CN106755097A - A kind of goat TLR4 gene knockout carriers and its construction method - Google Patents

A kind of goat TLR4 gene knockout carriers and its construction method Download PDF

Info

Publication number
CN106755097A
CN106755097A CN201611222780.XA CN201611222780A CN106755097A CN 106755097 A CN106755097 A CN 106755097A CN 201611222780 A CN201611222780 A CN 201611222780A CN 106755097 A CN106755097 A CN 106755097A
Authority
CN
China
Prior art keywords
tlr4
sgrna
goat
gene knockout
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201611222780.XA
Other languages
Chinese (zh)
Inventor
惠文巧
陈�胜
汤继顺
班谦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Animal Husbandry and Veterinary Medicine of Anhui Academy of Agricultural Sciences
Original Assignee
Institute of Animal Husbandry and Veterinary Medicine of Anhui Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Animal Husbandry and Veterinary Medicine of Anhui Academy of Agricultural Sciences filed Critical Institute of Animal Husbandry and Veterinary Medicine of Anhui Academy of Agricultural Sciences
Priority to CN201611222780.XA priority Critical patent/CN106755097A/en
Publication of CN106755097A publication Critical patent/CN106755097A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of goat TLR4 gene knockout carriers and its construction method, using CRISPR/cas9 systems, the sgRNA fragments of TLR4 genes are designed first, synthesis sgRNA nucleotide sequences, build the plasmid PYSY sgRNA for expressing sgRNA and Cas9 D10A simultaneously, connect and convert to bacillus coli DH 5 alpha competent cell, finally transformant is verified；It is correct that digestion and sequencing identification prove that TLR4 gene knockout carriers build.The carrier that the present invention is built using CRISPR/Cas9, is subsequently to obtain goat TLR4 Gene Deletion alveolar epithelial cells system, and the immune response molecular mechanism for studying Mycoplasma pneumoniae infections provides theoretical foundation.

Description

A kind of goat TLR4 gene knockout carriers and its construction method
Technical field
The invention belongs to gene engineering technology field, more particularly to a kind of goat TLR4 gene knockout carriers and its structure side Method.
Background technology
Toll-like receptor (TLRs) is a kind of important model identification receptor in natural immune system, alternative identification disease Pathogenic microorganism and start the innate immunity, play an important roll in host's innate immunity and acquired immunity.TLR4 is TLRs family One of important member of race, is induced by lipopolysaccharide (LPS) most important pattern recognition receptors, in mediation negative bacterium and its LPS Host response in play key effect.
CRISPR/Cas9 systems are that one kind that bacterium evolves under the long-term selection pressure of bacteriophage effectively resists outer One of immunologic mechanism of source DNA invasion.In thalline, CRISPR clusters are transcribed into precrRNA under the regulation and control of its leader, and The crRNA of maturation is processed into the case where tracrRNA and Cas9 is participated in, guiding crRNA/tracrRNA/Cas9 complex identifications are combined Exogenous DNA particular sequence, shears DNA double chain, so that the expression of silence foreign gene.CRISPR/Cas9 systems are developed to A kind of new gene targeting system.Relative to RNAi, ZFN and TALEN system earlier, this new targeting system has behaviour Make simple, low cost, efficiency high, can simultaneously silence any amount gene the advantages of.At present, this technology has been applied to carefully Bacterium, zebra fish, mouse, rat, silkworm and mammal and Human cell line etc., and all show stronger genome editor Activity.Hu etc. (2014) is knocked out using the technology to NUP155 genes in Goat Fibroblasts, and discovery 23 is slender There are 5 to there occurs NUP155 gene mutations in born of the same parents clone.Wang etc. (2015) using CRISPR/Cas9 technologies to goat MSTN and FGF5 genes are knocked out.The research prompting technology can be used successfully to goat gene knockout above.
Gene knockout is carried out using ZFNs or TALENs at present, each gene loci editor is required for designing and assembling two Individual nuclease, constructing technology difficulty is larger, the component composition time is more long.In addition, traditional gene knockout, mainly using gene weight Group principle loses genes of interest function by insertion mutation and targeting technology.
However, on TLR4 gene knockouts and correlation function research, there is not been reported on goat at present.
The content of the invention
It is an object of the invention to provide a kind of goat TLR4 gene knockout carriers and its construction method, it is intended to solve current Gene knockout is carried out using ZFNs or TALENs, each gene loci editor is required for design and assemble two nucleases, because And constructing technology difficulty is larger, the component composition time is more long；And traditional gene knockout, mainly lead to using pinciple of gene reconfiguration Cross the problem that insertion mutation and targeting technology lose genes of interest function.
The present invention is achieved in that a kind of goat TLR4 gene knockout carriers, the goat TLR4 gene knockout carriers SgRNA nucleotides sequences are classified as：
TLR4-gRNA-Lg1：GACTCATATTCAGCACCTGAAGG；
TLR4-gRNA-Rg1：TCACAACAAACTCTTGTCATTGG.
A kind of primer Oligo, primer Oligo sequences are：
F-TLR4-gRNA-L1：CACCGACTCATATTCAGCACCTGA；
R-TLR4-gRNA-L1：AAACTCAGGTGCTGAATATGAGTC；
F-TLR4-gRNA-R1：CACCGTCACAACAAACTCTTGTCAT；
R-TLR4-gRNA-R1：AAACATGACAAGAGTTTGTTGTGAC.
A kind of plasmid PYSY-sgRNA of expression sgRNA nucleotides, plasmid PYSY-sgRNA are：pYSY-CMV- Cas9n-U6-TLR4-gRNA-L2-SV40-Neo plasmids and pYSY-CMV-Cas9n-U6-TLR4-gRNA-R2-EF1a-eGFP Plasmid.
Another object of the present invention is to provide a kind of construction method of goat TLR4 gene knockout carriers, the goat TLR4 bases Because the construction method of knockout carrier includes：
Using CRISPR/cas9 systems, the sgRNA fragments of TLR4 genes are designed first, synthesize sgRNA nucleotide sequences；
The plasmid PYSY-sgRNA for expressing sgRNA and Cas9D10A simultaneously is built, is connected and is converted to bacillus coli DH 5 alpha Competent cell；
Finally transformant is verified.
Further, the construction method of the goat TLR4 gene knockout carriers is specifically included：
Primer annealing：The 100uM R-Oligo of F-Oligo, 1ul of 1ul 100uM, 8ul YSY oligo annealing is slow Fliud flushing is mixed in PCR pipe, and gradually 22 DEG C are down to from 95 DEG C with 1.5 DEG C per minute in PCR instrument；
Connection：0.5ul annealed products, the three-in-one CRISPR/Cas9n plasmids of 1ul YSY linearisations, 1ul T4 ligases, 2ul 5*T4Buffer, 5.5ul Milli Q；
Conversion：Pfu >=10 are used after room temperature 15min8Escherichia coli DH5a competent cell converted；
Transformant is verified：Picking monoclonal carries out 10ul system bacterium solutions PCR checkings after conversion coated plate；
It is sequenced after PCR Preliminary Identifications；
37 DEG C of incubated overnights of bacterium solution, the big extraction reagent kit of endotoxin-free plasmid extracts plasmid, and uses micro ultraviolet spectrometry light Degree meter determines plasmid concentration.
Further, picking monoclonal carries out 10ul system bacterium solutions PCR checkings after the conversion coated plate, specifically includes：Picking Monoclonal 0.5ul bacterium solutions, 0.5ul YSY checking forward primers, 0.5ul R-Oligo, 5ulMastermix, 3.5ul MilliQ；PCR reaction conditions are：1)：95 DEG C of predegeneration 2mim；2)：94 DEG C of denaturation 30s；3)：56 DEG C of annealing 30s；4)：72℃ Extend 30s；Step 2) to step 4) 35 circulations of operation；5)：72 DEG C re-extend 10min；6)：4 DEG C of preservations.
CRISPR/Cas9 systems in the goat TLR4 gene knockout carriers and its construction method of present invention offer, are newly to open A kind of new gene targeting system of hair, using the CRISPR clusters present in bacterium or Archimycetes, in the tune of its leader PrecrRNA is transcribed under control, and the crRNA, cRNA and tracrRNA bis- of maturation is processed into the case where tracrRNA and Cas9 is participated in The compound that person combines to form turns into, and sgRNA is combined with Cas9 endonucleases, and it is specific to guide its identification to combine exogenous DNA Sequence, shears DNA double chain, so that the expression of silence foreign gene.
The present invention need to be only directed to and be somebody's turn to do using CRISPR/Cas9 system constructing TLR4 gene knockout carriers, method simple and fast A sgRNA for being about 20bp or so is designed in gene knockout site, then the Cas9 genes of connection universal, and uses ZFNs Or TALENs carries out gene knockout, each gene loci editor is required for design and assemble two nucleases, constructing technology is difficult Spend larger, the component composition time more long.Therefore, with the gene Knockout such as traditional ZFNs, TALENs comparatively, using CRISPR/Cas9 builds gene knockout carrier more simple and fast, is easy to further genralrlization and is applied to subsequent experimental.
In addition, traditional gene knockout, mainly makes purpose using pinciple of gene reconfiguration by insertion mutation and targeting technology Gene function is lost, and compared with ZFN and TALEN both artificial nucleases, the Cas9 in CRISPR/Cas9 systems is used as otch Enzyme, with single-stranded cleavage activity, can manufacture single-stranded nick in ad-hoc location, will not so cause nonhomologous end to connect substantially Connect, so that efficiently the fixed point of mediate foreign gene is knocked in, or carries out point mutation to genome, greatly reduce nonhomologous end The brought risk of connection.
The carrier that the present invention builds, the CRISPR-Cas9 systems being oriented to using RNA form two incision, are not influenceing targeting Effect of missing the target is greatly reduced on the premise of cutting efficiency, gene knockout efficiency is improved.
The present invention uses CRISPR/Cas9 system constructing TLR4 knockout carriers, is subsequently to obtain goat TLR4 gene delections Type alveolar epithelial cells system, the immune response molecular mechanism of research goat mycoplasma pneumoniae infection provide theoretical foundation.
Brief description of the drawings
Fig. 1 is the construction method flow chart of goat TLR4 gene knockout carriers provided in an embodiment of the present invention；
Fig. 2 is PCR checkings clone's electrophoresis picture example one provided in an embodiment of the present invention；
In figure：Marker：Trans 2K Plus DNA Marker, are followed successively by 100bp, 250bp, 500bo from top to bottom, 750bp,1000bp,3000bp,5000bp；2:Negative control；3-6:TLR4-gRNA-Rg1 is cloned.
Fig. 3 is PCR checkings clone's electrophoresis picture example two provided in an embodiment of the present invention；
In figure：Marker：Trans 2K Plus DNA Marker, are followed successively by 100bp, 250bp, 500bo from top to bottom, 750bp,1000bp,3000bp,5000bp；2:Negative control；3-6:TLR4-gRNA-Lg1 is cloned.
Specific embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to embodiments, to the present invention It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to Limit the present invention.
Application principle of the invention is further described below in conjunction with the accompanying drawings.
Goat TLR4 gene knockout carriers provided in an embodiment of the present invention, the sgRNA of the goat TLR4 gene knockout carriers Nucleotides sequence is classified as：
SEQ ID NO1：TLR4-gRNA-Lg1：GACTCATATTCAGCACCTGAAGG；
SEQ ID NO2：TLR4-gRNA-Rg1：TCACAACAAACTCTTGTCATTGG.
A kind of primer Oligo, primer Oligo sequences are：
SEQ ID NO3：F-TLR4-gRNA-L1：CACCGACTCATATTCAGCACCTGA；
SEQ ID NO4：R-TLR4-gRNA-L1：AAACTCAGGTGCTGAATATGAGTC；
SEQ ID NO5：F-TLR4-gRNA-R1：CACCGTCACAACAAACTCTTGTCAT；
SEQ ID NO6：R-TLR4-gRNA-R1：AAACATGACAAGAGTTTGTTGTGAC.
A kind of plasmid PYSY-sgRNA of expression sgRNA nucleotides that the present invention is provided, plasmid PYSY-sgRNA are： PYSY-CMV-Cas9n-U6-TLR4-gRNA-L2-SV40-Neo plasmids and pYSY-CMV-Cas9n-U6-TLR4-gRNA-R2- EF1a-eGFP plasmids.
As shown in Figure 1：The construction method of goat TLR4 gene knockout carriers provided in an embodiment of the present invention, the goat TLR4 The construction method of gene knockout carrier includes：
S101：Using CRISPR/cas9 systems, the sgRNA fragments of TLR4 genes are designed first, synthesize sgRNA nucleotides Sequence；
S102：The plasmid PYSY-sgRNA for expressing sgRNA and Cas9D10A simultaneously is built, is connected and is converted to Escherichia coli DH5 α competent cells；
S103：Finally transformant is verified.
Further, the construction method of the goat TLR4 gene knockout carriers is specifically included：
Primer annealing：The 100uM R-Oligo of F-Oligo, 1ul of 1ul 100uM, 8ul YSY oligo annealing is slow Fliud flushing is mixed in PCR pipe, and gradually 22 DEG C are down to from 95 DEG C with 1.5 DEG C per minute in PCR instrument；
Connection：0.5ul annealed products, the three-in-one CRISPR/Cas9n plasmids of 1ul YSY linearisations, 1ul T4 ligases, 2ul 5*T4Buffer, 5.5ul Milli Q；
Conversion：Pfu >=10 are used after room temperature 15min8Escherichia coli DH5a competent cell converted；
Transformant is verified：Picking monoclonal carries out 10ul system bacterium solutions PCR checkings after conversion coated plate：0.5ul bacterium solutions, 0.5ul YSY verify forward primer, 0.5ul R-Oligo, 5ul Mastermix, 3.5ul MilliQ；
PCR reaction conditions are：
1)：95 DEG C of predegeneration 2mim；
2)：94 DEG C of denaturation 30s；
3)：56 DEG C of annealing 30s；
4)：72 DEG C of extension 30s；Step 2) to step 4) 35 circulations of operation；
5)：72 DEG C re-extend 10min；
6)：4 DEG C of preservations；
It is sequenced after PCR Preliminary Identifications；
37 DEG C of incubated overnights of bacterium solution, the big extraction reagent kit of endotoxin-free plasmid extracts plasmid, and uses micro ultraviolet spectrometry light Degree meter determines plasmid concentration.
Application principle of the invention is further described with reference to test method
1 material and method
1.1 materials
Trans2K Plus DNA Marker are purchased from Quan Shijin Bioisystech Co., Ltd, the purchase of CRISPR/Cas9n plasmids From Nanjing Yao and Shun Yu company, escherichia coli DH5a competent cell, T4 ligases, the big extraction reagent kit of endotoxin-free plasmid are purchased from Tiangeng biochemistry Co., Ltd.Cationic-liposome2000(Invitrogen).PCR primer is by Shanghai platinum Still Bioisystech Co., Ltd's synthesis.
1.2 methods
1.2.1sgRNA target spot determines and design of primers
According to goat TLR4 genes (GenBank:HQ263215.1), find CDS sequences and analyze its structure, according to the base Because structure determination knocks out site, selection exon sequence is input in software, obtains gRNA sequences.And according to design generation SgRNA, designs and synthesizes corresponding primer Oligo as follows：
F-TLR4-gRNA-L1：CACCGACTCATATTCAGCACCTGA；
R-TLR4-gRNA-L1：AAACTCAGGTGCTGAATATGAGTC；
F-TLR4-gRNA-R1：CACCGTCACAACAAACTCTTGTCAT；
R-TLR4-gRNA-R1：AAACATGACAAGAGTTTGTTGTGAC；
1.2.2CRISPR/Cas9 the structure of gene knockout carrier
Primer annealing：1ul F-Oligo (100uM), 1ul R-Oligo (100uM), 8ul YSY oligo annealing buffers Liquid, above solution is mixed in PCR pipe, and gradually 22 DEG C are down to from 95 DEG C with 1.5 DEG C per minute in PCR instrument.
Connection：0.5ul annealed products, the three-in-one CRISPR/Cas9n plasmids of 1ul YSY linearisations, 1ul T4 ligases, 2ul 5*T4Buffer, 5.5ul Milli Q.
Conversion：Escherichia coli DH5a competent cell (pfu >=10 are used after room temperature 15min8) converted.
Transformant is verified：Picking monoclonal carries out 10ul system bacterium solutions PCR checkings after conversion coated plate.
0.5ul bacterium solutions, 0.5ul YSY checking forward primers, 0.5ul R-Oligo, 5ul Mastermix, 3.5ulMilliQ；
PCR reaction conditions：Seg1：95 DEG C of predegeneration 2mim；Seg2：94 DEG C of denaturation 30s；Seg3：56 DEG C of annealing 30s； Seg4：72 DEG C of extension 30s；Seg2to Seg4 run 35 circulations；Seg5：72 DEG C re-extend 10min；Seg6：4 DEG C of preservations.
Positive colony is initially identified as through PCR and delivers to Nanjing Genscript Biotechnology Co., Ltd. being sequenced.
37 DEG C of incubated overnights of bacterium solution, the big extraction reagent kit of endotoxin-free plasmid extracts plasmid, and uses micro ultraviolet spectrometry light Degree meter determines plasmid concentration.
2. result
2.1sgRNA is designed
The sgRNA transcript folder RNA sequences designed under the driving of U6 promoters are respectively：
TLR4-gRNA-Lg1：GACTCATATTCAGCACCTGAAGG；
TLR4-gRNA-Rg1：TCACAACAAACTCTTGTCATTGG；
2.2PCR checking positive colony electrophoresis picture is as shown in Figure 2,3.
2.3 censorship sequencing results
To before verify that correct positive colony bacterium solution delivers to the sequencing of Jin Sirui Bioisystech Co., Ltd, partial order will be sequenced Row comparison result is specific as follows：
2.3.1pYSY-CMV-Cas9n-U6-TLR4-gRNA-L2-SV40-Neo；
By contrast, its homology reaches 100%.
2.3.2pYSY-CMV-Cas9n-U6-TLR4-gRNA-R2-EF1a-Egfp；
Its homology reaches 100%.Therefore, by above sequence alignment, it may be determined that target plasmid is successfully constructed.
The knockout plasmid pair of 2.4 goat TLR4MC1R genes is extracted and concentration mensuration：
PYSY-CMV-Cas9n-U6-TLR4-gRNA-L2-SV40-Neo plasmids：4ug concentration:130ng/ul；
PYSY-CMV-Cas9n-U6-TLR4-gRNA-R2-EF1a-eGFP plasmids：4ug concentration:209ng/ul.
With reference to principle analysis, the present invention is further described.
CRISPR/Cas9 systems, are a kind of new gene targeting systems newly developed, using being deposited in bacterium or Archimycetes CRISPR clusters, be transcribed into precrRNA under the regulation and control of its leader, and process in the case where tracrRNA and Cas9 is participated in The compound combined to form into both ripe crRNA, cRNA and tracrRNA turns into, sgRNA and Cas9 endonuclease knots Close, and guide its identification to combine exogenous DNA particular sequence, DNA double chain is sheared, so that the expression of silence foreign gene.
The present invention need to be only directed to and be somebody's turn to do using CRISPR/Cas9 system constructing TLR4 gene knockout carriers, method simple and fast A sgRNA for being about 20bp or so is designed in gene knockout site, then the Cas9 genes of connection universal, and uses ZFNs Or TALENs carries out gene knockout, each gene loci editor is required for design and assemble two nucleases, constructing technology is difficult Spend larger, the component composition time more long.Therefore, with the gene Knockout such as traditional ZFNs, TALENs comparatively, using CRISPR/Cas9 builds gene knockout carrier more simple and fast, is easy to further genralrlization and is applied to subsequent experimental.
In addition, traditional gene knockout, mainly makes purpose using pinciple of gene reconfiguration by insertion mutation and targeting technology Gene function is lost, and compared with ZFN and TALEN both artificial nucleases, the Cas9 in CRISPR/Cas9 systems is used as otch Enzyme, with single-stranded cleavage activity, can manufacture single-stranded nick in ad-hoc location, will not so cause nonhomologous end to connect substantially Connect, so that efficiently the fixed point of mediate foreign gene is knocked in, or carries out point mutation to genome, greatly reduce nonhomologous end The brought risk of connection.
The carrier that the present invention builds, the CRISPR-Cas9 systems being oriented to using RNA form two incision, are not influenceing targeting Effect of missing the target is greatly reduced on the premise of cutting efficiency, gene knockout efficiency is improved.
Presently preferred embodiments of the present invention is the foregoing is only, is not intended to limit the invention, it is all in essence of the invention Any modification, equivalent and improvement made within god and principle etc., should be included within the scope of the present invention.
<110>Husbandry ＆ Veternity Research Inst. of Anhui Prov. Agriculture Science Academy
<120>A kind of construction method of goat TLR4 gene knockout carriers
<160> 6
<210> 1
<211>23
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
GACTCATATTCAGCACCTGAAGG
<210> 2
<211>23
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
TCACAACAAACTCTTGTCATTGG
<210> 3
<211>24
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
CACCGACTCATATTCAGCACCTGA
<210> 4
<211>24
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
AAACTCAGGTGCTGAATATGAGTC
<210> 5
<211>24
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
CACCGTCACAACAAACTCTTGTCAT
<210> 6
<211>24
<212> RNA
<213>Artificial sequence
<400>Nucleotide sequence
AAACATGACAAGAGTTTGTTGTGAC

Claims (6)

1. a kind of goat TLR4 gene knockout carriers, it is characterised in that the sgRNA nucleotides of the goat TLR4 gene knockout carriers Sequence is：SEQ ID NO1 and SEQ ID NO2.
2. a kind of sgRNA nucleotides comprising described in claim 1 synthesizes corresponding primer Oligo, it is characterised in that the primer Oligo sequences are：SEQ ID NO3、SEQ ID NO4、SEQ ID NO5、SEQ ID NO6.
3. it is a kind of express claim 1 described in sgRNA nucleotides plasmid PYSY-sgRNA, it is characterised in that the plasmid PYSY-sgRNA is：
PYSY-CMV-Cas9n-U6-TLR4-gRNA-L2-SV40-Neo plasmids and
PYSY-CMV-Cas9n-U6-TLR4-gRNA-R2-EF1a-eGFP plasmids.
4. a kind of construction method of goat TLR4 gene knockout carriers as claimed in claim 1, it is characterised in that the goat The construction method of TLR4 gene knockout carriers includes：
Using CRISPR/cas9 systems, the sgRNA fragments of TLR4 genes are designed first, synthesize sgRNA nucleotide sequences；
The plasmid PYSY-sgRNA for expressing sgRNA and Cas9D10A simultaneously is built, is connected and is converted to bacillus coli DH 5 alpha impression State cell；
Finally transformant is verified.
5. the construction method of goat TLR4 gene knockout carriers as claimed in claim 4, it is characterised in that the goat TLR4 bases Because the construction method of knockout carrier is specifically included：
Primer annealing：By the 100uM R-Oligo of F-Oligo, 1ul of 1ul 100uM, 8ul YSY oligo annealing buffers It is mixed in PCR pipe, gradually 22 DEG C is down to from 95 DEG C with 1.5 DEG C per minute in PCR instrument；
Connection：0.5ul annealed products, 1ul YSY linearize three-in-one CRISPR/Cas9n plasmids, 1ul T4 ligases, 2ul 5*T4Buffer, 5.5ul Milli Q；
Conversion：Pfu >=10 are used after room temperature 15min8Escherichia coli DH5a competent cell converted；
Transformant is verified：Picking monoclonal carries out 10ul system bacterium solutions PCR checkings after conversion coated plate；
It is sequenced after PCR Preliminary Identifications；
37 DEG C of incubated overnights of bacterium solution, the big extraction reagent kit of endotoxin-free plasmid extracts plasmid, and uses micro ultraviolet specrophotometer Determine plasmid concentration.
6. the construction method of goat TLR4 gene knockout carriers as claimed in claim 5, it is characterised in that the conversion coated plate Picking monoclonal carries out 10ul system bacterium solutions PCR checkings afterwards, specifically includes：Picking monoclonal 0.5ul bacterium solutions, 0.5ul YSY are tested Card forward primer, 0.5ul R-Oligo, 5ul Mastermix, 3.5ul MilliQ；PCR reaction conditions are：1)：95 DEG C of pre- changes Property 2mim；2)：94 DEG C of denaturation 30s；3)：56 DEG C of annealing 30s；4)：72 DEG C of extension 30s；Step 2) to step 4) operation 35 follows Ring；5)：72 DEG C re-extend 10min；6)：4 DEG C of preservations.
CN201611222780.XA 2016-12-27 2016-12-27 A kind of goat TLR4 gene knockout carriers and its construction method Pending CN106755097A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611222780.XA CN106755097A (en) 2016-12-27 2016-12-27 A kind of goat TLR4 gene knockout carriers and its construction method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611222780.XA CN106755097A (en) 2016-12-27 2016-12-27 A kind of goat TLR4 gene knockout carriers and its construction method

Publications (1)

Publication Number Publication Date
CN106755097A true CN106755097A (en) 2017-05-31

Family

ID=58926492

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611222780.XA Pending CN106755097A (en) 2016-12-27 2016-12-27 A kind of goat TLR4 gene knockout carriers and its construction method

Country Status (1)

Country Link
CN (1) CN106755097A (en)

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
CN109651498A (en) * 2018-12-07 2019-04-19 上海浩港生物技术有限公司 A kind of preparation method of LBP related protein polypeptide antigen
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
CN111321171A (en) * 2018-12-14 2020-06-23 江苏集萃药康生物科技有限公司 Method for preparing gene targeting animal model by applying CRISPR/Cas9 mediated ES targeting technology
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103820454A (en) * 2014-03-04 2014-05-28 黄行许 Method for human PD1 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting PD1 gene
CN106715431A (en) * 2014-09-16 2017-05-24 吉利德科学公司 Solid forms of a toll-like receptor modulator

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103820454A (en) * 2014-03-04 2014-05-28 黄行许 Method for human PD1 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting PD1 gene
CN106715431A (en) * 2014-09-16 2017-05-24 吉利德科学公司 Solid forms of a toll-like receptor modulator

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
FERGUSON C等: "Toll-like receptor 4 (Tlr4) knockout rats produced by transcriptional activator-like effectornuclease (TALEN)-mediated gene inactivation", 《ALCOHOL》 *
RAJA A等: "Sequence analysis of Toll-like receptor genes 1-10 of goat (Capra hircus)", 《VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY》 *
刘健: "CRISPR-Cas9技术介导阿尔巴斯白绒山羊MSTN基因敲除的研究", 《中国优秀硕士学位论文全文数据库》 *
徐燕: "山羊Toll样受体基因家族的克隆表达及群体进化分析研究", 《中国优秀硕士学位论文全文数据库》 *
王正国等: "《分子创伤学》", 31 August 2004, 福建科学技术出版社 *
王雪芹: "《运动诱导大鼠免疫细胞凋亡及机制研究》", 31 March 2016, 山东人民出版社 *

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
CN109651498A (en) * 2018-12-07 2019-04-19 上海浩港生物技术有限公司 A kind of preparation method of LBP related protein polypeptide antigen
CN111321171A (en) * 2018-12-14 2020-06-23 江苏集萃药康生物科技有限公司 Method for preparing gene targeting animal model by applying CRISPR/Cas9 mediated ES targeting technology
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
CN106755097A (en) A kind of goat TLR4 gene knockout carriers and its construction method
CN106834347A (en) A kind of goat CDK2 gene knockout carriers and its construction method
CN107474129B (en) The method of specificity enhancing CRISPR-CAS system gene editorial efficiencies
US11317610B2 (en) Method of constructing zebrafish notch1a mutants
CN107418974A (en) It is a kind of to sort the quick method for obtaining CRISPR/Cas9 gene knockout stable cell lines using monoclonal cell
CN107326046A (en) A kind of method for improving foreign gene homologous recombination efficiency
CN106906242A (en) A kind of method that raising CRIPSR/Cas9 targeting knock outs gene produces nonhomologous end joint efficiency
CN107475300A (en) The construction method of Ifit3 eKO1 knock out mice animal models and application
CN108441520A (en) The gene conditionity knockout technique built using CRISPR/Cas9 systems
CN109136248B (en) Multi-target editing vector and construction method and application thereof
CN111742051A (en) Extended single guide RNA and uses thereof
CN109207515A (en) A method of design and building pig full-length genome CRISPR/Cas9 knock out library
CN113278619B (en) Double sgRNA, gene knockout vector, pig fibroblast line with STING gene knockout function and construction method thereof
CN108165581B (en) Method for repairing HBA2 gene mutation in vitro by using single-stranded nucleotide fragment
CN106282231B (en) Construction method and application of mucopolysaccharide storage disease type II animal model
CN106636201A (en) MC1R (melanocortin 1 receptor) gene carrier and construction method thereof
CN111849979B (en) sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line
US20230051396A1 (en) Class ii, type ii crispr systems
US20230416710A1 (en) Engineered and chimeric nucleases
CN109706148A (en) A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer
AU2022396533A1 (en) Endonuclease systems
CN106282230B (en) The method of rite-directed mutagenesis LDLR gene
CN109735541B (en) ACADSB gene knockout dairy cow mammary gland epithelial cell line and construction method thereof
WO2020093025A1 (en) Methods for knock-out of a target sequence through introduction of a premature stop codon
US20230091242A1 (en) Rna-guided genome recombineering at kilobase scale

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170531