCTCTTTACTGTTCTGT

qMtNXS-R(5’-3’)：AGATTGAAGGAGAAATGATTGTGTG

3 strains were tested per strain.

The detection results are shown in FIG. 5 (in the detection result of each gene, the R108 and WF1 mutants of Tribulus terrestris, pCAMBIA2300/WF1-1 and pWF 1: WF1gDNA-GFP-HA/WF 1-1 are arranged from left to right in sequence). The expression level of the carotenoid synthesis related gene in the flower of the WF1 mutant complementary transgenic plant is increased relative to that of the WF1 mutant, the expression level is obviously higher than that of the carotenoid synthesis related gene in the wild type R108, the detection result of a contrast carrier plant is the same as that of the WF1 mutant, and the WF1 gene is proved to be capable of effectively improving the expression of the carotenoid synthesis related gene, so that the yield of the carotenoid is improved.

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> plant carotenoid synthesis related protein, and coding gene and application thereof

<160>5

<210>1

<211>690

<212>DNA

<213> Medicago truncatula (Medicago truncatula)

<400>1

atgggtggtg ttgcatggac agaagaagaa gatcacttgc ttaagaaatg catacaacaa 60

tatggtgaag gaaagtggca tagggttcca ctattggctg gtctaaacag atgcagaaag 120

agttgtaggc taagatggtt gaactatcta cgtcctaaca taaagagagg aaattttgct 180

gaggaggaag tggaaatgat tgtcaaactc cacaaattat taggcaacag gtggtccctg 240

attgcaggaa ggctaccagg aaggacagca aatgacgtga aaaactattg gaactgtcat 300

ctaagcaaaa aactaaatgc tctagaagct gatcaagata ggtcacaatc atccaaagat 360

gttcaaatca ttaggccaca ggcaagaaac attggttcaa gctcagtgaa gagaaggagc 420

caaggagagt caccaactga ccaagttcta gttcaacaag agagtgacat gacaacattt 480

gatgctgatg gaaagaatca tatgcttgaa tcacaacaag acatgatggt gttttcatgc 540

ttggaccaac aaggtatggt tggtgagttt ccaatggatt ttcaattaga aggatttgaa 600

gctatggtaa gtggaggaga gggtagtagt agccaatgga attgggagga tttgctctta 660

gatatggatc tatataatgg tttttcttag 690

<210>2

<211>229

<212>PRT

<213> Medicago truncatula (Medicago truncatula)

<400>2

Met Gly Gly Val Ala Trp Thr Glu Glu Glu Asp His Leu Leu Lys Lys

1 5 10 15

Cys Ile Gln Gln Tyr Gly Glu Gly Lys Trp His Arg Val Pro Leu Leu

20 25 30

Ala Gly Leu Asn Arg Cys Arg Lys Ser Cys Arg Leu Arg Trp Leu Asn

35 40 45

Tyr Leu Arg Pro Asn Ile Lys Arg Gly Asn Phe Ala Glu Glu Glu Val

50 5560

Glu Met Ile Val Lys Leu His Lys Leu Leu Gly Asn Arg Trp Ser Leu

65 70 75 80

Ile Ala Gly Arg Leu Pro Gly Arg Thr Ala Asn Asp Val Lys Asn Tyr

85 90 95

Trp Asn Cys His Leu Ser Lys Lys Leu Asn Ala Leu Glu Ala Asp Gln

100 105 110

Asp Arg Ser Gln Ser Ser Lys Asp Val Gln Ile Ile Arg Pro Gln Ala

115 120 125

Arg Asn Ile Gly Ser Ser Ser Val Lys Arg Arg Ser Gln Gly Glu Ser

130 135 140

Pro Thr Asp Gln Val Leu Val Gln Gln Glu Ser Asp Met Thr Thr Phe

145 150 155 160

Asp Ala Asp Gly Lys Asn His Met Leu Glu Ser Gln Gln Asp Met Met

165 170 175

Val Tyr Ser Cys Leu Asp Gln Gln Gly Met Val Gly Glu Phe Pro Met

180 185 190

Asp Phe Gln Leu Glu Gly Phe Glu Ala Met Val Ser Gly Gly Glu Gly

195 200 205

Ser Ser Ser Gln Trp Asn Trp Glu Asp Leu Leu Leu Asp Met Asp Leu

210 215220

Tyr Asn Gly Phe Ser

225

<210>3

<211>6095

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>3

actcttttac tacaattgca agttattata tttcaggaac aaaatattct aaagattgag 60

tcttggagca aaagaaagga gaattggagc tgattcgtgc caaaaatata aaagatctta 120

tacaaaaata tatggtgcaa ggattgagga aaaatatatg aatatctcat acaaaaatat 180

catgtgcaaa gaatttgaag atcttgtaca aatctataca agaggcgcgc cccactttag 240

tccttttgct gtttttgctt tccagacaag ctacctatta gtttatttct gacctaaaag 300

cctttggttt cttgtggaac attctagtga tgtattcctt aggttttaag tcgttataga 360

ctataaatag agtagctagc tatcataaca aatcatcttt tgttctctga aataataagt 420

gacaattgtt ttttttaata aaagttcatc tttattttct ttattttatt ttatgttctt 480

tttcttcttc ttcttcttct tcttttctat ggctacaatg aacgttagtg agtagactct 540

tcttgttttg ggattgttgg ataagtctaa tgacataatc ttaatcaaac caagccttaa 600

attctaattt atgtaaccct aatttctaat ctaaattcac cgttttaaca tgacttaaca 660

attatcaaac tgtagaagcg aaagtggagg gttagtaatt gttaattcat catctcaaat 720

atcaattcat aaaacgaaag tggagttttg atattcgaac aagtgaattt agacaaggat 780

tgcgaaacat gaaaatagtc tagcaaacct tgagacatat aaagtttcga acttcaagga 840

ttctaatagc aatcaaccat gaaaataggc gtgattgcta gaggaacaca ctcaatgaga 900

ccgaaagaag atgtgatagg ctaaagagaa acttgtcttt agaaattaag tctaacataa 960

ggttctaggt ttaatggttt ggtttgtgaa gggtttgtcg ccatgacgga ccaataatca 1020

caaggctctt ttatttttat tattttctta attaaaaatc caaacttttt aacctttgaa 1080

actttcatct aatcaatatt aaaagttaat tgaattcata actccctgtc ggaacgatac 1140

tctttttact acttcggtag aaccgtgcac ttgcggtttt atcccatcaa aagccatgat 1200

agtggatcct ttttccataa tggtggtaag gagatcaaga gagatggggt gataaattaa 1260

tagaagaacg gttgaatcaa gaaccgtcca catttcaaaa ctagcgtcaa atggaagtag 1320

gcttctcttt tccgggttga tgaatgatat gattgataac cttgttgaca ctagcatgaa 1380

tctcaaacaa ttcagtccac acggcatagt gatccttctc catttctagc acaaaagcaa 1440

tgtttttttt ttttttttaa tttttttttt tatattggtc actacaaggg ccgagtgaaa 1500

atcgggtttt gccgaattgg aggtcacgac agcgatggag gacacgaaag tgaacgacaa 1560

catggcaggg gaggaaggca tggtgtgacg agagagagag agagagagag agagagagag 1620

agagagagag agagagagag agagagagag agagagagag agagagagag agagagagag 1680

agagagagag agctgctggc acggtggtta gtgcggcaaa ggaagacact tgatcgacca 1740

tgggcggctc aagagaatag gcagcggcgg ccttgggtga agaaaatggc ggcggttgca 1800

aggaagaaag gggtaggtta cgtgggaaat tagactcgtg ataccataaa ggaaatcaat 1860

tcgtgaattt cattgataat gataagagta tatatatagt tacaataggt agagtcaaat 1920

ctaggagagt aattagaaaa taatggagag taattacaaa gtaataacta acataattac 1980

taacataatt acataaggtc aaacattcta tcatgaaact tcccaacaca cccggctcac 2040

acttagagct gaaaatccga agcatgacca gagtcattca ataatgggcg gtccaacgag 2100

tcttagaagg ttctaataaa atcttagaat taggattgaa cctaatccaa tcttagaaaa 2160

ccgatttgtg agacgatgag gacccaccga ttatagctaa tacttttaaa ttactcccta 2220

aatttaagat agaaagaaga aagctaattt ttttttagga ctacgtaatt tgttgctgcg 2280

cgatgcaatg cattagttgc gcctactatg tcctgacatt acaaagcggt tttaatagtg 2340

atttacaatc acactgcaat tgtagcctga tgcgattggc accaccacaa ccacaatatt 2400

gggaccgtat caggtgatac ggtccccaat ttgaaacatt gattggggct acaattgcag 2460

ttgtttagtg tattttaaaa tatggttgat atttagttaa aggggagtaa aaggcggaga 2520

ggattcacgt ccttgttcga taactaactt tatgcattct gaaagacttc actgttggca 2580

ttattgttat tctaagaaaa ctctcctaat cttaatgaga tgacaaatga cagaaaaata 2640

cagatgggat aggtttggct ttgaatagga aataatacaa gcttctaatg tatgatgaga 2700

tccaatttct ttgagatgat gaggaccacc attggatact tatgatgtct atttaaaaac 2760

atagagcttg gtatcagagt tttagaaaga gcaatggacc atttactatg aattttgaag 2820

catacgacat agtatattac tctgccttgc tggctagttt ggcacatctt acttcaagaa 2880

acatgtgtgt gtgtaggtgt gtatgtgttt atcaccacca cacatatata taaaagatgc 2940

aggtgtgggt cgaatatgag ggtgaaaaag tagtagtggt tgaagagttt cataagagat 3000

gggtggtgtt gcatggacag aagaagaaga tcacttgctt aagaaatgca tacaacaata 3060

tggtgaagga aagtggcata gggttccact attggctggt aaaagttaat caattatttt 3120

tcctttttct tgatatttct atttgtcttc tctaaaacgg atatttaatt acttctttga 3180

agtatgtcat ctgaggttcg atctctcaca aatatgtatg gaagaacatt tttttattga 3240

aaaatcaatc gtcgacctct taaaacggat catattattt tgagagattg gtccatactc 3300

ttgactagga aaaccttggg ttcactatta aaatgaaatc atcatgaaat gaccgactct 3360

tgaagtatgt catctgaggt tccatctctg ataaatatgt atggaagaac atttttttat 3420

tgaaaatcaa ctgtcgacct cttaaaacgg atccgttatt ttgagagatt ggtccatact 3480

cttcttgact agaaaaacct tgggtttact attaaaatga aatcatcatg aaatgactga 3540

cttgttcaat ctttgcaatt ggttcttaca caattgaacc aacatactta cttagttgat 3600

tatttttctt ttttcatcaa acattggttt gttgaaggtc taaacagatg cagaaagagt 3660

tgtaggctaa gatggttgaa ctatctacgt cctaacataa agagaggaaa ttttgctgag 3720

gaggaagtgg aaatgattgt caaactccac aaattattag gcaacaggta aactttgatc 3780

tttaagactt tcctttggta ttttctaatg tgttctaagt tctaacaact aggcatgggc 3840

catgatagcc ttatgcagtt tttccaaagg tgttaaagct cattagtgaa gagtgtgcat 3900

agtaaaaagt tagtgttcaa gtatagtaaa tgatgttctc gctgaaaaaa agtatataat 3960

ataggatgtg taatattcat tcaatttgaa ccaattgatt tggttttggt gtgtttagat 4020

ttttagcaag taagatgttt ggattcactt tttgagctta tctataaata aagcatttat 4080

atttgttttg atctctaatt ttttttaaaa atgcactttt tatagatcca taacgaccaa 4140

tccttgcgtg aattgcaagg atccaataag tcctacattg attttctctg aggtgtcaat 4200

tggacaaata tatctatagt gactaggatg gatatcctgc atccgaaaac tagcagttcg 4260

tcccgtcaat cctccaggac ccaaataact caattttctc ccatgaacta tttgggtcaa 4320

tggattggtt cgatctaaaa cttgagataa tgggtgtaat ctaaaaaagg attcataagt 4380

ggttgctaat ggagttgaaa tcactaaatt ttgaggaatt cgtatcaata tatctaattg 4440

ctttatatat agttcctcaa attatatttt ctaaaccaac tagagccaat ccaaattcat 4500

cttttaatag atcactatca gtgggagtta tatgaaaaaa acttaagata tgtccatatg 4560

ttgttttctg tttattttca aaaactatct ataataactt acaaaaacaa cttacagctc 4620

atatgaaaac atttttcatt tttttacaga taaaaatagt ttattttgta aaaaaaaaaa 4680

aaaatagttt attcataagc attgatataa taagtgctta attaagttgt ttatctaaac 4740

attactcaaa tgattttagt tattgacccc tttagagtcc gcttattata gttttattgt 4800

gaaaaaaaaa aaaaattcta aacaaagttt tatcacttat aaaagttttt cccatgtgtt 4860

acaattttct tttgaaaaag agaatccgaa aaatatctaa aaattgcttc aagaaactgt 4920

gatgaataat ttctccgaaa aatcattttt atatgtggtt gttttaaggg ttaaatatgt 4980

ttttggtccc tataaatata tttacttttt gttttagtcc ctctaaattt ttctttcaac 5040

tattagtccc tataaaattt tcaatcacta cttttggtcc ctatttttaa gttaattttt 5100

gtatttttta atgaaattgt gtgaaaatgt gtagaatatt gtaaaaatct ttcttagaaa 5160

aaaagttaga tttttttaac aaaacataaa ttaaatatta atttttaacc ataaaaaata 5220

taaaaattca tttttaattc atgttttgtt aaaaaataga attttctttt gcgagagatt 5280

cttataatat tatgattttt actgcaaaat tttattgaaa atatgaattc tacatatgag 5340

tttactttaa agtagggacc aaaaatgaag atggaaaacc tttgggggac taaaagtcga 5400

agaaattttt tagagggact aaaacgaaaa gttgacatat ttatagggac caaaaacata 5460

tttagccatt gttttaaaaa ggtaaattta attaggatga acaaacacaa actagcttca 5520

acttttaatt tttttttaaa aatttctaaa aattaatctt taaaattttc aaaatcacct 5580

ttttgcaatt agtaacaaat ggaccctaag ctatttgcta caattttttt ttcttcaggt 5640

ggtccctgat tgcaggaagg ctaccaggaa ggacagcaaa tgacgtgaaa aactattgga 5700

actgtcatct aagcaaaaaa ctaaatgctc tagaagctga tcaagatagg tcacaatcat 5760

ccaaagatgt tcaaatcatt aggccacagg caagaaacat tggttcaagc tcagtgaaga 5820

gaaggagcca aggagagtca ccaactgacc aagttctagt tcaacaagag agtgacatga 5880

caacatttga tgctgatgga aagaatcata tgcttgaatc acaacaagac atgatggtgt 5940

tttcatgctt ggaccaacaa ggtatggttg gtgagtttcc aatggatttt caattagaag 6000

gatttgaagc tatggtaagt ggaggagagg gtagtagtag ccaatggaat tgggaggatt 6060

tgctcttaga tatggatcta tataatggtt tttct 6095

<210>4

<211>1503

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>4

tagattattg ttccttattg ccaataggga agacaatgta gtctctatac atgggttgtg 60

tgtcaatttc aaagttaaat gttatccaag gaaatggtgg cttaatcgat gtattttgta 120

aatcgaagta gttgttgttt aaataaacca ataaagtcgg tcttgtgaga catagttagc 180

cctaaaactg gttagtaata tggaaatagt tttgtagctt tttaaaccct attactatat 240

atctagtaga cgatttgttt ttttttaata gtatcctagt tgataataaa aaggaatatc 300

ctcctacata agagaggcag ataaatattc ctttatgttc tattggttga tcttagtgtc 360

ataaaaaaat tagctaccaa tgttaataaa gtttttaaat tttgattatg gtaacgattg 420

ttctgcaatc cttgatattg tagaaaatta tagttaaata caatcacaac tatctaaatt 480

atagtcgtaa acctttgttt aaaatttaag tcattatatt tccatctctt tcattccttc 540

agaatttgag gaatgaaaat acaaattttt tcttagatta tcctagtatg acatgctatt 600

agcttctttc ttcgtctccc ttctcccttc ttccttcatt ctttttaccc tccacactta 660

ttgggggaaa ttctctttta ttgcaatcct ttattctagg tgaatctttt gagttgtcaa 720

tgattatttg tgacttttat aagagttatt tgtactttta cgtttctttg atatgtggct 780

catatagaaa aatagaaatg ccaaacagct cttgataagg catgaacagt taaatcctac 840

cccttcacca caaaagaaga aagtcaaatc ctgccccacc tctgtttctg tttgagtatc 900

acctgtcttc atgatatcaa ttaaatattg gtgtttcttt gtgacaaaat atccattttt 960

ttagcttaac tagtttgttt ggtcgttttt ttaattttag ccctatggtt ttttaatagt1020

gtgattttga ccttcgtact tttaaacatg cgattttgcc ctctctagtt aaccctattt 1080

ttagtttcac aaccctctag ctctgaagcc catctacttt aaaatggatg acgtattgta 1140

ttacatgtgt atcctgcacc gatacctata tgatacttcc tgatacatat tagaagagta 1200

tctgatgatt atattttatt ttatttttta aaacaattat ctgatactat tcagatacat 1260

ctggaatacg agggataagc ggtagaaaac cgatatgtgc gggctacctg atgtttttat 1320

tatatttgat acatatgcaa ttgactaagt aatgatgttt tctatttagg atatatatca 1380

tatatgtaat tgattaattg tcgatttatt tattatcaat attacttaca tttatatctc 1440

catcgttgcc gtcgtctgtt ttgtgtctct ttatttgttt gagaacgatg ctattgttga 1500

ttg 1503

<210>5

<211>8417

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>5

actcttttac tacaattgca agttattata tttcaggaac aaaatattct aaagattgag 60

tcttggagca aaagaaagga gaattggagc tgattcgtgc caaaaatata aaagatctta 120

tacaaaaata tatggtgcaa ggattgagga aaaatatatg aatatctcat acaaaaatat 180

catgtgcaaa gaatttgaag atcttgtaca aatctataca agaggcgcgc cccactttag 240

tccttttgct gtttttgctt tccagacaag ctacctatta gtttatttct gacctaaaag 300

cctttggttt cttgtggaac attctagtga tgtattcctt aggttttaag tcgttataga 360

ctataaatag agtagctagc tatcataaca aatcatcttt tgttctctga aataataagt 420

gacaattgtt ttttttaata aaagttcatc tttattttct ttattttatt ttatgttctt 480

tttcttcttc ttcttcttct tcttttctat ggctacaatg aacgttagtg agtagactct 540

tcttgttttg ggattgttgg ataagtctaa tgacataatc ttaatcaaac caagccttaa 600

attctaattt atgtaaccct aatttctaat ctaaattcac cgttttaaca tgacttaaca 660

attatcaaac tgtagaagcg aaagtggagg gttagtaatt gttaattcat catctcaaat 720

atcaattcat aaaacgaaag tggagttttg atattcgaac aagtgaattt agacaaggat 780

tgcgaaacat gaaaatagtc tagcaaacct tgagacatat aaagtttcga acttcaagga 840

ttctaatagc aatcaaccat gaaaataggc gtgattgcta gaggaacaca ctcaatgaga 900

ccgaaagaag atgtgatagg ctaaagagaa acttgtcttt agaaattaag tctaacataa 960

ggttctaggt ttaatggttt ggtttgtgaa gggtttgtcg ccatgacgga ccaataatca 1020

caaggctctt ttatttttat tattttctta attaaaaatc caaacttttt aacctttgaa 1080

actttcatct aatcaatatt aaaagttaat tgaattcata actccctgtc ggaacgatac 1140

tctttttact acttcggtag aaccgtgcac ttgcggtttt atcccatcaa aagccatgat 1200

agtggatcct ttttccataa tggtggtaag gagatcaaga gagatggggt gataaattaa 1260

tagaagaacg gttgaatcaa gaaccgtcca catttcaaaa ctagcgtcaa atggaagtag 1320

gcttctcttt tccgggttga tgaatgatat gattgataac cttgttgaca ctagcatgaa 1380

tctcaaacaa ttcagtccac acggcatagt gatccttctc catttctagc acaaaagcaa 1440

tgtttttttt ttttttttaa tttttttttt tatattggtc actacaaggg ccgagtgaaa 1500

atcgggtttt gccgaattgg aggtcacgac agcgatggag gacacgaaag tgaacgacaa 1560

catggcaggg gaggaaggca tggtgtgacg agagagagag agagagagag agagagagag 1620

agagagagag agagagagag agagagagag agagagagag agagagagag agagagagag 1680

agagagagag agctgctggc acggtggtta gtgcggcaaa ggaagacact tgatcgacca 1740

tgggcggctc aagagaatag gcagcggcgg ccttgggtga agaaaatggc ggcggttgca 1800

aggaagaaag gggtaggtta cgtgggaaat tagactcgtg ataccataaa ggaaatcaat 1860

tcgtgaattt cattgataat gataagagta tatatatagt tacaataggt agagtcaaat 1920

ctaggagagt aattagaaaa taatggagag taattacaaa gtaataacta acataattac 1980

taacataatt acataaggtc aaacattcta tcatgaaact tcccaacaca cccggctcac 2040

acttagagct gaaaatccga agcatgacca gagtcattca ataatgggcg gtccaacgag 2100

tcttagaagg ttctaataaa atcttagaat taggattgaa cctaatccaa tcttagaaaa 2160

ccgatttgtg agacgatgag gacccaccga ttatagctaa tacttttaaa ttactcccta 2220

aatttaagat agaaagaaga aagctaattt ttttttagga ctacgtaatt tgttgctgcg 2280

cgatgcaatg cattagttgc gcctactatg tcctgacatt acaaagcggt tttaatagtg 2340

atttacaatc acactgcaat tgtagcctga tgcgattggc accaccacaa ccacaatatt 2400

gggaccgtat caggtgatac ggtccccaat ttgaaacatt gattggggct acaattgcag 2460

ttgtttagtg tattttaaaa tatggttgat atttagttaa aggggagtaa aaggcggaga 2520

ggattcacgt ccttgttcga taactaactt tatgcattct gaaagacttc actgttggca 2580

ttattgttat tctaagaaaa ctctcctaat cttaatgaga tgacaaatga cagaaaaata 2640

cagatgggat aggtttggct ttgaatagga aataatacaa gcttctaatg tatgatgaga 2700

tccaatttct ttgagatgat gaggaccacc attggatact tatgatgtct atttaaaaac 2760

atagagcttg gtatcagagt tttagaaaga gcaatggacc atttactatg aattttgaag 2820

catacgacat agtatattac tctgccttgc tggctagttt ggcacatctt acttcaagaa 2880

acatgtgtgt gtgtaggtgt gtatgtgttt atcaccacca cacatatata taaaagatgc 2940

aggtgtgggt cgaatatgag ggtgaaaaag tagtagtggt tgaagagttt cataagagat 3000

gggtggtgtt gcatggacag aagaagaaga tcacttgctt aagaaatgca tacaacaata 3060

tggtgaagga aagtggcata gggttccact attggctggt aaaagttaat caattatttt 3120

tcctttttct tgatatttct atttgtcttc tctaaaacgg atatttaatt acttctttga 3180

agtatgtcat ctgaggttcg atctctcaca aatatgtatg gaagaacatt tttttattga 3240

aaaatcaatc gtcgacctct taaaacggat catattattt tgagagattg gtccatactc 3300

ttgactagga aaaccttggg ttcactatta aaatgaaatc atcatgaaat gaccgactct 3360

tgaagtatgt catctgaggt tccatctctg ataaatatgt atggaagaac atttttttat 3420

tgaaaatcaa ctgtcgacct cttaaaacgg atccgttatt ttgagagatt ggtccatact 3480

cttcttgact agaaaaacct tgggtttact attaaaatga aatcatcatg aaatgactga 3540

cttgttcaat ctttgcaatt ggttcttaca caattgaacc aacatactta cttagttgat 3600

tatttttctt ttttcatcaa acattggttt gttgaaggtc taaacagatg cagaaagagt 3660

tgtaggctaa gatggttgaa ctatctacgt cctaacataa agagaggaaa ttttgctgag 3720

gaggaagtgg aaatgattgt caaactccac aaattattag gcaacaggta aactttgatc 3780

tttaagactt tcctttggta ttttctaatg tgttctaagt tctaacaact aggcatgggc 3840

catgatagcc ttatgcagtt tttccaaagg tgttaaagct cattagtgaa gagtgtgcat 3900

agtaaaaagt tagtgttcaa gtatagtaaa tgatgttctc gctgaaaaaa agtatataat 3960

ataggatgtg taatattcat tcaatttgaa ccaattgatt tggttttggt gtgtttagat 4020

ttttagcaag taagatgttt ggattcactt tttgagctta tctataaata aagcatttat 4080

atttgttttg atctctaatt ttttttaaaa atgcactttt tatagatcca taacgaccaa 4140

tccttgcgtg aattgcaagg atccaataag tcctacattg attttctctg aggtgtcaat 4200

tggacaaata tatctatagt gactaggatg gatatcctgc atccgaaaac tagcagttcg 4260

tcccgtcaat cctccaggac ccaaataact caattttctc ccatgaacta tttgggtcaa 4320

tggattggtt cgatctaaaa cttgagataa tgggtgtaat ctaaaaaagg attcataagt 4380

ggttgctaat ggagttgaaa tcactaaatt ttgaggaatt cgtatcaata tatctaattg 4440

ctttatatat agttcctcaa attatatttt ctaaaccaac tagagccaat ccaaattcat 4500

cttttaatag atcactatca gtgggagtta tatgaaaaaa acttaagata tgtccatatg 4560

ttgttttctg tttattttca aaaactatct ataataactt acaaaaacaa cttacagctc 4620

atatgaaaac atttttcatt tttttacaga taaaaatagt ttattttgta aaaaaaaaaa 4680

aaaatagttt attcataagc attgatataa taagtgctta attaagttgt ttatctaaac 4740

attactcaaa tgattttagt tattgacccc tttagagtcc gcttattata gttttattgt 4800

gaaaaaaaaa aaaaattcta aacaaagttt tatcacttat aaaagttttt cccatgtgtt 4860

acaattttct tttgaaaaag agaatccgaa aaatatctaa aaattgcttc aagaaactgt 4920

gatgaataat ttctccgaaa aatcattttt atatgtggtt gttttaaggg ttaaatatgt 4980

ttttggtccc tataaatata tttacttttt gttttagtcc ctctaaattt ttctttcaac 5040

tattagtccc tataaaattt tcaatcacta cttttggtcc ctatttttaa gttaattttt 5100

gtatttttta atgaaattgt gtgaaaatgt gtagaatatt gtaaaaatct ttcttagaaa 5160

aaaagttaga tttttttaac aaaacataaa ttaaatatta atttttaacc ataaaaaata 5220

taaaaattca tttttaattc atgttttgtt aaaaaataga attttctttt gcgagagatt 5280

cttataatat tatgattttt actgcaaaat tttattgaaa atatgaattc tacatatgag 5340

tttactttaa agtagggacc aaaaatgaag atggaaaacc tttgggggac taaaagtcga 5400

agaaattttt tagagggact aaaacgaaaa gttgacatat ttatagggac caaaaacata 5460

tttagccatt gttttaaaaa ggtaaattta attaggatga acaaacacaa actagcttca 5520

acttttaatt tttttttaaa aatttctaaa aattaatctt taaaattttc aaaatcacct 5580

ttttgcaatt agtaacaaat ggaccctaag ctatttgcta caattttttt ttcttcaggt 5640

ggtccctgat tgcaggaagg ctaccaggaa ggacagcaaa tgacgtgaaa aactattgga 5700

actgtcatct aagcaaaaaa ctaaatgctc tagaagctga tcaagatagg tcacaatcat 5760

ccaaagatgt tcaaatcatt aggccacagg caagaaacat tggttcaagc tcagtgaaga 5820

gaaggagcca aggagagtca ccaactgacc aagttctagt tcaacaagag agtgacatga 5880

caacatttga tgctgatgga aagaatcata tgcttgaatc acaacaagac atgatggtgt 5940

tttcatgctt ggaccaacaa ggtatggttg gtgagtttcc aatggatttt caattagaag 6000

gatttgaagc tatggtaagt ggaggagagg gtagtagtag ccaatggaat tgggaggatt 6060

tgctcttaga tatggatcta tataatggtt tttctcgggg atctgtcgac ggtggcggag 6120

ggggtggcat gggtaaagga gaacttttca ctggagttgt cccaattctt gttgaattag 6180

atggtgatgt taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat 6240

acggaaaact tacccttaaa tttatttgca ctactggaaa actacctgtt ccctggccaa 6300

cacttgtcac tactttctct tatggtgttc aatgcttttc aagataccca gatcatatga 6360

agcggcacga cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct 6420

tcttcaagga cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc 6480

tcgtcaacag gatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc 6540

acaagttgga atacaactac aactcccaca acgtatacat catggcagac aaacaaaaga 6600

atggaatcaa agttaacttc aaaattagac acaacattga agatggaagc gttcaactag 6660

cagaccatta tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc 6720

attacctgtc cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg 6780

tccttcttga gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaggt 6840

ctatcgtcga cggtagctac ccttatgacg tccccgacta cgctggctat ccctacgatg 6900

tgcctgatta tgcctagatt attgttcctt attgccaata gggaagacaa tgtagtctct 6960

atacatgggt tgtgtgtcaa tttcaaagtt aaatgttatc caaggaaatg gtggcttaat 7020

cgatgtattt tgtaaatcga agtagttgtt gtttaaataa accaataaag tcggtcttgt 7080

gagacatagt tagccctaaa actggttagt aatatggaaa tagttttgta gctttttaaa 7140

ccctattact atatatctag tagacgattt gttttttttt aatagtatcc tagttgataa 7200

taaaaaggaa tatcctccta cataagagag gcagataaat attcctttat gttctattgg 7260

ttgatcttag tgtcataaaa aaattagcta ccaatgttaa taaagttttt aaattttgat 7320

tatggtaacg attgttctgc aatccttgat attgtagaaa attatagtta aatacaatca 7380

caactatcta aattatagtc gtaaaccttt gtttaaaatt taagtcatta tatttccatc 7440

tctttcattc cttcagaatt tgaggaatga aaatacaaat tttttcttag attatcctag 7500

tatgacatgc tattagcttc tttcttcgtc tcccttctcc cttcttcctt cattcttttt 7560

accctccaca cttattgggg gaaattctct tttattgcaa tcctttattc taggtgaatc 7620

ttttgagttg tcaatgatta tttgtgactt ttataagagt tatttgtact tttacgtttc 7680

tttgatatgt ggctcatata gaaaaataga aatgccaaac agctcttgat aaggcatgaa 7740

cagttaaatc ctaccccttc accacaaaag aagaaagtca aatcctgccc cacctctgtt 7800

tctgtttgag tatcacctgt cttcatgata tcaattaaat attggtgttt ctttgtgaca 7860

aaatatccat ttttttagct taactagttt gtttggtcgt ttttttaatt ttagccctat 7920

ggttttttaa tagtgtgatt ttgaccttcg tacttttaaa catgcgattt tgccctctct 7980

agttaaccct atttttagtt tcacaaccct ctagctctga agcccatcta ctttaaaatg 8040

gatgacgtat tgtattacat gtgtatcctg caccgatacc tatatgatac ttcctgatac 8100

atattagaag agtatctgat gattatattt tattttattt tttaaaacaa ttatctgata 8160

ctattcagat acatctggaa tacgagggat aagcggtaga aaaccgatat gtgcgggcta 8220

cctgatgttt ttattatatt tgatacatat gcaattgact aagtaatgat gttttctatt 8280

taggatatat atcatatatg taattgatta attgtcgatt tatttattat caatattact 8340

tacatttata tctccatcgt tgccgtcgtc tgttttgtgt ctctttattt gtttgagaac 8400

gatgctattg ttgattg 8417

Claims

1. Use of any of the following for modulating carotenoid content in a plant;

1) the protein is composed of an amino acid sequence shown in a sequence 2 in a sequence table;

2) a gene encoding the protein of 1);

3) a recombinant expression vector, an expression cassette or a recombinant bacterium containing the gene of 2).

2. The use of claim 1, wherein: the genes are as follows (b1) or (b 2):

(b2) DNA molecule shown in sequence 5 of the sequence table.

3. A method of breeding a transgenic plant comprising the steps of: inhibiting the expression of the gene of claim 1 or 2 in a plant of interest to obtain a transgenic plant with reduced carotenoid content.

4. A method for reducing the carotenoid content of a plant comprises the following steps: inhibiting the expression of the protein of claim 1 in a plant of interest to obtain a transgenic plant having a reduced carotenoid content.

5. A method of breeding a transgenic plant comprising the steps of: a transgenic plant having an increased carotenoid content is obtained by introducing the gene of claim 1 or 2 into a target plant.

6. A method for increasing the carotenoid content in a plant, comprising the steps of: increasing the expression level of the protein of claim 1 in a plant of interest to obtain a transgenic plant with increased carotenoid content.

7. Use of the method of any one of claims 3 to 6 in plant breeding.