CN106636026A

CN106636026A - Corn protein having herbicide resistance activity and encoding gene and application thereof

Info

Publication number: CN106636026A
Application number: CN201710069195.9A
Authority: CN
Inventors: 方军; 朴钟泽; 万常照; 白建江; 杨瑞芳
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2017-02-08
Filing date: 2017-02-08
Publication date: 2017-05-10

Abstract

The invention discloses a corn protein having a herbicide resistance activity, and an encoding gene and an application of the corn protein. The corn protein is a mutant protein of corn acetohydroxyacid synthase, the amino acid sequence of the protein is shown as SEQ ID No.1 or SEQ ID No.2, the protein derives from the expression of an acetohydroxyacid synthase gene in a chromosome 4 or chromosome 5 of a corn genome, the corn acetohydroxyacid synthase is obtained through in vitro mutation, the amino acid sequence has the characteristics that compared with a wild type corn acetohydroxyacid synthase, an amino acid at the locus of Trp542 is lost, the mutant protein shows resistance to various herbicides like imidazolone, sulfonylurea and miazines, and a plant obtained through encoded gene transformation shows resistance to various herbicides like imidazolone, sulfonylurea and miazines.

Description

Corn protein with antiweed activity, its encoding gene and application

Technical field

The invention belongs to herbicide resistant protein matter field, and in particular to antiweed activity corn protein, its Encoding gene and application.

Background technology

Weeds are to restrict one of principal element of corn yield.Semen Maydiss are the primary raw materials of the Feed Manufacturing of China, its product Amount ensures the supply of the national meat egg food of China.With China's expanding economy, human cost more and more higher, maize seed Plant mode is changed by small-scale precision farming steering mechanicalization, and the popularization of mechanized manner makes weed problem become impact Semen Maydiss One of key factor of yield and quality.The cultivation of antiweed Semen Maydiss solves the problems, such as mechanization weeding.At present, China is still The popularizing planting of transgenic corns is not opened, but, every year from external a large amount of import transgenic corns as feedstuff.

In the external transgenic corns for being used to commercially produce, anti-herbicide gene is mostly from the external source base of microorganism Cause, the anti-herbicide gene from Maize genome are fewer.

The endogenous antiweed Acetohydroxyacid synthase of Semen Maydiss (acetohydroxy acid synthase, referred to as AHAS) protein is produced by ahas gene mutation, and it is special that expression antiweed AHAS protein can make plant obtain antiweed Property, solve the weed problem in field.AHAS protein is mainly distributed in microorganism and plant, is hardly deposited in animal Suppress herbicide to person poultry harmless in, AHAS.Therefore, excavate and study the Semen Maydiss AHAS protein tool with antiweed activity There are good novelty and economic worth.

At present, cultivate anti-AHAS to suppress the method for herbicide Semen Maydiss is to carry out chemistry as material with corn seed or plant Or physical mutagenesis, carry out genome mutation in plant body.This method obtains the test period length of antiweed Semen Maydiss and (is more than 3 years), obtain new mutant it is difficult (mutation result is the replacement that the single base change of nucleotide causes single amino acids, easily with The mutation that Jing is present repeats), and chance of success little (generally mutation success rate is less than hundred a ten thousandths), many laboratorys are carried out Research and development more than 5 years cannot obtain new mutant.

The content of the invention

It is an object of the invention to provide the corn protein with antiweed activity, its encoding gene and application, its For the Semen Maydiss AHAS muteins of anti-polymorphic type herbicidal activity, the protein has anti-imidazolone type, sulfonylurea Or the activity of the polymorphic type herbicide such as miazines, the plant of its encoding gene conversion has anti-imidazolone type, sulfonylurea Or the activity of the polymorphic type herbicide such as miazines.

Different from the acid substitution mutations body for being obtained by vivo mutations at present, the present invention adopts amino acid deletion plan Slightly, by being mutated outside genosome, Semen Maydiss AHAS protein is transformed, obtains Semen Maydiss AHAS muteins so as to removed with anti- Careless agent activity.

In order to achieve the above object, the present invention provides following technical scheme：

Corn protein with antiweed activity, which is Semen Maydiss AHAS muteins, and its aminoacid sequence is such as Shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.5 or SEQ ID No.6.

The Semen Maydiss of antiweed activity of its aminoacid sequence of the invention as shown in SEQ ID No.1 or SEQ ID No.2 Protein is precursor full length protein, becomes mature protein, corresponding to such as SEQ after the precursor full length protein erasure signal peptide The aminoacid sequence of the precursor full length protein shown in ID No.1 and SEQ ID No.2, the aminoacid sequence point of mature protein Not as shown in SEQ ID No.5 and SEQ ID No.6.

Gene with antiweed activity, which is the nucleoside of the coding corn protein with antiweed activity Acid sequence.

Further, the nucleotide sequence such as SEQ of corn protein of the aminoacid sequence as shown in SEQ ID No.1 Shown in ID No.3, or the nucleotide sequence such as SEQ ID of corn protein of the aminoacid sequence as shown in SEQ ID No.2 Shown in No.4, or the nucleotide sequence such as SEQ ID No.7 of corn protein of the aminoacid sequence as shown in SEQ ID No.5 Shown, the nucleotide sequence of corn protein of the aminoacid sequence as shown in SEQ ID No.6 is as shown in SEQ ID No.8.

It is of the present invention with antiweed activity corn protein be used for cultivate anti-imidazolone type, sulfonylurea and Miazines herbicide plant.

A kind of method for obtaining the polymorphic type herbicide plants such as anti-imidazolone type, sulfonylurea and miazines, including, by The encoding gene of the Semen Maydiss AHAS muteins is transformed in plant, the plant is produced with antiweed activity Semen Maydiss AHAS muteins.

Preferably, the nucleotide sequence of aminoacid sequence encoding gene of corn protein as shown in SEQ ID No.1 is such as Shown in SEQ ID No.3, or the nucleotides sequence of aminoacid sequence encoding gene of corn protein as shown in SEQ ID No.2 Row are as shown in SEQ ID No.4, or the nucleoside of aminoacid sequence encoding gene of corn protein as shown in SEQ ID No.5 Acid sequence as shown in SEQ ID No.7, the nucleoside of aminoacid sequence encoding gene of corn protein as shown in SEQ ID No.6 Acid sequence is as shown in SEQ ID No.8.

Further, the imidazolinone herbicide is not imazethapyr, imazamox or imazapic, but not It is limited to this several imidazolinone herbicide.

Also, the sulfonylurea herbicide is that chlorine sulphur is grand and sulfometuronmethyl, but it is not limited to this 2 kinds of sulfonylurea herbicides.

Preferably, the miazines herbicide is bispyribac-sodium, but is not limited to this miazines herbicide.

Further, the plant is Semen Maydiss, Oryza sativa L. or Cotton Gossypii, but is not limited to this several plant.

The corn protein of antiweed of the present invention activity, which is through artificial in No. 4 chromosomes of Semen Maydiss or No. 5 chromosomes The AHAS muteins of transformation, come from the expression of ahas genes in Maize genome, and wild-type corn ahas genes are led to External mutation is crossed, the characteristics of obtain Semen Maydiss AHAS muteins, aminoacid sequence is：Compared with wild type AHAS, Semen Maydiss AHAS muteins lack Trp542 site amino acids, the mutant protein confrontation imidazolone type, sulfonylurea and phonetic The polymorphic type herbicide such as pyridine class has resistance.

In the present invention, the aminoacid sequence of expression No. 4 chromosome mutation genes of Semen Maydiss is as shown in SEQ ID No.1, corresponding Mature protein aminoacid sequence as shown in SEQ ID No.5, express No. 5 chromosome mutation genes of Semen Maydiss aminoacid sequence As shown in SEQ ID No.2, corresponding mature protein aminoacid sequence is as shown in SEQ ID No.6.

The encoding gene of the AHAS muteins that the present invention is obtained is transformed in plant, and table is carried out in plant Reach, contain AHAS muteins in making plant, can make plant that there is anti-imidazolone type, sulfonylurea and pyrimidine carboxylic class Etc. the activity of polymorphic type herbicide.

The nucleotide sequence of encoding gene of the AHAS muteins of the present invention is not limited to Semen Maydiss endogenous sequence, can be with It is the synthetic nucleotide sequence for expressing the protein.

Semen Maydiss AHAS mutants are expressed in Oryza sativa L., Semen Maydiss or Cotton Gossypii, transgenic corns M-MA1M5 and M- is obtained MA2M5, transgenic paddy rice R-MA1M5 and R-MA2M5, transgene cotton C-MA1M5 and C-MA2M5, in transgenic plant and open country Raw type plant seedling stage sprays the polymorphic type herbicides such as anti-imidazolone type, sulfonylurea or pyrimidine carboxylic class, wild-type plant Plant is all dead, and transgenic plant is all survived.Illustrate that the plant for expressing Semen Maydiss AHAS mutants of the present invention has anti-imidazoles The polymorphic type herbicidal activities such as quinoline ketone, sulfonylurea or pyrimidine carboxylic class.

Compared with prior art, the present invention has the advantages that：

1) present invention adopts aminoacid deletion strategy, carries out rite-directed mutagenesises to aminoacid, can be prominent after aminoacid to deleting Variant proteins carry out external antiweed determination of activity, provide to develop more new antiweed AHAS muteins Basis, with simple to operate, screening process is simple, strong innovation the advantages of, excavated the endogenous anti-herbicide gene of Semen Maydiss, increased The species of anti-herbicide gene.

2) AHAS muteins of the invention are obtained by external mutation, and external mutation is with designability By force, the incomparable advantage of vivo mutations such as short, strong innovation of test period, obtained the mutant time less than 2 months, meanwhile, Designed by specific mutation, it is to avoid repeat with AHAS muteins are reported.

3) after express the encoding gene of AHSA muteins of the present invention, the AHAS total length muteins of acquisition The polymorphic types such as anti-imidazolone type, sulfonylurea and pyrimidine carboxylic class are respectively provided with AHAS no signal peptide Ripening Mutant protein The activity of herbicide.

Description of the drawings

Fig. 1 is the AHAS protein S DS-PAGE electrophoretograms in the embodiment of the present invention 1 after purification；

Wherein, swimming lane 1：The protein of MA1M5S after purification；Swimming lane 2：MA2M5S protein after purification；Swimming lane 3：Purification MA1WS protein afterwards；Swimming lane 4：MA2WS protein after purification；Mk：Protein Marker, molecular weight are marked on the diagram.

Fig. 2-Fig. 3 is mutein MA1M5S and MA2M5S and its control wild-type protein in the embodiment of the present invention 2 Matter MA1WS and MA2WS resistance curve chart respectively to imidazolinone herbicide (imazethapyr and imazamox).

Fig. 4 is mutein MA1M5S and MA2M5S and its control wild-type protein in the embodiment of the present invention 2 The resistance curve chart of MA1WS and MA2WS difference pyrimidine carboxylic class herbicide (bispyribac-sodium).

Fig. 5-Fig. 6 is mutein MA1M5S and MA2M5S and its control wild-type protein in the embodiment of the present invention 2 The resistance curve chart of matter MA1WS and MA2WS to sulfonylurea herbicide (chlorimuronethyl and sulfometuronmethyl).

Specific embodiment

Below in conjunction with specific embodiment, the invention will be further described.

In following examples, if no special instructions for《Molecular Cloning:A Laboratory guide》(Science Press, 2002) is remembered Support method.

Primer synthesizes and be sequenced student on commission's work Shanghai biological engineering limited company to be carried out, and reagent, bacterial strain, carrier etc. are real Test articles for use to buy from Hangzhou biotech company of Sigma.

Imidazoles cigarette acetic acid herbicide is " bean agrees " that Shandong first reaches company, and diluted concentration is 200 times of dilution.Methyl miaow grass " hundred ridges lead to " of the cigarette herbicide for BASF Aktiengesellschaft, diluted concentration is 1000 times of dilution.Imazamox herbicide is U.S. " the golden bean " of cyanamide company of state, diluted concentration are 100 times of dilution.Chlorsulfuron weedicide is that Hormone Inst., Jiangsu Prov share is limited " chlorine sulphur is grand " of company, diluted concentration are 20000 times of dilution." gloomy grass of the sulfometuronmethyl herbicide for Jiangsu Rui Bang insecticide factories Only ", diluted concentration is 5000 times of dilution." double grass of the bispyribac-sodium herbicide for Jiangsu Institute of Econones Co., Ltd. Ether ", diluted concentration are 1000 times of dilution.

Embodiment 1 obtains Semen Maydiss AHAS muteins, comprises the following steps：

1. the ahas genes for deleting Trp542 aminoacid are built

(1) by the method for many Polymerization chain reactions (PCR), AHAS1 on No. 4 chromosomes is amplified from Maize genome DNA fragmentation ch4A (the public database NCBI serial numbers at place：15056-17296 in NC_024462), by sepharose electrophoresis Separate, be purified into PCR primer, i.e. ch4A.

Wherein, entering the performing PCR primer that uses of reaction is：

ZM ch4-F：5’gtaaatccaaagagaccgtaaa；

ZM ch4-R：5’agctcatgcatgtcaaagata.

PCR reaction systems are：2 × exo+ polymerase premixed liquid, 50 μ l, 4 μ l of primer ZM ch4-F (10 μM), primer ZM 4 μ l of ch4-R (10 μM), 41 μ l of 1 μ l of wild-type corn genomic DNA and deionized water, cumulative volume are 100 μ l.

PCR programs：A) 95 DEG C, 10 minutes；B) 95 DEG C, 40 seconds；C) 52 DEG C, 40 seconds；D) 68 DEG C, 2 minutes；E) circulation step 2-4,25 times；F) 68 DEG C, 10 minutes；G) 16 DEG C, preserve.

With ch4A as template, using primer MA1F and MA1R, ahas1 gene ma1w (NCBI serial numbers are amplified：NC_ 15108-17031 in 024462), PCR primer is carried out into T clones (pGEMT, Promega companies of the U.S.), T-MA1W is obtained.

Wherein, in PCR reaction systems and program, outside removing template and primer, other conditions are ibid.

The particular sequence of primer is：

MA1F：5’cgcaaccatggccaccgccgccaccgcg；

MA1R：5’tcaatacacagtcctgccatcac.

(2) with T-MA1W as template, using primer MA1542WF and MA1542WR, enter performing PCR reaction, PCR primer is entered Row T is cloned, and obtains the mutant clone T-MA1M5 for deleting Trp542 aminoacid.

Wherein, in PCR reaction systems and program, removing template and outer other conditions of primer are identical with step (1).

The particular sequence of primer is：

MA1542WF：5’cacctggggatggtggtgcaggaggacaggttctataaggcc；

MA1542WR：5’ggccttatagaacctgtcctcctgcaccaccatccccaggtg.

Wherein, as shown in SEQ ID NO.3, aminoacid sequence is as shown in SEQ ID NO.1 for the DNA sequence of MA1M5.

In the same manner, the AHAS genes that Trp542 aminoacid is deleted on No. 5 chromosomes of Semen Maydiss are built, specially：

Using the AHAS genes with deletion Trp542 aminoacid on structure No. 4 chromosomes of Semen Maydiss in above-mentioned steps (1)-(2) When, identical PCR method amplifies DNA fragmentation ch5A (the NCBI serial numbers at AHAS2 places from Maize genome：NC_ 4261-6497 in 024463), then with ch5A as template, using primer MA2F and MA2R, enter performing PCR reaction, amplify ahas2 Gene ma2w (NCBI serial numbers：4520-6443 in NC_024463), the PCR primer is carried out into T clones, T-MA2W is obtained, then With T-MA2W as template, enter performing PCR reaction using primer MA1542WF and MA1542WR (the same step of primer sequence (2)), by PCR Product carries out T clones, obtains the mutant clone T-MA2M5, the DNA sequence such as SEQ ID of MA2M5 for deleting Trp542 aminoacid Shown in NO.4, aminoacid sequence is as shown in SEQ ID NO.2.

Wherein, when expanding ch5A, the primer for using is ZM ch5-F and ZM ch5-R, and particular sequence is as follows：

ZM ch5-F：5’agcgctcactggacaccacgtt；

ZM ch5-R:：5’agcagggaggcggtgcttgct.

Wherein, when expanding ahas2 gene ma2w, the particular sequence of the primer MA2F and MA2R that use is as follows：

MA2F：5’cgcaaccatggccaccgccgccgccgcg；

MA2R：5’tcagtacacagtcctgccatcac.

2. expression, the Semen Maydiss AHAS mature proteins of purification erasure signal peptide

(1) T-MA1W obtained with above-mentioned steps 1 (1) enters performing PCR using primer MABamF and MAEcoR anti-as template Should, PCR primer is carried out into T clones, ma1w gene clonings T-MA1WS of erasure signal peptide are obtained.

Wherein, in PCR reaction systems and program, removing template and outer other conditions of primer are identical with above-mentioned steps 1, primer Particular sequence is：

MABamF：5’ggatccacaatgctacgtccgtggggccccaacgagccc；

MAEcoR：5’gaattctcagtacacagtcctgccatcaccat.

(2) protein expression vector is built, MA1WS is cloned into into pGEX4T2, obtain expression no signal peptide AHAS wild types The carrier 4T2-MA1WS of protein.

(3) the carrier 4T2-MA1WS of expression no signal peptide AHAS wild-type proteins is proceeded to into expression strain Rosetta In, centrifugation is obtained supernatant by GST posts by culture, harvesting, ultrasonic disruption cell, cleans GST posts, eluting, finally Obtain ripe wild-type protein MA1WS.

With with 2 (1)-(3) same method of above-mentioned steps, the T-MA2W obtained with step 1 as template, using primer MABamF and MAEcoR enter performing PCR reaction, and PCR primer is carried out T clones, build protein expression vector, obtain no signal peptide Expression maturation AHAS protein carrier 4T2-MA2WS, then expressed by expression strain Rosetta, obtained no signal peptide Ripe wild-type protein MA2WS.

With with 2 (1) -2 (3) same method of above-mentioned steps, the T-MA1M5 obtained with step 1 as template, using primer MABamF and MAEcoR enter performing PCR reaction, and PCR primer is carried out T clones, build protein expression vector, obtain no signal peptide And the carrier 4T2-MA1M5S of the expression maturation AHAS muteins of deletion Trp542 aminoacid, then by expression strain Rosetta is expressed, and is obtained no signal peptide and is deleted the ripe AHAS muteins MA1M5S of Trp542 aminoacid, , as shown in SEQ ID NO.5, DNA sequence is as shown in SEQ ID NO.7 for its aminoacid sequence.

With with 2 (1) -2 (3) same method of above-mentioned steps, the T-MA2M5 obtained with step 1 as template, using primer MABamF and MAEcoR enter performing PCR reaction, and PCR primer is carried out T clones, build protein expression vector, obtain no signal peptide And the carrier 4T2-MA2M5S of the expression maturation AHAS muteins of deletion Trp542 aminoacid, then by expression strain Rosetta is expressed, and is obtained no signal peptide and is deleted the ripe AHAS mutant proteins MA2M5S of Trp542 aminoacid, its , as shown in SEQ ID NO.6, DNA sequence is as shown in SEQ ID NO.8 for aminoacid sequence.

Wild-type protein MA1WS, MA2WS and mutein MA1M5S, MA2M5S of acquisition are carried out into SDS- PAGE electrophoresis detection, obtains protein adhesive, and protein adhesive is referring to Fig. 1.

As seen from Figure 1, the AHAS protein in swimming lane 1 to swimming lane 4 has obvious band in 90kDa positions, this position with Protein theory size is consistent.Additionally, the protein band accounts for major portion in the protein band of whole swimming lane, illustrate logical Cross step 2 and obtain highly purified AHAS protein.

Embodiment 2 detects the resistance of AHAS mutant protein confrontation herbicides

Semen Maydiss AHAS variant proteins MA1M5S for being obtained with embodiment 1 respectively and MA2M5S, wild-type protein MA1WS It is detection main body with MA2WS, water is that blank is processed, with concentration in 0-100 μM of different cultivars herbicide (imidazoles cigarette second Acid, imazamox, bispyribac-sodium, chlorimuronethyl, sulfometuronmethyl) for influence factor, carry out antiweed bioassay.

Solution reaction system is configured in 2ml centrifuge tubes：450 μ l determine buffer, 10 μ l AHAS protein

(MA1M5S, MA2M5S, MA1WS or MA2WS, 0.5 μ g/ μ l), (water is at blank to 40 μ l influence factor's solution Reason, herbicide is influence factor), 500 μ l of cumulative volume.

AHAS determination of activity buffer：100mM Sodium Pyruvates, 10mM magnesium chlorides, 1mM TPP, 50 μM of FAD, 50mM phosphoric acid Salt, pH7.4.

Response procedures：Centrifuge tube containing different affecting factors reaction system is placed in 37 DEG C to react 1 hour；20 μ l30% Sulphuric acid terminating reaction.60 DEG C are reacted 0.5 hour；250 μ l, 1.7% alpha-Naphthols are added, 0.17% creatine, 60 DEG C of colour developings 0.5 are little When.200 μ l are taken out from centrifuge tube, solution of the detection containing different affecting factors is in 525nm absorbances.

Testing result：With herbicide concentration as the wild-type protein MA1WS process of 0 (influence factor's solution is compareed for water) 525nm absorbances be 100% active, calculate the activity of wild type and mutein under the conditions of different affecting factors Ratio, draws curve chart, as a result referring to Fig. 2-Fig. 6.

From Fig. 2-Fig. 6, with the increasing of the polymorphic type herbicides such as imidazolone type, sulfonylurea or pyrimidine carboxylic class Plus, wild-type protein MA1WS, MA2WS activity is reduced to 0；And mutein MA1M5S, MA2M5S activity is in high concentration Still remain close to 100% active in herbicide (except sulfometuronmethyl), keep 90% active in high concentration sulfometuronmethyl.Cause This, mutein MA1M5S, MA2M5S are to polymorphic type herbicides such as imidazolone type, sulfonylurea or pyrimidine carboxylic classes With resistance.

Conversion and expression of the 3 Semen Maydiss ahas mutant genes of embodiment in plant

1. the Expression element of construction expression AHAS muteins

In order to AHAS muteins are expressed in unifacial leaf and dicotyledon, with (the letter of 1300 carriers of pCambia 1300) being called carrier, AHAS Expression elements being built with Fructus Capsici mottle virus 35S (abbreviation 35S) promoteres and terminator, 35S is opened Mover and terminator DNA sequence are shown in http://www.snapgene.com/resources/plasmid_files/plant_ Vectors/pCAMBIA1300/, comprises the following steps that：

(1) T-MA1M5 obtained with 1 step 1 of embodiment is as template, using primer MABamF and MASacR, by PCR With BamH1/Sac1 double digestions, ahas mutant fragments MA1M5T are obtained.

Wherein, primer sequence is：

MABamF：5’ggatccacaatgctacgtccgtggggccccaacgagccc；

MASacR：5’gagctctcagtacacagtcctgccatcaccat.

(2) it is with 1300 carriers as template, using primer 35S-Hind and 35S-Bam, double by PCR and BamH1/Hind3 Enzyme action, obtains promoter fragment 35S；

Wherein, primer sequence is：

35S-Hind：5'gcgaagcttcatggagtcaaagattcaaa；

35S-Bam：5'gtgggatccagtcccccgtgttctctccaaatgaa.

(3) with 1300 carriers as template, using primer ter-Sac and ter-Kpn, by the double enzymes of PCR and BamH1/Hind3 Cut, obtain and terminate sub-piece ter；

Wherein, primer sequence is：

ter-Sac：5'gtggagctcagtagatgccgaccggatctgt；

ter-Kpn：5'cagggtacccgccgaattaattcggggga.

(4) HindIII/SacI double digestions are carried out 1300, obtain fragment 1300HS, with 35S and MA1M5T be attached, Clone, obtains 1300-35S-MA1M5.

(5) 1300-35S-MA1M5 is carried out into SacI/KpnI double digestions, is connected with ter, clones, obtained expression AHAS and dash forward The carrier 1300-MA1M5 of variant.

With with above-mentioned steps (1)-(5) same method, with T-MA2M5 as template, obtain expression AHAS mutants load Body 1300-MA2M5.

(6) 1300-MA1M5 and 1300-MA2M5 is proceeded in agrobacterium strains LBA4044 respectively, obtains expression AHAS and dash forward The Plant transformation Agrobacterium of variant proteins.

2. the plant of expression AHAS muteins is obtained

The preparation method of transgenic plant is existing mature technology, and transgenic plant preparation commission Shanghai is rich to pray biotechnology Company limited is carried out.

Carrier 1300-MA1M5 and 1300-MA2M5 are proceeded to into Semen Maydiss, Oryza sativa L. and Cotton Gossypii respectively using agrobacterium-mediated transformation In, obtain transgenic corns M-MA1M5 and M-MA2M5, transgenic paddy rice R-MA1M5 and R-MA2M5, transgene cotton C- MA1M5 and C-MA2M5.

In the transgenic plant for obtaining：Transgenic corns M-MA1M5 and M-MA2M5, transgenic paddy rice R-MA1M5 and R- The seedling stage spray herbicide of MA2M5, transgene cotton C-MA1M5 and C-MA2M5 and correspondence wild-type plant, after ten days, statistics is dead Die rate, as a result referring to table 1.

Table 1

Explanation：* Oryza sativa L. itself has resistance to bispyribac-sodium, can be pushed away by the protein active determination experiment in embodiment 2 The resistance of breaking is not originating from the AHAS muteins of the present invention.

As shown in Table 1, wild-type plant plant is all dead, and transgenic plant is all survived, and illustrates the expression present invention There is the plant of AHAS muteins the polymorphic type herbicides such as anti-imidazolone type, sulfonylurea or pyrimidine carboxylic class to live Property.

<110>Academy of Agricultural Sciences, Shanghai City

<120>Corn protein with antiweed activity, its encoding gene and application

<130> 1711034

<160> 8

<170> PatentIn version 3.5

<210> SEQ ID NO.1

<211> 637

<212> PRT

<213>Semen Maydiss（Zea mays）

<400> 1

Met Ala Thr Ala Ala Thr Ala Ala Ala Ala Leu Thr Gly Ala Thr Thr

1 5 10 15

Ala Thr Pro Lys Ser Arg Arg Arg Ala His His Leu Ala Thr Arg Arg

20 25 30

Ala Leu Ala Ala Pro Ile Arg Cys Ser Ala Leu Ser Arg Ala Thr Pro

35 40 45

Thr Ala Pro Pro Ala Thr Pro Leu Arg Pro Trp Gly Pro Asn Glu Pro

50 55 60

Arg Lys Gly Ser Asp Ile Leu Val Glu Ala Leu Glu Arg Cys Gly Val

65 70 75 80

Arg Asp Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln

85 90 95

Ala Leu Thr Arg Ser Pro Val Ile Ala Asn His Leu Phe Arg His Glu

100 105 110

Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr Ala Arg Ser Ser Gly Arg

115 120 125

Val Gly Val Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val

130 135 140

Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser Val Pro Ile Val Ala Ile

145 150 155 160

Thr Gly Gln Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe Gln Glu

165 170 175

Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His Asn Tyr Leu

180 185 190

Val Leu Asp Val Asp Asp Ile Pro Arg Val Val Gln Glu Ala Phe Phe

195 200 205

Leu Ala Ser Ser Gly Arg Pro Gly Pro Val Leu Val Asp Ile Pro Lys

210 215 220

Asp Ile Gln Gln Gln Met Ala Val Pro Ala Trp Asp Thr Pro Met Ser

225 230 235 240

Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys Pro Pro Ala Thr Glu Phe

245 250 255

Leu Glu Gln Val Leu Arg Leu Val Gly Glu Ser Arg Arg Pro Val Leu

260 265 270

Tyr Val Gly Gly Gly Cys Ala Ala Ser Gly Glu Glu Leu Cys Arg Phe

275 280 285

Val Glu Leu Thr Gly Ile Pro Val Thr Thr Thr Leu Met Gly Leu Gly

290 295 300

Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu Arg Met Leu Gly Met His

305 310 315 320

Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp Lys Ala Asp Leu Leu Leu

325 330 335

Ala Phe Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys Ile Glu Ala

340 345 350

Phe Ala Gly Arg Ala Lys Ile Val His Ile Asp Ile Asp Pro Ala Glu

355 360 365

Ile Gly Lys Asn Lys Gln Pro His Val Ser Ile Cys Ala Asp Val Lys

370 375 380

Leu Ala Leu Gln Gly Met Asn Thr Leu Leu Glu Gly Ser Thr Ser Lys

385 390 395 400

Lys Ser Phe Asp Phe Gly Ser Trp His Asp Glu Leu Asp Gln Gln Lys

405 410 415

Arg Glu Phe Pro Leu Gly Tyr Lys Ile Phe Asn Glu Glu Ile Gln Pro

420 425 430

Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu Thr Lys Gly Lys Ala Ile

435 440 445

Ile Ala Thr Gly Val Gly Gln His Gln Met Trp Ala Ala Gln Tyr Tyr

450 455 460

Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser Ser Ala Gly Leu Gly Ala

465 470 475 480

Met Gly Phe Gly Leu Pro Ala Ala Ala Gly Ala Ala Val Ala Asn Pro

485 490 495

Gly Val Thr Val Val Asp Ile Asp Gly Asp Gly Ser Phe Leu Met Asn

500 505 510

Ile Gln Glu Leu Ala Met Ile Arg Ile Glu Asn Leu Pro Val Lys Val

515 520 525

Phe Val Leu Asn Asn Gln His Leu Gly Met Val Val Gln Glu Asp Arg

530 535 540

Phe Tyr Lys Ala Asn Arg Ala His Thr Phe Leu Gly Asn Pro Glu Asn

545 550 555 560

Glu Ser Glu Ile Tyr Pro Asp Phe Val Ala Ile Ala Lys Gly Phe Asn

565 570 575

Ile Pro Ala Val Arg Val Thr Lys Lys Ser Glu Val His Ala Ala Ile

580 585 590

Lys Lys Met Leu Glu Ala Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val

595 600 605

Pro His Gln Glu His Val Leu Pro Met Ile Pro Ser Gly Gly Ala Phe

610 615 620

Lys Asp Met Ile Leu Asp Gly Asp Gly Arg Thr Val Tyr

625 630 635

<210> SEQ ID NO.2

<211> 637

<212> PRT

<213>Semen Maydiss（Zea mays）

<400> 2

Met Ala Thr Ala Ala Ala Ala Ser Thr Ala Leu Thr Gly Ala Thr Thr

1 5 10 15

Ala Ala Pro Lys Ala Arg Arg Arg Ala His Leu Leu Ala Thr Arg Arg

20 25 30

Ala Leu Ala Ala Pro Ile Arg Cys Ser Ala Ala Ser Pro Ala Met Pro

35 40 45

Met Ala Pro Pro Ala Thr Pro Leu Arg Pro Trp Gly Pro Thr Asp Pro

50 55 60

Arg Lys Gly Ala Asp Ile Leu Val Glu Ser Leu Glu Arg Cys Gly Val

65 70 75 80

Arg Asp Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln

85 90 95

Ala Leu Thr Arg Ser Pro Val Ile Ala Asn His Leu Phe Arg His Glu

100 105 110

Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr Ala Arg Ser Ser Gly Arg

115 120 125

Val Gly Val Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val

130 135 140

Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser Val Pro Met Val Ala Ile

145 150 155 160

Thr Gly Gln Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe Gln Glu

165 170 175

Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His Asn Tyr Leu

180 185 190

Val Leu Asp Val Asp Asp Ile Pro Arg Val Val Gln Glu Ala Phe Phe

195 200 205

Leu Ala Ser Ser Gly Arg Pro Gly Pro Val Leu Val Asp Ile Pro Lys

210 215 220

Asp Ile Gln Gln Gln Met Ala Val Pro Val Trp Asp Lys Pro Met Ser

225 230 235 240

Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys Pro Pro Ala Thr Glu Leu

245 250 255

Leu Glu Gln Val Leu Arg Leu Val Gly Glu Ser Arg Arg Pro Val Leu

260 265 270

Tyr Val Gly Gly Gly Cys Ala Ala Ser Gly Glu Glu Leu Arg Arg Phe

275 280 285

Val Glu Leu Thr Gly Ile Pro Val Thr Thr Thr Leu Met Gly Leu Gly

290 295 300

Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu Arg Met Leu Gly Met His

305 310 315 320

Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp Lys Ala Asp Leu Leu Leu

325 330 335

Ala Leu Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys Ile Glu Ala

340 345 350

Phe Ala Ser Arg Ala Lys Ile Val His Val Asp Ile Asp Pro Ala Glu

355 360 365

Ile Gly Lys Asn Lys Gln Pro His Val Ser Ile Cys Ala Asp Val Lys

370 375 380

Leu Ala Leu Gln Gly Met Asn Ala Leu Leu Glu Gly Ser Thr Ser Lys

385 390 395 400

Lys Ser Phe Asp Phe Gly Ser Trp Asn Asp Glu Leu Asp Gln Gln Lys

405 410 415

Arg Glu Phe Pro Leu Gly Tyr Lys Thr Ser Asn Glu Glu Ile Gln Pro

420 425 430

Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu Thr Lys Gly Glu Ala Ile

435 440 445

Ile Gly Thr Gly Val Gly Gln His Gln Met Trp Ala Ala Gln Tyr Tyr

450 455 460

Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser Ser Ala Gly Leu Gly Ala

465 470 475 480

Met Gly Phe Gly Leu Pro Ala Ala Ala Gly Ala Ser Val Ala Asn Pro

485 490 495

Gly Val Thr Val Val Asp Ile Asp Gly Asp Gly Ser Phe Leu Met Asn

500 505 510

Val Gln Glu Leu Ala Met Ile Arg Ile Glu Asn Leu Pro Val Lys Val

515 520 525

Phe Val Leu Asn Asn Gln His Leu Gly Met Val Val Gln Glu Asp Arg

530 535 540

Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr Leu Gly Asn Pro Glu Asn

545 550 555 560

Glu Ser Glu Ile Tyr Pro Asp Phe Val Thr Ile Ala Lys Gly Phe Asn

565 570 575

Ile Pro Ala Val Arg Val Thr Lys Lys Asn Glu Val Arg Ala Ala Ile

580 585 590

Lys Lys Met Leu Glu Thr Pro Gly Pro Tyr Leu Leu Asp Ile Ile Val

595 600 605

Pro His Gln Glu His Val Leu Pro Met Ile Pro Ser Gly Gly Ala Phe

610 615 620

Lys Asp Met Ile Leu Asp Gly Asp Gly Arg Thr Val Tyr

625 630 635

<210> SEQ ID NO.3

<211> 1914

<212> DNA

<213>Semen Maydiss（Zea mays）

<400> 3

atggccaccg ccgccaccgc ggccgccgcg ctcaccggcg ccactaccgc tacgcccaag 60

tcgaggcgcc gagcccacca cttggccacc cggcgcgccc tcgccgcgcc catcaggtgc 120

tcagcgttgt cacgcgccac gccgacggct cccccggcca ctccgctacg tccgtggggc 180

cccaacgagc cccgcaaggg ctccgacatc ctcgtcgagg ctctcgagcg ctgtggcgtc 240

cgtgacgtct tcgcctaccc cggcggcgca tccatggaga tccaccaggc actcacccgc 300

tcccccgtca tcgccaacca cctcttccgc cacgaacaag gggaggcctt cgccgcctcc 360

ggctacgcgc gctcctcggg ccgcgttggc gtctgcatcg ccacctccgg ccccggcgcc 420

accaacctag tctctgcgct cgcagacgcg ttgctcgact ccgtccccat tgtcgccatc 480

acgggacagg tgccgcgacg catgattggc accgacgcct ttcaggagac gcccatcgtc 540

gaggtcaccc gctccatcac caagcacaac tacctggtcc tcgacgtcga cgacatcccc 600

cgcgtcgtgc aggaggcctt cttcctcgca tcctctggtc gcccggggcc ggtgcttgtt 660

gacatcccca aggacatcca gcagcagatg gcggtgccgg cctgggacac gcccatgagt 720

ctgcctgggt acatcgcgcg ccttcccaag cctcccgcga ctgaatttct tgagcaggtg 780

ctgcgtcttg ttggtgaatc acggcgccct gttctttatg ttggcggtgg ctgtgcagca 840

tcaggtgagg agttgtgccg ctttgtggag ttgactggaa tcccagtcac aactactctt 900

atgggccttg gcaacttccc cagcgacgac ccactgtcac tgcgcatgct tggtatgcat 960

ggcacagtgt atgcaaatta tgcagtggat aaggccgatc tgttgcttgc atttggtgtg 1020

cggtttgatg atcgtgtgac agggaaaatt gaggcttttg caggcagagc taagattgtg 1080

cacattgata ttgatcctgc tgagattggc aagaacaagc agccacatgt gtccatctgt 1140

gcagatgtta agcttgcttt gcagggcatg aatactcttc tggaaggaag cacatcaaag 1200

aagagctttg acttcggctc atggcatgat gaattggatc agcaaaagcg ggagtttccc 1260

cttgggtata aaatcttcaa tgaggaaatc cagccacaat atgctattca ggttcttgat 1320

gagttgacga aggggaaggc catcattgcc acaggtgttg ggcagcacca gatgtgggcg 1380

gcacagtatt acacttacaa gcggccaagg cagtggctgt cttcagctgg tcttggggct 1440

atgggatttg gtttgccggc tgctgctggt gctgctgtgg ccaacccagg tgtcactgtt 1500

gttgacatcg acggagatgg tagcttcctc atgaacattc aggagctagc tatgatccgt 1560

attgagaacc tcccagtcaa ggtctttgtg ctaaacaacc agcacctcgg gatggtggtg 1620

caggaggaca ggttctataa ggccaataga gcacacacat tcttgggaaa cccagagaac 1680

gaaagtgaga tatatccaga ttttgtggca attgccaaag ggttcaacat tccagcagtc 1740

cgtgtgacaa agaagagcga agtccatgca gcaatcaaga agatgcttga ggctccaggg 1800

ccgtacctct tggatataat cgtcccgcac caggagcatg tgttgcctat gatccctagt 1860

ggtggggctt tcaaggatat gatcctggat ggtgatggca ggactgtgta ttga 1914

<210> SEQ ID NO.4

<211> 1914

<212> DNA

<213>Semen Maydiss（Zea mays）

<400> 4

atggccaccg ccgccgccgc gtctaccgcg ctcactggcg ccactaccgc tgcgcccaag 60

gcgaggcgcc gggcgcacct cctggccacc cgccgcgccc tcgccgcgcc catcaggtgc 120

tcagcggcgt cacccgccat gccgatggct cccccggcca ccccgctccg gccgtggggc 180

cccaccgatc cccgcaaggg cgccgacatc ctcgtcgagt ccctcgagcg ctgcggcgtc 240

cgcgacgtct tcgcctaccc cggcggcgcg tccatggaga tccaccaggc actcacccgc 300

tcccccgtca tcgccaacca cctcttccgc cacgagcaag gggaggcctt tgcggcctcc 360

ggctacgcgc gctcctcggg ccgcgtcggc gtctgcatcg ccacctccgg ccccggcgcc 420

accaaccttg tctccgcgct cgccgacgcg ctgctcgatt ccgtccccat ggtcgccatc 480

acgggacagg tgccgcgacg catgattggc accgacgcct tccaggagac gcccatcgtc 540

gaggtcaccc gctccatcac caagcacaac tacctggtcc tcgacgtcga cgacatcccc 600

cgcgtcgtgc aggaggcttt cttcctcgcc tcctctggtc gaccggggcc ggtgcttgtc 660

gacatcccca aggacatcca gcagcagatg gcggtgcctg tctgggacaa gcccatgagt 720

ctgcctgggt acattgcgcg ccttcccaag ccccctgcga ctgagttgct tgagcaggtg 780

ctgcgtcttg ttggtgaatc ccggcgccct gttctttatg ttggcggtgg ctgcgcagca 840

tctggtgagg agttgcgacg ctttgtggag ctgactggaa tcccggtcac aactactctt 900

atgggcctcg gcaacttccc cagcgacgac ccactgtctc tgcgcatgct aggtatgcat 960

ggcacggtgt atgcaaatta tgcagtggat aaggccgatc tgttgcttgc acttggtgtg 1020

cggtttgatg atcgtgtgac agggaagatt gaggcttttg caagcagggc taagattgtg 1080

cacgttgata ttgatccggc tgagattggc aagaacaagc agccacatgt gtccatctgt 1140

gcagatgtta agcttgcttt gcagggcatg aatgctcttc ttgaaggaag cacatcaaag 1200

aagagctttg actttggctc atggaacgat gagttggatc agcagaagag ggaattcccc 1260

cttgggtata aaacatctaa tgaggagatc cagccacaat atgctattca ggttcttgat 1320

gagctgacga aaggcgaggc catcatcggc acaggtgttg ggcagcacca gatgtgggcg 1380

gcacagtact acacttacaa gcggccaagg cagtggttgt cttcagctgg tcttggggct 1440

atgggatttg gtttgccggc tgctgctggt gcttctgtgg ccaacccagg tgttactgtt 1500

gttgacatcg atggagatgg tagctttctc atgaacgttc aggagctagc tatgatccga 1560

attgagaacc tcccggtgaa ggtctttgtg ctaaacaacc agcacctggg gatggtggtg 1620

caggaggaca ggttctataa ggccaacaga gcgcacacat acttgggaaa cccagagaat 1680

gaaagtgaga tatatccaga tttcgtgacg atcgccaaag ggttcaacat tccagcggtc 1740

cgtgtgacaa agaagaacga agtccgcgca gcgataaaga agatgctcga gactccaggg 1800

ccgtacctct tggatataat cgtcccacac caggagcatg tgttgcctat gatccctagt 1860

ggtggggctt tcaaggatat gatcctggat ggtgatggca ggactgtgta ctga 1914

<210> SEQ ID NO.5

<211> 582

<212> PRT

<213>Semen Maydiss（Zea mays）

<400> 5

Leu Arg Pro Trp Gly Pro Asn Glu Pro Arg Lys Gly Ser Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Val Arg Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Ala Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ser Ser Gly Arg Val Gly Val Cys Ile Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Val Pro Ile Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Asp Asp Ile

130 135 140

Pro Arg Val Val Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Ala Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ala Thr Glu Phe Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Val Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Cys Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Gly Arg Ala Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Met Asn

325 330 335

Thr Leu Leu Glu Gly Ser Thr Ser Lys Lys Ser Phe Asp Phe Gly Ser

340 345 350

Trp His Asp Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr

355 360 365

Lys Ile Phe Asn Glu Glu Ile Gln Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Lys Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Met Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Phe Val Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

485 490 495

His Thr Phe Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

500 505 510

Phe Val Ala Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr

515 520 525

Lys Lys Ser Glu Val His Ala Ala Ile Lys Lys Met Leu Glu Ala Pro

530 535 540

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

545 550 555 560

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly

565 570 575

Asp Gly Arg Thr Val Tyr

580

<210> SEQ ID NO.6

<211> 582

<212> PRT

<213>Semen Maydiss（Zea mays）

<400> 6

Leu Arg Pro Trp Gly Pro Thr Asp Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ser Leu Glu Arg Cys Gly Val Arg Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Ala Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ser Ser Gly Arg Val Gly Val Cys Ile Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Val Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Asp Asp Ile

130 135 140

Pro Arg Val Val Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Val Trp Asp Lys Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ala Thr Glu Leu Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Val Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Leu Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ala Lys Ile

290 295 300

Val His Val Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Met Asn

325 330 335

Ala Leu Leu Glu Gly Ser Thr Ser Lys Lys Ser Phe Asp Phe Gly Ser

340 345 350

Trp Asn Asp Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Tyr

355 360 365

Lys Thr Ser Asn Glu Glu Ile Gln Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Gly Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ala Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ser Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Val Gln Glu Leu Ala Met Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Phe Val Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

485 490 495

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

500 505 510

Phe Val Thr Ile Ala Lys Gly Phe Asn Ile Pro Ala Val Arg Val Thr

515 520 525

Lys Lys Asn Glu Val Arg Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

530 535 540

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

545 550 555 560

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Leu Asp Gly

565 570 575

Asp Gly Arg Thr Val Tyr

580

<210> SEQ ID NO.7

<211> 1749

<212> DNA

<213>Semen Maydiss（Zea mays）

<400> 7

ctacgtccgt ggggccccaa cgagccccgc aagggctccg acatcctcgt cgaggctctc 60

gagcgctgtg gcgtccgtga cgtcttcgcc taccccggcg gcgcatccat ggagatccac 120

caggcactca cccgctcccc cgtcatcgcc aaccacctct tccgccacga acaaggggag 180

gccttcgccg cctccggcta cgcgcgctcc tcgggccgcg ttggcgtctg catcgccacc 240

tccggccccg gcgccaccaa cctagtctct gcgctcgcag acgcgttgct cgactccgtc 300

cccattgtcg ccatcacggg acaggtgccg cgacgcatga ttggcaccga cgcctttcag 360

gagacgccca tcgtcgaggt cacccgctcc atcaccaagc acaactacct ggtcctcgac 420

gtcgacgaca tcccccgcgt cgtgcaggag gccttcttcc tcgcatcctc tggtcgcccg 480

gggccggtgc ttgttgacat ccccaaggac atccagcagc agatggcggt gccggcctgg 540

gacacgccca tgagtctgcc tgggtacatc gcgcgccttc ccaagcctcc cgcgactgaa 600

tttcttgagc aggtgctgcg tcttgttggt gaatcacggc gccctgttct ttatgttggc 660

ggtggctgtg cagcatcagg tgaggagttg tgccgctttg tggagttgac tggaatccca 720

gtcacaacta ctcttatggg ccttggcaac ttccccagcg acgacccact gtcactgcgc 780

atgcttggta tgcatggcac agtgtatgca aattatgcag tggataaggc cgatctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgacaggga aaattgaggc ttttgcaggc 900

agagctaaga ttgtgcacat tgatattgat cctgctgaga ttggcaagaa caagcagcca 960

catgtgtcca tctgtgcaga tgttaagctt gctttgcagg gcatgaatac tcttctggaa 1020

ggaagcacat caaagaagag ctttgacttc ggctcatggc atgatgaatt ggatcagcaa 1080

aagcgggagt ttccccttgg gtataaaatc ttcaatgagg aaatccagcc acaatatgct 1140

attcaggttc ttgatgagtt gacgaagggg aaggccatca ttgccacagg tgttgggcag 1200

caccagatgt gggcggcaca gtattacact tacaagcggc caaggcagtg gctgtcttca 1260

gctggtcttg gggctatggg atttggtttg ccggctgctg ctggtgctgc tgtggccaac 1320

ccaggtgtca ctgttgttga catcgacgga gatggtagct tcctcatgaa cattcaggag 1380

ctagctatga tccgtattga gaacctccca gtcaaggtct ttgtgctaaa caaccagcac 1440

ctcgggatgg tggtgcagga ggacaggttc tataaggcca atagagcaca cacattcttg 1500

ggaaacccag agaacgaaag tgagatatat ccagattttg tggcaattgc caaagggttc 1560

aacattccag cagtccgtgt gacaaagaag agcgaagtcc atgcagcaat caagaagatg 1620

cttgaggctc cagggccgta cctcttggat ataatcgtcc cgcaccagga gcatgtgttg 1680

cctatgatcc ctagtggtgg ggctttcaag gatatgatcc tggatggtga tggcaggact 1740

gtgtattga 1749

<210> SEQ ID NO.8

<211> 1749

<212> DNA

<213>Semen Maydiss（Zea mays）

<400> 8

ctccggccgt ggggccccac cgatccccgc aagggcgccg acatcctcgt cgagtccctc 60

gagcgctgcg gcgtccgcga cgtcttcgcc taccccggcg gcgcgtccat ggagatccac 120

caggcactca cccgctcccc cgtcatcgcc aaccacctct tccgccacga gcaaggggag 180

gcctttgcgg cctccggcta cgcgcgctcc tcgggccgcg tcggcgtctg catcgccacc 240

tccggccccg gcgccaccaa ccttgtctcc gcgctcgccg acgcgctgct cgattccgtc 300

cccatggtcg ccatcacggg acaggtgccg cgacgcatga ttggcaccga cgccttccag 360

gagacgccca tcgtcgaggt cacccgctcc atcaccaagc acaactacct ggtcctcgac 420

gtcgacgaca tcccccgcgt cgtgcaggag gctttcttcc tcgcctcctc tggtcgaccg 480

gggccggtgc ttgtcgacat ccccaaggac atccagcagc agatggcggt gcctgtctgg 540

gacaagccca tgagtctgcc tgggtacatt gcgcgccttc ccaagccccc tgcgactgag 600

ttgcttgagc aggtgctgcg tcttgttggt gaatcccggc gccctgttct ttatgttggc 660

ggtggctgcg cagcatctgg tgaggagttg cgacgctttg tggagctgac tggaatcccg 720

gtcacaacta ctcttatggg cctcggcaac ttccccagcg acgacccact gtctctgcgc 780

atgctaggta tgcatggcac ggtgtatgca aattatgcag tggataaggc cgatctgttg 840

cttgcacttg gtgtgcggtt tgatgatcgt gtgacaggga agattgaggc ttttgcaagc 900

agggctaaga ttgtgcacgt tgatattgat ccggctgaga ttggcaagaa caagcagcca 960

catgtgtcca tctgtgcaga tgttaagctt gctttgcagg gcatgaatgc tcttcttgaa 1020

ggaagcacat caaagaagag ctttgacttt ggctcatgga acgatgagtt ggatcagcag 1080

aagagggaat tcccccttgg gtataaaaca tctaatgagg agatccagcc acaatatgct 1140

attcaggttc ttgatgagct gacgaaaggc gaggccatca tcggcacagg tgttgggcag 1200

caccagatgt gggcggcaca gtactacact tacaagcggc caaggcagtg gttgtcttca 1260

gctggtcttg gggctatggg atttggtttg ccggctgctg ctggtgcttc tgtggccaac 1320

ccaggtgtta ctgttgttga catcgatgga gatggtagct ttctcatgaa cgttcaggag 1380

ctagctatga tccgaattga gaacctcccg gtgaaggtct ttgtgctaaa caaccagcac 1440

ctggggatgg tggtgcagga ggacaggttc tataaggcca acagagcgca cacatacttg 1500

ggaaacccag agaatgaaag tgagatatat ccagatttcg tgacgatcgc caaagggttc 1560

aacattccag cggtccgtgt gacaaagaag aacgaagtcc gcgcagcgat aaagaagatg 1620

ctcgagactc cagggccgta cctcttggat ataatcgtcc cacaccagga gcatgtgttg 1680

cctatgatcc ctagtggtgg ggctttcaag gatatgatcc tggatggtga tggcaggact 1740

gtgtactga 1749

Claims

1. there is the corn protein of antiweed activity, which is the mutein of maize acetyl hydroxyl acid enzyme, its Aminoacid sequence is as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.5 or SEQ ID No.6.

2. there is the gene of antiweed activity, which is the nucleotide sequence for encoding protein described in claim 1.

3. there is the gene of antiweed activity as claimed in claim 2, it is characterised in that the aminoacid sequence such as SEQ The nucleotide sequence of the corn protein shown in ID No.1 is as shown in SEQ ID No.3, or aminoacid sequence such as SEQ ID The nucleotide sequence of the corn protein shown in No.2 is as shown in SEQ ID No.4, or aminoacid sequence such as SEQ ID No.5 The nucleotide sequence of shown corn protein is as shown in SEQ ID No.7, or aminoacid sequence is as shown in SEQ ID No.6 Corn protein nucleotide sequence as shown in SEQ ID No.8.

4. there is the corn protein of antiweed activity to be used to cultivate anti-imidazolone type, sulfonylureas as claimed in claim 1 Class and miazines herbicide plant.

5. a kind of method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant, including by claim 1 The encoding gene of the corn protein is transformed in plant, makes the plant produce the maize acetyl with antiweed activity The mutein of hydroxyl acid enzyme.

6. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the nucleotide sequence such as SEQ ID No.3 of the encoding gene, SEQ ID No.4, SEQ ID No.7 or SEQ ID Shown in No.8.

7. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the imidazolinone herbicide is at least one in imazethapyr, imazamox and imazapic.

8. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the sulfonylurea herbicide be that chlorine sulphur is grand and sulfometuronmethyl at least one.

9. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the miazines herbicide is bispyribac-sodium.

10. anti-imidazolone type, sulfonylurea and miazines herbicide plant are obtained according to any one of claim 5-9 Method, it is characterised in that the plant is Semen Maydiss, Oryza sativa L. or Cotton Gossypii.