CN108395473A - Carotenoid in Plants synthesis associated protein and its encoding gene and application - Google Patents

Abstract

The invention discloses a kind of Carotenoid in Plants synthesis associated protein and its encoding gene and applications.It is following (a1) or (a2) the present invention provides a kind of protein：(a1) protein that amino acid sequence forms shown in sequence in sequence table 2；(a2) by amino acid sequence shown in sequence in sequence table 2 by one or several amino acid residues substitution and/or lack and or add and with the protein with the same function derived from sequence 2.The present inventor clones WF1 genes from M. truncatula, successfully builds plant complementing vector, converts M. truncatula white flower-mutant using agriculture bacillus mediated leaf disk method, compared with the control, the flower for being transferred to the white flower M. truncatula of WF1 genes becomes yellow.Present disclosure can be to study the gene to regulate and control carotenogenesis in plant and lay the first stone.

Description

Carotenoid in Plants synthesis associated protein and its encoding gene and application

Technical field

The present invention relates to a kind of Carotenoid in Plants synthesis associated protein and its encoding gene and applications.

Background technology

Pulse family (Leguminosae) plant is the third-largest section for being only second to composite family and orchid family, extensively there are about 700 18000 kinds of categories It is general to be distributed in the whole world, it is the important sources of human foods and oil plant and herbage, green manure, medicinal material and timber etc., has important Economy, ecology and biological value.But since most of legume genome is larger, genetic conversion system is still immature Etc. factors, limit the research of legume functional genomics.M. truncatula (Medicagotruncatula) is annual Herbaceous plant, grazing-type herbage are beans because growth period is short, ploidy is small, genome is small, self-pollination and the features such as fixed nitrogen The idealized model plant of section's Plant genetics and genomics research.

Carotenoid is the general name of a kind of C40 terpenoid compounds and its derivative, be all photosynthetic organisms it is basic at Point, it is widely present in animal, plant, algae, bacterium and fungi, but animal itself cannot synthesize carotenoid, it can only be from outer It absorbs on boundary.Carotenoid is the precursor substance of vitamin A needed by human, plays anti-oxidant, the work(such as removing free radical in vivo Can, and it is related to the colors such as the yellow in the flowers of plant, fruit to red.Carotenoid identified at present is tied by it Structure difference is divided into hydrocarbon carotenes, in orange, red；Alcohol carotenoid is in yellow；Ketone and acid carotenoid take on a red color.

Invention content

The object of the present invention is to provide a kind of Carotenoid in Plants synthesis associated protein and its encoding gene and applications.

The present invention provides a kind of protein (being named as WF1 albumen), are obtained from M. truncatula, are following (a1) or (a2)：

(a1) protein that amino acid sequence forms shown in sequence in sequence table 2；

(a2) by amino acid sequence shown in sequence in sequence table 2 by one or several amino acid residues substitution and/ Or lack and or add and with the protein with the same function derived from sequence 2.

In order to make WF1 albumen in (a1) convenient for purifying and detection, can in by sequence table amino acid sequence shown in sequence 1 Arrange the amino terminal or the upper label as shown in Table 1 of carboxyl terminal connection of the protein of composition.

The sequence of 1 label of table

Label	Residue	Sequence
			Poly--Arg	5-6 (being usually 5)	RRRRR
Poly-His	2-10 (being usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

WF1 albumen in above-mentioned (a2) can be artificial synthesized, also can first synthesize its encoding gene, then carries out biological expression and obtain It arrives.The encoding gene of WF1 albumen in above-mentioned (a2) can be by will lack one in DNA sequence dna shown in sequence in sequence table 1 Or the codon of several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 ' end and/ Or 3 ' end connect the coded sequence of label shown in table 1 and obtain.

The gene (WF1 genes) for encoding the WF1 albumen also belongs to protection scope of the present invention.

The gene is any DNA molecular in following (b1)-(b4)：

(b1) DNA molecular shown in sequence 1 in code area such as sequence table；

(b2) DNA molecular shown in the sequence 5 of sequence table；

(b3) hybridize under strict conditions with (b1) or (b2) DNA sequence dna limited and encode albumen described in claim 1 The DNA molecular of matter；

(b4) from M. truncatula and homologous with 90% or more with the DNA sequence dna of (b1) or (b2) or (b3) restriction Property and encode claim 1 described in protein DNA molecular.

Above-mentioned stringent condition can be with 0.1 × SSPE (or 0.1 × SSC), and the solution of 0.1%SDS is miscellaneous in DNA or RNA It hands over and hybridizes at 65 DEG C in experiment and wash film.

Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing the WF1 genes belong to the present invention Protection domain.

The recombinant expression carrier concretely inserts sequence table in the KpnI restriction enzyme sites of pCAMBIA2300 plasmids Sequence 3 shown in DNA fragmentation, and DNA fragmentation shown in the sequence 4 of insetion sequence table obtains in PstI restriction enzyme sites Recombinant plasmid.

The expression vector of the recombinant expression carrier concretely double chain DNA molecule shown in the sequence 5 containing ordered list.

The present invention also protects the application of WF1 albumen or WF1 genes in regulating and controlling Carotenoid in Plants content.

The present invention also protects a kind of method (method 1) for cultivating genetically modified plants, includes the following steps：Inhibit purpose plant The expression of middle WF1 genes obtains the genetically modified plants of carotenoid content reduction.

The present invention also protects a kind of method (method 2) reducing Carotenoid in Plants content, includes the following steps：Inhibit The activity and/or expression quantity of WF1 albumen in purpose plant obtain the genetically modified plants of carotenoid content reduction.

The present invention also protects a kind of method (method 3) for cultivating genetically modified plants, includes the following steps：WF1 genes are led Enter purpose plant, obtains the genetically modified plants of carotenoid content raising.

In the method, the WF1 genes can import purpose plant by recombinant expression carrier.The recombinant expression carries Body can be conventional by Ti-plasmids, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated etc. Biological method is transformed into plant cell or tissue.

The recombinant expression carrier concretely inserts sequence table in the KpnI restriction enzyme sites of pCAMBIA2300 plasmids Sequence 3 shown in DNA fragmentation, and DNA fragmentation shown in the sequence 4 of insetion sequence table obtains in PstI restriction enzyme sites Recombinant plasmid.

The expression vector of the recombinant expression carrier concretely double chain DNA molecule shown in the sequence 5 containing ordered list.

The present invention also protects a kind of method (method 4) that raising Carotenoid in Plants content improves, and includes the following steps： The activity and/or expression quantity for improving WF1 albumen in purpose plant obtain the genetically modified plants of carotenoid content raising.

The present invention also protects the application of WF1 albumen or the method for WF1 genes or any description above in plant breeding.

The purpose of the breeding is to cultivate the low plant of carotenoid high plant (method 3 or method 4) or carotenoid Object (method 1 or method 2).

Any description above purpose plant is dicotyledon or monocotyledon.The dicotyledon is planted for Rosales Object, the Rosales plant are legume.The legume is clover.The clover is puncture vine lucerne Mu.In method 1 or method 2, the purpose plant more specifically can be M. truncatula R108.In method 3 or method 4, the purpose Plant more specifically can be wf1 mutant (The Nobel Foundation, number：NF4496).

Any description above carrotene concretely lutein.

Any description above plant is dicotyledon or monocotyledon.The dicotyledon is Rosales plant, The Rosales plant is legume.The legume is clover.The clover is M. truncatula, more Concretely M. truncatula R108.

The present inventor clones WF1 genes from M. truncatula, plant complementing vector is successfully built, using agriculture bar The leaf disk method conversion M. truncatula white flower-mutant that bacterium mediates is transferred to the flower of the white flower M. truncatula of WF1 genes compared with the control Become yellow.Present disclosure can be to study the gene to regulate and control carotenogenesis in plant and lay the first stone.

Description of the drawings

Fig. 1 is that M. truncatula R108 wild types flower and M. truncatula wf1 white flower-mutants spend phenotypic map.

Fig. 2 is that R108 flowers and wf1 spend middle carotenoid content and composition measurement.

Fig. 3 is that WF1 is analyzed with white flower phenotype linkage relationship.

Fig. 4 is wf1 mutant complementations transfer-gen plant pattern phenotypic analysis and wf1 mutant complementation transfer-gen plant molecules Detection.

Fig. 5 is the expression analysis of wf1 mutant complementation transfer-gen plant carotenogenesis related genes.

Specific implementation mode

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even Mean value.

M. truncatula R108 (wild type)：The Nobel Foundation.

Wf1 mutant：The Nobel Foundation, number：NF4496.

Wf1-2 mutant：The Nobel Foundation, number：NF10625.

Wf1-3 mutant：The Nobel Foundation, number：NF10301.

PCAMBIA2300 plasmids：The Wuhan bio tech ltd Zhong Liyuan, article No.：P0283.

Agrobacterium AGL1：Biomed, article No.：BC302-01.

YEP solid mediums：Peptone 10g, yeast extract 10g, sodium chloride 5g, agar powder 10g, distilled water are settled to 1L。

YEP fluid nutrient mediums：Peptone 10g, yeast extract 10g, sodium chloride 5g, distilled water are settled to 1L.

Callus induced fluid culture medium (PH 5.8)：A great number of elements mother liquor 100mL, micro- mother liquor 1mL, organic element Mother liquor 1mL, mother liquid of iron salt 140mg, inositol 100mg, sucrose 30g, auxin 4mg, basic element of cell division 0.5mg, cephalo 200mg, Ticarcillin/Clavulanate Acid 250mg, cremart 2mg, are settled to 1L.

Callus induces solid medium (PH 5.8)：A great number of elements mother liquor 100mL, micro- mother liquor 1mL, organic element Mother liquor 1mL, mother liquid of iron salt 140mg, inositol 100mg, sucrose 30g, auxin 4mg, basic element of cell division 0.5mg, cephalo 200mg, Ticarcillin/Clavulanate Acid 250mg, cremart 2mg, Phytagel 3.2g, are settled to 1L.

Differential medium (PH 5.8)：A great number of elements mother liquor 100mL, micro- mother liquor 1mL, organic element mother liquor 1mL, Mother liquid of iron salt 140mg, inositol 100mg, sucrose 20g, cephalo 200mg, Ticarcillin/Clavulanate Acid 250mg, cremart 2mg, Phytagel 3.2g is settled to 1L.

Root media (PH 5.8)：Murashige&Skoog Basal Medium with Vitamins 2.215g/ L (companies：PhytoTechnology Laboratories, article No.：16B0519138A)

Mother liquid of iron salt：Disodium ethylene diamine tetraacetate 37.3mg, green vitriol 27.8mg.

A great number of elements mother liquor：Bitter salt 1.85g, potassium nitrate 28.3g, ammonium sulfate 4.63g, CALCIUM CHLORIDE DIHYDRATE 1.66g, potassium dihydrogen phosphate 4g, distilled water are settled to 1L.

Micro- mother liquor：Manganous sulfate monohydrate 1g, boric acid 500mg, Zinc vitriol 100mg, potassium iodide 100mg, Two molybdic acid hydrates receive 10mg, Salzburg vitriol 20mg, cobalt chloride hexahydrate 10mg, and distilled water is settled to 1L.

Organic element mother liquor：Niacin 500mg, thiamine hydrochloride 500mg, puridoxine hydrochloride 500mg, distilled water are settled to 1L。

The discovery of embodiment 1, WF1 and its encoding gene WF1

One, mutant acquisition and phenotypic analysis

By screening M. truncatula Tnt1 insertional mutagenesis libraries, obtains a pattern and white is become by the yellow of wild type Extreme abnormal sudden change body, be named as white flower1 (wf1).

The flower Phenotypic Observation the result is shown in Figure 1 of wf1 mutant and M. truncatula R108 (wild type).In Fig. 1, A：Wild type R108 spends front；B：Wild type R108 star-spangled banner valves；C：The ala and fossil fragments of wild type R108 flower fusions；D：Wild type R108 flowers Diadelphous stamen；E：Wf1 spends front；F：Wf1 star-spangled banner valves；G：The ala and fossil fragments of wf1 flower fusions；H：Wf1 spends diadelphous stamen.It is wild The ala closure bone flap for spending front, star-spangled banner valve, flower to merge of raw type R108 is yellow；Wf1 spends front, star-spangled banner valve, flower fusion Ala and fossil fragments be white.

Two, pigments composition measures

Plant to be measured：M. truncatula R108 (wild type) and wf1 mutant.

The pigment composition in plant to be measured is analyzed, steps are as follows：

1, mortar and medicine spoon are cleaned, pour into appropriate absolute ethyl alcohol and lights calcination, room temperature cools down 1h, is used before being put into sample Liquid nitrogen freezes 2-3 times.

2, take growth conditions consistent, wide-open plant petal about 20mg to be measured (about 8-9, removal petiole, sepal with Stamen), it is put into liquid nitrogen rapidly after precise weight and freezes.

3, after completing step 2, petal is ground in the mortar that step 1 is handled well, after grinding, 100 μ l6% is added (w/v) KOH/methanol solution, after vortex 10s mixings, the lower 60 DEG C of heating 1h of dark condition.

4, after completing step 3,100 μ l Tris-HCl buffer (50mM, pH7.5, NaCl containing 1M) is added, run up and down 8-10 times, 10min is placed after mixing well on ice.

5, after completing step 4,400 μ L chloroforms is added, 10min is placed on ice after the mixing that turns upside down.

6, after completing step 5,4 DEG C, 3000g centrifugation 5min take lower liquid.

7, upper layer remaining liq is extracted again according to step 5,6, the lower liquid that 2 times are obtained mixes, nitrogen It is dissolved with 100 μ L ethyl acetate after drying, pigment composition is detected by HPLC.

Standard items：Lutein Lutein (Carotenature, NO.0133)；

Chromatographic column：5 μm of C of YMC companies₃₀20 × 4.6mmC of column (250 × 4.6mm) series connection₃₀Column；

Sample size：10μL；

Flow velocity：1.0mL·min^-1；

Column temperature：25℃；

Detection wavelength：450nm；

Mobile phase：A：Methanol；B：Water/methanol (volume ratio 1/4 contains 0.2% ammonium acetate)；C：Tertiary methyl butyl ether

Gradient elution：95%A, 5%B isocratic elution 12 minutes, 80%A, 5%B, 15%C elution 12 minutes, subsequent 30% A, 5%B, 65%C are eluted 30 minutes.

The results are shown in Figure 2.The result shows that it is lutein that M. truncatula R108 (wild type), which spends middle primary pigments, (Lutein), the lutein content during wf1 mutant is spent is far below wild type.

Three, the confirmation of WF1 and white flower phenotype linkage relationship and its acquisition of encoding gene WF1

1, according to M. truncatula mutant database (https：//medicago-mutant.noble.org/mutant/) The flanking sequence of the Tnt1 retrotransponsons insertion points of offer, designs corresponding primer WF1-Insertion-6-F and WF1- Insertion-6-R is combined with the primer of Tnt1 (LTR6 or LTR31) respectively, and screening is isolated with wf1 mutation type surfaces Tnt1 insertion points, preliminary latch target gene.

LRT31-F(5’-3’)：CTCCTCTCGGGGTCGTGGTT

LTR6-R(5’-3’)：GCTACCAACCAAACCAAGTCAA

WF1-Insertion-6-F(5’-3’)：GGTGTTGCATGGACAGAA

WF1-Insertion-6-R(5’-3’)：GCCCATGCCTAGTTGTTA

2, extract the total serum IgE of M. truncatula R108 (wild type) wide-open chrysanthemum, reverse transcription at cDNA as template, It is expanded using primer pair WF1-F/WF1-R, obtains pcr amplification product.It is sequenced, obtains the code area sequence of target gene Row, as shown in sequence 1 in sequence table, protein shown in the sequence 2 of polynucleotide.Egg shown in sequence 2 by sequence table White matter is named as WF1, is made of 230 amino acid residues.The encoding gene of WF1 is named as WF1 genes.

3, further reversed to screen M. truncatula Tnt1 retrotransponsons insertional mutagenesis libraries, and obtain other two WF1 Tnt1 insertion mutation bodies wf1-2 and wf1-3.Then to M. truncatula R108 (wild type), wf1 mutant, wf1-2 and wf1-3 Mutant carries out genome and transcriptional level analysis, and is analysed in depth to the phenotype of completely open flower.

4, the genomic DNA of extraction M. truncatula R108 (wild type) and three mutant is template, according to M. truncatula Mutant database (https：//medicago-mutant.noble.org/mutant/) provide Tnt1 retrotransponsons be inserted into Site sequence design primer analyzes the insertion situation of Tnt1 retrotransponsons in wf1-1, wf1-2 and wf1-3 respectively, the results show that Tnt1 is inserted respectively on second exon and third exon in wf1-1 and wf1-2, leads to Huang of the pattern by wild type Discoloration is at white, and Tnt1 is inserted into the 3 ' areas UTR of its genome in wf1-3 mutant, leads to yellow of the pattern by wild type Become light yellow (Fig. 3 A).WF1 gene expression amount situations in three mutant are further analyzed on transcriptional level, extraction is wild respectively The total serum IgE of raw type R108 and three mutant, reverse transcription at cDNA be template, with WF1 CDS amplimers WF1-F/WF1-R The primer pair amplifies WF1 genes of composition, and in the primer pair amplifies M. truncatula formed with primer MtActin-F/MtActin-R Join gene M tActin, carry out RT-PCR, amplified production the results show that compared with wild type in wf1-1 WF1 genes purpose piece Duan Bian little, the sequencing fragment result show its second Exon deletion, lead to WF1 gene 130bp base deletions, to make this Gene, which generates frameshift mutation, leads to afunction (Fig. 3 B).Through sequencing, WF1 gene mistakes splicing (scheming C) in wf1-1 mutant. Respectively extract wild type R108 and three mutant total serum IgE, reverse transcription at cDNA be template, with WF1 special primers qWF1- The primer pair amplifies WF1 genes of F/qWF1-R compositions, and the primer pair amplifies formed with primer qMtActin-F/qMtActin-R M. truncatula reference gene MtActin carries out Real-time PCR, shows that the expression of WF1 genes in three mutant is equal Significantly lower than wild type (Fig. 3 D), further demonstrating the missing of WF1 genes causes M. truncatula pattern to become white by yellow Color illustrates that WF1 is played an important role in the regulation and control of M. truncatula pattern.Fig. 3 E：Wild type R108 spends front；Fig. 3 F：Wf1 is spent Front；Fig. 3 G：Wf1-2 spends front；Fig. 3 H：Wf1-3 spends front.The front of spending of wild type R108 is yellow；Wf1 spend front and It is white that wf1-2, which spends front, and it is light yellow that wf1-3, which spends front,.

WF1-F(5’-3’)：CAAAAAAGCAGGCTTCATGGGTGGTGTTGCATGGAC

WF1-R(5’-3’)：CAAGAAAGCTGGGTCCTAAGAAAAACCATTATATAGATCC

MtActin-F：TCTTACTCTCAAGTACCCCATTGAGC

MtActin-R：GTGGGAGTGCATAACCCTCATAGATT

The functional verification of embodiment 2, WF1 genes

In order to further verify effects of the WF1 in carotenogenesis regulation and control, by carrying out WF1 in wf1 mutant Genome complementation experiment carries out functional verification.

One, the structure of complementary expression vector

DNA fragmentation shown in the sequence 3 of sequence table is inserted in the KpnI restriction enzyme sites of pCAMBIA2300 plasmids, and And the DNA fragmentation shown in the sequence 4 of insetion sequence table in PstI restriction enzyme sites, obtain recombinant plasmid pWF1pro：：WF1 GDNA-1.5KASC (sequence verification).

The sequence 3 of sequence table is WF1 upstream region of gene 3K promoters section and WF1 gene gDNA sections, the sequence 4 of sequence table For the terminators WF1 downstream of gene 1.5K section.The sequence 5 of sequence table is WF1 upstream region of gene 3K promoter section-WF1 genes The complete sequence of the gDNA sections-terminators carrier intermediate segment-WF1 downstream of gene 1.5K section.

Two, the acquisition of complemented mutant body plant

1, the recombinant plasmid pWF1pro for preparing step 1：：WF1 gDNA-1.5KASC convert Agrobacterium AGL1, obtain Recombinant bacterium AGL1/pWF1pro：：WF1 gDNA-1.5KASC.

2, the recombinant bacterium AGL1/pWF1pro for obtaining step 1：：WF1 gDNA-1.5KASC are inoculated in containing 50mg/mL Rifampin antibiotic and 50mg/mL card that antibiotic YEP solid mediums on, 28 DEG C culture to single bacterium colony is grown, choose Take single bacterium to drop down onto in YEP fluid nutrient mediums, 28 DEG C, 200rpm shaken cultivations stay overnight.

3, it after completing step 2, takes 500 μ L bacterium solutions to be inoculated in 5mLYEP fluid nutrient mediums, adds 5 μ L 100mg/mL Acetosyringone, 28 DEG C, 200rpm shaken cultivations to OD_600nm=0.8,3800rpm centrifuge bacterium solution 15min and collect thalline.

4, the thalline that step 3 obtains is resuspended using the SH3a fluid nutrient mediums of the acetosyringone containing 100mg/L, adjusts bacterium Liquid OD_600nm=0.2, it obtains infecting liquid.

5, growth 4 weeks or so wf1 mutant, first compound leaf is taken, about 10s is washed with 75% ethyl alcohol, then with 5% sodium hypochlorite 5min is sterilized, is at least washed with sterile water 5 times in super-clean bench, be put into that step 4 obtains after cut-off blade infects in liquid, infects 15min。

6, after completing step 5, the blade after infecting is transferred on SH3a solid mediums, culture surrounding is to there is white Embryo callus (replaces a subculture in two weeks).

7, after completing step 6, white embryo callus is transferred on differential medium, culture surrounding is green to differentiating Color embryoid (replaces a subculture in two weeks).

8, after completing step 7, green embryoid is transferred on root media, a subculture is replaced within two weeks, takes root It is moved in vermiculite after coming into leaves, until seedling, obtains T0 for complemented mutant body plant.

T0 generation selfings obtain T1 generations, and T1 generation selfings obtain T2 generations.

9, recombinant plasmid pWF1pro is substituted using pCAMBIA2300 plasmids：：WF1 gDNA-1.5KASC, according to step 1- 8 are operated, and obtain turning empty carrier plant (pCAMBIA2300-GFP-HA/wf1).

Three, the phenotype of complemented mutant body plant

Plant to be measured：M. truncatula R108 (wild type), wf1 mutant, complemented mutant body plant (F2 generations) (pWF1：WF1 GDNA-GFP-HA/wf1), turn empty carrier plant (pCAMBIA2300-GFP-HA/wf1).

Observe the wide-open colored phenotype of plant to be measured.As a result as illustrated in figs. 4 a-4d.The result shows that complemented mutant body The pattern of plant is become the yellow of similar wild type by the white of wf1 mutant.The pattern of control vector plant is to be mutated with wf1 The identical white of body.It is white to turn empty carrier plant pattern still, and excluding carrier influences pattern.

Four, complemented mutant body plant carotenogenic gene expression analysis

Plant to be measured：M. truncatula R108 (wild type), wf1 mutant, empty carrier transformed plant (F2 generations) (pCAMBIA2300/wf1-7), complemented mutant body plant (F2 generations) (pWF1：WF1 gDNA-GFP-HA/wf1-1).

1, the wide-open colored total serum IgE of plant to be measured is extracted, and is reversed to cDNA.

2, the cDNA obtained using step 1 is template, using qRT-PCR detection wild types R108, wf1 mutant, wf1-2 and Wf1-3 mutant spends the expression of middle carotenogenesis related gene, the following (MtActin of gene and its detection primer of detection For reference gene)：

qMtActin-F(5’-3’)：TCAATGTGCCTGCCATGTATGT

qMtActin-R(5’-3’)：ACTCACACCGTCACCAGAATCC

qMtWF1-F(5’-3’)：CTAGAAGCTGATCAAGATAGGTCAC

qMtWF1-R(5’-3’)：CTTGGCTCCTTCTCTTCACTG

qMtPSY-F(5’-3’)：ATGACTCCTGAAAGGCGAAG

qMtPSY-R(5’-3’)：TGATTCCCACCTATCCATTGC

qMtPDS-F(5’-3’)：TTCTACCTTTCGTGCTTCTCC

qMtPDS-R(5’-3’)：TTTCCACCTAGAACGTCTCTTG

qMtZDS-F(5’-3’)：CCTCCCGTTTTACTAAGACTCG

qMtZDS-R(5’-3’)：CTCGATAATGTTCAGGCTCCG

qMtCRTISO-F(5’-3’)：CTCTCCCTTTCTAACCACACC

qMtCRTISO-R(5’-3’)：TTTCACCGCCACCCTTTT

qMtLYCE-F(5’-3’)：AGCATGTTTGGAAGGATACCG

qMtLYCE-R(5’-3’)：GAGCCAAGATATGAGACACCTG

qMtLYCB-F(5’-3’)：TGTGGATCTTGTCGTTGTCG

qMtLYCB-R(5’-3’)：CCTCAAATTCATCCACCCAAAC

qMtECH-F(5’-3’)：GGCTGTTCAAATTGGTGCTG

qMtECH-R(5’-3’)：TCCACAGCTCCATTACCTTTC

qMtBCHa-F(5’-3’)：TTTGCTCTATCAGTGGGTGC

qMtBCHa-R(5’-3’)：CACAAGGAAGCATGCCAAAG

qMtBCHb-F(5’-3’)：TCACTTACCTAGTTGCAGCTG

qMtBCHb-R(5’-3’)：GCCAAACATTTCAGACCAAGG

qMtVDE-F(5’-3’)：ACCAGAGCCTTCCATTGTG

qMtVDE-R(5’-3’)：CCTTCTCCAAATCCTTCTCCAC

qMtZEP-F(5’-3’)：AGTGGTCTTGGATAATGGTCAG

qMtZEP-R(5’-3’)：CCCGAGTATGTAGCTTCTGTTG

qMtNXS-F(5’-3’)：ACCAAACTTCTCTTTACTGTTCTGT

qMtNXS-R(5’-3’)：AGATTGAAGGAGAAATGATTGTGTG

Each strain detects 3 plants.

Testing result (in the testing result of each gene, is followed successively by M. truncatula R108, wf1 from left to right as shown in Figure 5 Mutant, pCAMBIA2300/wf1-1 and pWF1：WF1 gDNA-GFP-HA/wf1-1).Wf1 mutant complementation transfer-gen plants The expression quantity of middle carotenogenesis related gene is spent to be increased with respect to wf1 mutant, and expression quantity is significantly more than wild type R108 The testing result of the expression quantity of middle carotenogenesis related gene, control vector plant is identical as wf1 mutant, it was demonstrated that WF1 Gene can effectively improve the expression of carotenogenesis related gene, to improve carotenoid output.

<110>Biological Technology institute, Chinese Academy of Agricultural Sciences

<120>Carotenoid in Plants synthesis associated protein and its encoding gene and application

<160> 5

<210> 1

<211> 690

<212> DNA

<213>M. truncatula (Medicago truncatula)

<400> 1

atgggtggtg ttgcatggac agaagaagaa gatcacttgc ttaagaaatg catacaacaa 60

tatggtgaag gaaagtggca tagggttcca ctattggctg gtctaaacag atgcagaaag 120

agttgtaggc taagatggtt gaactatcta cgtcctaaca taaagagagg aaattttgct 180

gaggaggaag tggaaatgat tgtcaaactc cacaaattat taggcaacag gtggtccctg 240

attgcaggaa ggctaccagg aaggacagca aatgacgtga aaaactattg gaactgtcat 300

ctaagcaaaa aactaaatgc tctagaagct gatcaagata ggtcacaatc atccaaagat 360

gttcaaatca ttaggccaca ggcaagaaac attggttcaa gctcagtgaa gagaaggagc 420

caaggagagt caccaactga ccaagttcta gttcaacaag agagtgacat gacaacattt 480

gatgctgatg gaaagaatca tatgcttgaa tcacaacaag acatgatggt gttttcatgc 540

ttggaccaac aaggtatggt tggtgagttt ccaatggatt ttcaattaga aggatttgaa 600

gctatggtaa gtggaggaga gggtagtagt agccaatgga attgggagga tttgctctta 660

gatatggatc tatataatgg tttttcttag 690

<210> 2

<211> 229

<212> PRT

<213>M. truncatula (Medicago truncatula)

<400> 2

Met Gly Gly Val Ala Trp Thr Glu Glu Glu Asp His Leu Leu Lys Lys

1 5 10 15

Cys Ile Gln Gln Tyr Gly Glu Gly Lys Trp His Arg Val Pro Leu Leu

20 25 30

Ala Gly Leu Asn Arg Cys Arg Lys Ser Cys Arg Leu Arg Trp Leu Asn

35 40 45

Tyr Leu Arg Pro Asn Ile Lys Arg Gly Asn Phe Ala Glu Glu Glu Val

50 55 60

Glu Met Ile Val Lys Leu His Lys Leu Leu Gly Asn Arg Trp Ser Leu

65 70 75 80

Ile Ala Gly Arg Leu Pro Gly Arg Thr Ala Asn Asp Val Lys Asn Tyr

85 90 95

Trp Asn Cys His Leu Ser Lys Lys Leu Asn Ala Leu Glu Ala Asp Gln

100 105 110

Asp Arg Ser Gln Ser Ser Lys Asp Val Gln Ile Ile Arg Pro Gln Ala

115 120 125

Arg Asn Ile Gly Ser Ser Ser Val Lys Arg Arg Ser Gln Gly Glu Ser

130 135 140

Pro Thr Asp Gln Val Leu Val Gln Gln Glu Ser Asp Met Thr Thr Phe

145 150 155 160

Asp Ala Asp Gly Lys Asn His Met Leu Glu Ser Gln Gln Asp Met Met

165 170 175

Val Tyr Ser Cys Leu Asp Gln Gln Gly Met Val Gly Glu Phe Pro Met

180 185 190

Asp Phe Gln Leu Glu Gly Phe Glu Ala Met Val Ser Gly Gly Glu Gly

195 200 205

Ser Ser Ser Gln Trp Asn Trp Glu Asp Leu Leu Leu Asp Met Asp Leu

210 215 220

Tyr Asn Gly Phe Ser

225

<210> 3

<211> 6095

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 3

actcttttac tacaattgca agttattata tttcaggaac aaaatattct aaagattgag 60

tcttggagca aaagaaagga gaattggagc tgattcgtgc caaaaatata aaagatctta 120

tacaaaaata tatggtgcaa ggattgagga aaaatatatg aatatctcat acaaaaatat 180

catgtgcaaa gaatttgaag atcttgtaca aatctataca agaggcgcgc cccactttag 240

tccttttgct gtttttgctt tccagacaag ctacctatta gtttatttct gacctaaaag 300

cctttggttt cttgtggaac attctagtga tgtattcctt aggttttaag tcgttataga 360

ctataaatag agtagctagc tatcataaca aatcatcttt tgttctctga aataataagt 420

gacaattgtt ttttttaata aaagttcatc tttattttct ttattttatt ttatgttctt 480

tttcttcttc ttcttcttct tcttttctat ggctacaatg aacgttagtg agtagactct 540

tcttgttttg ggattgttgg ataagtctaa tgacataatc ttaatcaaac caagccttaa 600

attctaattt atgtaaccct aatttctaat ctaaattcac cgttttaaca tgacttaaca 660

attatcaaac tgtagaagcg aaagtggagg gttagtaatt gttaattcat catctcaaat 720

atcaattcat aaaacgaaag tggagttttg atattcgaac aagtgaattt agacaaggat 780

tgcgaaacat gaaaatagtc tagcaaacct tgagacatat aaagtttcga acttcaagga 840

ttctaatagc aatcaaccat gaaaataggc gtgattgcta gaggaacaca ctcaatgaga 900

ccgaaagaag atgtgatagg ctaaagagaa acttgtcttt agaaattaag tctaacataa 960

ggttctaggt ttaatggttt ggtttgtgaa gggtttgtcg ccatgacgga ccaataatca 1020

caaggctctt ttatttttat tattttctta attaaaaatc caaacttttt aacctttgaa 1080

actttcatct aatcaatatt aaaagttaat tgaattcata actccctgtc ggaacgatac 1140

tctttttact acttcggtag aaccgtgcac ttgcggtttt atcccatcaa aagccatgat 1200

agtggatcct ttttccataa tggtggtaag gagatcaaga gagatggggt gataaattaa 1260

tagaagaacg gttgaatcaa gaaccgtcca catttcaaaa ctagcgtcaa atggaagtag 1320

gcttctcttt tccgggttga tgaatgatat gattgataac cttgttgaca ctagcatgaa 1380

tctcaaacaa ttcagtccac acggcatagt gatccttctc catttctagc acaaaagcaa 1440

tgtttttttt ttttttttaa tttttttttt tatattggtc actacaaggg ccgagtgaaa 1500

atcgggtttt gccgaattgg aggtcacgac agcgatggag gacacgaaag tgaacgacaa 1560

catggcaggg gaggaaggca tggtgtgacg agagagagag agagagagag agagagagag 1620

agagagagag agagagagag agagagagag agagagagag agagagagag agagagagag 1680

agagagagag agctgctggc acggtggtta gtgcggcaaa ggaagacact tgatcgacca 1740

tgggcggctc aagagaatag gcagcggcgg ccttgggtga agaaaatggc ggcggttgca 1800

aggaagaaag gggtaggtta cgtgggaaat tagactcgtg ataccataaa ggaaatcaat 1860

tcgtgaattt cattgataat gataagagta tatatatagt tacaataggt agagtcaaat 1920

ctaggagagt aattagaaaa taatggagag taattacaaa gtaataacta acataattac 1980

taacataatt acataaggtc aaacattcta tcatgaaact tcccaacaca cccggctcac 2040

acttagagct gaaaatccga agcatgacca gagtcattca ataatgggcg gtccaacgag 2100

tcttagaagg ttctaataaa atcttagaat taggattgaa cctaatccaa tcttagaaaa 2160

ccgatttgtg agacgatgag gacccaccga ttatagctaa tacttttaaa ttactcccta 2220

aatttaagat agaaagaaga aagctaattt ttttttagga ctacgtaatt tgttgctgcg 2280

cgatgcaatg cattagttgc gcctactatg tcctgacatt acaaagcggt tttaatagtg 2340

atttacaatc acactgcaat tgtagcctga tgcgattggc accaccacaa ccacaatatt 2400

gggaccgtat caggtgatac ggtccccaat ttgaaacatt gattggggct acaattgcag 2460

ttgtttagtg tattttaaaa tatggttgat atttagttaa aggggagtaa aaggcggaga 2520

ggattcacgt ccttgttcga taactaactt tatgcattct gaaagacttc actgttggca 2580

ttattgttat tctaagaaaa ctctcctaat cttaatgaga tgacaaatga cagaaaaata 2640

cagatgggat aggtttggct ttgaatagga aataatacaa gcttctaatg tatgatgaga 2700

tccaatttct ttgagatgat gaggaccacc attggatact tatgatgtct atttaaaaac 2760

atagagcttg gtatcagagt tttagaaaga gcaatggacc atttactatg aattttgaag 2820

catacgacat agtatattac tctgccttgc tggctagttt ggcacatctt acttcaagaa 2880

acatgtgtgt gtgtaggtgt gtatgtgttt atcaccacca cacatatata taaaagatgc 2940

aggtgtgggt cgaatatgag ggtgaaaaag tagtagtggt tgaagagttt cataagagat 3000

gggtggtgtt gcatggacag aagaagaaga tcacttgctt aagaaatgca tacaacaata 3060

tggtgaagga aagtggcata gggttccact attggctggt aaaagttaat caattatttt 3120

tcctttttct tgatatttct atttgtcttc tctaaaacgg atatttaatt acttctttga 3180

agtatgtcat ctgaggttcg atctctcaca aatatgtatg gaagaacatt tttttattga 3240

aaaatcaatc gtcgacctct taaaacggat catattattt tgagagattg gtccatactc 3300

ttgactagga aaaccttggg ttcactatta aaatgaaatc atcatgaaat gaccgactct 3360

tgaagtatgt catctgaggt tccatctctg ataaatatgt atggaagaac atttttttat 3420

tgaaaatcaa ctgtcgacct cttaaaacgg atccgttatt ttgagagatt ggtccatact 3480

cttcttgact agaaaaacct tgggtttact attaaaatga aatcatcatg aaatgactga 3540

cttgttcaat ctttgcaatt ggttcttaca caattgaacc aacatactta cttagttgat 3600

tatttttctt ttttcatcaa acattggttt gttgaaggtc taaacagatg cagaaagagt 3660

tgtaggctaa gatggttgaa ctatctacgt cctaacataa agagaggaaa ttttgctgag 3720

gaggaagtgg aaatgattgt caaactccac aaattattag gcaacaggta aactttgatc 3780

tttaagactt tcctttggta ttttctaatg tgttctaagt tctaacaact aggcatgggc 3840

catgatagcc ttatgcagtt tttccaaagg tgttaaagct cattagtgaa gagtgtgcat 3900

agtaaaaagt tagtgttcaa gtatagtaaa tgatgttctc gctgaaaaaa agtatataat 3960

ataggatgtg taatattcat tcaatttgaa ccaattgatt tggttttggt gtgtttagat 4020

ttttagcaag taagatgttt ggattcactt tttgagctta tctataaata aagcatttat 4080

atttgttttg atctctaatt ttttttaaaa atgcactttt tatagatcca taacgaccaa 4140

tccttgcgtg aattgcaagg atccaataag tcctacattg attttctctg aggtgtcaat 4200

tggacaaata tatctatagt gactaggatg gatatcctgc atccgaaaac tagcagttcg 4260

tcccgtcaat cctccaggac ccaaataact caattttctc ccatgaacta tttgggtcaa 4320

tggattggtt cgatctaaaa cttgagataa tgggtgtaat ctaaaaaagg attcataagt 4380

ggttgctaat ggagttgaaa tcactaaatt ttgaggaatt cgtatcaata tatctaattg 4440

ctttatatat agttcctcaa attatatttt ctaaaccaac tagagccaat ccaaattcat 4500

cttttaatag atcactatca gtgggagtta tatgaaaaaa acttaagata tgtccatatg 4560

ttgttttctg tttattttca aaaactatct ataataactt acaaaaacaa cttacagctc 4620

atatgaaaac atttttcatt tttttacaga taaaaatagt ttattttgta aaaaaaaaaa 4680

aaaatagttt attcataagc attgatataa taagtgctta attaagttgt ttatctaaac 4740

attactcaaa tgattttagt tattgacccc tttagagtcc gcttattata gttttattgt 4800

gaaaaaaaaa aaaaattcta aacaaagttt tatcacttat aaaagttttt cccatgtgtt 4860

acaattttct tttgaaaaag agaatccgaa aaatatctaa aaattgcttc aagaaactgt 4920

gatgaataat ttctccgaaa aatcattttt atatgtggtt gttttaaggg ttaaatatgt 4980

ttttggtccc tataaatata tttacttttt gttttagtcc ctctaaattt ttctttcaac 5040

tattagtccc tataaaattt tcaatcacta cttttggtcc ctatttttaa gttaattttt 5100

gtatttttta atgaaattgt gtgaaaatgt gtagaatatt gtaaaaatct ttcttagaaa 5160

aaaagttaga tttttttaac aaaacataaa ttaaatatta atttttaacc ataaaaaata 5220

taaaaattca tttttaattc atgttttgtt aaaaaataga attttctttt gcgagagatt 5280

cttataatat tatgattttt actgcaaaat tttattgaaa atatgaattc tacatatgag 5340

tttactttaa agtagggacc aaaaatgaag atggaaaacc tttgggggac taaaagtcga 5400

agaaattttt tagagggact aaaacgaaaa gttgacatat ttatagggac caaaaacata 5460

tttagccatt gttttaaaaa ggtaaattta attaggatga acaaacacaa actagcttca 5520

acttttaatt tttttttaaa aatttctaaa aattaatctt taaaattttc aaaatcacct 5580

ttttgcaatt agtaacaaat ggaccctaag ctatttgcta caattttttt ttcttcaggt 5640

ggtccctgat tgcaggaagg ctaccaggaa ggacagcaaa tgacgtgaaa aactattgga 5700

actgtcatct aagcaaaaaa ctaaatgctc tagaagctga tcaagatagg tcacaatcat 5760

ccaaagatgt tcaaatcatt aggccacagg caagaaacat tggttcaagc tcagtgaaga 5820

gaaggagcca aggagagtca ccaactgacc aagttctagt tcaacaagag agtgacatga 5880

caacatttga tgctgatgga aagaatcata tgcttgaatc acaacaagac atgatggtgt 5940

tttcatgctt ggaccaacaa ggtatggttg gtgagtttcc aatggatttt caattagaag 6000

gatttgaagc tatggtaagt ggaggagagg gtagtagtag ccaatggaat tgggaggatt 6060

tgctcttaga tatggatcta tataatggtt tttct 6095

<210> 4

<211> 1503

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 4

tagattattg ttccttattg ccaataggga agacaatgta gtctctatac atgggttgtg 60

tgtcaatttc aaagttaaat gttatccaag gaaatggtgg cttaatcgat gtattttgta 120

aatcgaagta gttgttgttt aaataaacca ataaagtcgg tcttgtgaga catagttagc 180

cctaaaactg gttagtaata tggaaatagt tttgtagctt tttaaaccct attactatat 240

atctagtaga cgatttgttt ttttttaata gtatcctagt tgataataaa aaggaatatc 300

ctcctacata agagaggcag ataaatattc ctttatgttc tattggttga tcttagtgtc 360

ataaaaaaat tagctaccaa tgttaataaa gtttttaaat tttgattatg gtaacgattg 420

ttctgcaatc cttgatattg tagaaaatta tagttaaata caatcacaac tatctaaatt 480

atagtcgtaa acctttgttt aaaatttaag tcattatatt tccatctctt tcattccttc 540

agaatttgag gaatgaaaat acaaattttt tcttagatta tcctagtatg acatgctatt 600

agcttctttc ttcgtctccc ttctcccttc ttccttcatt ctttttaccc tccacactta 660

ttgggggaaa ttctctttta ttgcaatcct ttattctagg tgaatctttt gagttgtcaa 720

tgattatttg tgacttttat aagagttatt tgtactttta cgtttctttg atatgtggct 780

catatagaaa aatagaaatg ccaaacagct cttgataagg catgaacagt taaatcctac 840

cccttcacca caaaagaaga aagtcaaatc ctgccccacc tctgtttctg tttgagtatc 900

acctgtcttc atgatatcaa ttaaatattg gtgtttcttt gtgacaaaat atccattttt 960

ttagcttaac tagtttgttt ggtcgttttt ttaattttag ccctatggtt ttttaatagt 1020

gtgattttga ccttcgtact tttaaacatg cgattttgcc ctctctagtt aaccctattt 1080

ttagtttcac aaccctctag ctctgaagcc catctacttt aaaatggatg acgtattgta 1140

ttacatgtgt atcctgcacc gatacctata tgatacttcc tgatacatat tagaagagta 1200

tctgatgatt atattttatt ttatttttta aaacaattat ctgatactat tcagatacat 1260

ctggaatacg agggataagc ggtagaaaac cgatatgtgc gggctacctg atgtttttat 1320

tatatttgat acatatgcaa ttgactaagt aatgatgttt tctatttagg atatatatca 1380

tatatgtaat tgattaattg tcgatttatt tattatcaat attacttaca tttatatctc 1440

catcgttgcc gtcgtctgtt ttgtgtctct ttatttgttt gagaacgatg ctattgttga 1500

ttg 1503

<210> 5

<211> 8417

<212> DNA

<213>Artificial sequence

<220>

<223>

<400> 5

actcttttac tacaattgca agttattata tttcaggaac aaaatattct aaagattgag 60

tcttggagca aaagaaagga gaattggagc tgattcgtgc caaaaatata aaagatctta 120

tacaaaaata tatggtgcaa ggattgagga aaaatatatg aatatctcat acaaaaatat 180

catgtgcaaa gaatttgaag atcttgtaca aatctataca agaggcgcgc cccactttag 240

tccttttgct gtttttgctt tccagacaag ctacctatta gtttatttct gacctaaaag 300

cctttggttt cttgtggaac attctagtga tgtattcctt aggttttaag tcgttataga 360

ctataaatag agtagctagc tatcataaca aatcatcttt tgttctctga aataataagt 420

gacaattgtt ttttttaata aaagttcatc tttattttct ttattttatt ttatgttctt 480

tttcttcttc ttcttcttct tcttttctat ggctacaatg aacgttagtg agtagactct 540

tcttgttttg ggattgttgg ataagtctaa tgacataatc ttaatcaaac caagccttaa 600

attctaattt atgtaaccct aatttctaat ctaaattcac cgttttaaca tgacttaaca 660

attatcaaac tgtagaagcg aaagtggagg gttagtaatt gttaattcat catctcaaat 720

atcaattcat aaaacgaaag tggagttttg atattcgaac aagtgaattt agacaaggat 780

tgcgaaacat gaaaatagtc tagcaaacct tgagacatat aaagtttcga acttcaagga 840

ttctaatagc aatcaaccat gaaaataggc gtgattgcta gaggaacaca ctcaatgaga 900

ccgaaagaag atgtgatagg ctaaagagaa acttgtcttt agaaattaag tctaacataa 960

ggttctaggt ttaatggttt ggtttgtgaa gggtttgtcg ccatgacgga ccaataatca 1020

caaggctctt ttatttttat tattttctta attaaaaatc caaacttttt aacctttgaa 1080

actttcatct aatcaatatt aaaagttaat tgaattcata actccctgtc ggaacgatac 1140

tctttttact acttcggtag aaccgtgcac ttgcggtttt atcccatcaa aagccatgat 1200

agtggatcct ttttccataa tggtggtaag gagatcaaga gagatggggt gataaattaa 1260

tagaagaacg gttgaatcaa gaaccgtcca catttcaaaa ctagcgtcaa atggaagtag 1320

gcttctcttt tccgggttga tgaatgatat gattgataac cttgttgaca ctagcatgaa 1380

tctcaaacaa ttcagtccac acggcatagt gatccttctc catttctagc acaaaagcaa 1440

tgtttttttt ttttttttaa tttttttttt tatattggtc actacaaggg ccgagtgaaa 1500

atcgggtttt gccgaattgg aggtcacgac agcgatggag gacacgaaag tgaacgacaa 1560

catggcaggg gaggaaggca tggtgtgacg agagagagag agagagagag agagagagag 1620

agagagagag agagagagag agagagagag agagagagag agagagagag agagagagag 1680

agagagagag agctgctggc acggtggtta gtgcggcaaa ggaagacact tgatcgacca 1740

tgggcggctc aagagaatag gcagcggcgg ccttgggtga agaaaatggc ggcggttgca 1800

aggaagaaag gggtaggtta cgtgggaaat tagactcgtg ataccataaa ggaaatcaat 1860

tcgtgaattt cattgataat gataagagta tatatatagt tacaataggt agagtcaaat 1920

ctaggagagt aattagaaaa taatggagag taattacaaa gtaataacta acataattac 1980

taacataatt acataaggtc aaacattcta tcatgaaact tcccaacaca cccggctcac 2040

acttagagct gaaaatccga agcatgacca gagtcattca ataatgggcg gtccaacgag 2100

tcttagaagg ttctaataaa atcttagaat taggattgaa cctaatccaa tcttagaaaa 2160

ccgatttgtg agacgatgag gacccaccga ttatagctaa tacttttaaa ttactcccta 2220

aatttaagat agaaagaaga aagctaattt ttttttagga ctacgtaatt tgttgctgcg 2280

cgatgcaatg cattagttgc gcctactatg tcctgacatt acaaagcggt tttaatagtg 2340

atttacaatc acactgcaat tgtagcctga tgcgattggc accaccacaa ccacaatatt 2400

gggaccgtat caggtgatac ggtccccaat ttgaaacatt gattggggct acaattgcag 2460

ttgtttagtg tattttaaaa tatggttgat atttagttaa aggggagtaa aaggcggaga 2520

ggattcacgt ccttgttcga taactaactt tatgcattct gaaagacttc actgttggca 2580

ttattgttat tctaagaaaa ctctcctaat cttaatgaga tgacaaatga cagaaaaata 2640

cagatgggat aggtttggct ttgaatagga aataatacaa gcttctaatg tatgatgaga 2700

tccaatttct ttgagatgat gaggaccacc attggatact tatgatgtct atttaaaaac 2760

atagagcttg gtatcagagt tttagaaaga gcaatggacc atttactatg aattttgaag 2820

catacgacat agtatattac tctgccttgc tggctagttt ggcacatctt acttcaagaa 2880

acatgtgtgt gtgtaggtgt gtatgtgttt atcaccacca cacatatata taaaagatgc 2940

aggtgtgggt cgaatatgag ggtgaaaaag tagtagtggt tgaagagttt cataagagat 3000

gggtggtgtt gcatggacag aagaagaaga tcacttgctt aagaaatgca tacaacaata 3060

tggtgaagga aagtggcata gggttccact attggctggt aaaagttaat caattatttt 3120

tcctttttct tgatatttct atttgtcttc tctaaaacgg atatttaatt acttctttga 3180

agtatgtcat ctgaggttcg atctctcaca aatatgtatg gaagaacatt tttttattga 3240

aaaatcaatc gtcgacctct taaaacggat catattattt tgagagattg gtccatactc 3300

ttgactagga aaaccttggg ttcactatta aaatgaaatc atcatgaaat gaccgactct 3360

tgaagtatgt catctgaggt tccatctctg ataaatatgt atggaagaac atttttttat 3420

tgaaaatcaa ctgtcgacct cttaaaacgg atccgttatt ttgagagatt ggtccatact 3480

cttcttgact agaaaaacct tgggtttact attaaaatga aatcatcatg aaatgactga 3540

cttgttcaat ctttgcaatt ggttcttaca caattgaacc aacatactta cttagttgat 3600

tatttttctt ttttcatcaa acattggttt gttgaaggtc taaacagatg cagaaagagt 3660

tgtaggctaa gatggttgaa ctatctacgt cctaacataa agagaggaaa ttttgctgag 3720

gaggaagtgg aaatgattgt caaactccac aaattattag gcaacaggta aactttgatc 3780

tttaagactt tcctttggta ttttctaatg tgttctaagt tctaacaact aggcatgggc 3840

catgatagcc ttatgcagtt tttccaaagg tgttaaagct cattagtgaa gagtgtgcat 3900

agtaaaaagt tagtgttcaa gtatagtaaa tgatgttctc gctgaaaaaa agtatataat 3960

ataggatgtg taatattcat tcaatttgaa ccaattgatt tggttttggt gtgtttagat 4020

ttttagcaag taagatgttt ggattcactt tttgagctta tctataaata aagcatttat 4080

atttgttttg atctctaatt ttttttaaaa atgcactttt tatagatcca taacgaccaa 4140

tccttgcgtg aattgcaagg atccaataag tcctacattg attttctctg aggtgtcaat 4200

tggacaaata tatctatagt gactaggatg gatatcctgc atccgaaaac tagcagttcg 4260

tcccgtcaat cctccaggac ccaaataact caattttctc ccatgaacta tttgggtcaa 4320

tggattggtt cgatctaaaa cttgagataa tgggtgtaat ctaaaaaagg attcataagt 4380

ggttgctaat ggagttgaaa tcactaaatt ttgaggaatt cgtatcaata tatctaattg 4440

ctttatatat agttcctcaa attatatttt ctaaaccaac tagagccaat ccaaattcat 4500

cttttaatag atcactatca gtgggagtta tatgaaaaaa acttaagata tgtccatatg 4560

ttgttttctg tttattttca aaaactatct ataataactt acaaaaacaa cttacagctc 4620

atatgaaaac atttttcatt tttttacaga taaaaatagt ttattttgta aaaaaaaaaa 4680

aaaatagttt attcataagc attgatataa taagtgctta attaagttgt ttatctaaac 4740

attactcaaa tgattttagt tattgacccc tttagagtcc gcttattata gttttattgt 4800

gaaaaaaaaa aaaaattcta aacaaagttt tatcacttat aaaagttttt cccatgtgtt 4860

acaattttct tttgaaaaag agaatccgaa aaatatctaa aaattgcttc aagaaactgt 4920

gatgaataat ttctccgaaa aatcattttt atatgtggtt gttttaaggg ttaaatatgt 4980

ttttggtccc tataaatata tttacttttt gttttagtcc ctctaaattt ttctttcaac 5040

tattagtccc tataaaattt tcaatcacta cttttggtcc ctatttttaa gttaattttt 5100

gtatttttta atgaaattgt gtgaaaatgt gtagaatatt gtaaaaatct ttcttagaaa 5160

aaaagttaga tttttttaac aaaacataaa ttaaatatta atttttaacc ataaaaaata 5220

taaaaattca tttttaattc atgttttgtt aaaaaataga attttctttt gcgagagatt 5280

cttataatat tatgattttt actgcaaaat tttattgaaa atatgaattc tacatatgag 5340

tttactttaa agtagggacc aaaaatgaag atggaaaacc tttgggggac taaaagtcga 5400

agaaattttt tagagggact aaaacgaaaa gttgacatat ttatagggac caaaaacata 5460

tttagccatt gttttaaaaa ggtaaattta attaggatga acaaacacaa actagcttca 5520

acttttaatt tttttttaaa aatttctaaa aattaatctt taaaattttc aaaatcacct 5580

ttttgcaatt agtaacaaat ggaccctaag ctatttgcta caattttttt ttcttcaggt 5640

ggtccctgat tgcaggaagg ctaccaggaa ggacagcaaa tgacgtgaaa aactattgga 5700

actgtcatct aagcaaaaaa ctaaatgctc tagaagctga tcaagatagg tcacaatcat 5760

ccaaagatgt tcaaatcatt aggccacagg caagaaacat tggttcaagc tcagtgaaga 5820

gaaggagcca aggagagtca ccaactgacc aagttctagt tcaacaagag agtgacatga 5880

caacatttga tgctgatgga aagaatcata tgcttgaatc acaacaagac atgatggtgt 5940

tttcatgctt ggaccaacaa ggtatggttg gtgagtttcc aatggatttt caattagaag 6000

gatttgaagc tatggtaagt ggaggagagg gtagtagtag ccaatggaat tgggaggatt 6060

tgctcttaga tatggatcta tataatggtt tttctcgggg atctgtcgac ggtggcggag 6120

ggggtggcat gggtaaagga gaacttttca ctggagttgt cccaattctt gttgaattag 6180

atggtgatgt taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat 6240

acggaaaact tacccttaaa tttatttgca ctactggaaa actacctgtt ccctggccaa 6300

cacttgtcac tactttctct tatggtgttc aatgcttttc aagataccca gatcatatga 6360

agcggcacga cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct 6420

tcttcaagga cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc 6480

tcgtcaacag gatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc 6540

acaagttgga atacaactac aactcccaca acgtatacat catggcagac aaacaaaaga 6600

atggaatcaa agttaacttc aaaattagac acaacattga agatggaagc gttcaactag 6660

cagaccatta tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc 6720

attacctgtc cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg 6780

tccttcttga gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaggt 6840

ctatcgtcga cggtagctac ccttatgacg tccccgacta cgctggctat ccctacgatg 6900

tgcctgatta tgcctagatt attgttcctt attgccaata gggaagacaa tgtagtctct 6960

atacatgggt tgtgtgtcaa tttcaaagtt aaatgttatc caaggaaatg gtggcttaat 7020

cgatgtattt tgtaaatcga agtagttgtt gtttaaataa accaataaag tcggtcttgt 7080

gagacatagt tagccctaaa actggttagt aatatggaaa tagttttgta gctttttaaa 7140

ccctattact atatatctag tagacgattt gttttttttt aatagtatcc tagttgataa 7200

taaaaaggaa tatcctccta cataagagag gcagataaat attcctttat gttctattgg 7260

ttgatcttag tgtcataaaa aaattagcta ccaatgttaa taaagttttt aaattttgat 7320

tatggtaacg attgttctgc aatccttgat attgtagaaa attatagtta aatacaatca 7380

caactatcta aattatagtc gtaaaccttt gtttaaaatt taagtcatta tatttccatc 7440

tctttcattc cttcagaatt tgaggaatga aaatacaaat tttttcttag attatcctag 7500

tatgacatgc tattagcttc tttcttcgtc tcccttctcc cttcttcctt cattcttttt 7560

accctccaca cttattgggg gaaattctct tttattgcaa tcctttattc taggtgaatc 7620

ttttgagttg tcaatgatta tttgtgactt ttataagagt tatttgtact tttacgtttc 7680

tttgatatgt ggctcatata gaaaaataga aatgccaaac agctcttgat aaggcatgaa 7740

cagttaaatc ctaccccttc accacaaaag aagaaagtca aatcctgccc cacctctgtt 7800

tctgtttgag tatcacctgt cttcatgata tcaattaaat attggtgttt ctttgtgaca 7860

aaatatccat ttttttagct taactagttt gtttggtcgt ttttttaatt ttagccctat 7920

ggttttttaa tagtgtgatt ttgaccttcg tacttttaaa catgcgattt tgccctctct 7980

agttaaccct atttttagtt tcacaaccct ctagctctga agcccatcta ctttaaaatg 8040

gatgacgtat tgtattacat gtgtatcctg caccgatacc tatatgatac ttcctgatac 8100

atattagaag agtatctgat gattatattt tattttattt tttaaaacaa ttatctgata 8160

ctattcagat acatctggaa tacgagggat aagcggtaga aaaccgatat gtgcgggcta 8220

cctgatgttt ttattatatt tgatacatat gcaattgact aagtaatgat gttttctatt 8280

taggatatat atcatatatg taattgatta attgtcgatt tatttattat caatattact 8340

tacatttata tctccatcgt tgccgtcgtc tgttttgtgt ctctttattt gtttgagaac 8400

gatgctattg ttgattg 8417

Claims (10)

1. a kind of protein is following (a1) or (a2)：

(a1) protein that amino acid sequence forms shown in sequence in sequence table 2；

(a2) amino acid sequence shown in sequence in sequence table 2 by the substitution of one or several amino acid residues and/or is lacked Lose and/or addition and with the protein with the same function derived from sequence 2.

2. encoding the gene of protein described in claim 1.

3. gene as claimed in claim 2, it is characterised in that：The gene is any DNA in following (b1)-(b4) Molecule：

(b1) DNA molecular shown in sequence 1 in code area such as sequence table；

(b2) DNA molecular shown in the sequence 5 of sequence table；

(b3) hybridize under strict conditions with (b1) or (b2) DNA sequence dna limited and encode protein described in claim 1 DNA molecular；

(b4) derive from M. truncatula and with (b1) or (b2) or (b3) limit DNA sequence dna have 90% or more homology and Encode the DNA molecular of protein described in claim 1.

4. the recombinant expression carrier, expression cassette, transgenic cell line containing gene described in Claims 2 or 3 or recombinant bacterium.

5. protein described in claim 1, or, gene described in Claims 2 or 3, in regulating and controlling Carotenoid in Plants content Using.

6. a kind of method for cultivating genetically modified plants, includes the following steps：Inhibit base described in Claims 2 or 3 in purpose plant The expression of cause obtains the genetically modified plants of carotenoid content reduction.

7. a kind of method reducing Carotenoid in Plants content, includes the following steps：Inhibit claim 1 institute in purpose plant The activity and/or expression quantity for stating protein obtain the genetically modified plants of carotenoid content reduction.

8. a kind of method for cultivating genetically modified plants, includes the following steps：Channel genes purpose described in Claims 2 or 3 is planted Object obtains the genetically modified plants of carotenoid content raising.

9. a kind of method for improving Carotenoid in Plants content and improving, includes the following steps：Improve claim in purpose plant The activity and/or expression quantity of 1 protein obtain the genetically modified plants of carotenoid content raising.

10. protein described in claim 1, or, gene described in Claims 2 or 3, or, any sides claim 6-9 Application of the method in plant breeding.