CN106749678A

CN106749678A - HER2 CAR recombined lentivirus vectors and its construction method and application

Info

Publication number: CN106749678A
Application number: CN201710013312.XA
Authority: CN
Inventors: 何昱; 栗红建; 余祥; 赵杨杨; 姜冬冬; 孟邑芳
Original assignee: Shenzhen Ka Di Biotechnology Co Ltd; Beijing Pregene Biotechnology Company ltd
Current assignee: Shenzhen Pregene Biopharma Co ltd
Priority date: 2017-01-09
Filing date: 2017-01-09
Publication date: 2017-05-31

Abstract

The present invention relates to a kind of HER2 CAR recombined lentivirus vectors and its construction method and application, wherein the nucleotide sequence of CAR structural genes is as shown in SEQ ID 1；Spliced by by anti-HER2 ScFV genes and CAR structural genes, obtained HER2 CAR genes, its nucleotide sequence is as shown in SEQ ID 3；Pre Lenti EF1 MCS carriers and HER2 CAR genetic recombination are built, HER2 CAR recombined lentivirus vectors are obtained, nucleotide sequence is as shown in SEQ ID 4.The HER2 CAR recombined lentivirus vectors that the present invention is provided, by being packaged into HER2 CAR slow virus and infecting the T cell of fresh separated, the HER2 CART for preparing can effectively kill A431 target cells, hence it is evident that suppress the growth of tumour cell, can be used for preparing antineoplastic.

Description

HER2 CAR recombined lentivirus vectors and its construction method and application

Technical field

The present invention relates to biological technical field, and in particular to a kind of HER2 CAR recombined lentivirus vectors and its construction method With application.

Background technology

The death rate that tumour causes worldwide ranks the first.Issued according to national tumour Register《In 2013 State's tumour registration annual report》Prediction, 2015, Chinese tumor invasion number was 4,280,000 people, and about 2,800,000 people are dead.Current tumour Therapeutic modality is mainly operation, radiotherapy, chemotherapy, targeted therapy and newest immunization therapy, and operation, chemicotherapy and targeted therapy are made It is the Main Means of clinical treatment tumour, there are different indications and limiting factor.Immunization therapy and foregoing four kinds of therapies Difference essentially consists in the immune system by activating body, kills tumour cell, i.e. immunotherapy medicaments or technology is not directed to Tumour cell, but transfer the immunocyte kill that immunologic escape state is in immunosuppressive condition in body or to tumour Tumour.Immunization therapy provides a kind of strategy of brand-new treatment tumour, can develop multi-medicament perhaps and technology, is tumour Treatment with the addition of modern weapons.Two presently the most feasible means of immunization therapy are that immunologic test point inhibitor and chimeric antigen are received Body T cell (Chimeric Antigen Receptor T cells, CART).Wherein CART mainly passes through genetic modification T cell The ability of the tumour cell of T cell identification immunologic escape is imparted, the tumour cell of identification can be killed by T cell, white in treatment Blood disease and surprising curative effect is shown during lymthoma, about 93% children's recurrence, Refractory Leukemia are cured by CART.Pass through the most The CART identification molecules of allusion quotation are CD19, are mainly expressed in acute lymphoblastic B leukaemia.CART cells can be recognized not Tumour cell marker molecule, such as, and the CD33 marker molecules of marrow series leukemia, Huppert's disease BCMA, CD138 mark The marker molecules such as molecule, EGFR, HER2 of solid tumor.In view of CART treats the surprising curative effect of leukaemia, some research institutions are just Attempting by the use of the molecule of the tumor tissues such as EGFR, HER2 expression high as target spot, CART is in treatment of solid tumors side for research observation The effect in face.

In the technology development of CART, the evolution in different generations is have passed through, first generation CART only has CD3 signals, without collaboration Stimulus signal, in clinical test, effect is bad；The Carl June of Pennsylvania university were taught in 2011, using two generations CART technologies are treated 3 CLL (chronic lymphocytic leukemia) and achieve extraordinary effect, 2 complete incidence graphs (CR), 1 Alleviate (PR) in example part；Two generation CART are different according to the costimulatory molecules selected, and are divided into CD28 costimulatory molecules and 4-1BB Costimulatory molecules, two class CART are achieved successfully at clinical treatment ALL (acute lymphatic leukemia)；CD28 is assisted Promote cell rapid amplifying with stimulus signal, 4-1BB signals promote cell to expand, the continued survival time is longer.With HER2 molecules It is the CART of target spot, the article of 2009 is seen earliest, it was recently reported that HER2 CART can kills the positive tumour cells of HER2, Definite effect is shown in zoopery, this CART structure be two generation CART, including CD28 costimulatory signals and CD3 letter Number.2015, Ahmed, N. etc. were utilized in HER2 CART 19 clinical tests of HER2+ sarcoma patients of cell therapy, using thin Born of the same parents' quantity is 1x10⁸/m², during 17 can assess patient, 3 people 6 months after the treatment, 12 months with 16 months lasting remissions, The HER2 CART structures that Ahmed, N. etc. are used also are CD28 molecules and two generation CART of CD3 molecules.However, existing 2 generation HER2 In the clinical test for the treatment of tumour, effect is general, and only about 17.6% complete remission rate (3/17) is, it is necessary to two for CART Transformed again for CART, to obtain more preferable curative effect.

The content of the invention

For defect of the prior art, present invention aim at provide a kind of HER2 CAR recombined lentivirus vectors and its Construction method and application.

The present invention provides a kind of albumen, is following (a) or (b)：The amino acid sequence of (a) as shown in sequence in sequence table 12 The protein of composition；(b) taking by one or several amino acid residues by the amino acid sequence shown in sequence in sequence table 12 Generation and/or missing and/or addition and with identical function as derived from sequence 12 protein.

The present invention also protects the HER2 CAR genes of the above-mentioned albumen of coding.

The present invention provides a kind of HER2 CAR genes, and HER2 CAR genes are any one following DNA moleculars：(a) nucleosides DNA molecular of the acid sequence as shown in SEQ ID 3；B nucleotide sequence hybridization and coding that () limits with (a) under strict conditions The DNA molecular of the albumen with identical function；C nucleotide sequence that () limits with (a) at least has 90%, at least has 95%th, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and coding have it is identical The DNA molecular of the albumen of function.

Stringent condition can be as follows：50 DEG C, in 7% lauryl sodium sulfate (SDS), 0.5M NaPO₄With 1mM EDTA's Hybridize in mixed solution, at 50 DEG C, 2 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO₄With Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C, 1 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, 7%SDS, 0.5M NaPO₄Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.5 × SSC is rinsed in 0.1%SDS；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO₄Hybridize with the mixed solution of 1mM EDTA, at 50 DEG C, 0.1 × SSC floats in 0.1%SDS Wash；Can also be：50 DEG C, in 7%SDS, 0.5M NaPO₄Hybridize with the mixed solution of 1mM EDTA, at 65 DEG C, 0.1 × SSC, Rinsed in 0.1%SDS；Or：In 6 × SSC, the solution of 0.5%SDS, hybridize at 65 DEG C, then with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.

Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned HER2 CAR genes belong to the present invention Protection domain；Recombinant vector is specially in above-mentioned HER2 CAR genes insertion expression vector, obtains expressing claim 1 The recombinant vector of the albumen；Certainly, amplification gene total length or the primer pair of its any fragment are also protected.

The present invention provides a kind of synthetic method of HER2 CAR genes, comprises the following steps：By anti-HER2 ScFV genes and CAR structural genes are spliced using over-lap PCR, obtain HER2 CAR genes；Wherein, the nucleotide sequence of CAR structural genes As shown in SEQ ID 1, the nucleotide sequence of anti-HER2 ScFV genes is as shown in SEQ ID 2；The HER2 CAR genes for obtaining Nucleotide sequence is as shown in SEQ ID 3.Wherein, the sequence of anti-HER2 ScFV genes derives from United States Patent (USP) US5821337 (1998), the protein of its coding is total length humanized antibody, trade name Herceptin, including heavy chain amino codon The nucleotides of optimization, linker (G4S)₃With the nucleotide sequence of light chain amino acid codon optimization.

The present invention provides a kind of CAR structural genes, and CAR structural genes are any one following DNA moleculars：(a) nucleotides DNA molecular of the sequence as shown in SEQ ID 1；B nucleotide sequence hybridization and coding tool that () limits with (a) under strict conditions There is the DNA molecular of the albumen of identical function；C nucleotide sequence that () and (a) are limited at least has 90%, at least have 95%, At least have 96%, at least have 97%, at least have 98% or at least there is 99% homology and coding has identical function Albumen DNA molecular.Stringent condition is with described above.

Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned CAR structural genes belong to of the invention Protection domain, also protects amplification gene total length or the primer pair of its any fragment.

The albumen obtained by above-mentioned CAR structural gene codings belongs to protection scope of the present invention.CAR structural gene codings Albumen includes CD8 hinge areas, CD28 hinge areas, transmembrane region, cytoplasmic domain, 4-1BB cytoplasmic domains and CD3 ζ cytoplasmic domains.

The present invention provides a kind of HER2 CAR recombined lentivirus vectors, and HER2 CAR recombined lentivirus vectors are Pre- Lenti-EF1-HER2 CAR, its nucleotide sequence is as shown in SEQ ID 4.

The present invention provides a kind of construction method of HER2 CAR recombined lentivirus vectors, comprises the following steps：Using overlap PCR synthesizes HER2 CAR genes, and two ends set XbaI, BamHI restriction endonuclease sites；Wherein, the core of HER2 CAR genes Nucleotide sequence is as shown in SEQ ID 3；With restriction enzyme XbaI, BamHI double digestion Pre-Lenti-EF1-MCS carriers and HER2 CAR genes, are separately recovered the purpose product after digestion；Wherein, the nucleotide sequence of Pre-Lenti-EF1-MCS carriers As shown in SEQ ID 5；The purpose product after the digestion for harvesting is connected back to, HER2 CAR recombined lentivirus vectors Pre- is obtained Lenti-EF1-HER2 CAR.It should be noted that the HER2 CAR recombined lentivirus vectors Pre-Lenti-EF1- that will be obtained HER2 CAR are converted, picked clones, extract plasmid, and sequencing obtains being sequenced the slow virus load that can correctly express HER2 CAR Body Pre-Lenti-EF1-HER2 CAR.

In above-mentioned building process, the primer sequence of use includes：First primer sequence, its nucleotide sequence such as SEQ ID Shown in 6；Second primer sequence, its nucleotide sequence is as shown in SEQ ID 7；Three-primer sequence, its nucleotide sequence such as SEQ Shown in ID 8；4th primer sequence, its nucleotide sequence is as shown in SEQ ID 9.In building process, using the first primer sequence Row and three-primer sequence amplification HER2 ScFV genes obtain above fragment, using the second primer sequence and the 4th primer sequence The gene for expanding 3 generation CAR structures obtains fragment below, then overlaps, and obtains total length 3 generation HER2 CAR genes, then be cloned into Pre-Lenti-EF1-MCS carriers.

The present invention also protects application of following any one materials in antineoplastic is prepared：1) above-mentioned albumen is contained； 2) recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing CAR genes or HER2 CAR genes；3)HER2 CAR Recombined lentivirus vector；4) expression cassette, transgenic cell line or recombinant bacterium containing HER2 CAR recombined lentivirus vectors.

The technical scheme that the present invention is provided, with following beneficial effect：The HER2 CAR recombinant slow virus that structure is obtained Carrier Pre-Lenti-EF1-MCS-HER2 CAR, by being packaged into HER2 CAR slow virus and infecting the T cell of fresh separated, The HER2 CART for preparing can effectively kill A431 target cells, hence it is evident that suppress the growth of tumour cell, to be applied to prepare Antineoplastic is provided may.

Additional aspect of the invention and advantage will be set forth in part in the description, and will partly become from the following description Obtain substantially, or recognized by practice of the invention.

Brief description of the drawings

Fig. 1 is the evolution schematic diagram of the CART carriers design in the embodiment of the present invention；

Fig. 2 is that the HER2 CAR slow virus carriers in the embodiment of the present invention build flow chart；

Fig. 3 is that the streaming of the single-chain antibody identification HER2 Protein Assavs on the HER2 CART surfaces in the embodiment of the present invention is thin Born of the same parents analyze negative control figure；

Fig. 4 is that the streaming of the single-chain antibody identification HER2 Protein Assavs on the HER2 CART surfaces in the embodiment of the present invention is thin Born of the same parents' analysis chart；

Fig. 5 is that the HER2 CART in the embodiment of the present invention effectively kill the microscope figure that A431 tumour cells are tested；

Fig. 6 is that the HER2 CART in the embodiment of the present invention effectively kill the LDH release experiments that A431 tumour cells are tested Figure；

Fig. 7 is that the HER2 CART in the embodiment of the present invention effectively kill the IFN- that the experiment detection of A431 tumour cells is obtained γ concentration levels figures；

Fig. 8 is that the HER2 CART in the embodiment of the present invention suppress the zoopery design that mouse Subcutaneous Tumor Growth is tested Figure；

Fig. 9 is that the HER2 CART in the embodiment of the present invention suppress the tumor growth curve that mouse Subcutaneous Tumor Growth is tested Figure；

Figure 10 is that the HER2 CART in the embodiment of the present invention suppress the mouse hypodermic tumour that mouse Subcutaneous Tumor Growth is tested Gross examination of skeletal muscle figure.

Specific embodiment

Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is carried out clear, complete Site preparation is described.The following examples are only intended to illustrate the technical solution of the present invention more clearly, therefore is intended only as example, without Can be limited the scope of the invention with this.

Experimental technique in following embodiments, unless otherwise specified, is conventional method.Examination used in following embodiments Material is tested, unless otherwise specified, is what is be commercially available from routine biochemistry reagent shop.Quantitative test in following examples, It is respectively provided with three repetitions to test, data are the average value or mean+SD of three repetition experiments.

In the present invention, HER2 ScFV genes, CAR structural genes and all of primer synthesize by calm and peaceful company of Sino-U.S.；Weight Folded PCR reactions, endonuclease reaction, recovery digestion products and enzyme react kit, reaction system and the response procedures for using Using conventional use of kit and corresponding method.

Fig. 1 is the evolution schematic diagram of CART carriers design.Generation carrier is extracellular to recognize tumour by single-chain antibody (scFv) Marker molecule, such as CD19, intracellular transmit signal using CD3 molecule ζ chains；Two generation carriers are divided into two classes, and one kind is divided for collaboration stimulates Sub- CD28+CD3 ζ, one kind promotes T cell amplification for costimulatory molecules 4-1BB+CD3 ζ, CD28 molecule, and 4-1BB molecules are not only Promote T cell amplification, and extend the time-to-live in CART cell bodies；CD3 ζ are added including costimulatory molecules CD28,4-1BB Three generations's carrier of molecule, simulates the stimulus signal being subject to when T cell normally plays a role substantially, is compared with two generation carriers, tool There is more preferable effect.

Embodiment one：The structure of HER2 CAR recombined lentivirus vector Pre-Lenti-EF1-HER2 CAR

1. design of primers

HER2 CAR gene orders are analyzed using software pDRAW32, restriction enzyme XbaI, BamHI are suitable for base Because of clone, can be matched with XbaI, the BamHI in the MCS of Pre-Lenti-EF1-MCS carriers, two ends design of primers It is as follows.

XbaI-up sequences are as shown in SEQ ID 6：

GCTCTAGA GCCACCATGCCTCTGCTGCTGCTGCTG；

BamHI-down sequences are as shown in SEQ ID 7：

CGGGATCCTTAGCGAGGGGGCAGGGCCTG；

Middle-R sequences are as shown in SEQ ID 8：

GTCGTGGTGGGCTTCGCTGGCTTGATTTCCACTTTTGTGC；

Middle-F sequences are as shown in SEQ ID 9：

GCACAAAAGTGGAAATCAAGCCAGCGAAGCCCACCACGAC。

2.PCR amplifications, molecular cloning

Above fragment is obtained using XbaI-up and Middle-R PCR amplification HER2 ScFV genes, Middle-F and The gene that BamHI-down PCR expand 3 generation CAR structures obtains fragment below, then overlaps, and obtains total length 3 generation HER2 CAR bases Cause, its nucleotide sequence is as shown in SEQ ID 3.

By in 3 generation HER2 CAR gene clonings to Pre-Lenti-EF1-MCS carriers, step specific as follows：

Double digestion：With restriction enzyme XbaI, BamHI double digestion Pre-Lenti-EF1-MCS carriers and HER2 CAR Gene, is separately recovered the purpose product after digestion；Wherein, the nucleotide sequence of Pre-Lenti-EF1-MCS carriers such as SEQ ID Shown in 5.

Enzyme even reacts：The connection purpose product reclaimed after the digestion for obtaining, obtains HER2 CAR recombinant slow virus load Body Pre-Lenti-EF1-HER2 CAR (nucleotide sequence is as shown in SEQ ID 4).

The product that will be obtained send sequencing, and primer is：

Pre-up-Seq is as shown in SEQ ID10：GGAGCCTACCTAGACTCAGC

Pre-down-Seq is as shown in SEQ ID 11：CAACCAGGATTTATACAAGG.

Sequencing is correct, obtains HER2 CAR recombined lentivirus vector Pre-Lenti-EF1-HER2 CAR.Building process shows It is intended to as shown in Figure 2.

Embodiment two：Cell killing is tested

(1) slow virus is packed

293T cell culture is in 37 DEG C, 5%CO₂In incubator, culture medium is DMEM (Hyclone)/10%FBS (Lanzhou hundred Spirit).Packaging the previous day, digest 293T cells, 7 × 10⁶Cell/ware plantation 10cm culture dishes.During transfectional cell, except Pre- Outside Lenti-EF1-MCS-HER2 CAR plasmids, will also be with packaging plasmid psPAX2, pMD2.0G (Addgene) cotransfection.Wherein The μ g of 5 μ g, psPAX2 plasmids of Pre-Lenti-EF1-MCS-HER2 CAR, 3.75 μ g, pMD2.0G plasmid 1.25.During transfection, by three The mixture for planting plasmid is added in 500 μ l opti-MEM culture mediums (Invitrogen), in another 1.5ml micro centrifugal pipe It is interior to add in 500 μ l opti-MEM culture mediums the reagents of 25 μ l Lipofectamine 2000, then, the transfection examination that will be diluted Agent adds the plasmid top of dilution, mixes, and brief centrifugation is stored at room temperature 20 minutes, finally by plasmid and transfection reagent mixtures (during incubation at room temperature plasmid, old culture medium is changed to 5ml opti-MEM culture mediums, increases in the culture medium of addition 10cm culture dishes Transfection efficiency), several lower mixings are gently shaken, it is put into 37 DEG C, 5%CO₂Incubator, after 5 hours, is changed to the fresh DMEM/10%FBS trainings of 10ml Support base.

After cell transfecting 3 days, virus is harvested, 10ml bases containing Virus culture is transferred in 15ml centrifuge tubes, 4 DEG C, 1250rpm, is centrifuged 5 minutes, removes dead 293T cells, then, will contain viral supernatants filtering, concentration, packing, -80 DEG C of jellies Deposit, remaining portions virus determines titre.

(2) PMBC is separated

Blood drawing：The venous blood 10ml of human body is extracted under sterile conditions.

Separating periphery blood monocytic cell (PBMC)：User's lymphocyte separation medium (is that biological engineering finite is public up to section Department), carried out according to specification, PBMC is obtained, it is resuspended with 1640 culture mediums containing IL2, inactivated serum, count.

(3) T cell purifying

LC, takes 1x10⁷Individual lymphocyte is in 1.5ml micro centrifugal pipes.250g, is centrifuged 10 points by 22 DEG C Clock.Supernatant liquid is abandoned in suction, and 80 μ L Beads enrichment buffer solution re-suspended cells add the CD3MicroBeads (U.S. day Ni) of 20 μ l.4 Placed 1 hour in DEG C refrigerator.After 1 hour, the Beads enrichment buffer solution of 1mL is added, gently overturn and mix, 250g, 5 DEG C of centrifugations 10 Minute.Filter column is placed on magnet, with the buffer solution rinse of 500 μ l.The cell of centrifuge washing abandons supernatant, 500 μ l bufferings Liquid is resuspended, adds Filter column top, and after cell suspension outflow, pillar is washed four times with the buffer solution of 500 μ l.By Filter column from magnet On lay down, the T cell of magnetic absorption is gone out using 1mL buffer solutions, to 1ml centrifuge tubes.250g, 5 DEG C, 10 minutes.Containing IL2, 1640 culture mediums containing 10% inactivated serum are resuspended, count.

(4) T cell slow-virus infection

The T cell that purifying is obtained is counted, and 2 × 10⁶T cell/hole (6 orifice plate) is planted, and after overnight incubation, it is 2 to add MOI Comparison virus liquid (empty carrier is packed, Control) and Pre-Lenti-EF1-MCS-HER2 CAR virus liquids, 1000g, 22 DEG C, Centrifugation 30 minutes, is put into incubator, and infection is overnight.

Infection first day, adds 1ml fresh cultures.

Infect the 3rd day, T cell molecular marker for increased proliferation, 25cm will be transferred to after T cell results, centrifugation²Blake bottle.

After cell is expanded to certain amount, using the single-stranded anti-of flow cytometry HER2 CART surfaces identification HER2 The positive expression rate of body, concrete outcome is as shown in Figure 3 and Figure 4.A number of CART cells are taken, is divided into two pipes, a pipe is used HER2-Fc fusion proteins and HER2 CART are incubated, and are subsequently adding PE secondary antibodies (HER2-Fc) (corresponding diagram 4), and another pipe is only added PE secondary antibodies, used as negative control (control) (corresponding diagram 3), Fig. 3 and Fig. 4 are visible for flowcytometric results, about 86% The expression of CART cells can recognize the single-chain antibody of HER2 albumen, i.e. CART virus infection positive rates are 86%.

(5) killing experiments

Count the A431 cells of expression HER2 high, 1 × 10⁴Individual A431 cells/wells (96 orifice plate)；Count the T cell of infection (the Control T cells of Control virus liquids infection and the HER2 of Pre-Lenti-EF1-MCS-HER2 CAR virus liquids infection CART cells), compare 10 according to effect target:1,5:1,2.5:1 ratio adds A431 cells upper strata, and experimental design is as shown in table 1.

The killing experiments of table 1 design table (target cell：A431)

(6) measurement is killed

By measuring the LDH that dead cell discharges, determine that CART cells kill the effect of A431 target cells.

Operation discharges kit specification (the non-radioactive cell toxicity detections of CytoTox 96, goods according to Promega LDH Number：G1780).

Overnight, after about 18h, maximum release aperture adds 10 × cell pyrolysis liquid 20ul to killing experiments in step (5).

After 2 hours, 50 μ l supernatants are taken per hole, be subsequently adding 50 μ l LDH zymolytes, be stored at room temperature reaction 20 minutes, enzyme mark Absorbance OD492 at instrument measurement 492nm.Meanwhile, 50ul supernatants are taken, ELISA experiments are carried out, observe IFN-γ secretion level.

Killing rate computing formula is：

Experimental port be different effect targets than the OD492 absorbances that obtain, effector cell it is spontaneous for Control T cells or The OD492 values of HER2 CART cells, target cell is spontaneous to be discharged for A431 is minimum, and target cell is the maximum releases of A431 to the maximum and (adds Cracking fluid apertures).

The killing rate being calculated is as shown in Fig. 5, Fig. 6 and Fig. 7：From microscope photograph after the cell experiment of Fig. 5, it is seen that under There is no tumour cell in the figure in face, be killed, assemble agglomerating after CART cell activations；LDH release experiments as seen from Figure 6 Detection fragmentation effect, as seen from Figure 7 after killing experiments, IFN-γ concentration in ELISA detection nutrient solutions, fragmentation effect is obvious HER2 CART secretion high concentration IFN-γs, result above shows the killing ability of Pre-Lenti-EF1-MCS-HER2 CART Preferably.

Embodiment three：Zoopery

Mouse species：It is NSG immunodeficient mouses (lacking T cell, B cell and NK cell functions).

Tumor inoculation：Using A431 tumor cell lines, 3x10⁶Cell/100ul PBS hypodermic injections (10 mouse).

CART is injected：After A431 cancer cell subcutaneous are inoculated with 8 days, tail vein injection Control or HER2 CART cells (1x10⁷Cell/200ul PBS, one group of 5 mouse, the next day inject, every mouse co-injection 3 times), zoopery design is as schemed Shown in 8.

Observe within every 3 days, measure mouse subcutaneous tumor volumes, until CART cell infusions are after 18 days, HER2 CART groups are subcutaneous Tumor disappearance, takes a picture after mouse anesthesia.

Experimental result：Tumor growth curve is as shown in figure 9, after tail vein injection CART cells, measure tumour body in every 3 days Product, draws tumor growth curve, it is seen that HER2 CART substantially suppress tumour growth；Mouse hypodermic tumour gross examination of skeletal muscle such as Figure 10 Shown (HER2 CART are using after 18 days).Knowable to the result of Fig. 9 and Figure 10, by HER2 CART treatment, can significantly press down The growth of tumour processed.

HER2 CAR recombined lentivirus vectors and its construction method and application that the present invention is provided, the HER2 that structure is obtained CAR recombined lentivirus vector Pre-Lenti-EF1-MCS-HER2 CAR, by being packaged into HER2 CAR slow virus and infecting new The T cell of fresh separation, the HER2 CART for preparing can effectively kill A431 target cells, hence it is evident that suppress the life of tumour cell It is long, provide possibility to be applied to prepare antineoplastic.

It should be noted that unless otherwise indicated, technical term used in this application or scientific terminology should be this hair The ordinary meaning that bright one of ordinary skill in the art are understood.Unless specifically stated otherwise, otherwise illustrate in these embodiments The relative step of part and step, numerical expression and numerical value do not limit the scope of the invention.It is illustrated and described herein In all examples, unless otherwise prescribed, any occurrence should be construed as merely exemplary, not as limitation, because This, other examples of exemplary embodiment can have different values.

Finally it should be noted that：Various embodiments above is merely illustrative of the technical solution of the present invention, rather than its limitations；To the greatest extent Pipe has been described in detail with reference to foregoing embodiments to the present invention, it will be understood by those within the art that：Its according to The technical scheme described in foregoing embodiments can so be modified, or which part or all technical characteristic are entered Row equivalent；And these modifications or replacement, the essence of appropriate technical solution is departed from various embodiments of the present invention technology The scope of scheme, it all should cover in the middle of the scope of claim of the invention and specification.

SEQUENCE LISTING

<110>Beijing Puri gold Science and Technology Ltd., Shenzhen Ka Di bio tech ltd

<120>HER2 CAR recombined lentivirus vectors and its construction method and application

<130> 2017

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 939

<212> DNA

<213>It is artificial synthesized

<400> 1

ccagcgaagc ccaccacgac gccagcgccg cgaccaccaa caccggcgcc caccatcgcg 60

tcgcagcccc tgtccctgcg cccagaggcg tgccggccag cggcgggggg cgcagtgcac 120

acgagggggc tggacttcgc cccacgcaaa attgaagtta tgtatcctcc tccttaccta 180

gacaatgaga agagcaatgg aaccattatc catgtgaaag ggaaacacct ttgtccaagt 240

cccctatttc ccggaccttc taagcccttt tgggtgctgg tggtggttgg tggagtcctg 300

gcttgctata gcttgctagt aacagtggcc tttattattt tctgggtgag gagtaagagg 360

agcaggctcc tgcacagtga ctacatgaac atgactcccc gccgccccgg gcccacccgc 420

aagcattacc agccctatgc cccaccacgc gacttcgcag cctatcgctc caaacggggc 480

agaaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 540

gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 600

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 660

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 720

gaccctgaga tggggggaaa gccgcagaga aggaagaacc ctcaggaagg cctgtacaat 780

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 840

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 900

tacgacgccc ttcacatgca ggccctgccc cctcgctaa 939

<210> 2

<211> 774

<212> DNA

<213>It is artificial synthesized

<400> 2

atgcctctgc tgctgctgct gccactgctg tgggcaggag cactggctga ggtgcagctg 60

gtcgaaagcg gaggaggact ggtgcagcct ggagggagtc tgaggctgtc atgcgccgct 120

agcggcttta acatcaaaga cacctacatt cactgggtgc gacaggctcc aggaaaggga 180

ctggagtggg tcgcacgaat ctatcctact aatggctaca cccgatatgc cgactccgtg 240

aaagggcggt ttacaatttc cgccgataca tctaagaaca ctgcttacct gcagatgaat 300

agtctgagag ctgaagacac tgcagtctac tattgcagca gatggggagg cgacggcttc 360

tacgccatgg attattgggg ccagggaacc ctggtgacag tcagctccgg aggaggaggg 420

agcggcggag gaggcagcgg aggaggaggc tctgatatcc agatgaccca gtccccctct 480

agtctgtccg cctctgtggg cgacagggtc actattacct gtcgcgcttc tcaggatgtg 540

aacacagcag tcgcctggta ccagcagaag ccaggaaaag cacccaagct gctgatctac 600

agtgcctcat tcctgtatag tggcgtgcca tcacggttta gcgggtccag atctggaact 660

gacttcacac tgactatttc aagcctgcag cccgaggatt ttgccaccta ctattgtcag 720

cagcattata ccacaccccc taccttcgga cagggcacaa aagtggaaat caag 774

<210> 3

<211> 1713

<212> DNA

<213>It is artificial synthesized

<400> 3

atgcctctgc tgctgctgct gccactgctg tgggcaggag cactggctga ggtgcagctg 60

gtcgaaagcg gaggaggact ggtgcagcct ggagggagtc tgaggctgtc atgcgccgct 120

agcggcttta acatcaaaga cacctacatt cactgggtgc gacaggctcc aggaaaggga 180

ctggagtggg tcgcacgaat ctatcctact aatggctaca cccgatatgc cgactccgtg 240

aaagggcggt ttacaatttc cgccgataca tctaagaaca ctgcttacct gcagatgaat 300

agtctgagag ctgaagacac tgcagtctac tattgcagca gatggggagg cgacggcttc 360

tacgccatgg attattgggg ccagggaacc ctggtgacag tcagctccgg aggaggaggg 420

agcggcggag gaggcagcgg aggaggaggc tctgatatcc agatgaccca gtccccctct 480

agtctgtccg cctctgtggg cgacagggtc actattacct gtcgcgcttc tcaggatgtg 540

aacacagcag tcgcctggta ccagcagaag ccaggaaaag cacccaagct gctgatctac 600

agtgcctcat tcctgtatag tggcgtgcca tcacggttta gcgggtccag atctggaact 660

gacttcacac tgactatttc aagcctgcag cccgaggatt ttgccaccta ctattgtcag 720

cagcattata ccacaccccc taccttcgga cagggcacaa aagtggaaat caagccagcg 780

aagcccacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag 840

cccctgtccc tgcgcccaga ggcgtgccgg ccagcggcgg ggggcgcagt gcacacgagg 900

gggctggact tcgccccacg caaaattgaa gttatgtatc ctcctcctta cctagacaat 960

gagaagagca atggaaccat tatccatgtg aaagggaaac acctttgtcc aagtccccta 1020

tttcccggac cttctaagcc cttttgggtg ctggtggtgg ttggtggagt cctggcttgc 1080

tatagcttgc tagtaacagt ggcctttatt attttctggg tgaggagtaa gaggagcagg 1140

ctcctgcaca gtgactacat gaacatgact ccccgccgcc ccgggcccac ccgcaagcat 1200

taccagccct atgccccacc acgcgacttc gcagcctatc gctccaaacg gggcagaaag 1260

aaactcctgt atatattcaa acaaccattt atgagaccag tacaaactac tcaagaggaa 1320

gatggctgta gctgccgatt tccagaagaa gaagaaggag gatgtgaact gagagtgaag 1380

ttcagcagga gcgcagacgc ccccgcgtac cagcagggcc agaaccagct ctataacgag 1440

ctcaatctag gacgaagaga ggagtacgat gttttggaca agagacgtgg ccgggaccct 1500

gagatggggg gaaagccgca gagaaggaag aaccctcagg aaggcctgta caatgaactg 1560

cagaaagata agatggcgga ggcctacagt gagattggga tgaaaggcga gcgccggagg 1620

ggcaaggggc acgatggcct ttaccagggt ctcagtacag ccaccaagga cacctacgac 1680

gcccttcaca tgcaggccct gccccctcgc taa 1713

<210> 4

<211> 8580

<212> DNA

<213>It is artificial synthesized

<400> 4

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840

aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900

caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960

gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020

cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080

ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140

aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200

tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260

aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320

gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380

cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440

gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500

ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560

actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620

gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680

aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740

ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800

tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860

actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920

cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980

cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag 2040

gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac 2100

aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg 2160

acagcagaga tccagtttat cgataaggat ctgcgatcgc tccggtgccc gtcagtgggc 2220

agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaacggg 2280

tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 2340

ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 2400

tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca tctctccttc 2460

acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg ttctgccgcc 2520

tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa agctcaggtc 2580

gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc ggctctccac 2640

gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg ttctgcgccg 2700

ttacagatcc aagctgtgac cggcgcctac gctagacgaa ttcctcgaga ctagttctag 2760

aatgccacca tgcctctgct gctgctgctg ccactgctgt gggcaggagc actggctgag 2820

gtgcagctgg tcgaaagcgg aggaggactg gtgcagcctg gagggagtct gaggctgtca 2880

tgcgccgcta gcggctttaa catcaaagac acctacattc actgggtgcg acaggctcca 2940

ggaaagggac tggagtgggt cgcacgaatc tatcctacta atggctacac ccgatatgcc 3000

gactccgtga aagggcggtt tacaatttcc gccgatacat ctaagaacac tgcttacctg 3060

cagatgaata gtctgagagc tgaagacact gcagtctact attgcagcag atggggaggc 3120

gacggcttct acgccatgga ttattggggc cagggaaccc tggtgacagt cagctccgga 3180

ggaggaggga gcggcggagg aggcagcgga ggaggaggct ctgatatcca gatgacccag 3240

tccccctcta gtctgtccgc ctctgtgggc gacagggtca ctattacctg tcgcgcttct 3300

caggatgtga acacagcagt cgcctggtac cagcagaagc caggaaaagc acccaagctg 3360

ctgatctaca gtgcctcatt cctgtatagt ggcgtgccat cacggtttag cgggtccaga 3420

tctggaactg acttcacact gactatttca agcctgcagc ccgaggattt tgccacctac 3480

tattgtcagc agcattatac cacaccccct accttcggac agggcacaaa agtggaaatc 3540

aagccagcga agcccaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 3600

gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 3660

cacacgaggg ggctggactt cgccccacgc aaaattgaag ttatgtatcc tcctccttac 3720

ctagacaatg agaagagcaa tggaaccatt atccatgtga aagggaaaca cctttgtcca 3780

agtcccctat ttcccggacc ttctaagccc ttttgggtgc tggtggtggt tggtggagtc 3840

ctggcttgct atagcttgct agtaacagtg gcctttatta ttttctgggt gaggagtaag 3900

aggagcaggc tcctgcacag tgactacatg aacatgactc cccgccgccc cgggcccacc 3960

cgcaagcatt accagcccta tgccccacca cgcgacttcg cagcctatcg ctccaaacgg 4020

ggcagaaaga aactcctgta tatattcaaa caaccattta tgagaccagt acaaactact 4080

caagaggaag atggctgtag ctgccgattt ccagaagaag aagaaggagg atgtgaactg 4140

agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 4200

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 4260

cgggaccctg agatgggggg aaagccgcag agaaggaaga accctcagga aggcctgtac 4320

aatgaactgc agaaagataa gatggcggag gcctacagtg agattgggat gaaaggcgag 4380

cgccggaggg gcaaggggca cgatggcctt taccagggtc tcagtacagc caccaaggac 4440

acctacgacg cccttcacat gcaggccctg ccccctcgct aaggatccac gcgtctggaa 4500

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 4560

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 4620

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 4680

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 4740

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 4800

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 4860

gttgggcact gacaattccg tggtgttgtc ggggaagctg acgtcctttc catggctgct 4920

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 4980

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 5040

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc ctggaattaa 5100

ttctgcagtc gagacctaga aaaacatgga gcaatcacaa gtagcaatac agcagctacc 5160

aatgctgatt gtgcctggct agaagcacaa gaggaggagg aggtgggttt tccagtcaca 5220

cctcaggtac ctttaagacc aatgacttac aaggcagctg tagatcttag ccacttttta 5280

aaagaaaaga ggggactgga agggctaatt cactcccaac gaagacaaga tatccttgat 5340

ctgtggatct accacacaca aggctacttc cctgattagc agaactacac accagggcca 5400

ggggtcagat atccactgac ctttggatgg tgctacaagc tagtaccagt tgagccagat 5460

aaggtagaag aggccaataa aggagagaac accagcttgt tacaccctgt gagcctgcat 5520

gggatggatg acccggagag agaagtgtta gagtggaggt ttgacagccg cctagcattt 5580

catcacgtgg cccgagagct gcatccggag tacttcaaga actgctgata tcgagcttgc 5640

tacaagggac tttccgctgg ggactttcca gggaggcgtg gcctgggcgg gactggggag 5700

tggcgagccc tcagatcctg catataagca gctgcttttt gcctgtactg ggtctctctg 5760

gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 5820

tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 5880

taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtagtagttc 5940

atgtcatctt attattcagt atttataact tgcaaagaaa tgaatatcag agagtgagag 6000

gccttgacat tgctagcgtt taccgtcgac ctctagctag agcttggcgt aatcatggtc 6060

atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca tacgagccgg 6120

aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat taattgcgtt 6180

gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt aatgaatcgg 6240

ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga 6300

ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 6360

acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 6420

aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 6480

tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 6540

aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 6600

gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 6660

acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 6720

accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 6780

ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 6840

gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 6900

aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 6960

ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 7020

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 7080

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat 7140

cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga 7200

gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg 7260

tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga 7320

gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc 7380

agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac 7440

tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc 7500

agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc 7560

gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc 7620

catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt 7680

ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc 7740

atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg 7800

tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag 7860

cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat 7920

cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc 7980

atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa 8040

aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta 8100

ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa 8160

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtcgacgg 8220

atcgggagat caacttgttt attgcagctt ataatggtta caaataaagc aatagcatca 8280

caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca 8340

tcaatgtatc ttatcatgtc tggatcaact ggataactca agctaaccaa aatcatccca 8400

aacttcccac cccataccct attaccactg ccaattacct gtggtttcat ttactctaaa 8460

cctgtgattc ctctgaatta ttttcatttt aaagaaattg tatttgttaa atatgtacta 8520

caaacttagt agtttttaaa gaaattgtat ttgttaaata tgtactacaa acttagtagt 8580

<210> 5

<211> 6867

<212> DNA

<213>It is artificial synthesized

<400> 5

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840

aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900

caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960

gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020

cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080

ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140

aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200

tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260

aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320

gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380

cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440

gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500

ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560

actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620

gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680

aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740

ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800

tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860

actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920

cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980

cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag 2040

gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac 2100

aaactaaaga attacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg 2160

acagcagaga tccagtttat cgataaggat ctgcgatcgc tccggtgccc gtcagtgggc 2220

agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaacggg 2280

tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 2340

ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 2400

tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca tctctccttc 2460

acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg ttctgccgcc 2520

tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa agctcaggtc 2580

gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc ggctctccac 2640

gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg ttctgcgccg 2700

ttacagatcc aagctgtgac cggcgcctac gctagacgaa ttcctcgaga ctagttctag 2760

agcggccgcg gatccacgcg tctggaacaa tcaacctctg gattacaaaa tttgtgaaag 2820

attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg ctgctttaat 2880

gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc 2940

ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg 3000

cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct 3060

ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg ccgcctgcct 3120

tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg 3180

gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac 3240

gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct 3300

gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc ggatctccct 3360

ttgggccgcc tccccgcctg gaattaattc tgcagtcgag acctagaaaa acatggagca 3420

atcacaagta gcaatacagc agctaccaat gctgattgtg cctggctaga agcacaagag 3480

gaggaggagg tgggttttcc agtcacacct caggtacctt taagaccaat gacttacaag 3540

gcagctgtag atcttagcca ctttttaaaa gaaaagaggg gactggaagg gctaattcac 3600

tcccaacgaa gacaagatat ccttgatctg tggatctacc acacacaagg ctacttccct 3660

gattagcaga actacacacc agggccaggg gtcagatatc cactgacctt tggatggtgc 3720

tacaagctag taccagttga gccagataag gtagaagagg ccaataaagg agagaacacc 3780

agcttgttac accctgtgag cctgcatggg atggatgacc cggagagaga agtgttagag 3840

tggaggtttg acagccgcct agcatttcat cacgtggccc gagagctgca tccggagtac 3900

ttcaagaact gctgatatcg agcttgctac aagggacttt ccgctgggga ctttccaggg 3960

aggcgtggcc tgggcgggac tggggagtgg cgagccctca gatcctgcat ataagcagct 4020

gctttttgcc tgtactgggt ctctctggtt agaccagatc tgagcctggg agctctctgg 4080

ctaactaggg aacccactgc ttaagcctca ataaagcttg ccttgagtgc ttcaagtagt 4140

gtgtgcccgt ctgttgtgtg actctggtaa ctagagatcc ctcagaccct tttagtcagt 4200

gtggaaaatc tctagcagta gtagttcatg tcatcttatt attcagtatt tataacttgc 4260

aaagaaatga atatcagaga gtgagaggcc ttgacattgc tagcgtttac cgtcgacctc 4320

tagctagagc ttggcgtaat catggtcata gctgtttcct gtgtgaaatt gttatccgct 4380

cacaattcca cacaacatac gagccggaag cataaagtgt aaagcctggg gtgcctaatg 4440

agtgagctaa ctcacattaa ttgcgttgcg ctcactgccc gctttccagt cgggaaacct 4500

gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg 4560

gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 4620

ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 4680

aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 4740

ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 4800

gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 4860

cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 4920

gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 4980

tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 5040

cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 5100

cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 5160

gtggcctaac tacggctaca ctagaagaac agtatttggt atctgcgctc tgctgaagcc 5220

agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag 5280

cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 5340

tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat 5400

tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag 5460

ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat 5520

cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc 5580

cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat 5640

accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag 5700

ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg 5760

ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc 5820

tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca 5880

acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg 5940

tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc 6000

actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta 6060

ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc 6120

aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg 6180

ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc 6240

cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc 6300

aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat 6360

actcatactc ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag 6420

cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc 6480

ccgaaaagtg ccacctgacg tcgacggatc gggagatcaa cttgtttatt gcagcttata 6540

atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt ttttcactgc 6600

attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg atcaactgga 6660

taactcaagc taaccaaaat catcccaaac ttcccacccc ataccctatt accactgcca 6720

attacctgtg gtttcattta ctctaaacct gtgattcctc tgaattattt tcattttaaa 6780

gaaattgtat ttgttaaata tgtactacaa acttagtagt ttttaaagaa attgtatttg 6840

ttaaatatgt actacaaact tagtagt 6867

<210> 6

<211> 35

<212> DNA

<213>It is artificial synthesized

<400> 6

gctctagagc caccatgcct ctgctgctgc tgctg 35

<210> 7

<211> 29

<212> DNA

<213>It is artificial synthesized

<400> 7

cgggatcctt agcgaggggg cagggcctg 29

<210> 8

<211> 40

<212> DNA

<213>It is artificial synthesized

<400> 8

gtcgtggtgg gcttcgctgg cttgatttcc acttttgtgc 40

<210> 9

<211> 40

<212> DNA

<213>It is artificial synthesized

<400> 9

gcacaaaagt ggaaatcaag ccagcgaagc ccaccacgac 40

<210> 10

<211> 20

<212> DNA

<213>It is artificial synthesized

<400> 10

ggagcctacc tagactcagc 20

<210> 11

<211> 20

<212> DNA

<213>It is artificial synthesized

<400> 11

caaccaggat ttatacaagg 20

<210> 12

<211> 570

<212> PRT

<213>It is artificial synthesized

<400> 12

Met Pro Leu Leu Leu Leu Leu Pro Leu Leu Trp Ala Gly Ala Leu Ala

1 5 10 15

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

20 25 30

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Ile Lys Asp Thr

35 40 45

Tyr Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

50 55 60

Ala Arg Ile Tyr Pro Thr Asn Gly Tyr Thr Arg Tyr Ala Asp Ser Val

65 70 75 80

Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr

85 90 95

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

100 105 110

Ser Arg Trp Gly Gly Asp Gly Phe Tyr Ala Met Asp Tyr Trp Gly Gln

115 120 125

Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser

145 150 155 160

Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala

165 170 175

Ser Gln Asp Val Asn Thr Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly

180 185 190

Lys Ala Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr Ser Gly

195 200 205

Val Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr Leu

210 215 220

Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln

225 230 235 240

Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr Lys Val Glu

245 250 255

Ile Lys Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr

260 265 270

Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala

275 280 285

Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe

290 295 300

Ala Pro Arg Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn

305 310 315 320

Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys

325 330 335

Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val

340 345 350

Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala

355 360 365

Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser

370 375 380

Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His

385 390 395 400

Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Lys

405 410 415

Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg

420 425 430

Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro

435 440 445

Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser

450 455 460

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

465 470 475 480

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

485 490 495

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro

500 505 510

Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala

515 520 525

Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His

530 535 540

Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp

545 550 555 560

Ala Leu His Met Gln Ala Leu Pro Pro Arg

565 570

Claims

1. a kind of albumen, it is characterised in that be following (a) or (b)：

A protein that the amino acid sequence of () shown in sequence in sequence table 12 is constituted；

B () is by the amino acid sequence shown in sequence in sequence table 12 is by the substitution of one or several amino acid residues and/or lacks Lose and/or addition and with identical function as derived from sequence 12 protein.

2. the HER2 CAR genes of albumen described in claim 1 are encoded.

3. HER2 CAR genes as claimed in claim 2, it is characterised in that the gene is any one following DNA points Son：

DNA molecular of (a) nucleotide sequence as shown in SEQ ID 3；

DNA points of the b albumen of nucleotide sequence hybridization and coding with identical function that () limits with (a) under strict conditions Son；

C nucleotide sequence that () limits with (a) at least has 90%, at least has 95%, at least have 96%, at least have 97%th, at least have 98% or at least there is the DNA molecular of the albumen of 99% homology and coding with identical function.

4. recombinant vector, expression cassette, transgenic cell line or restructuring containing the HER2 CAR genes described in Claims 2 or 3 Bacterium；

The recombinant vector is specially in the HER2 CAR genes insertion expression vector described in Claims 2 or 3, is expressed The recombinant vector of albumen described in claim 1.

5. a kind of synthetic method of HER2 CAR genes, it is characterised in that comprise the following steps：

Anti- HER2 ScFV genes and CAR structural genes are spliced using over-lap PCR, HER2 CAR genes are obtained；

Wherein, the nucleotide sequence of the CAR structural genes is as shown in SEQ ID 1, the nucleotides of the HER2 ScFV genes Sequence is as shown in SEQ ID 2；The nucleotide sequence of the HER2 CAR genes for obtaining is as shown in SEQ ID 3.

6. a kind of HER2 CAR recombined lentivirus vectors, it is characterised in that：

The HER2 CAR recombined lentivirus vectors are Pre-Lenti-EF1-HER2 CAR, its nucleotide sequence such as SEQ ID 4 It is shown.

7. expression cassette, transgenic cell line or recombinant bacterium containing the HER2 CAR recombined lentivirus vectors described in claim 6.

8. the construction method of HER2 CAR recombined lentivirus vectors as claimed in claim 6, it is characterised in that including following step Suddenly：

HER2 CAR genes are synthesized using over-lap PCR, two ends set XbaI, BamHI restriction endonuclease sites；Wherein, it is described The nucleotide sequence of HER2 CAR genes is as shown in SEQ ID 3；

With restriction enzyme XbaI, BamHI double digestion Pre-Lenti-EF1-MCS carriers and the HER2 CAR genes, divide Purpose product that Hui Shou be after digestion；Wherein, the nucleotide sequence of the Pre-Lenti-EF1-MCS carriers such as institutes of SEQ ID 5 Show；

The connection purpose product reclaimed after the digestion for obtaining, obtains HER2 CAR recombined lentivirus vectors Pre-Lenti- EF1-HER2 CAR。

9. the construction method of HER2 CAR recombined lentivirus vectors as claimed in claim 8, it is characterised in that the primer of use Sequence includes：

First primer sequence, its nucleotide sequence is as shown in SEQ ID 6；

Second primer sequence, its nucleotide sequence is as shown in SEQ ID 7；

Three-primer sequence, its nucleotide sequence is as shown in SEQ ID 8；

4th primer sequence, its nucleotide sequence is as shown in SEQ ID 9.

10. application of following any one materials in antineoplastic is prepared：1) albumen described in claim 1 is contained；2) contain The recombinant vector of the HER2 CAR genes having the right described in requirement 2 or 3, expression cassette, transgenic cell line or recombinant bacterium；3) right It is required that the HER2 CAR recombined lentivirus vectors described in 6；4) the HER2 CAR recombined lentivirus vectors described in claim 6 are contained Expression cassette, transgenic cell line or recombinant bacterium.