CN106996976B - CTC protein parting kits based on microflow control technique - Google Patents
CTC protein parting kits based on microflow control technique Download PDFInfo
- Publication number
- CN106996976B CN106996976B CN201610045465.8A CN201610045465A CN106996976B CN 106996976 B CN106996976 B CN 106996976B CN 201610045465 A CN201610045465 A CN 201610045465A CN 106996976 B CN106996976 B CN 106996976B
- Authority
- CN
- China
- Prior art keywords
- protein
- ctcs
- cell
- antibody
- aptamers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5302—Apparatus specially adapted for immunological test procedures
- G01N33/5304—Reaction vessels, e.g. agglutination plates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
Abstract
The present invention relates to a kind of CTC protein parting kits based on microflow control technique include：(1) it is directed to the capture antibody complex of different CTCs protein markers：Each capture antibody complex is formed by connecting by the capture antibody and aptamers specifically bound with corresponding protein marker by that can shear material, described to shear the deoxyribonucleotide double-strand that material is the palindrome with 2 or 2 or more restriction endonuclease sites；(2) surface coupling has the micro-fluidic chip of cell capture component：The micro-fluidic chip surface is fixed with the cell capture component being made of microtrabeculae, and one end of the microtrabeculae is modified with the specificity junction mixture that association reaction can occur with aptamers.The present invention realizes automatic detection efficient to CTCs, quick and parting using microflow control technique, easy to operate, and false negative and false positive results caused by reducing manual operation factor improve sensitivity and the accuracy of detection.
Description
Technical field
The invention belongs to molecular biology fields, are related to medicine and biotechnology, relate particularly to a kind of based on miniflow
The CTC protein parting kits of control technology, suitable for blood the capture of circulating tumor cell, isolate and purify and parting mirror
It is fixed.
Background technology
Circulating tumor cell (circulating tumor cells, CTCs) derives from primary tumo(u)r or metastatic tumour, obtains
The ability of basilar memebrane must be detached from and enter blood vessel by invading periplast, be all kinds of tumour cells being present in peripheral blood
It is referred to as.It is broadly divided into epithelium positive markers phenotype (abbreviation epithelial cell type), interstitial according to the differential expression of its surface antigen
Positive markers phenotype (abbreviation interstitial cell type) and epithelium mix phenotype (abbreviation epithelial-mesenchymal cellular type) etc. with interstitial.On
Chrotoplast type CTCs is increased by the way that epithelial-mesenchymal conversion (epithelial-mesenchymal transition, EMT) occurs
Migration and invasive ability reach potential transfer site, can form new tumour stove under suitable microenvironment.Therefore, to swollen
CTCs in tumor blood samples of patients is detected with Classification Identification to the early diagnosis of disease, curative effect evaluation, individualized treatment scheme
Foundation and prognosis evaluation be of great significance.
Contents of the CTCs in human body haemocyte is seldom, is only therefore detected to it containing about 1-10 CTCs in 1mL blood
The sensitivity and specificity for having high are had to Classification Identification technology.At present by the expression of surface protein to CTCs into
Row detection depends on epithelial cell adhesion molecule (epithelial cell adhesion molecule, EpCAM), by
In there is difference in different stage CTCs antigen presentations, can not be detected so causing and losing the CTCs that EpCAM is expressed.
And traditional protein detection techniques, such as immunofluorescence dyeing, flow cytometry and immunostaining have operation excessively numerous
The defects of trivial, sample consumption is big and cannot automate, cannot achieve efficient, the accurately automatic detection of CTCs.
Microflow control technique refers to that physics, chemistry and biological means can be being integrated within the scope of micro-nano-scale, is realized whole
The micromation of device and inexpensive detecting system, important potential technology method is provided for the high sensitivity of CTCs, efficient separation.
There are CTCs Testing and appraisals method based on microflow control technique and the kit listing of commercialization, including CellSearch both at home and abroad
Detecting system, micro-fluidic multicolor fluorescence cell counter,Circulating tumor cell detecting system and circulating tumor cell
Capture instrument and its capture colouring method etc..Current microflow control technique is based primarily upon physical property (cell size and the change of CTCs
Shape sex differernce etc.) and antigen presentation difference captured and identified.Due to the use of capture antibody it is more single, be mostly based on
Endothelial cell marker causes a degree of missing inspection, reduces sensitivity and the accuracy of detection.For the CTCs to capture
Molecule and protein analysis are carried out, needs to detach it with specificity junction mixture.Traditional separation method is low with the rate of recovery, damages
The defects of hindering cell activity, integrality and surface antigen affects subsequent Classification Identification.Therefore, be badly in need of a kind of high sensitivity,
The high-efficient automatic CTCs genotyping detection methods of accuracy height, high specificity.
Invention content
One of the objects of the present invention is to provide a kind of CTC protein parting kits based on microflow control technique, can lead to
It crosses efficient capture, separation and detection CTCs protein from biological sample whether there is, realizes and Classification Identification is carried out to CTCs.
Realize that the technical solution of above-mentioned purpose is as follows.
A kind of CTC protein parting kits based on microflow control technique include：
(1) it is directed to the capture antibody complex of different CTCs protein markers：Each capture antibody complex by with it is corresponding
Protein marker specific binding capture antibody and aptamers be formed by connecting by the way that material can be sheared, it is described to shear material
For the deoxyribonucleotide double-strand of the palindrome of the restriction endonuclease sites with 2 or 2 or more；The aptamers
It can be combined with corresponding specificity junction mixture,
(2) surface coupling has the micro-fluidic chip of cell capture component, and the cell capture component is made of microtrabeculae, described
One end of microtrabeculae is connected with micro-fluidic chip, and the other end is modified with specificity junction mixture, the specificity junction mixture can with it is above-mentioned
Corresponding aptamers specific binding.
The aptamers are selected from one of the embodiments,：Biotin, digoxin, fluorescein or single-stranded deoxyribose
One kind in nucleotide；The specificity junction mixture be corresponding Streptavidin, anti digoxin antibody, anti-fluorescein antibody or
One kind in complementary single strand deoxyribonucleotide.
Be directed to each CTCs protein marker in one of the embodiments, has corresponding capture antibody complex respectively：
The CTCs protein markers are selected from least one of EpCAM, E-cadherin, KTR18 and KTR19 conduct
Epithelial cell types protein marker, and/or in N-cadherin, vimentin, fibronectin, ZEB1 and SNAI1
At least one as mesenchymal cell types protein marker；
The capture antibody complex, for each CTCs protein marker, capture antibody complex is respectively by corresponding
CTCs protein markers capture antibody constitute；Different CTCs, aptamers can shear material identical.
Further include having in one of the embodiments,：For the labelled antibody of each CTCs protein marker, the label
Antibody can occur specific binding with respective capture antibody and react, and be modified with fluorophor, differ CTCs cell types,
Labelled antibody fluorophor is different.
Further include in one of the embodiments,：For the magnetic bead antibody of leucocyte protein marker, the magnetic bead antibody
It is combined into magnetic bead for the labelled antibody for leucocyte protein marker；The magnetic bead antibody can be with leucocyte marker protein
Specific binding reaction occurs for matter, and the labelled antibody for leucocyte protein marker is modified with fluorophor, and with
CTCs cell type fluorophors are different.
The base sequence of the deoxyribonucleotide double-strand is respectively such as SEQ ID NO in one of the embodiments,:1
With SEQ ID NO:Shown in 2.
Base sequence such as SEQ ID NO in one of the embodiments,:The 5 ' of 1 deoxyribonucleotide chain are equipped with ammonia
Base group, deoxyribonucleotide chain are connected by the amino group with capture antibody；Base sequence such as SEQ ID NO:2 it is de-
The 5 ' of oxygen ribonucleotide chain are connected with aptamers.
The aptamers are biotin in one of the embodiments, and the specificity junction mixture is corresponding strepto- parent
And element.
Leucocyte protein marker is CD45 in one of the embodiments,.
In one of the embodiments, the CTCs protein markers be selected from EpCAM, E-cadherin, KTR18 and
KTR19 is epithelial cell protein marker, and makees selected from N-cadherin, vimentin, fibronectin, ZEB1 and SNAI1
For mesenchymal cell markers protein.
Main advantages of the present invention are：
(1) present invention realizes automatic detection efficient to CTCs, quick and parting, operation letter using microflow control technique
Single, false negative and false positive results caused by reducing manual operation factor improve sensitivity and the accuracy of detection.
(2) based on microflow control technique to the capture of CTCs separation usually have low cell recoveries, cell membrane integrity and
The defects of surface antigen is impaired and activity declines, but the CTCs acquisition modes that the present invention uses have invertibity, utilize this
The invention material of shearing (specifically has the deoxidation of the palindrome of 2 or 2 or more restriction endonuclease sites
Ribonucleotide double-strand) connection suitable CTCs capture antibody and with suitable aptamers, by outer after the completion of capture reaction
Source condition degradation connecting material, you can make capture antibody be detached with aptamers-specificity junction mixture compound, CTCs is greatly improved
Organic efficiency.The stimulation of selection can shear the external source condition of material degradation not damaging cells film integrality, surface protein and thin
Cytoactive makes isolated CTCs can be used for further analyzing and identifying.
(3) with directly by capture antibody modification compared with chip surface is to capture CTCs, the present invention is using capture antibody
Aptamers and the mode of specificity junction mixture generation association reaction on micro-fluidic chip cell capture component capture in compound
CTCs, such acquisition mode can reduce the steric hindrance of association reaction, keep capture rate more preferable, in conjunction with more securely；This
Outside, it captures the capture antibody in antibody complex and fully knot occurs with CTCs in sample before sample enters micro-fluidic chip
Reaction is closed, ensure that all target detection albumen all combine corresponding capture antibody, improve the accuracy of genotyping result, it is real
The subsequent accurate partings of existing CTCs.
(4) the capture antibody of the corresponding clone number selected by present invention capture antibody complex, it is a large amount of to be that inventor passes through
Experiment carries out the optimal selection obtained after comprehensive assessment and statistical analysis, and specificity knot can occur under uniform reaction condition
Reaction is closed, there is specificity and sensitivity well, and response characteristic is not interfere with each other between various capture antibody, it can be to greatest extent
Non-specific binding reaction is reduced, interference of the background fluorescence to experimental result is reduced.Being applied in combination for Multiple Antibodies makes identification try
Agent box and detection method form an accurate, comprehensive detecting system, can realize the accurate parting of CTC.
(5) microflow control technique is typically only capable to realize capture, separation and the purifying of CTCs, but the present invention is received by increasing cell
Collect module, uses multi-fluorescence antibody in the module, a variety of CTCs specific proteins can be marked simultaneously, and be by its parting
I types (epitheliated type), II types (epithelial-mesenchymal mixed type) and type III (interstitial type) realize CTCs captures, isolate and purify and divide
Type identification integration.
Description of the drawings
Fig. 1 is micro fluidic device result schematic diagram of the present invention；
Fig. 2 is the CTC protein parting kit detection process schematic diagrames of microflow control technique in the embodiment of the present invention 2；
Fig. 3 is positive CTC qualification result schematic diagrames of the invention；
Fig. 4 is positive CTC genotyping result schematic diagrames of the invention.
Specific implementation mode
Embodiment 1
The CTC protein parting kits based on microflow control technique described in the present embodiment, mainly include：
One, antibody complex is captured
The capture antibody complex includes the capture antibody specifically bound with each protein markers of CTCs and is adapted to
For connecting protein marker and labelled antibody with protein marker and labelled antibody specificity knot can occur for body, capture antibody
Reaction is closed, capture antibody is the monoclonal antibody with high-purity, and response characteristic is not interfere with each other between the capture antibody of selection, is caught
It obtains by the way that material connection can be sheared between antibody and aptamers, it includes light-sensitive material, temperature sensing material, wet sensitive material that can shear material
Material, thermo-sensitive material, enzymatic degradation material etc., aptamers are that can be specifically bound on micro-fluidic chip superficial cell capture component
The micromolecular compound, including biotin, digoxin, fluorescein or single strand deoxyribonucleotide etc. of association reaction occur for object.
The present embodiment preferred EpCAM, E-cadherin, KTR18 and KTR19 as epithelial cell protein marker, N-cadherin,
Vimentin, fibronectin, ZEB1 and SNAI1 are as mesenchymal cell markers protein.For corresponding protein marker
Capture antibody information be shown in Table 1.Aptamers of the preferred biotin of the present embodiment as capture antibody complex, preferably deoxyribose
Nucleotide double is as that can shear material, and preferably Streptavidin is as specificity junction mixture.Capture antibody passes through deoxyribose
Nucleotide chain is connect with biotin, and heretofore described deoxyribonucleotide chain is the palindrome of restrictive restriction enzyme site
Structure includes 2 or 2 or more restriction enzyme sites, can issue raw degradation, the present embodiment preferably 2 in restriction enzyme enzyme effect
A restriction enzyme site.The present invention 5 ' the ends single-stranded as one in the deoxyribonucleotide double-strand that can shear material are equipped with
Amino, for connecting capture antibody, aptamers can be connected to the single-stranded 3 ' end or aptamers can also be connected to it is another
5 ' single-stranded ends of item.The present invention 3 ' the ends single-stranded as one in the deoxyribonucleotide double-strand that can shear material are set
There is amino, for connecting capture antibody, aptamers can be connected to 5 ' the single-stranded ends or aptamers and can also be connected to separately
One 3 ' single-stranded end.Deoxyribonucleotide double-stranded sequence information in the present embodiment is shown in Table 2, and work bioengineering is given birth to by Shanghai
Hybridization becomes double-strand, wherein SEQ ID NO after limited liability company is synthesizing single-stranded：15 ' ends, which are contained, to be combined with capture antibody
Amino be used for capture antibody be connected, SEQ ID NO：The terminal modified biotin having as aptamers in the 5 ' of 2, synthetic sequence
Row are configured to the storage liquid of 100pmol/mL with 10mmol/L Tris Buffer respectively, and through following Conditions Hybridization at double-strand：
The SEQ ID NO of equivalent：1 and SEQ ID NO：2 hybridize 40min in 37 DEG C, and hybridization buffer is the tris-HCl of pH7.4
(10mM Tris-HCl, 1mM EDTA, 50mM NaCl).Capture the deoxyribonucleotide double-strand of antibody and biotin modification in
30min is incubated on shaking table altogether and obtains capture antibody complex.
The capture antibody of 1 target protein of table
| Protein | Article No. | Clone number |
| EpCAM | ab20160 | AUA1 |
| E-cadherin | ab1416 | HECD-1 |
| KRT18 | ab7797 | DC10 |
| KRT19 | ab7754 | A53-B/A2 |
| N-cadherin | ab76011 | EPR1791-4 |
| vimentin | ab92547 | EPR3776 |
| fibronectin | ab32419 | F1 |
| ZEB1 | 3396S | D80D3 |
| SNAI1 | AP22229PU-N | 1-50 |
2 deoxyribonucleotide chain-ordering information of table
Two, surface coupling has the micro-fluidic chip of cell capture component
Micro-fluidic chip surface is fixed with the cell capture component being made of microtrabeculae and specificity junction mixture, the microtrabeculae
One end be modified with can with aptamers occur association reaction specificity junction mixture, including streptomysin Avidin, anti digoxin antibody,
Anti-fluorescein antibody or complementary single strand deoxyribonucleotide etc., the preferred biotin of the present embodiment is as aptamers, preferably strepto-
Avidin is as specificity junction mixture
Three, labelled antibody
Labelled antibody can occur specific binding with capture antibody and react, and be modified with fluorophor, by anti-with capture
The Cascaded amplification for being implemented in combination with target protein signal of body.Response characteristic is not interfere with each other between the labelled antibody of selection, for
The fluorophor of different cell category protein markers is different, and fluorophor can be selected from：FAM、TET、JOE、HEX、
Cy3, TAMRA, ROX, Texas Red, LC RED640, Cy5, LC RED705 and Alexa Fluor 488, labelled antibody
The fluorophor of FL1, FL2 and FL3 selection is different, i.e., the color of selected fluorophor is different or launch wavelength
It is different, in order to distinguish different types of protein marker.It is shown in Table for the labelled antibody information of corresponding capture antibody
3, the fluorophor label of the preferred table of the present embodiment 3, wherein leukocyte marker antibody be modified with fluorophor monoclonal it is anti-
Body.
The labelled antibody of the different cell category protein markers of table 3
Note：A indicates the clone number of antibody, is modified with Cy5 fluorophors for the labelled antibody of CD45, modification step is such as
Under：
(1) appropriate CD45 antibody is taken, physiological saline and carbonate buffer solution is added, makes a concentration of 20mg/mL of final antibody,
In mixing postposition ice bank, low temperature shakes (speed is suitably advisable with not blistering foam) 5-10min.
(2) add the Standard entertion Cy5 fluorchromes of 0.01mg fluoresceins by every mg capture antibody.
(3) Cy5 fluorchromes are added in CD45 antibody-solutions gradually while stirring, continue to shake incubation under the conditions of 4 DEG C
12-18h。
(4) above-mentioned reaction solution and 2500r/min are centrifuged into 20min, removes wherein a small amount of sediment, is fitted into bag filter
It is placed in beaker, with dialysed overnight under the conditions of 0~4 DEG C of pH8.0 buffered salines.
(5) marker of dialysed overnight is taken, -25 column of sephadex G is crossed, detaches the fluorescein that dissociates, you can obtain phase Cy5
The labelled antibody for leucocyte protein marker CD45 of label.
Four, magnetic bead antibody
The magnetic bead antibody can occur specific binding with leucocyte and react, and the antibody combined with magnetic bead is the list of high-purity
Directional migration can occur under the influence of a magnetic field for clonal antibody, magnetic bead antibody.Magnetic bead antibody is leukocyte marker antibody in table 3
CD45, CD45 have embedded magnetic bead, and magnetic bead is purchased from Thermofiser (article No. 88845), and 1mg magnetic beads, magnetic bead are used per 30ug antibody
The stringent by specification of step is embedded to carry out.
Five, microflow control technique device
Microflow control technique device used in the present invention is conventional equipment, refers to Fig. 1, has specifically included：
(1) micro-fluidic chip 1 of leucocyte is removed by magnetic action：The micro-fluidic chip 1 include sample injection port,
Magnetic particle is enriched with chamber, matrix, substrate, sample outflux, external magnetic component；The sample injection port includes that automation is noted
Emitter or constant flow pump etc.；The magnetic particle enrichment chamber is for collecting the leucocyte combined with magnetic bead antibody；The sample flow
Exit end connects micro-fluidic chip 1, and the other end is connected with towards 2 microchannel of cell collecting chamber, which is provided with control sample
The valve of liquid stream；The external magnet components can form the magnetic field for the leucocyte directional migration for making to be combined with magnetic bead antibody；
(2) the cell collecting chamber 2 of CTCs marker proteins and capture antibody complex specific binding：The cell is received
Collection room 2 include with 1 sample of micro-fluidic chip outflow microchannel be connected injection port, matrix, substrate, exogenous agent injection port,
Sample outflux, discarded fluid outlet, waste liquid collecting chamber, external controllable device；Described injection port one end connects micro-fluidic core
1 sample of piece flows out microchannel, and the other end connects 2 sample introduction microchannel of cell collecting chamber；The exogenous agent injection port is used for thin
The reagents such as capture antibody complex, cell fixer, antigen retrieval buffers, confining liquid and cleaning solution are added in born of the same parents' collecting chamber 2；The sample
Product outflux one end connects cell collecting chamber 2, and the other end is connected with the microchannel towards micro-fluidic chip 3, which is provided with control
The valve of sample liquid flow processed；Discarded fluid outlet one end connection cell collecting chamber 2, the other end is connected with waste liquid collecting chamber
It connects；The waste liquid collecting chamber is used to collect the reagent after reaction；The external electrical apparatus can make 2 substrate of cell collecting chamber low
Speed is shaken, and it is adjustable to shake rate；
(3) micro-fluidic chip 3 of CTCs is captured：The micro-fluidic chip 3 includes flowing out micro-pipe with 2 sample of cell collecting chamber
Injection port that road is connected, matrix, substrate, exogenous agent injection port, sample outflux, discarded fluid outlet, waste liquid are collected
Room, external controllable device；2 sample of injection port one end connection cell collecting chamber flows out microchannel, and other end connection is micro-fluidic
3 sample introduction microchannel of chip；Described matrix material is silicon, glass material or bio-compatible high molecular material, and the present embodiment is preferably poly-
Dimethyl siloxane (PDMS)；The substrate material is that silicon, glass material or bio-compatible high molecular material, the present embodiment are preferred
Dimethyl silicone polymer (PDMS) is fixed with cell capture component on substrate, and the cell capture component is by high molecular polymer
It constitutes, the preferred dimethyl silicone polymer of the present embodiment (PDMS), surface modification has can be with aptamers in capture antibody complex
The specificity junction mixture of association reaction occurs, the preferred Streptavidin of the present embodiment is as specificity junction mixture；The external source examination
Agent injection port can shear the necessary reaction reagent of material degradation for being added into micro-fluidic chip 3；The sample outflux one
End connection micro-fluidic chip 3, the other end are connected with towards 4 microchannel of cell collecting chamber；Described discarded fluid outlet one end connects
Micro-fluidic chip 3 is connect, the other end is connected with waste liquid collecting chamber；The waste liquid collecting chamber is used to collect the examination after reaction
Agent；The external controllable device can generate the necessary reaction condition for shearing material degradation made in capture antibody complex, wrap
Include light source, temperature, humidity or catalysis enzyme etc., to detach the CTCs for being combined with capture antibody with aptamers, the present embodiment
External controllable device can provide the optimum temperature of endonuclease reaction；
(4) the cell collecting chamber 4 of capture antibody and labelled antibody specific binding：The cell collecting chamber 4 include with it is micro-
Injection port that 3 sample of fluidic chip outflow microchannel is connected, matrix, substrate, exogenous agent injection port, discarded fluid outlet,
Waste liquid collecting chamber, external electrical apparatus；Injection port one end connection 3 sample of micro-fluidic chip flows out microchannel, the other end
Connect 4 sample introduction microchannel of cell collecting chamber；Described matrix material is silicon, glass material or bio-compatible high molecular material, this reality
Apply the preferred dimethyl silicone polymer of example (PDMS)；The substrate material is silicon, glass material or bio-compatible high molecular material, sheet
The preferred dimethyl silicone polymer of embodiment (PDMS)；Described matrix can be taken out with substrate from cell collecting chamber 4, be used for microscope
Observation；The exogenous agent injection port is used to that the reagents such as labelled antibody and cleaning solution to be added to cell collecting chamber 2；The waste liquid
Outflux one end connects cell collecting chamber 4, and the other end is connected with waste liquid collecting chamber；The waste liquid collecting chamber is for collecting
Reagent after reaction；The external electrical apparatus can be such that 4 substrate low speed of cell collecting chamber shakes, and it is adjustable to shake rate.
Embodiment 2 is detected human peripheral circulating tumor cell with the kit in embodiment 1
The formula of the various solution is as follows：
Capture mixed liquor and colour developing mixed liquor in the present embodiment use in 1 corresponding protein marker list of embodiment
Whole antibody.
One, sample preprocessing
1. using liquid preservation blood sample is preserved in Sample preservation pipe, 600 × g horizontal centrifugal 5min abandon supernatant, remove
Red blood cell is added 1mLPBS and is resuspended.
2. the corresponding magnetic beads of 450uL is taken to be mixed, supernatant is removed in centrifugation, and 1mLPBS is added and is resuspended, anti-according to every 30ug magnetic beads
Body uses 1mg magnetic beads, and magnetic bead antibody mixed liquor is added into cell suspension, reacts 30min on the mixer.Supernatant is removed in centrifugation,
10uLPBS is added to be resuspended.
Two, micro fluidic device detects
1. the cell suspension after above-mentioned reaction is added by injection port in micro-fluidic chip 1, magnetic outside sample-adding front opening
Field assembly makes the leucocyte for being combined with magnetic bead antibody migrate under the action of a magnetic force, is adsorbed onto magnetic cell enrichment room
In cavity wall.The CTCs not combined with magnetic bead antibody is carried out by microchannel in cell collecting chamber 2.
2. after completing sample introduction 5min, 500 μ L, 4% poly first is added by the exogenous agent injection port of cell collecting chamber 2
Aldehyde, room temperature fix 1h, open waste collection room valve, remove liquid, and 1mL PBS washings are added three times；500 μ L antigens are added to repair
Multiple liquid, is incubated at room temperature 5min, removes liquid, and 1mL PBS washings are added three times；500ul permeabilization agent is added, is incubated at room temperature 30min,
Liquid is removed, 1mL PBS washings are added three times；500ul confining liquids are added, open external electrical apparatus, shaking table low speed shakes, room
Temperature is incubated 30min, removes liquid, and 1mL PBS washings are added three times；It is (compound containing capture antibody that 300uL captures mixed liquor is added
Object), shaking table low speed shakes, and is incubated at room temperature 1h, removes liquid, and the washing of 1mL cleaning solutions is added three times.
3. opening the valve on 2 sample outflux of cell collecting chamber and 3 injection port of micro-fluidic chip, sample is made to enter miniflow
Chip 3 is controlled, the CTCs combined with capture antibody complex is fixed by the specificity junction mixture in micro-fluidic chip 3, is trapped in core
Piece surface.After completing sample introduction 5min, 1mLPBS washings are added, remove the cell not combined, then by exogenous agent into
Sample mouth is added 200uL and detaches mixed liquor, 37 DEG C of incubation 15min.With the CTCs of high flow rate PBS buffer solution elution capture.
4. isolated CTCs enters cell collecting chamber 4 by microchannel, 300uL is added by exogenous agent injection port
Develop the color mixed liquor, opens external electrical apparatus, and shaking table low speed shakes, and is incubated at room temperature 30min, removes liquid, and 1mL cleaning solutions are added
Washing is three times.Substrate and substrate are taken out, 10 μ L are added on the retention areas CTCs and redye liquid.
Three, fluorescence microscope CTCs
1. direct microscopy is placed in -20 DEG C of preservations.
2. counting CTC opposite sex nuclear volumes by 20 times of object lens.
3. according to 10 times of anisotropic nuclear locations of object lens positioning, oil dripping, with oil mirror observation experiment as a result, and photographing to record result.
4. then further according to the next anisotropic nuclear location of 10 times of object lens positioning, oil dripping with oil mirror observation experiment result and regards
Open country photographs to record result.
5. repetitive operation is to all anisotropic core has been clapped, quantity is consistent with 20 times of object lens count results.
Microscope is shown in Table 4 using channel：
The excitation wavelength and launch wavelength of 4 fluorophor of table
Four, testing result judges and analyzes
1. positive CTC standards of perfection
On substrate material, it is enriched with a small amount of circulating tumor cell and remaining a small amount of leucocyte, circulating tumor is thin
The criterion of born of the same parents' positive is (referring to Fig. 1)：
1) there is circulating tumor cell specific marker's object, shown as in this kit in the channels Cy3 and Alexa
Fluor can be displayed in red fluorescence signal or green florescent signal under 488 channel.
2) do not have leukocyte specific marker, show as not showing that fluorescence is believed under the channels Cy5 in this kit
Number.
3) nucleus DAPI stained positives.
4) circulating tumor cell nuclear shape is irregular, and diameter is more than 10 μm.
2. positive CTC parting standards：
This kit is dyed using multi-fluorescence antibody, is directed to a variety of CTCs specific proteins respectively, is passed through different face
Color fluorescence signal further can carry out parting to CTCs.Wherein I type (epitheliated type) CTCs carries Cy3 fluorophors and (is shown as red
Color fluorescence signal), III type (interstitial type) CTCs carries 488 fluorophors (shown in green fluorescence signal) of Alexa Fluor,
The CTCs for expressing I type and III type specificity protein simultaneously be II type (epithelial-mesenchymal mixed type, at the same be displayed in red fluorescence and
Green florescent signal).Referring to Fig. 3 and Fig. 4.CTCs parting standards are as shown in table 5：
5 positive CTC parting standards of table
3. using above-mentioned detection method, 20 tumor patient blood samples are detected and are observed, concrete outcome such as table 6
It is shown：
6 pattern detection result of table
Embodiment 3：Tumor cell line is detected with the kit in embodiment 1
One, the selection of tumor cell line
In the present embodiment, we are by epitheliated type cell strain MCF-10A, interstitial type tumor cell line U118 and epithelial-mesenchymal
Healthy volunteer's peripheral blood sample is added in the cell of mixed type lung cancer cell line PC-9 dose known amounts, wherein using lymphoblast
CCRF-HSB-2 is as negative control for strain.Those skilled in the art are only it is to be understood that the title of cell line can be obtained by buying.
With the tumour cell capture rate of the kit detection present invention in embodiment 1.
Two, sample detection
200 MCF-10A cells, U118 cells and PC-9 cells (being determined by cell counter) are respectively taken, it is strong that 5mL is added
In health volunteer's peripheral blood sample, mixing is detected sample by detection process and method described in embodiment 2, target cell
Capture rate is calculated by following formula：Capture rate=capture cell number/initial cell number × 100%.Separately take 200 CCRF-
HSB-2 cells are added in new 5mL healthy volunteer's peripheral blood samples, as negative control experiments group, for detecting this reagent
The specificity of box.Testing result is as shown in table 7：
7 sample detection result of table
By result it is found that can realize capture of the target tumor more than 95% and separative efficiency through the invention, and
To negative tumor cells without capture, high sensitivity, specificity is good, while directly can carry out type to the tumour cell of capture
Identification.
Classifying method in 4 comparing embodiment 2 of embodiment and traditional immunization fluorescent staining classifying method detection result
One, the selection of detection method
The present invention is by detaching and detecting whether epithelial cell protein marker, and/or interstitial cell protein marker are deposited
Classification Identification is being carried out to CTCs.The present embodiment preferred EpCAM, E-cadherin, KTR18 and KTR19 are as epithelial cell mark
Will protein, N-cadherin, vimentin, fibronectin, ZEB1 and SNAI1 as mesenchymal cell markers protein,
CD45 is as leucocyte protein marker.
Traditional immunization fluorescent staining testing process and the present invention are almost the same, after biological sample splitting erythrocyte with CD45 magnetic
Pearl antibody incubation removes leucocyte using U.S.'s day Ni magnetic bead sorting systems, to which enrichment obtains the CTCs in sample.It is then right
CTCs is fixed, antigen retrieval, closing, is incubated primary antibody, washing, is incubated secondary antibody, washs and redye, finally in fluorescence microscope
Under to cell carry out observation and result judgement.Since whole operation process is relatively complicated and is carried out manually by technical staff, make
Greatly at sample loss, the defects of influencing experimental result accuracy and more repeated destabilizing factor.
The selection of the present embodiment detection method is as follows：Implementation group 1 examines sample using traditional immunization fluorescence colour
Survey parting；Detection method examines sample described in kit and embodiment 2 described in 2 embodiment 1 using the present invention of implementation group
Survey parting.The reagent component that two implementation groups use is same source.
Two, sample detection
Healthy volunteer's blood sample 21-25 is taken, MCF-10A cells, U118 cells and PC-9 cells are added thereto
The cell of addition is mixed well with blood, is then equally divided into 2 parts, in every part by each 200 (being determined by cell counter)
Respectively contain 100 MCF-10A cells, U118 cells and PC-9 cells, uses kit of the present invention and method and tradition respectively
Immunofluorescence staining is detected sample, and the results are shown in Table 8：
Testing result of the different detection methods of table 8 to sample
By result it is found that CTCs in sample is detected using kit of the present invention and method and parting have than tradition
Immunofluorescence dyeing detects and the higher sensitivity of typing and stability, capture rate higher, and background quantity of leucocyte is wanted
Well below traditional immunization fluorescent staining detection and typing.
Embodiment 5 captures antibody complex using single strand deoxyribonucleotide as aptamers detection result
One, the design of antibody complex is captured
The present invention captures antibody complex by the capture antibody and aptamers that are specifically bound with corresponding protein marker
It is formed by connecting by the way that material can be sheared, the material of shearing is returning with 2 or 2 or more restriction endonuclease sites
The deoxyribonucleotide double-strand of literary structure；The aptamers are can be with specificity on micro-fluidic chip superficial cell capture component
The micromolecular compound of association reaction, including biotin, digoxin, fluorescein or single strand deoxyribonucleotide occur for conjugate
Deng.
For the preferred single strand deoxyribonucleotide of the present embodiment as aptamers, material SEQ ID NO can be sheared by being connected to:1
3 ' end or SEQ ID NO:25 ' ends, the single strand deoxyribonucleotide meet following design principle：(1) base number
Between 5-70, between preferably 10-40, between more preferably 18-25；(2) G/C content is between 40%-60%；(3)
It avoids the occurrence of and sequence of the material similarity more than 60% can be sheared；(4) there is no hair fasteners with that can shear inside after material is connect
The secondary structures such as structure or dimer.Table 9 gives 10 aptamers sequences for meeting the above design principle：SEQ ID NO:3-
SEQ ID NO:12, table 10 is the specificity junction mixture of corresponding aptamers：SEQ ID NO:13-SEQ ID NO:22.
9 single strand deoxyribonucleotide aptamers sequence information of table
Directly above-mentioned aptamers sequence is synthesized with can shear together with material in composition sequence, material can be sheared by being connected to
SEQ ID NO:13 ' ends or SEQ ID NO:25 ' ends.
10 single strand deoxyribonucleotide aptamers of table correspond to specificity junction mixture sequence information
| Title | Base sequence (5 ' → 3 ') | SEQIDNO. |
| Specificity junction mixture 1 | ATGGCAGGCAGTTAGCGGAT | 13 |
| Specificity junction mixture 2 | GACTGACCAGTATCCAGGCT | 14 |
| Specificity junction mixture 3 | CCATGCACAGTTAGCCTGAC | 15 |
| Specificity junction mixture 4 | CGAATCGGACTAGCGATCCAG | 16 |
| Specificity junction mixture 5 | CTGTCTATACGATCAGGCTCA | 17 |
| Specificity junction mixture 6 | GCATTGACAGTCAGGACTGA | 18 |
| Specificity junction mixture 7 | CGGACTAGCATAGCCGACAT | 19 |
| Specificity junction mixture 8 | TACCATCGGATTAGCATGGAC | 20 |
| Specificity junction mixture 9 | TTGACAGTCAGGCTATACAG | 21 |
| Specificity junction mixture 10 | GCTACGTACCGTACATGGCA | 22 |
Specificity junction mixture is synthesized by Shanghai Sheng Gong bioengineering limited liability company, is modified in 3 cell of micro-fluidic chip
The surface of capture component, method of modifying are art technology common technology.
According to the selection of single strand deoxyribonucleotide aptamers sequence be arranged 4 kinds of different types of kits, and by its
It is specific as shown in table 11 for the detection of 4 experimental groups, SEQ ID NO:25 ' ends are equipped with amino, anti-for connecting capture
Body.Other compositions of the kit, it is same as Example 1.
11 experimental group of table designs
Two, sample detection
Healthy volunteer blood sample 26-30 is taken, it is each that MCF-10A cells, U118 cells and PC-9 cells are added thereto
The cell of addition is mixed well with blood, is then equally divided into 4 parts by 400 (being determined by cell counter), each in every part
Containing 100 MCF-10A cells, U118 cells and PC-9 cells, table 11 is used to capture reagent prepared by antibody complex respectively
Detection method in box and embodiment 2 is detected sample, as a result as shown in table 12：
Testing result of the different deoxyribonucleotide aptamers of table 12 to sample
The kit prepared by 4 kinds of capture antibody complexes is to sample detection result it is found that 4 kinds of single-stranded dezyribonucleosides
The capture rate of 3 kinds of cells of sour aptamers and corresponding specificity junction mixture pair is all higher than 95%, and efficient and stability is good.It says
Meet the single strand deoxyribonucleotide aptamers that design principle is designed as long as bright and be used equally for preparing kit of the present invention
Antibody complex is captured, other are connected to SEQ ID for the selection of different single strand deoxyribonucleotide aptamers and aptamers
NO:The kit at 25 ' ends is consistent with above-mentioned 4 kinds of single strand deoxyribonucleotide aptamers to the testing result of sample, specifically
Data are omitted.
Influence of the different delivery modes of embodiment 6 to testing result
One, the selection of cell delivery mode
The CTCs acquisition modes that the present invention uses have invertibity, each capture antibody complex by with corresponding mark egg
The capture antibody and aptamers of white matter specific binding are formed by connecting by that can shear material, by outer after the completion of capture reaction
Source condition degradation connecting material, you can make capture antibody be detached with aptamers-specificity junction mixture compound, CTCs is greatly improved
Organic efficiency.Compared with conventional microflow control technique capture release CTCs, the stimulation that the present invention selects can shear material degradation
External source condition not damaging cells film integrality, surface antigen and cell activity, so that isolated CTCs is can be used for further
Analyze and identify.
The present embodiment discharges the cell of capture using 3 kinds of modes, upon discharge, Trypan Blue is carried out to the cell of recycling
Identification：Normal living cells due to the cell membrane with structural integrity, therefore can repel trypan blue, be allowed to that born of the same parents can not be entered
It is interior；And loss of activity or the incomplete cell of cell membrane, membrane passage increase, trypan blue can penetrate the cell of denaturation
Film is combined with DNA, makes its coloring, cell that can dye blue by trypan blue, so as to distinguish normal live cells and dead or just
In dead cell.Specific delivery mode design is as shown in table 13, and other compositions are identical as embodiment.
Cell delivery mode after table 13 captures
Wherein, it is ultraviolet light light-sensitive material that experimental group 9, which captures antibody with PC-spacer in aptamers connecting material, in purple
It can degrade under outside line treatment conditions.
Two, sample detection
Healthy volunteer blood sample 31-35 is taken, epithelial-mesenchymal mixed type lung cancer cell line PC-9 cells are added thereto
300, the cell of addition is mixed well with blood, is then equally divided into 3 parts, 100 PC-9 cells are respectively contained in every part, point
The detection method not captured using table 13 in kit and embodiment 2 prepared by antibody complex is detected sample, still
The cell that release is captured in micro-fluidic chip 3 enters behind cell collection Room 4 without immunofluorescence dyeing identification, but carries out platform
Expect blue dyeing and count, to obtain the cell recoveries and cell activity of each experimental group, cell recoveries calculation formula is：It returns
Yield=recycling cell number/total number of cells × 100%, cell activity=viable count/(viable count+dead cell number) ×
100%.Testing result is as shown in table 14 (data are cell number or percentage in table)：
Testing result of the different delivery modes of table 14 to sample
By above 3 experimental group cell recoveries and Trypan Blue result it is found that the present invention is selected to shear material
The cell recovering effect that the delivery mode of material obtains is best, and the rate of recovery is up to 95% or more (experimental group 7), and cell surface egg
White and cell membrane integrity is hardly affected, and the cell of recycling is provided with normal live cells state, can be used for follow-up
Dyeing identification and other analysis；And other two kinds of delivery mode cell recoveries are substantially less than the present invention, and cell surface egg
White and cell membrane integrity is by a degree of damage, and cell activity declines, wherein most with 8 delivery mode effect of experimental group
Difference, cell recoveries and cell activity are minimum.
7 separate sources of embodiment captures influence of the capture antibody complex of antibody composition to testing result
One, the design (selection of target detection protein marker difference clone number capture antibody) that prepared by kit
Kit epithelial cell protein marker of the present invention is selected from：In EpCAM, E-cadherin, KTR18 and KTR19
Two or more；The interstitial cell protein marker is selected from：N-cadherin、vimentin、fibronectin、
Two or more in ZEB1 and SNAI1；It is carried out when selecting different clone number capture antibody composition capture antibody complexes
When detection, detection sensitivity and background fluorescence intensity effect are different.
Number selection of capture antibody is cloned referring to implementation group 10-12 for blip protein difference, chooses 2 respectively
Kind, the capture antibody of other clones number of 4 kinds and 9 kinds, compare its detection result, and implementation group 13 is using whole and implementation
The identical capture antibody in 1 source of example, specific design are as shown in Table 15.
The selection of the different clone number capture antibody of table 15
Two, pattern detection
Healthy volunteer blood sample 36-40 is taken, it is each that MCF-10A cells, U118 cells and PC-9 cells are added thereto
The cell of addition is mixed well with blood, is then equally divided into 4 parts by 400 (being determined by cell counter), each in every part
Containing 100 MCF-10A cells, U118 cells and PC-9 cells, table 15 is used to capture reagent prepared by antibody complex respectively
Detection method in box and embodiment 2 is detected sample, as a result as shown in table 16：
The comparison for the capture antibody complex detection result that table 16 is formed using separate sources capture antibody
From the testing result of 4 experimental groups it is found that compared with currently preferred clone number capture antibody, by other clones
Number capture antibody composition capture antibody complex detection result and sensitivity it is poor, to the protein marker of some differential expressions
It cannot detect.Other kits for being directed to the different capture antibody complexes preparations for cloning number capture antibody composition can use identical
Testing result, specific data omit.
Each technical characteristic of embodiment described above can be combined arbitrarily, to keep description succinct, not to above-mentioned reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, it is all considered to be the range of this specification record.
Several embodiments of the invention above described embodiment only expresses, the description thereof is more specific and detailed, but simultaneously
It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art
It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention
Range.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (11)
1. a kind of CTC protein parting kits based on microflow control technique, which is characterized in that include：
(1) it is directed to the capture antibody complex of different CTCs protein markers：Each capture antibody complex by with corresponding mark
The capture antibody and aptamers that will protein specific combines are formed by connecting by that can shear material, and the material of shearing is tool
There is the deoxyribonucleotide double-strand of the palindrome of 2 or 2 or more restriction endonuclease sites；The adaptation physical efficiency with
Corresponding specificity junction mixture combines；
(2) surface coupling has the micro-fluidic chip of cell capture component, the cell capture component to be made of microtrabeculae, the microtrabeculae
One end be connected with micro-fluidic chip, the other end is modified with specificity junction mixture, the specificity junction mixture can to it is above-mentioned corresponding
Aptamers specific binding.
2. the CTC protein parting kits according to claim 1 based on microflow control technique, which is characterized in that described
Aptamers are selected from：One kind in biotin, digoxin, fluorescein or single strand deoxyribonucleotide；The specificity junction mixture
For one kind in corresponding Streptavidin, anti digoxin antibody, anti-fluorescein antibody or complementary single strand deoxyribonucleotide.
3. the CTC protein parting kits according to claim 1 based on microflow control technique, which is characterized in that be directed to
Each CTCs protein marker has corresponding capture antibody complex respectively：
The CTCs protein markers are to be used as epithelium selected from least one of EpCAM, E-cadherin, KTR18 and KTR19
Cell type protein marker, and/or in N-cadherin, vimentin, fibronectin, ZEB1 and SNAI1 extremely
It is few a kind of as mesenchymal cell types protein marker；
The capture antibody complex, for each CTCs protein marker, capture antibody complex is respectively by corresponding
CTCs protein markers capture antibody and constitute；Different CTCs, aptamers can shear material identical.
4. the CTC protein parting kits according to claim 1 based on microflow control technique, which is characterized in that also wrap
It has included：For the labelled antibody of each CTCs protein marker, with respective capture antibody specificity can occur for the labelled antibody
Association reaction, and be modified with fluorophor, different CTCs cell types, labelled antibody fluorophor are different.
5. the CTC protein parting kits according to claim 4 based on microflow control technique, which is characterized in that also wrap
It includes：For the magnetic bead antibody of leucocyte protein marker, the magnetic bead antibody is anti-for the label for leucocyte protein marker
Body is combined into magnetic bead；The magnetic bead antibody can occur specific binding with leucocyte protein marker and react, described to be directed to
The labelled antibody of leucocyte protein marker is modified with fluorophor, and different with CTCs cell type fluorophors.
6. the CTC protein parting kits according to any one of claims 1 to 5 based on microflow control technique, feature
It is, the base sequence of the deoxyribonucleotide double-strand is respectively such as SEQ ID NO:1 and SEQ ID NO:Shown in 2.
7. the CTC protein parting kits according to claim 6 based on microflow control technique, which is characterized in that described
A 5 ' single-stranded ends in deoxyribonucleotide double-strand are equipped with amino, and for connecting capture antibody, aptamers are connected to this
3 ' single-stranded ends or aptamers are connected to another 5 ' single-stranded ends；
Or a 3 ' single-stranded ends in the deoxyribonucleotide double-strand are equipped with amino, for connecting capture antibody, adaptation
Body is connected to 5 ' the single-stranded ends or aptamers are connected to another 3 ' single-stranded ends.
8. the CTC protein parting kits according to claim 7 based on microflow control technique, which is characterized in that base
Sequence such as SEQ ID NO:The 5 ' of 1 deoxyribonucleotide chain are equipped with amino group, and deoxyribonucleotide chain passes through the ammonia
Base group is connected with capture antibody；Base sequence such as SEQ ID NO:The 5 ' of 2 deoxyribonucleotide chain are connected with aptamers.
9. the CTC protein parting kits according to any one of claims 1 to 5 based on microflow control technique, feature exist
In the aptamers are biotin, and the specificity junction mixture is corresponding Streptavidin.
10. the CTC protein parting kits according to claim 5 based on microflow control technique, which is characterized in that white thin
Born of the same parents' protein marker is CD45.
11. according to CTC protein parting kit of claim 3 to 5 any one of them based on microflow control technique, feature
It is, it is epithelial cell marker protein that the CTCs protein markers, which are selected from EpCAM, E-cadherin, KTR18 and KTR19,
Matter, and selected from N-cadherin, vimentin, fibronectin, ZEB1 and SNAI1 as mesenchymal cell markers protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610045465.8A CN106996976B (en) | 2016-01-22 | 2016-01-22 | CTC protein parting kits based on microflow control technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610045465.8A CN106996976B (en) | 2016-01-22 | 2016-01-22 | CTC protein parting kits based on microflow control technique |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106996976A CN106996976A (en) | 2017-08-01 |
| CN106996976B true CN106996976B (en) | 2018-10-02 |
Family
ID=59428324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610045465.8A Active CN106996976B (en) | 2016-01-22 | 2016-01-22 | CTC protein parting kits based on microflow control technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106996976B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109856388A (en) * | 2018-11-29 | 2019-06-07 | 北京优迅医学检验实验室有限公司 | The catching method and capture kit of circulating tumor cell |
| CN112143732B (en) * | 2019-06-28 | 2022-03-22 | 中国科学院苏州纳米技术与纳米仿生研究所 | ssDNA aptamer for specifically recognizing N-cadherin, and screening method and application thereof |
| CN111424034B (en) * | 2020-04-23 | 2022-04-15 | 京东方科技集团股份有限公司 | Nucleic acid probe, biochip, kit and method for sorting target cells |
| CN112730840B (en) * | 2021-01-29 | 2023-10-17 | 章毅 | Method for identifying CD44 and CD24 molecular phenotypes |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102414562A (en) * | 2009-03-24 | 2012-04-11 | 生物概念股份有限公司 | Devices and methods of cell capture and analysis |
| WO2013181532A1 (en) * | 2012-06-01 | 2013-12-05 | Creatv Microtech, Inc. | Capture, identification and use of a new biomarker of solid tumors in body fluids |
| CN103589629A (en) * | 2013-11-15 | 2014-02-19 | 上海康微健康科技有限公司 | Separation system for CTCs (circulating tumor cells) |
| CN103642756A (en) * | 2013-11-06 | 2014-03-19 | 上海交通大学 | Method for separating high-purity circulating tumor cells from blood |
| CN104651315A (en) * | 2015-03-19 | 2015-05-27 | 武汉大学 | Method for sorting tumor cells in microfluidic chip by simultaneously utilizing specific antigen-antibody recognition and cell size difference |
| CN105115878A (en) * | 2015-09-11 | 2015-12-02 | 上海交通大学 | Circulating tumor cell detection kit, preparing method thereof and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9341550B2 (en) * | 2010-11-19 | 2016-05-17 | On-Chip Biotechnologies Co., Ltd. | Method for detecting low concentrations of specific cell from high concentrations of cell populations, and method for collecting and analyzing detected cell |
-
2016
- 2016-01-22 CN CN201610045465.8A patent/CN106996976B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102414562A (en) * | 2009-03-24 | 2012-04-11 | 生物概念股份有限公司 | Devices and methods of cell capture and analysis |
| WO2013181532A1 (en) * | 2012-06-01 | 2013-12-05 | Creatv Microtech, Inc. | Capture, identification and use of a new biomarker of solid tumors in body fluids |
| CN103642756A (en) * | 2013-11-06 | 2014-03-19 | 上海交通大学 | Method for separating high-purity circulating tumor cells from blood |
| CN103589629A (en) * | 2013-11-15 | 2014-02-19 | 上海康微健康科技有限公司 | Separation system for CTCs (circulating tumor cells) |
| CN104651315A (en) * | 2015-03-19 | 2015-05-27 | 武汉大学 | Method for sorting tumor cells in microfluidic chip by simultaneously utilizing specific antigen-antibody recognition and cell size difference |
| CN105115878A (en) * | 2015-09-11 | 2015-12-02 | 上海交通大学 | Circulating tumor cell detection kit, preparing method thereof and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 基于微流控技术的循环肿瘤细胞分选研究;黄笛等;《化学进展》;20150724;第27卷(第7期);第882-912页 * |
| 微流控芯片技术在循环肿瘤细胞分离中的研究进展;吕晓庆等;《生物化学与生物物理进展》;20150415;第42卷(第4期);第301-312页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106996976A (en) | 2017-08-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106996976B (en) | CTC protein parting kits based on microflow control technique | |
| CN104178454B (en) | A kind of enrichment of circulating tumor cell, analysis method | |
| CN105785005A (en) | Circulating tumor cell detection kit and application thereof | |
| Wu et al. | Nanosphere-based one-step strategy for efficient and nondestructive detection of circulating tumor cells | |
| WO2020133912A1 (en) | Method for simultaneously detecting exosome membrane protein and mrna | |
| CN104651315B (en) | It is a kind of to recognize the method that tumour cell is sorted with cell size difference using antigen and antibody specific simultaneously in micro-fluidic chip | |
| US20120071335A1 (en) | Method for Identification, Selection and Analysis of Tumour Cells | |
| CN103592432B (en) | Method for separating sperm in sperm and epithelial cell mixed stain by using immunological magnetic beads | |
| CN107356744B (en) | Method for sorting and/or enriching circulating tumor cells and kit thereof | |
| KR101279918B1 (en) | Device for detection of tumor cells and detecting method tumor cells | |
| CN106970225B (en) | A kind of kit and its application for combining 8 probe identification circulating tumor cells of CEP using CD45 immunofluorescences | |
| CN106970224B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP probe identification circulating tumor cells | |
| CN106980018B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells | |
| WO2018214623A1 (en) | Microfluidic chip for circulating tumor cell separation, circulating tumor cell separation method and counting method | |
| CN109439732B (en) | Kit for three-dimensional noninvasive tumor early screening | |
| CN108535228A (en) | A method of detaching the fetal cell that dissociates from maternal blood | |
| EP2972359B1 (en) | Enrichment of circulating tumor cells by depleting white blood cells | |
| CN111812071A (en) | Novel circulating tumor cell identification technology | |
| CN106996975B (en) | Circulating tumor cell albumen parting kit | |
| CN205067292U (en) | Circulation tumor cells detect reagent box | |
| Huang et al. | Multiplex single-cell droplet PCR with machine learning for detection of high-risk human papillomaviruses | |
| CN108546676A (en) | The method that tunnel magnetic field technology detaches and is enriched with rare cell in peripheral blood | |
| WO2017096714A1 (en) | Circulating tumor cell typing identification kit | |
| CN107561265A (en) | A kind of separation of solid and liquid composite membrane and preparation method thereof | |
| CN110927369A (en) | Kit for identifying circulating tumor cells by combining TCPP (TCPP) with CEP (cytokine induced apoptosis protein) probe and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |