CN106980018B - A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells - Google Patents
A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells Download PDFInfo
- Publication number
- CN106980018B CN106980018B CN201710157833.2A CN201710157833A CN106980018B CN 106980018 B CN106980018 B CN 106980018B CN 201710157833 A CN201710157833 A CN 201710157833A CN 106980018 B CN106980018 B CN 106980018B
- Authority
- CN
- China
- Prior art keywords
- cep17
- slide
- fluorescence
- cell
- circulating tumor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/533—Production of labelled immunochemicals with fluorescent label
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to biomedical clinical detection fields, and in particular to a kind of kit and its application for contaminating identification circulating tumor cell altogether using CD45 immunofluorescences joint CEP17 fluorescence in situ hybridization probe one-step method.The kit includes：Fixer, 2 × SSC, 40/0.4 × SSC of 0.3%NP, 0.075M KCl solution, CD45 monoclonal antibodies and CEP17 probes mixed liquor, DAPI counterstains, perforation agent, confining liquid and mountant.The circulating tumor cell that the present invention is captured using the joint CEP17 fluorescence in situ hybridization probe identifications of CD45 Immunofluorescent Antibodies, immunofluorescence and fluorescence in situ hybridization detection are completed by one-step method, it overcomes Immunofluorescence test and when fluorescence in situ hybridization detection is used in combination exists and interferes with each other, detect the problem of time-consuming longer, one-step method hybridization incubation is rapidly completed in 2h, detection time is greatly reduced, and testing result observation is intuitive.
Description
Technical field
The invention belongs to biomedical clinical detection fields, and in particular to a kind of application CD45 immunofluorescences joint CEP17
The kit of fluorescence in situ hybridization probe identification circulating tumor cell and its application.
Background technology
Circulating tumor cell (circulating tumor cells, CTCs) refers to be present in all kinds of in peripheral blood
The general designation of tumour cell, because of spontaneous or operation of diagnosis and treatment, from entity tumor lesion (primary tumor, transfer stove), coming off discharges into periphery
The tumour cell of blood circulation, most of CTCs occur apoptosis or are swallowed after peripheral blood is entered, and minority can escape and anchor
Develop into transfer stove.CTCs gradually showed up prominently in the clinical manifestation of diagnosing tumor, treatment and monitoring etc. in recent years, was
Current most potential tumour non-invasive diagnosis and real-time curative effect monitoring means, clinical value are extremely notable.With tradition
Imaging diagnosis, endoscopy and pathological diagnosis compare, advantage is notable, can more sensitively find the change of disease
Change, more science, the effect for rapidly evaluating a certain therapeutic scheme.And separation and concentration CTCs need to only extract a small amount of periphery of patient
Blood is free from side effects to patient, therefore can achieve the purpose that monitor progression of disease in real time with the monitoring of frequent.It is even more important
, CTCs can as analysis patient tumors biological property real-time sample, it can be found that patient real-time biological change,
And therapeutic scheme is adjusted according to result in time, realize real-time individualized treatment.
The method of CTCs enrichment captures is substantially based on following three kinds of principles：Immunocapture, cell size, other features
It identifies (such as cell density, charge, deformability), first two is to apply more method at present.CTCs is identified after capture
It is to realize that CTCs the effect of applying to clinical tumor patient is assessed in real time, the state of an illness monitors in real time, direction of medication usage and Index for diagnosis
It is crucial.The identification most common methods of CTCs mainly have 6 kinds of methods：(1) immunofluorescence technique；(2) flow cytometry；(3) fluorescence is former
Position hybrid method；(4)RT-PCR；(5) gene chips；(6) two generation PCR sequencing PCRs.Immunofluorescence technique and flow cytometry are based on CTCs
Memebrane protein characterization technology；It is special that fluorescence in situ hybridization, RT-PCR, gene chips and two generation PCR sequencing PCRs are based on CTCs nucleic acid
Levy identification technology.
Immunofluorescence is the principle combined using antigen with antibody specificity, and fluorescein-labeled antibody is made to swell with special
Tumor markers (mainly including epithelial cell keratin, epithelial cell membrane specific antigen etc.) combine, and pass through enzyme and substrate reactions
It develops the color come the presence for judging tumour cell.Immunofluorescence is to detect one of maturation method of CTCs, easy, intuitive and can carry out
Morphological analysis, but its sensibility only has 105Left and right, and the tumour of many differentiation differences cannot express target antigen, Er Feishang
Cytokeratin and epithelial antigen also may be positive in chrotoplast, in addition under mirror to the subjectivity of result observation and interpretation compared with
By force, these all limit application of the immunofluorescence in CTCs detections.
Fluorescence in situ hybridization (Fluorescence in situ hybridization, FISH) is an emerging molecule
Cytogenetic techniques are to grow up on the basis of original radioactive in situ hybridization technology phase late 1980s
A kind of nonradioactivein situhybridization technology.This technology has been widely used for the structural research of animal-plant gene group, dyeing at present
The analysis of variance of body fine structure, viral infection assays, mankind's pre-natal diagnosis, cancer genetics and genome evolution research etc. are many
Field.The basic principle of FISH be with it is known label single-chain nucleic acid be probe, according to the principle of base complementrity, with material to be checked
In unknown single-chain nucleic acid specifically bound, form the heteroduplex nucleic acid that can be detected.Since DNA molecular is in chromosome
On be linearly to be arranged along the chromosome longitudinal axis, thus with chromosome can directly hybridize so as to by specific base with probe
Because positioning on chromosome.Compared with traditional radioactive label in situ hybridization, fluorescence in situ hybridization has quick, detection signal
By force, hybrid specificities are high and can be with multiple staining the features such as, therefore in molecular cytogenetics field by common concern.Fluorescence
Hybridization in situ technique is applied to detection CTCs chromosome polyploids, gene break, during Gene Fusion, due in the CTCs of capture
There are a large amount of haemocyte backgrounds, and under fluorescence microscope, searching target CTCs is extremely difficult, exists so as to limit FISH technology
Application in CTCs.
Invention content
The present invention is in view of the deficiencies of the prior art, and it is an object of the present invention to provide a kind of application CD45 immunofluorescences joint CEP17 is glimmering
The kit of light in situ hybridization probe identification circulating tumor cell and its application.
For achieving the above object, the technical solution adopted by the present invention is：
A kind of reagent using CD45 immunofluorescences joint CEP17 fluorescence in situ hybridization probe identification circulating tumor cells
Box, including：Fixer, 2 × SSC, 0.3%NP-40/0.4 × SSC, 0.075M KCl solution, CD45 monoclonal antibodies and CEP17 probes
Mixed liquor, DAPI counterstains, perforation agent, confining liquid and mountant.
In said program, the component of the CD45 monoclonal antibodies and CEP17 probe mixed liquors is fluorescent marker CD45 monoclonal antibodies,
CEP17 fluorescence in situ hybridization probe, dextran sulfate, deionized formamide, BSA, SSC, Triton-100.
In said program, the CD45 monoclonal antibodies and CEP17 probe mixed liquor each components it is a concentration of：Fluorescent marker CD45 is mono-
Anti- a concentration of 0.002mg/ml, a concentration of 2ng/ μ L of CEP17 fluorescence in situ hybridization probe, 10% (quality of dextran sulfate
Concentration), deionized formamide 50% (volumetric concentration), BSA1% (mass concentration), 6 × SSC, 1 ‰ (volumes of Triton-100
Concentration).
In said program, the fixer is methanol and glacial acetic acid by volume 3:1 mixing gained mixed liquor.
In said program, the component of the perforation agent is 5 ‰ Triton X-100,0.1M phosphate buffers.
In said program, the component of the confining liquid is 5% BSA.
In said program, the mountant is resin.
Mentioned reagent box, for identifying the application in circulating tumor cell product, specifically includes the following steps preparing：
(1) cell is harvested：The circulating tumor cell sample (CTCs) of capture is drawn to conical centrifuge tube, centrifuges, remove supernatant；
(2) it is hypotonic：0.075mol/L KCl 6~8mL of solution of pre-temperature to 37 DEG C are added in, with suction pipe piping and druming mixing postposition 37
DEG C 20~30min of incubator；
(3) it pre-fixes：Fixer 2mL is added in, blows and beats mixing, centrifugation；
(4) supernatant is sucked, adds the fixer 5mL of Fresh, blows and beats mixing, fixed 10min, centrifugation；
(5) step (4) is repeated until cell precipitation whitens wash clean；
(6) preparation of cell suspension：Supernatant is sucked, adds in appropriate fixer, the suitable cell suspension (10 of concentration is made
× object lens observe cell density under phase contrast microscope, it is desirable that cell is non-overlapping, and haplopia open country cell quantity is at 100~200
It is advisable)；
(7) film-making：It draws 3~5 μ L cell suspensions to drop on anticreep glass slide, 56 DEG C of agings 0.5~2 hour；
(8) it closes：100ul confining liquids are added in slide, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(9) it perforates：100ul perforation agent is added dropwise, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(10) it is dehydrated：Slide is sequentially placed into 70Vt% (volumetric concentration) ethyl alcohol, 85Vt% ethyl alcohol and 100Vt% ethyl alcohol
Slide is spontaneously dried after each 2min dehydrations；
(11) hybridization incubation：CD45 monoclonal antibodies and CEP17 probe mixed liquors are taken out, is stored at room temperature 5 minutes, it is short after thorough mixing
Temporarily centrifugation takes 10 μ L drops to cover the coverslip of 22mm × 22mm immediately, probe should under coverslip in cell drop piece hybridising region
Uniformly expansion bubble-free, with resin edge sealing, slide is placed on hybridization instrument and carries out hybridization incubation；
(12) it washs：The slide after being incubated is taken out, the rubber glue on coverslip is removed, slide is placed in 65 DEG C~68 immediately
In DEG C 0.3%NP-40/0.4 × SSC solution, 10~20s of oscillation sloughs coverslip, impregnates 5~10 minutes, slide is placed in 37
In DEG C deionized water, 1~3s is vibrated, is impregnated 2 minutes, dark place spontaneously dries slide；
(13) mounting：10ul DAPI counterstains are added dropwise；
(14) diagosis：Suitable optical filter observation slide is selected under fluorescence microscope；
(15) result judgement：A.CD45 stained positives are leucocyte；B.CD45 is not colored, but is non-in huge bare nucleus
Tumour cell；C.CD45 is not colored, signaling point >=2, and non-huge bare nucleus may determine that as circulating tumor cell, be counted
Number.
In said program, the condition of step (11) described hybridization incubation is：75 DEG C are denaturalized 2 minutes, and 37 DEG C are incubated 2 hours.
Beneficial effects of the present invention are as follows：
(1) present invention is overcome immune using immunofluorescence joint fluorescence in situ hybridization technique identification circulating tumor cell
When fluoroscopic examination or fluorescence in situ hybridization detection monotechnics detect, testing result cannot fully turn out to be circulating tumor cell
Shortcoming reduces the mistake of circulating tumor cell identification；
(2) cycle that the present invention is captured using the joint CEP17 fluorescence in situ hybridization probe identifications of CD45 Immunofluorescent Antibodies
Tumour cell completes immunofluorescence and fluorescence in situ hybridization detection by one-step method, and one-step method hybridization incubation is quick in 2h
It completes, greatly reduces detection time；
(3) heretofore described CEP17 probes are prepared using non repetitive sequence technology, are reduced conventional CEP17 and are visited
Needle can effectively reduce the miscount of circulating tumor cell because of nonspecific hybridization signals caused by repetitive sequence；Simultaneously should
Hybridization can be rapidly completed within 2 hours in CEP17 probes prepared by technology, when 16~24 hours than conventional probe hybridize
Between, it greatly shortens.
Description of the drawings
Fig. 1 is the circulating tumor of this kit identification capture, and wherein A cells are not by CD45 red colourations, while contain in core
Multiple (＞ 2) fluorescence in situ hybridization signals, the cell are circulating tumor cell；B cell contains 2 by CD45 red colourations in core
A fluorescence signal point, the cell are blood cell (leucocyte).
Fig. 2 is the circulating tumor of this kit identification capture, and wherein A cells are not by CD45 red colourations, while contain 2 in core
A fluorescence in situ hybridization signal, the cell are circulating tumor cell, and the multiple tumour cells of the sample form bulk.
Fig. 3 is the circulating tumor of this kit identification capture, and wherein A cells are not by CD45 red colourations, while contain in core
Multiple (＞ 2) fluorescence in situ hybridization signals, the cell are circulating tumor cell；B cell contains 2 by CD45 red colourations in core
A fluorescence signal point, the cell are blood cell (leucocyte).
Specific embodiment
For a better understanding of the present invention, with reference to the embodiment content that the present invention is furture elucidated, but the present invention
Content is not limited solely to the following examples.
Embodiment 1
A kind of reagent using CD45 immunofluorescences joint CEP17 fluorescence in situ hybridization probe identification circulating tumor cells
Box, the composition of kit are as shown in table 1 below：
1 kit forms of table
Embodiment 2
Patient with breast cancer's circulating tumor cell ,+No. 17 dyes of CD45 monoclonal antibodies of use are identified using kit described in embodiment 1
Colour solid fluorescence in situ hybridization probe detects, and No. 17 chromosome fluorescence in-situ hybridization probe-specific sequences (SEQ ID NO.1) are：
TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCTCTGA
GGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATT
CAAATCCCAGAGT
Specifically comprise the following steps：
(1) cell is harvested：The circulating tumor cell sample (CTCs) of capture is drawn to conical centrifuge tube, is centrifuged, 1000 turns/
Min, 10min remove supernatant；
(2) it is hypotonic：0.075mol/L KCL 6~8mL of solution of pre-temperature to 37 DEG C are added in, with suction pipe piping and druming mixing postposition 37
DEG C 20~30min of incubator；
(3) it pre-fixes：Fixer 2mL is added in, blows and beats mixing, 1000 turns/min centrifugations 10min；
(4) supernatant is sucked, adds the fixer 5mL of Fresh, blows and beats mixing, fixed 10min, 1000 turns/min centrifugations
10min；
(5) step (4) is repeated until cell precipitation whitens wash clean；
(6) preparation of cell suspension：Supernatant is sucked, adds in appropriate fixer, the suitable cell suspension of concentration is made；
(7) film-making：It draws 3~5 μ L cell suspensions to drop on anticreep glass slide, 56 DEG C of agings 0.5~2 hour；
(8) it closes：100ul confining liquids are added in slide, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(9) it perforates：100ul perforation agent is added dropwise, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(10) it is dehydrated：Slide is sequentially placed into each 2min dehydrations in 70Vt% ethyl alcohol, 85Vt% ethyl alcohol and 100Vt% ethyl alcohol
After spontaneously dry slide；
(11) hybridization incubation：CD45 monoclonal antibodies and CEP17 probe mixed liquors are taken out, is stored at room temperature 5 minutes, it is short after thorough mixing
Temporarily centrifugation takes 10 μ L drops to cover the coverslip of 22mm × 22mm immediately, probe should under coverslip in cell drop piece hybridising region
Uniformly expansion bubble-free, with resin edge sealing, slide is placed on hybridization instrument, and 75 DEG C are denaturalized 2 minutes, and 37 DEG C are incubated 2 hours；
(12) it washs：The slide after being incubated is taken out, the rubber glue on coverslip is removed, slide is placed in 65 DEG C~68 immediately
In DEG C 0.3%NP-40/0.4 × SSC solution, coverslip is sloughed in oscillation for 10~20 seconds, impregnates 5~10 minutes, slide is placed in 37
It in DEG C deionized water, vibrates 1~3 second, impregnates 2 minutes, dark place spontaneously dries slide；
(13) mounting：10ul DAPI counterstains are added dropwise；
(14) diagosis：Suitable optical filter observation slide is selected under fluorescence microscope.
Testing result as depicted in figs. 1 and 2, Fig. 1 be this kit identification capture circulating tumor, wherein A cells not by
CD45 red colourations, while containing multiple (＞ 2) fluorescence in situ hybridization signals in core, which is circulating tumor cell；B is thin
Born of the same parents are by CD45 red colourations, and containing 2 fluorescence signal points in core, which is blood cell (leucocyte).
Fig. 2 is the circulating tumor of this kit identification capture, and wherein A cells are not by CD45 red colourations, while contain 2 in core
A fluorescence in situ hybridization signal, the cell are circulating tumor cell, and the multiple tumour cells of the sample form bulk.
Embodiment 3
Using kit described in the embodiment of the present invention, using CD45 immunofluorescences and the joint inspection of CEP17 fluorescence in situ hybridization
Patients with gastric cancer circulating tumor cell is surveyed, No. 17 chromosome fluorescence in-situ hybridization probe-specific sequences (SEQ ID NO.1) are：
TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGAC
CTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATG
TTTGCATTCAAATCCCAGAGT
Specifically comprise the following steps：
(1) cell is harvested：Peripheral blood in patients 10ml is extracted, instrument is captured using commercially available circulating tumor cell or kit is caught
The circulating tumor cell (CTCs) obtained, the circulating tumor cell after capture are drawn to conical centrifuge tube, centrifugation, 1000 turns/min,
10min removes supernatant；
(2) it is hypotonic：0.075mol/LKCL 6~8mL of solution of pre-temperature to 37 DEG C are added in, with suction pipe piping and druming mixing postposition 37
DEG C 20~30min of incubator；
(3) it pre-fixes：Fixer 2mL is added in, blows and beats mixing, 1000 turns/min centrifugations 10min；
(4) supernatant is sucked, adds the fixer 5mL of Fresh, blows and beats mixing, fixed 10min, 1000 turns/min centrifugations
10min；
(5) step (4) is repeated until cell precipitation whitens wash clean；
(6) preparation of cell suspension：Supernatant is sucked, adds in appropriate fixer, the suitable cell suspension of concentration is made；
(7) film-making：It draws 3~5 μ L cell suspensions to drop on anticreep glass slide, 56 DEG C of agings 0.5~2 hour；
(8) it closes：100ul confining liquids are added in slide, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(9) it perforates：100ul perforation agent is added dropwise, after room temperature closes 10min, 2 × SSC (pH 7.0) rinsings 5min；
(10) it is dehydrated：Slide is sequentially placed into 70% ethyl alcohol, 85% ethyl alcohol and 100% ethyl alcohol natural after each 2min dehydrations
Dry slide；
(11) hybridization incubation：CD45 monoclonal antibodies and CEP17 probe mixed liquors are taken out, is stored at room temperature 5 minutes, it is short after thorough mixing
Temporarily centrifugation takes 10 μ L drops to cover the coverslip of 22mm × 22mm immediately, probe should under coverslip in cell drop piece hybridising region
Uniformly expansion bubble-free, with resin edge sealing, slide is placed on hybridization instrument, and 75 DEG C are denaturalized 2 minutes, and 37 DEG C are incubated 2 hours；
(12) it washs：The slide after being incubated is taken out, the rubber glue on coverslip is removed, slide is placed in 65 DEG C~68 immediately
In DEG C 0.3%NP-40/0.4 × SSC solution, coverslip is sloughed in oscillation for 10~20 seconds, impregnates 5~10 minutes, slide is placed in 37
It in DEG C deionized water, vibrates 1~3 second, impregnates 2 minutes, dark place spontaneously dries slide；
(13) mounting：10ul DAPI counterstains are added dropwise；
(14) diagosis：Suitable optical filter observation slide is selected under fluorescence microscope.
Testing result is as shown in Figure 3.Fig. 3 is the circulating tumor of this kit identification capture, and wherein A cells are not contaminated by CD45
Red, while containing multiple (＞ 2) fluorescence in situ hybridization signals in core, which is circulating tumor cell；B cell is by CD45
Red colouration, containing 2 fluorescence signal points in core, which is blood cell (leucocyte).
Obviously, above-described embodiment is only intended to clearly illustrate made example, and is not the limitation to embodiment.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or
It changes.There is no necessity and possibility to exhaust all the enbodiments.And the obvious variation or change therefore amplified
It moves within still in the protection domain of the invention.
Sequence table
<110>Wuhan Kang Lu Biotechnology Ltd.
<120>It is a kind of to combine the kit of 17 probe identification circulating tumor cells of CEP using CD45 immunofluorescences and its answer
With
<160>1
<210> 1
<211> 167bp
<212> DNA
<213>Artificial sequence
<400> 1
tgaacattcc tttggatgga gcaggtttga gacactcttt ttgtacaatc tacaagtgga 60
tatttggacc tctctgagga tttcgttgga aacgggataa ctgcacctaa ctaaacggaa 120
gcattctcag aaacttcttg gtgatgtttg cattcaaatc ccagagt 167
Claims (1)
1. a kind of kit using CD45 immunofluorescences joint CEP17 fluorescence in situ hybridization probe identification circulating tumor cells is examined
The method for surveying identification circulating tumor cell, the method are used for non-disease diagnose and treat purpose, which is characterized in that specifically wrap
Include following steps：
（1）Harvest cell：By the circulating tumor cell sample of capture（CTCs）Conical centrifuge tube is drawn to, centrifuges, remove supernatant；
（2）It is hypotonic：0.075mol/L KCl 6 ~ 8mL of solution of pre-temperature to 37 DEG C are added in, mixing 37 DEG C of perseverances of postposition are blown and beaten with suction pipe
20 ~ 30min of incubator；
（3）It pre-fixes：Fixer 2mL is added in, blows and beats mixing, centrifugation；
（4）Supernatant is sucked, adds the fixer 5mL of Fresh, blows and beats mixing, fixed 10min, centrifugation；
（5）Repeat step（4）Until cell precipitation whitens wash clean；
（6）The preparation of cell suspension：Supernatant is sucked, adds in appropriate fixer, the suitable cell suspension of concentration is made；
（7）Film-making：It draws 3 ~ 5 μ L cell suspensions to drop on anticreep glass slide, 56 DEG C of agings 0.5 ~ 2 hour；
（8）Closing：100uL confining liquids are added in slide, after room temperature closes 10min, 2 × SSC rinsings 5min；
（9）Perforation：100ul perforation agent is added dropwise, after room temperature closes 10min, 2 × SSC rinsings 5min；
（10）Dehydration：Slide is sequentially placed into 70%, 85% and 100% ethanol solution after each 2min dehydrations and spontaneously dries slide；
（11）Hybridization incubation：Take out CD45 monoclonal antibodies and CEP17 probe mixed liquors, be stored at room temperature 5 minutes, after thorough mixing it is of short duration from
The heart takes 10 μ L drops to cover the coverslip of 22mm × 22mm immediately, probe should be uniform under coverslip in cell drop piece hybridising region
Bubble-free is unfolded, with resin edge sealing, slide is placed on hybridization instrument and carries out hybridization incubation；The condition of the hybridization incubation is：75
DEG C denaturation 2 minutes, 37 DEG C be incubated 2 hours；
（12）Washing：The slide after being incubated is taken out, the rubber glue on coverslip is removed, slide is placed in 65 DEG C ~ 68 DEG C immediately
In 0.3%NP-40/0.4 × SSC solution, 10 ~ 20s of oscillation sloughs coverslip, impregnates 5 ~ 10 minutes, by slide be placed in 37 DEG C go from
In sub- water, 1 ~ 3s is vibrated, is impregnated 2 minutes, dark place spontaneously dries slide；
（13）Mounting：10uL DAPI counterstains are added dropwise；
（14）Diagosis：Suitable optical filter observation slide is selected under fluorescence microscope；
（15）Result judgement：A. CD45 stained positives are leucocyte；B. CD45 is not colored, but is non-swollen in huge bare nucleus
Oncocyte；C. CD45 is not colored, signaling point >=2, and non-huge bare nucleus may determine that as circulating tumor cell；
The kit includes：Fixer, 2 × SSC, 0.3%NP-40/0.4 × SSC, 0.075M KCl solution, CD45 monoclonal antibodies and
CEP17 probes mixed liquor, DAPI counterstains, perforation agent, confining liquid and mountant；The CD45 monoclonal antibodies and the mixing of CEP17 probes
The component of liquid for fluorescent marker CD45 monoclonal antibodies, CEP17 fluorescence in situ hybridization probe, dextran sulfate, deionized formamide, BSA,
SSC and Triton X-100；The CD45 monoclonal antibodies and CEP17 probe mixed liquor each components it is a concentration of：Fluorescent marker CD45 is mono-
Anti- a concentration of 0.002mg/ml, a concentration of 2ng/ μ L of CEP17 fluorescence in situ hybridization probe, dextran sulfate 10%, deionization
Formamide 50%, BSA1%, 6 × SSC, Triton X-100 1 ‰；The fixer is methanol and glacial acetic acid by volume 3:1 is mixed
Close gained mixed liquor；The component of the perforation agent is 5 ‰ Triton X-100,0.1M phosphate buffers；The confining liquid
Component is 5% BSA；The mountant is resin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710157833.2A CN106980018B (en) | 2017-03-16 | 2017-03-16 | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710157833.2A CN106980018B (en) | 2017-03-16 | 2017-03-16 | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106980018A CN106980018A (en) | 2017-07-25 |
| CN106980018B true CN106980018B (en) | 2018-06-26 |
Family
ID=59339135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710157833.2A Active CN106980018B (en) | 2017-03-16 | 2017-03-16 | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106980018B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107589002B (en) * | 2017-09-08 | 2020-05-29 | 杭州市妇产科医院 | Preparation method of induced pluripotent stem cell chromosome |
| CN111363789B (en) * | 2018-12-25 | 2023-12-12 | 中山大学孙逸仙纪念医院 | Kit and method for simultaneously detecting protein and RNA |
| CN110927369A (en) * | 2019-12-11 | 2020-03-27 | 安徽安龙基因科技有限公司 | Kit for identifying circulating tumor cells by combining TCPP (TCPP) with CEP (cytokine induced apoptosis protein) probe and application |
| CN111474358B (en) * | 2020-04-16 | 2023-08-18 | 伊莱瑞特(武汉)生物技术有限公司 | 3D (three-dimensional) three-dimensional immunofluorescence staining kit and application thereof |
| CN114645076B (en) * | 2022-03-01 | 2023-12-08 | 武汉科技大学 | miR-589-3p horizontal in-situ hybridization detection kit and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805564A (en) * | 2012-11-09 | 2014-05-21 | 中国疾病预防控制中心辐射防护与核安全医学所 | Method for rapidly preparing prematurely condensed chromosomes of human peripheral blood lymphocytes |
| CN104007257A (en) * | 2013-02-24 | 2014-08-27 | 北京莱尔生物医药科技有限公司 | Method for detecting non-humoral rare karyotes, and kit thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103091491B (en) * | 2011-11-01 | 2015-01-07 | 李彦萍 | Method for discriminating non-blood-borne nucleated cells enriched from human or animal biological fluid |
-
2017
- 2017-03-16 CN CN201710157833.2A patent/CN106980018B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103805564A (en) * | 2012-11-09 | 2014-05-21 | 中国疾病预防控制中心辐射防护与核安全医学所 | Method for rapidly preparing prematurely condensed chromosomes of human peripheral blood lymphocytes |
| CN104007257A (en) * | 2013-02-24 | 2014-08-27 | 北京莱尔生物医药科技有限公司 | Method for detecting non-humoral rare karyotes, and kit thereof |
Non-Patent Citations (1)
| Title |
|---|
| FISH-based determination of HER2 status in circulating tumor cells isolated with the microfluidic CEEtm platform;Julie Ann Mayer等;《cancer genetics》;20111231(第204期);第590页右栏第3段，591页左栏第1-2段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106980018A (en) | 2017-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106980018B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP17 probe identification circulating tumor cells | |
| CN106970225B (en) | A kind of kit and its application for combining 8 probe identification circulating tumor cells of CEP using CD45 immunofluorescences | |
| CN106970224B (en) | A kind of kit and its application using CD45 immunofluorescences joint CEP probe identification circulating tumor cells | |
| CN110095608B (en) | Tumor exosome nano fluorescence sensor based on magnetic separation and DNA self-assembly | |
| CN104007257B (en) | Method for detecting non-humoral rare karyotes, and kit thereof | |
| CN101587043B (en) | Integrated method for enriching and detecting rare cell in biological fluid sample | |
| CN102892900B (en) | Method for separating target cell | |
| CN105954246B (en) | Method and kit for detecting free rare tumor cells in human biological fluid sample | |
| CN110082531B (en) | Tumor exosome nano fluorescence detection kit and application thereof | |
| CN109187146B (en) | Human body cell full-form immunofluorescence staining method and kit | |
| CN106771185A (en) | A kind of nasopharyngeal carcinoma circulating tumor cell detection kit | |
| CN114127562A (en) | Detection method of tumor cell surface marker molecule PD-L1 | |
| CN110095599B (en) | Micro-immunofluorescence detection method without cell loss | |
| CN108866064B (en) | Aptamer of targeted metastatic human breast cancer cells and application thereof | |
| CN111521794A (en) | Immunofluorescence kit and detection method for detecting NSE gene mutation of peripheral blood circulating tumor cells of small cell lung cancer patients | |
| CN110907416A (en) | Circulating tumor cell detection device based on hollow nano needle tube electroporation system and detection method thereof | |
| CN111351937A (en) | MMR protein expression deletion detection kit and detection method thereof | |
| CN114487415A (en) | Tumor cell PD-L1PD-L2 immunofluorescence + FISH detection kit | |
| CN107525920B (en) | Poly ion liquid magnetic nanocomposites and its application to trace enriching specificity of circulating tumor cell and detection | |
| CN209555255U (en) | A kind of kit early sieved for three-dimensional noninvasive tumour | |
| CN107561265A (en) | A kind of separation of solid and liquid composite membrane and preparation method thereof | |
| EP3199638B1 (en) | Cancer cell detection method using living body derived cells | |
| CN111521793A (en) | Immunofluorescence kit and detection method for detecting CEA gene mutation of peripheral blood circulating tumor cells of non-small cell lung cancer patients | |
| CN102174465A (en) | Method for separating enriched target cells from tissues | |
| CN110527726A (en) | The excretion body detection device and application for detecting for non-small cell lung cancer and judging by stages |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |