CN106636027A

CN106636027A - Wheat protein with herbicide resisting activity as well as coding gene and application thereof

Info

Publication number: CN106636027A
Application number: CN201710069306.6A
Authority: CN
Inventors: 方军; 朴钟泽; 万常照; 白建江; 杨瑞芳
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2017-02-08
Filing date: 2017-02-08
Publication date: 2017-05-10

Abstract

The invention provides a wheat protein with herbicide resisting activity as well as a coding gene and application thereof. The wheat protein is a mutant protein of wheat acetohydroxy acid synthase, and the amino acid sequence is shown as SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3; the protein is derived from expression of a acetohydroxy acid synthase gene of a wheat No.6 chromosome 6A, 6B or 6D and is obtained by carrying out in-vitro mutation on the wheat acetohydroxy acid synthase; the amino acid sequence has the characteristics that compared with a wild type, the No.6 chromosomes 6A, 6B and 6D do not have a Trp551 site amino acid, a Trp550 site amino acid and a Trp548 site amino acid respectively; the mutant protein has resistance on a plurality of types of herbicides including an imidazolinone type, a sulfonylurea type and a pyrimidine type and the like; coding gene transformed plants have the activity of resisting the plurality of types of herbicides including the imidazolinone type, the sulfonylurea type and the pyrimidine type and the like.

Description

Aleuronat with antiweed activity, its encoding gene and application

Technical field

The invention belongs to herbicide resistant protein matter field, and in particular to antiweed activity aleuronat, its Encoding gene and its application.

Background technology

Semen Tritici aestivi is one of four big staple food grain crop of China (other staple food grains are Oryza sativa L., Semen Maydiss, Rhizoma Solani tuber osi), and yield concerns the steady of country Fixed and safety.But, weeds are won honour for, strive fertilizer, strive water with Semen Tritici aestivi, cause the Wheat Production underproduction, or even total crop failure.

Grassy weed, such as Triticum tauschii, Herba bromi japonici, wild oat, annual bluegrass etc. belong to not of the same race, more year life or together with Semen Tritici aestivi Nian Sheng, formalness seedling stage, Adult plant are very much like with Semen Tritici aestivi, especially grow early stage and are difficult to recognize.In recent years, by Warm, lack the reasons such as no-tillage area expansion in winter climate, weeds of wheat occurrence injury increases, Wheat Production is constituted sternly Threaten again, and the gesture that harm is spread in extension.Plantation antiweed Semen Tritici aestivi can simply, economy, efficiently solve in wheat paddock The harm of weeds.

Antiweed Acetohydroxyacid synthase (acetohydroxy acid synthase, the abbreviation of wheat endogenous AHAS) protein is produced by ahas gene mutation.Antiweed AHAS protein is produced by ahas gene mutation, expresses anti-weeding Agent AHAS protein can make plant obtain Tolerance To Herbicides, solve the weed problem in field.AHAS protein mainly divides Cloth is there's almost no in microorganism and plant in animal, and AHAS suppresses herbicide to person poultry harmless.

But, Semen Tritici aestivi is heterologous 6 times of body plants, and the homology and heterologouss of gene is more complicated, at present, both at home and abroad to little The research and development of wheat gene function lag far behind 2 times of body plants such as Oryza sativa L., Semen Maydiss, wherein, wheat endogenous herbicide resistant protein matter is ground Study carefully very few.Therefore, excavate and study the Semen Tritici aestivi AHAS protein with antiweed activity and there is good novelty and economy Value.

At present, cultivate anti-AHAS to suppress the method for herbicide Semen Tritici aestivi is to carry out chemistry as material with wheat seed or plant Or physical mutagenesis, carry out genome mutation in plant body.This method obtains the test period length of antiweed Semen Maydiss and (is more than 5 years), obtain new mutant it is difficult (mutation result is the replacement that the single base change of nucleotide causes single amino acids, easily with The mutation that Jing is present repeats), and chance of success little (generally mutation success rate is less than hundred a ten thousandths), many laboratorys are carried out Research and development for many years cannot obtain new mutant.

The content of the invention

It is an object of the invention to provide the aleuronat with antiweed activity, its encoding gene and its application, Which is the Semen Tritici aestivi AHAS muteins of anti-polymorphic type herbicidal activity, and the protein has anti-imidazolone type, sulfonylureas The activity of the polymorphic type herbicide such as class or miazines, the plant of its encoding gene conversion have anti-imidazolone type, sulfonylureas The activity of the polymorphic type herbicide such as class or miazines.

Different from the acid substitution mutations body for being obtained by vivo mutations at present, the present invention adopts amino acid deletion plan Slightly, by being mutated outside genosome, Semen Tritici aestivi AHAS protein is transformed, obtains Semen Tritici aestivi AHAS muteins so as to removed with anti- Careless agent activity.

In order to achieve the above object, the present invention provides following technical scheme：

Aleuronat with antiweed activity, which is the mutein of Semen Tritici aestivi Acetohydroxyacid synthase, Its aminoacid sequence such as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.7, SEQ ID No.8 or Shown in SEQ ID No.9.

Anti- weeding of its aminoacid sequence as shown in SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3 of the invention The aleuronat of agent activity is precursor full length protein, becomes maturation protein after the precursor full length protein erasure signal peptide Matter, corresponding to the aminoacid system of the precursor full length protein as shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3 Row, the aminoacid sequence of mature protein is respectively as shown in SEQ ID No.7, SEQ ID No.8 and SEQ ID No.10.

Gene with antiweed activity, which is the nucleoside of the coding aleuronat with antiweed activity Acid sequence.

Further, the nucleotide sequence such as SEQ of aleuronat of the aminoacid sequence as shown in SEQ ID No.1 Shown in ID No.4, or the nucleotide sequence such as SEQ ID of aleuronat of the aminoacid sequence as shown in SEQ ID No.2 Shown in No.5, or the nucleotide sequence such as SEQ ID No.6 of aleuronat of the aminoacid sequence as shown in SEQ ID No.3 It is shown, or the nucleotide sequence of aleuronat of the aminoacid sequence as shown in SEQ ID No.7 such as SEQ ID No.10 institutes Show, or the nucleotide sequence of aleuronat of the aminoacid sequence as shown in SEQ ID No.8 be as shown in SEQ ID No.11, Or the nucleotide sequence of aleuronat of the aminoacid sequence as shown in SEQ ID No.9 is as shown in SEQ ID No.12.

Protein with antiweed activity of the present invention is used to cultivate anti-imidazolone type, sulfonylurea and pyrimidine Class herbicide plant.

A kind of method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant, including by the Semen Tritici aestivi The encoding gene of AHAS muteins is transformed in plant, makes the plant produce the Semen Tritici aestivi with antiweed activity AHAS muteins.

Preferably, the nucleotide sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.1 is such as Shown in SEQ ID No.4, the nucleotide sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.2 is such as Shown in SEQ ID No.5, the nucleotide sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.3 is such as Shown in SEQ ID No.6, the nucleotide sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.7 is such as Shown in SEQ ID No.10, the nucleotide sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.8 As shown in SEQ ID No.11, the nucleotides sequence of aminoacid sequence encoding gene of aleuronat as shown in SEQ ID No.9 Row are as shown in SEQ ID No.12.

Further, the imidazolinone herbicide is not imazethapyr, imazamox or imazapic, but not It is limited to this several imidazolinone herbicide.

Also, the sulfonylurea herbicide is sulfometuronmethyl, but it is not limited to this sulfonylurea herbicide.

Preferably, the miazines herbicide is bispyribac-sodium, but is not limited to this miazines herbicide.

Further, the plant is Semen Tritici aestivi, Semen Maydiss or Cotton Gossypii.

The protein of antiweed activity of the present invention, the protein is ahas genes in Semen Tritici aestivi No. 6 chromosomes 6A, 6B, 6D Through engineered Semen Tritici aestivi AHAS muteins in expression, the expression of ahas genes in Wheat volatiles is come from, by open country Raw type Semen Tritici aestivi AHAS by external mutation, the characteristics of obtain Semen Tritici aestivi AHAS muteins, its aminoacid sequence is：Expression dye The aminoacid sequence of colour solid 6A mutant genes lacks Trp551 site amino acids compared with wild-type wheat AHAS.Expression dyeing The aminoacid sequence of body 6B mutant genes lacks Trp550 site amino acids compared with wild-type wheat AHAS, expresses chromosome The sequence of 6D mutant gene aminoacid lacks Trp548 site amino acids, these mutant eggs compared with wild-type wheat AHAS White matter has resistance to the polymorphic type herbicide such as imidazolone type, sulfonylurea and miazines.

In the present invention, express No. 6 chromosome 6A mutant genes of Semen Tritici aestivi aminoacid sequence as shown in SEQ ID No.1, its The aminoacid sequence of mature protein is as shown in SEQ ID No.7；The aminoacid sequence of expression No. 6 chromosome 6B mutant genes of Semen Tritici aestivi , as shown in SEQ ID No.2, the aminoacid sequence of its mature protein is as shown in SEQ ID No.8 for row；No. 6 dyeing of expression Semen Tritici aestivi The aminoacid sequence of body 6D mutant genes as shown in SEQ ID No.3, the aminoacid sequence such as SEQ ID of its mature protein Shown in No.9.

The AHAS mutant code gene transformation that the present invention is obtained in plant is expressed in plant, is made plant In contain AHAS muteins, can make plant that there is the polymorphic types such as anti-imidazolone type, sulfonylurea and pyrimidine carboxylic class The activity of herbicide.

The nucleotide sequence of the AHAS mutant code genes of the present invention is not limited to wheat endogenous sequence, including described in expression The synthetic nucleotide sequence of protein.

AHAS mutants are expressed in Semen Tritici aestivi, Semen Maydiss or Cotton Gossypii, transgenic wheat W-WA1M5, W-WA2M5, W- is obtained WA3M5, transgenic corns M-WA1M5, M-WA2M5, M-WA3M5, transgene cotton C-WA1M5, C-WA2M5, C-WA3M5, Transgenic plant and wild-type plant seedling stage spray the polymorphic type weedings such as anti-imidazolone type, sulfonylurea or pyrimidine carboxylic class Agent, wild-type plant plant are all dead, and transgenic plant is all survived.Illustrate to express the plant of Semen Tritici aestivi AHAS mutants of the present invention Thing has the polymorphic type herbicidal activities such as anti-imidazolone type, sulfonylurea or pyrimidine carboxylic class.

Compared with prior art, the present invention has the advantages that：

1) present invention adopts aminoacid deletion strategy, carries out rite-directed mutagenesises to aminoacid, can be prominent after aminoacid to deleting Variant proteins carry out external antiweed determination of activity, provide to develop more new antiweed AHAS muteins Basis, with simple to operate, screening process is simple, strong innovation the advantages of, excavated wheat endogenous anti-herbicide gene, increased The species of anti-herbicide gene.

2) AHAS muteins of the invention are obtained by external mutation, and external mutation is with designability By force, the incomparable advantage of vivo mutations such as short, strong innovation of test period, obtained the mutant time less than 2 months, meanwhile, Designed by specific mutation, it is to avoid repeat with AHAS muteins are reported.

3) after express the encoding gene of AHSA muteins of the present invention, the AHAS total length muteins of acquisition The polymorphic types such as anti-imidazolone type, sulfonylurea and pyrimidine carboxylic class are respectively provided with AHAS no signal peptide Ripening Mutant protein The activity of herbicide.

Description of the drawings

Fig. 1 is the AHAS protein S DS-PAGE electrophoretograms in the embodiment of the present invention 1 after purification；

Wherein, swimming lane 1：WA1M5S protein after purification；Swimming lane 2：WA2M5S protein after purification；Swimming lane 3：Purification WA3M5S protein afterwards；Swimming lane 4：WA1WS protein after purification；Swimming lane 5：WA2WS protein after purification；Swimming lane 6：It is pure WA3WS protein after change；Mk：Protein Marker, molecular weight are marked on the diagram.

Fig. 2-Fig. 3 is WA1M5S, WA2M5S, WA3M5S and its control WA1WS, WA2WS, WA3WS in the embodiment of the present invention 2 Resistance curve chart to imidazolinone herbicide (imazethapyr and imazamox).

Fig. 4 is WA1M5S, WA2M5S, WA3M5S in the embodiment of the present invention 2 and its control WA1WS, WA2WS, WA3WS to phonetic The resistance curve chart of pyridine carboxylic acidss herbicide (bispyribac-sodium).

Fig. 5 is WA1M5S, WA2M5S, WA3M5S in the embodiment of the present invention 2 and its control WA1WS, WA2WS, WA3WS to sulphur The resistance curve chart of sulfonylurea herbicide (sulfometuronmethyl).

Specific embodiment

Below in conjunction with specific embodiment, the invention will be further described.

In following examples, if no special instructions for《Molecular Cloning:A Laboratory guide》(Science Press, 2002) is remembered Support method.

Primer synthesizes and be sequenced student on commission's work Shanghai biological engineering limited company to be carried out, and reagent, bacterial strain, carrier etc. are real Test articles for use to buy from Hangzhou biotech company of Sigma.

Imidazoles cigarette acetic acid herbicide is " bean agrees " that Shandong first reaches company, and diluted concentration is 200 times of dilution.Methyl miaow grass " hundred ridges lead to " of the cigarette herbicide for BASF Aktiengesellschaft, diluted concentration is 1000 times of dilution.Imazamox herbicide is U.S. " the golden bean " of cyanamide company of state, diluted concentration are 100 times of dilution." gloomy grass of the sulfometuronmethyl herbicide for Jiangsu Rui Bang insecticide factories Only ", diluted concentration is 5000 times of dilution." double grass of the bispyribac-sodium herbicide for Jiangsu Institute of Econones Co., Ltd. Ether ", diluted concentration are 1000 times of dilution.

Embodiment 1 is deleted Trp551 (6A)/Trp550 (6B)/Trp548 (6D) AHAS in obtaining No. 6 chromosomes of Semen Tritici aestivi and is dashed forward The method of variant proteins, comprises the following steps：

1. the Semen Tritici aestivi ahas genes for deleting Trp551 (6A)/Trp550 (6B)/Trp548 (6D) base acid are built

1.1 build the Semen Tritici aestivi ahas1 genes for deleting Trp551 (6A) aminoacid

(1) the DNA pieces at AHAS1 places by the method for many Polymerization chain reactions (PCR), are amplified from Wheat volatiles Section A6A (public database NCBI serial numbers：3996-7551 in TGACv1 473240_6AL), separated by sepharose electrophoresis, It is purified into PCR primer, i.e. A6A.

Wherein, entering the performing PCR primer that uses of reaction is：

CH6AL-F：5’tttgtgtcgttttatactggtatag；

CH6AL-R：5’atcggtgtgacttagaatcggggtc.

PCR reaction systems are：2 × exo+ polymerase premixed liquid, 50 μ l, 4 μ l of primer CH6AL-F (10 μM), primer 4 μ l of CH6AL-R (10 μM), 41 μ l of 1 μ l of wild-type wheat genomic DNA and deionized water, cumulative volume are 100 μ l.

PCR programs：A) 95 DEG C, 10 minutes；B) 95 DEG C, 40 seconds；C) 52 DEG C, 40 seconds；D) 68 DEG C, 2 minutes；E) circulation step 2-4,25 times；F) 68 DEG C, 10 minutes；G) 16 DEG C, preserve.

With A6A as template, using primer 6AL F and TA A1EcoR, ahas1 gene wa1w (NCBI serial numbers are amplified： 4575-6520 in TGACv1 473240_6AL), PCR primer is carried out into T clones (pGEMT, Promega companies of the U.S.), is obtained T-WA1W。

Wherein, in PCR reaction systems and program, outside removing template and primer, other conditions are ibid.

The particular sequence of primer is：

6AL F：5’ccatggccgccgccacctcccccgc；

TA A1EcoR：5’gaattctcagtacgaggtcctgccatcaccc.

(2) with T-WA1W as template, using primer 6AL 551WF and 6AL 551WR, enter performing PCR reaction, by PCR primer T clones are carried out, the mutant clone T-WA1M5 for deleting Trp551 (6A) aminoacid is obtained.

Wherein, in PCR reaction systems and program, removing template and outer other conditions of primer are identical with step (1).

The particular sequence of primer is：

6AL 551WF：5’catctgggaatggtggtgcaagaggataggttttacaaggcc；

6AL 551WR：5’ggccttgtaaaacctatcctcttgcaccaccattcccagatg.

Wherein, as shown in SEQ ID NO.4, aminoacid sequence is as shown in SEQ ID NO.1 for the DNA sequence of WA1M5.

1.2 build the Semen Tritici aestivi ahas2 genes for deleting Trp550 (6B) aminoacid

Step identical PCR side in the Semen Tritici aestivi ahas1 genes for delete Trp551 (6A) aminoacid is built using with above-mentioned 1.1 Method, amplifies DNA fragmentation B6A (the NCBI sequences at ahas2 places from Wheat volatiles using primer CH6BL-F and CH6BL-R Number：40831-44374 in TGACv1 500462_6BL), then with B6A as template, using primer 6BL F and TA A1EcoR, enter Performing PCR reacts, and amplifies ahas2 gene wa2w (NCBI serial numbers：42182-44124 in TGACv1 500462), PCR is produced Thing carries out T clones, obtains T-WA2W, then with T-WA2W as template, using primer 6BL 550WF and 6BL 550WR, enters performing PCR PCR primer is carried out T clones by reaction, obtains the mutant clone T-WA2M5 for deleting Trp550 (6B) aminoacid, wherein, , as shown in SEQ ID NO.5, aminoacid sequence is as shown in SEQ ID NO.2 for the DNA sequence of WA2M5.

Wherein, when expanding B6A, the particular sequence of the primer CH6BL-F and CH6BL-R that use is as follows：

CH6BL-F：5’ccacaaccgcgagtggaaatacc；

CH6BL-R：5’catgaagcaggaaaaagggat.

Wherein, when expanding ahas2 gene wa2w, the primer 6BL F particular sequences for using are as follows：

6BL F:5’ccatggccgcagccacctcccccgc；

Wherein, when the mutant WA2M5 of Trp550 aminoacid is deleted in amplification, primer the 6BL 550WF and 6BL for using 550WR particular sequences are as follows：

6BL 550WF：5’catctgggaatggtggtgcaggaggataggttttacaaggcc；

6BL 550WR：5’ggccttgtaaaacctatcctcctgcaccaccattcccagatg.

1.3 build the Semen Tritici aestivi ahas3 genes for deleting Trp548 (6D) aminoacid

Identical PCR side in the Semen Tritici aestivi ahas1 genes for delete Trp551 (6A) aminoacid is built using with above-mentioned steps 1.1 Method, using primer CH6DL-F and CH6DL-R, amplifies DNA fragmentation D6A (the NCBI sequences at ahas3 places from Wheat volatiles Row number：28689-32840 in TGACv1 527727_6DL), D6A is template, using primer 6AL F and TA A1EcoR (referring to Step (1) in the present embodiment 1.1), amplify ahas3 gene wa3w (NCBI serial numbers：In TGACv1 527727_6DL 29526-31462), PCR primer is carried out into T clones, obtains T-WA3W, then with T-WA3W as template, using primer 6AL 551WF With 6AL 551WR (particular sequence is referring to 1.1 steps (2) in the present embodiment), enters performing PCR reaction, PCR primer carried out into T clones, Obtain delete Trp548 aminoacid mutant clone T-WA3M5, wherein, the DNA sequence of WA3M5 as shown in SEQ ID NO.6, Aminoacid sequence is as shown in SEQ ID NO.3.

Wherein, during amplification of DNA fragments D6A, the particular sequence of primer CH6DL-F and CH6DL-R used is：

CH6DL-F：5’gtgtaaaagtagacatgtgtt；

CH6DL-R：5’tgcgaccccccacaacacccg.

2. expression, the Semen Tritici aestivi AHAS mature proteins of purification erasure signal peptide

(1) T-WA1W obtained with above-mentioned steps 1.1, is carried out as template using primer 6AL BamF and TA A1EcoR PCR reacts, and PCR primer is carried out T clones, obtains wa1w gene clonings T-MA1WS of erasure signal peptide.

Wherein, in PCR reaction systems and program, outer other conditions of removing template and primer ibid, primer 6AL BamF：Tool Body sequence is：

6AL BamF：5’ggatccacaatgctccggccctggggcccgtccgag；

(2) protein expression vector is built, WA1WS is cloned into into pGEX4T2, obtain expression no signal peptide AHAS wild types The carrier 4T2-WA1WS of protein.

(3) the carrier 4T2-WA1WS of expression no signal peptide AHAS wild-type proteins is proceeded to into expression strain Rosetta In, centrifugation is obtained supernatant by GST posts by culture, harvesting, ultrasonic disruption cell, cleans GST posts, eluting, finally Obtain ripe wild-type protein WA1WS.

With with 2 (1) -2 (3) identical method of above-mentioned steps, respectively with obtain in above-mentioned steps 1 T-WA2W, T-WA3W, T-WA1M5, T-WA2M5 and T-WA3M5 are template, enter performing PCR reaction using corresponding primer, PCR primer is carried out T gram It is grand, protein expression vector is built, the expression maturation AHAS wild-type protein carrier 4T2-WA2WS of no signal peptide are obtained respectively With the expression maturation AHAS mutein carrier 4T2- of 4T2-WA3WS, no signal peptide and deletion Trp551 (6A) aminoacid The expression maturation AHAS mutein carrier 4T2-WA2M5S of WA1M5S, no signal peptide and deletion Trp550 (6B) aminoacid And the expression maturation AHAS mutein carrier 4T2-WA3M5S of no signal peptide and deletion Trp548 (6D) aminoacid, then Above-mentioned expression vector is expressed by expression strain Rosetta respectively, the ripe wild type of corresponding no signal peptide is obtained The ripe AHAS mutant proteins WA1M5S of protein WA2WS and WA3WS, no signal peptide and deletion Trp551 aminoacid, its Aminoacid sequence as shown in SEQ ID NO.7, DNA sequence is as shown in SEQ ID NO.10, no signal peptide and delete Trp550 The ripe AHAS mutant proteins WA2M5S of aminoacid, its aminoacid sequence as shown in SEQ ID NO.8, DNA sequence such as SEQ Shown in ID NO.11, no signal peptide and the ripe AHAS mutant proteins WA3M5S of Trp548 aminoacid is deleted, its aminoacid , as shown in SEQ ID NO.9, DNA sequence is as shown in SEQ ID NO.12 for sequence.

Wherein, with T-WA2W as template expanded when, the primer for using be 6BL BamF and TA A1EcoR, primer 6BL The particular sequence of BamF is：

6BL BamF：5’ggatccacaatgctccggccgtggggcccctccgag；

With T-WA3W as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

With T-WA1M5 as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

With T-WA2M5 as template expanded when, the primer for using be 6BL BamF and TA A1EcoR.

With T-WA3M5 as template expanded when, the primer for using be 6AL BamF and TA A1EcoR.

Wild-type protein WA1WS, WA2WS and the WA3WS that will be obtained, and mutein WA1M5S, WA2M5S And WA3M5S, SDS-PAGE electrophoresis detection is carried out, protein adhesive is obtained, protein adhesive is referring to Fig. 1.

As seen from Figure 1, the AHAS protein in swimming lane 1 to swimming lane 6 has obvious band in 90kDa positions, this position with Protein theory size is consistent.Additionally, the protein band accounts for major portion in the protein band of whole swimming lane, illustrate logical Cross step 2 and obtain highly purified AHAS protein.

Embodiment 2 detects the resistance of AHAS mutant protein confrontation herbicides

It is wild with Semen Tritici aestivi AHAS variant proteins WA1M5S, WA2M5S and WA3M5S of the acquisition of embodiment 1, and AHAS respectively Raw type protein WA1WS, WA2WS and WA3WS are detection main body, and water is that blank is processed, with concentration in 0-100 μM of difference Kind herbicide (imidazoles cigarette acetic acid, imazamox, sulfometuronmethyl, bispyribac-sodium) is influence factor, carries out antiweed biological Determine.

Solution reaction system is configured in 2ml centrifuge tubes：450 μ l measure buffer, 10 μ l AHAS protein (WA1M5S, WA2M5S, WA3M5S, WA1WS, WA2WS or WA3WS, 0.5 μ g/ μ l), 40 μ l influence factor's solution (water is blank process, Herbicide is influence factor), 500 μ l of cumulative volume.

AHAS determination of activity buffer：100mM Sodium Pyruvates, 10mM magnesium chlorides, 1mM TPP, 50 μM of FAD, 50mM phosphoric acid Salt, pH7.4.

Response procedures：Centrifuge tube containing different affecting factors reaction system is placed in 37 DEG C to react 1 hour；20 μ l30% Sulphuric acid terminating reaction.60 DEG C are reacted 0.5 hour；250 μ l, 1.7% alpha-Naphthols are added, 0.17% creatine, 60 DEG C of colour developings 0.5 are little When.200 μ l are taken out from centrifuge tube, solution of the detection containing different affecting factors is in 525nm absorbances.

Testing result：With herbicide concentration as the wild-type protein WA1WS process of 0 (influence factor's solution is compareed for water) 525nm absorbances be 100% active, calculate the activity of wild type and mutein under the conditions of different affecting factors Ratio, draws curve chart, as a result referring to Fig. 2-Fig. 5.

From Fig. 2-Fig. 5, with the increasing of the polymorphic type herbicides such as imidazolone type, sulfonylurea or pyrimidine carboxylic class Plus, WA1WS, WA2WS, WA3WS activity is reduced to 0；And WA1M5S, WA2M5S, WA3M5S activity in high concentration herbicide according to 100% is remained close to so active.Therefore, WA1M5S, WA2M5S, WA3M5S are to imidazolone type, sulfonylurea or pyrimidine carboxylic The polymorphic type herbicide such as acids has resistance.

Conversion and expression of the 3 Semen Tritici aestivi ahas mutant genes of embodiment in plant

In order to AHAS muteins are expressed in unifacial leaf and dicotyledon, with (the letter of 1300 carriers of pCambia 1300) being called carrier, AHAS Expression elements being built with Fructus Capsici mottle virus 35S (abbreviation 35S) promoteres and terminator, 35S is opened Mover and terminator DNA sequence are shown in http://www.snapgene.com/resources/plasmid_files/plant_ Vectors/pCAMBIA1300/, comprises the following steps that：

(1) the mutant clone T-WA1M5 of the deletion Trp551 aminoacid for being obtained with embodiment 1 as template, using drawing Thing 6AL BamF and TA A1Sac (primer sets are as described in Example 1), by PCR and BamH1/Sac1 double digestions, obtains Ahas mutant fragments WA1M5T.

(2) it is with 1300 carriers as template, using primer 35S-Hind and 35S-Bam, double by PCR and BamH1/Hind3 Enzyme action, obtains promoter fragment 35S；

Wherein, primer sequence is：

35S-Hind：5’gcgaagcttcatggagtcaaagattcaaa；

35S-Bam：5’gtgggatccagtcccccgtgttctctccaaatgaa.

(3) with 1300 carriers as template, using primer ter-Sac and ter-Kpn, by the double enzymes of PCR and BamH1/Hind3 Cut, obtain and terminate sub-piece ter；

Wherein, primer sequence is：

ter-Sac：5’gtggagctcagtagatgccgaccggatctgt；

ter-Kpn：5’cagggtacccgccgaattaattcggggga.

(4) HindIII/SacI double digestions are carried out 1300, obtain fragment 1300HS, with 35S and WA1M5T be attached, Clone, obtains 1300-35S-WA1M5.

(5) 1300-35S-WA1M5 is carried out into SacI/KpnI double digestions, is connected with ter, clones, obtained expression AHAS and dash forward The carrier 1300-WA1M5 of variant.

With with above-mentioned steps (1)-(5) same method, with the mutant clone T-WA2M5 for deleting Trp550 aminoacid be Template, obtains the carrier 1300-WA2M5 of expression AHAS mutants.Wherein, the primer used in step (1) be 6BL BamF and TA A1Sac (primer sets are as described in Example 1).

With with above-mentioned steps (1)-(5) same method, with the mutant clone T-WA3M5 for deleting Trp548 aminoacid be Template, obtains the carrier 1300-WA3M5 of expression AHAS mutants, wherein, the primer used in step (1) and step (1) phase Together, it is 6AL BamF and TA A1Sac.

(6) carrier 1300-WA1M5,1300-WA2M5 and 1300-WA3M5 of expression AHAS mutants are proceeded to into agriculture respectively In bacillus strain LBA4044, the Plant transformation Agrobacterium of expression AHAS muteins is obtained.

2. the plant of expression AHAS muteins is obtained

The preparation method of transgenic plant is existing mature technology, and transgenic plant preparation commission Shanghai is rich to pray biotechnology Company limited is carried out.

Carrier 1300-WA1M5,1300-WA2M5,1300-WA3M5 are proceeded to into Semen Tritici aestivi, jade respectively using agrobacterium-mediated transformation In rice and Cotton Gossypii, transgenic wheat W-WA1M5, W-WA2M5, W-WA3M5, transgenic corns M-WA1M5, M-WA2M5, M- are obtained WA3M5, transgene cotton C-WA1M5, C-WA2M5, C-WA3M5.

In the transgenic plant for obtaining：Transgenic wheat W-WA1M5, W-WA2M5, W-WA3M5, transgenic corns M- WA1M5, M-WA2M5, M-WA3M5, transgene cotton C-WA1M5, C-WA2M5, C-WA3M5 and correspondence wild-type plant seedling stage Spray herbicide, after ten days, counts mortality rate, as a result referring to table 1.

Table 1

As shown in Table 1, wild-type plant plant is all dead, and transgenic plant is all survived, and illustrates the expression present invention There is the plant of AHAS muteins the polymorphic type herbicides such as anti-imidazolone type, sulfonylurea or pyrimidine carboxylic class to live Property.

<110>Academy of Agricultural Sciences, Shanghai City

<120>Aleuronat with antiweed activity, its encoding gene and application

<130> 1711035

<160> 12

<170> PatentIn version 3.5

<210> SEQ ID NO.1

<211> 646

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 1

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Met Pro Lys Pro Ala Arg Gln Pro Leu Pro Arg His

20 25 30

Gln Pro Ala Ser Arg Arg Ala Leu Pro Ala Arg Val Val Arg Cys Cys

35 40 45

Ala Ala Pro Pro Ala Ala Ala Thr Ser Ala Ala Pro Pro Ala Thr Ala

50 55 60

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

65 70 75 80

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

85 90 95

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

100 105 110

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

115 120 125

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

130 135 140

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

145 150 155 160

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

165 170 175

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

180 185 190

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

195 200 205

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

210 215 220

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

225 230 235 240

Val Pro Ile Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

245 250 255

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

260 265 270

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

275 280 285

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

290 295 300

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

305 310 315 320

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

325 330 335

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

340 345 350

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

355 360 365

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

370 375 380

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

385 390 395 400

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

405 410 415

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

420 425 430

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

435 440 445

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

450 455 460

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

465 470 475 480

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

485 490 495

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

500 505 510

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

515 520 525

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

530 535 540

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

545 550 555 560

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

565 570 575

Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr

580 585 590

Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

595 600 605

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

610 615 620

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

625 630 635 640

Asp Gly Arg Thr Ser Tyr

645

<210> SEQ ID NO.2

<211> 645

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 2

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Ala Ala

1 5 10 15

Ala Ala Ala Ala Ile Pro Lys Pro Ala Arg Gln Pro Leu Pro Arg His

20 25 30

Gln Pro Ala Ser Arg Arg Ala Leu Pro Ala Arg Ile Val Arg Cys Cys

35 40 45

Ala Ala Ser Pro Ala Ala Thr Ser Val Ala Pro Pro Ala Thr Ala Leu

50 55 60

Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu Val

65 70 75 80

Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro Gly

85 90 95

Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile

100 105 110

Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser

115 120 125

Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser

130 135 140

Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu

145 150 155 160

Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met

165 170 175

Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg

180 185 190

Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro

195 200 205

Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly

210 215 220

Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val

225 230 235 240

Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg Leu

245 250 255

Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu Val

260 265 270

Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala Ala

275 280 285

Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val

290 295 300

Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu

305 310 315 320

Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala

325 330 335

Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp

340 345 350

Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile Val

355 360 365

His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His

370 375 380

Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Ala

385 390 395 400

Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro Trp

405 410 415

His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe Lys

420 425 430

Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp

435 440 445

Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His

450 455 460

Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp

465 470 475 480

Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala

485 490 495

Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp

500 505 510

Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg

515 520 525

Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His Leu

530 535 540

Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His

545 550 555 560

Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp Phe

565 570 575

Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr Lys

580 585 590

Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly

595 600 605

Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro

610 615 620

Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly Asp

625 630 635 640

Gly Arg Thr Ser Tyr

645

<210> SEQ ID NO.3

<211> 643

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 3

Met Ala Ala Ala Thr Ser Pro Ala Val Ala Phe Ser Gly Ala Thr Ala

1 5 10 15

Ala Ala Met Pro Lys Pro Ala Arg His Pro Leu Pro Arg His Gln Pro

20 25 30

Val Ser Arg Arg Ala Leu Pro Ala Arg Val Val Arg Cys Cys Ala Ala

35 40 45

Ser Pro Ala Ala Thr Ser Ala Ala Pro Pro Ala Thr Ala Leu Arg Pro

50 55 60

Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala

65 70 75 80

Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro Gly Gly Ala

85 90 95

Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val Ile Thr Asn

100 105 110

His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala Ser Gly Tyr

115 120 125

Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr Ser Gly Pro

130 135 140

Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu Leu Asp Ser

145 150 155 160

Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly

165 170 175

Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile

180 185 190

Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile Pro Arg Val

195 200 205

Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro Gly Pro Val

210 215 220

Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala Val Pro Val

225 230 235 240

Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg Leu Pro Lys

245 250 255

Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu Val Gly Glu

260 265 270

Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala Ala Ser Gly

275 280 285

Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro Val Thr Thr

290 295 300

Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro Leu Ser Leu

305 310 315 320

Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr Ala Val Asp

325 330 335

Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val

340 345 350

Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile Val His Ile

355 360 365

Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro His Val Ser

370 375 380

Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn Asp Leu Leu

385 390 395 400

Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro Trp His Lys

405 410 415

Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe Lys Thr Phe

420 425 430

Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu Asp Glu Leu

435 440 445

Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln His Gln Met

450 455 460

Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln Trp Leu Ser

465 470 475 480

Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala Ala Ala Gly

485 490 495

Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile Asp Gly Asp

500 505 510

Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile Arg Ile Glu

515 520 525

Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His Leu Gly Met

530 535 540

Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr

545 550 555 560

Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp Phe Val Thr

565 570 575

Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr Lys Lys Ser

580 585 590

Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro Gly Pro Tyr

595 600 605

Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu Pro Met Ile

610 615 620

Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly Asp Gly Arg

625 630 635 640

Thr Ser Tyr

<210> SEQ ID NO.4

<211> 1941

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 4

atggccgccg ccacctcccc cgccgtcgca ttctccggcg ccgccgccgc cgccgccgcc 60

atgcccaagc ccgcccgcca gcctctcccg cgccaccagc ccgcctcgcg ccgcgcgctc 120

cccgcccgcg tcgtcaggtg ctgcgccgcg ccccccgctg ctgccacctc cgccgcgccc 180

cccgccaccg cgctccggcc ctggggcccg tccgagcccc gcaagggcgc cgacatcctc 240

gtcgaggcgc tcgagcgctg cggcatcgtc gacgtattcg cctaccccgg cggcgcgtcc 300

atggagatcc accaggcgct gacgcgctcg cccgtcatca ccaaccacct cttccgccac 360

gagcaggggg aggcgttcgc ggcgtccggc tacgcccgcg cgtccggccg cgtcggcgtc 420

tgcgtcgcca cctccggccc gggggccacc aacctcgtct ccgcgctcgc tgacgccctc 480

ctcgactcca tccccatggt cgccatcacg ggccaggtcc cccgccgcat gatcggcacg 540

gacgcgttcc aggagacgcc catagtggag gtcacgcgct ccatcaccaa gcacaactac 600

ctggtccttg acgtggagga tatcccccgc gtcatccagg aagccttctt cctcgcgtcc 660

tctggccgcc cggggccggt gctggttgat atccccaagg atatccagca gcagatggcc 720

gtgcctatct gggacacgcc gatgagtttg ccagggtaca tcgcccgcct gcccaagcca 780

ccatctactg aatcgcttga gcaggtcctg cgtctggttg gcgagtcacg gcgcccaatt 840

ctgtatgttg gtggtggctg cgctgcatct ggcgaggagt tgcgccgctt tgttgagctc 900

actgggattc cagttacaac tactcttatg ggccttggca acttccccag cgacgaccca 960

ctgtctctgc gcatgcttgg gatgcatggc actgtgtatg caaattatgc agtcgataag 1020

gctgacctgt tgcttgcatt tggtgtgcgg tttgatgatc gtgtgactgg gaaaatcgag 1080

gcttttgcaa gcaggtccaa gattgtgcac attgacattg acccagctga gattggcaag 1140

aacaagcagc cacatgtctc catttgtgca gatgttaagc ttgctttaca ggggttgaat 1200

gctctattaa atgggagcaa agcacaacag ggtctggatt ttggtccatg gcacaaggag 1260

ttggatcagc agaagaggga gtttcctcta ggattcaaga cttttggcga ggccatcccg 1320

ccgcaatatg ctatccaggt actggatgag ctgacaaaag gggaggcgat cattgctacc 1380

ggtgttgggc agcaccagat gtgggcggct cagtattaca cttacaagcg gccacggcag 1440

tggctgtctt cgtctggttt gggggcaatg ggatttgggt taccagctgc agctggcgct 1500

gctgtggcca acccaggtgt tacagttgtt gacattgatg gagacggtag tttcctcatg 1560

aacattcagg agttggcatt gatccgtatt gagaacctcc ctgtgaaggt gatgatattg 1620

aacaaccagc atctgggaat ggtggtgcaa gaggataggt tttacaaggc caatcgggcg 1680

cacacatacc ttggcaaccc agaaaatgag agtgagatat atccagattt tgtgacgatt 1740

gctaaaggat tcaacgttcc ggcagttcgt gtgacgaaga agagcgaagt cactgcagca 1800

atcaagaaga tgcttgagac cccagggcca tacttgttgg atatcatcgt cccgcatcag 1860

gagcacgtgc tgcctatgat cccaagcggt ggtgctttca aggacatgat catggagggt 1920

gatggcagga cctcgtactg a 1941

<210> SEQ ID NO.5

<211> 1938

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 5

atggccgcag ccacctcccc cgccgtcgca ttctcgggcg ccgccgccgc cgccgccgcc 60

atacccaaac ccgcccgcca gcctctcccg cgccaccagc ccgcctcgcg ccgcgcgctc 120

cccgcccgca tcgtcaggtg ctgcgccgcg tcccccgccg ccacctccgt cgcgcctccc 180

gccaccgcgc tccggccgtg gggcccctcc gagccccgca agggcgccga catcctcgtc 240

gaggcgctgg agcgctgcgg catcgtcgac gtcttcgcct accctggcgg cgcgtccatg 300

gagatccacc aggcgctgac gcgctcgcca gtcatcacca accacctctt ccgccacgag 360

cagggggagg cgttcgcggc gtccgggtac gcccgcgcgt ccggccgcgt cggcgtctgc 420

gtcgccacct ccggcccggg ggccaccaac ctcgtctccg cgctcgccga cgctctcctc 480

gactccatcc ccatggtcgc catcacgggc caggtccccc gccgcatgat cggcacggat 540

gcgttccagg agacgcccat cgtggaggtc acgcgctcca tcaccaagca caactacctg 600

gtccttgacg tggaggatat cccccgcgtc atccaggaag ccttcttcct cgcatcctct 660

ggccgcccgg ggccggtgct ggttgatatc cccaaggaca tccagcagca gatggctgtg 720

cctgtctggg acacgccgat gagtttgcca gggtacatcg cccgcctgcc caagccacca 780

tctactgaat cgcttgagca ggtcctgcgt ctggttggcg agtcacggcg cccaattctg 840

tatgttggtg gtggctgcgc tgcatctggt gaggagttgc gccgctttgt tgagctcact 900

gggattccag ttacaactac tcttatgggc cttggcaact tccccagtga cgacccactg 960

tctctgcgca tgctggggat gcatggcact gtgtatgcaa attatgcagt agataaggct 1020

gacctgttgc ttgcatttgg tgtgcggttt gatgatcgtg tgaccgggaa aatcgaggct 1080

tttgcaagca ggtccaagat tgtgcacatt gacattgacc cagctgagat tggcaagaac 1140

aagcagccac atgtctccat ttgtgcagat gttaagcttg ctttacaggg gttgaatgct 1200

ctattaaatg ggagcaaagc acaacagggt ctggattttg gtccatggca caaggagttg 1260

gatcagcaga agagggagtt tcctctagga ttcaagactt ttggtgaggc catcccgccg 1320

caatatgcta tccaggtact ggatgagctg acaaaagggg aggcgatcat tgccaccggt 1380

gttgggcagc atcagatgtg ggcggctcag tattacactt acaagcggcc acggcagtgg 1440

ctgtcttcgt ccggtttggg tgcaatggga tttgggttgc cagctgcagc tggcgctgct 1500

gtggccaacc caggtgttac agttgttgac attgatgggg acggtagttt cctcatgaac 1560

attcaggagt tggcgttgat ccgtattgag aacctcccag tgaaggtgat gatattgaac 1620

aaccagcatc tgggaatggt ggtgcaggag gataggtttt acaaggccaa ccgggcgcac 1680

acataccttg gcaacccaga aaatgagagt gagatatatc cagattttgt gacgattgct 1740

aaaggattca acgttccggc agttcgtgtg acgaagaaga gcgaagtcac tgcagcaatc 1800

aagaagatgc ttgagacccc agggccatac ttgttggata tcattgtccc gcatcaggag 1860

cacgtgctgc ctatgatccc aagcggtggt gcttttaagg acatgatcat ggagggtgat 1920

ggcaggacct cgtactga 1938

<210> SEQ ID NO.6

<211> 1932

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 6

atggccgccg ccacctcccc cgccgtcgca ttctcgggcg ccaccgccgc cgccatgccc 60

aaacccgccc gccatcctct cccgcgccac cagcccgtct cgcgccgcgc gctccccgcc 120

cgcgtcgtca ggtgttgcgc cgcgtccccc gccgccacct ccgccgcgcc tcccgcaacc 180

gcgctccggc cctggggccc gtccgagccc cgcaagggcg ccgacatcct cgtcgaggcg 240

ctcgagcgct gcggcatcgt cgacgtcttc gcctaccccg gcggcgcctc catggagatc 300

caccaggcgc tgacgcgctc gcccgtcatc accaaccacc tcttccgcca cgagcagggg 360

gaggcgttcg cggcgtccgg ctacgcccgc gcgtccggcc gcgtcggcgt ctgcgtcgcc 420

acctccggcc cgggggccac caacctcgtc tccgcgctcg ccgacgccct cctcgactcc 480

atccccatgg tcgccatcac gggccaggtc ccccgccgca tgatcggcac ggacgcgttc 540

caggagacgc ccatagtgga ggtcacgcgc tccatcacca agcacaacta cctggtcctt 600

gacgtggagg atatcccccg cgtcatccag gaagccttct tccttgcatc ctctggccgc 660

ccggggccgg tgctagttga tatccccaag gacatccagc agcagatggc tgtgcccgtc 720

tgggacactc caatgagttt gccagggtac atcgcccgcc tgcccaagcc accatctact 780

gaatcgcttg agcaggtcct gcgtctggtt ggcgagtcac ggcgcccaat tctgtatgtt 840

ggtggtggct gcgctgcatc tggcgaggag ttgcgccgct ttgttgagct cactgggatt 900

ccagttacaa ctactcttat gggccttggc aacttcccca gtgacgaccc actgtctctg 960

cgcatgctgg ggatgcatgg cactgtgtat gcaaattatg cagtcgataa ggctgacctg 1020

ttgcttgcat ttggtgtgcg gtttgatgat cgtgtgactg ggaaaatcga ggcttttgca 1080

agcaggtcca agattgtgca cattgacatt gacccagctg agattggcaa gaacaagcag 1140

ccacatgtct ccatttgtgc agatgttaag cttgctttac aggggttgaa tgatctatta 1200

aatgggagca aagcacaaca gggtctggat tttggtccat ggcacaagga gttggatcag 1260

cagaagaggg agtttcctct aggattcaag acttttggcg aggccatccc gccgcaatat 1320

gctatccagg tactggatga gctgacaaaa ggggaggcga tcattgccac cggtgttggg 1380

cagcaccaga tgtgggcggc tcagtattac acttacaagc ggccacggca gtggctgtct 1440

tcgtctggtt tgggggcaat gggatttggg ttaccagctg cagctggcgc tgctgtggcc 1500

aacccaggtg ttacagttgt tgacattgat ggagacggta gtttcctcat gaacattcag 1560

gagttggcat tgatccgtat tgagaacctc ccagtgaagg tgatgatatt gaacaaccag 1620

catctgggaa tggtggtgca ggaggatagg ttttacaagg ccaatcgggc gcacacatac 1680

cttggcaacc cagaaaatga gagtgagata tatccagatt ttgtgacgat tgctaaagga 1740

ttcaacgttc cagcagttcg agtgacgaag aagagcgaag tcactgcagc aatcaagaag 1800

atgcttgaga ccccagggcc atacttgttg gatatcatag tcccgcatca ggagcacgtg 1860

ctgcctatga tcccaagcgg tggtgctttc aaggacatga tcatggaggg tgatggcagg 1920

acctcgtact ga 1932

<210> SEQ ID NO.7

<211> 582

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 7

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Ile Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

485 490 495

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

500 505 510

Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr

515 520 525

Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

530 535 540

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

545 550 555 560

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.8

<211> 582

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 8

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Ala Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

485 490 495

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

500 505 510

Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr

515 520 525

Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

530 535 540

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

545 550 555 560

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.9

<211> 582

<212> PRT

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 9

Leu Arg Pro Trp Gly Pro Ser Glu Pro Arg Lys Gly Ala Asp Ile Leu

1 5 10 15

Val Glu Ala Leu Glu Arg Cys Gly Ile Val Asp Val Phe Ala Tyr Pro

20 25 30

Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser Pro Val

35 40 45

Ile Thr Asn His Leu Phe Arg His Glu Gln Gly Glu Ala Phe Ala Ala

50 55 60

Ser Gly Tyr Ala Arg Ala Ser Gly Arg Val Gly Val Cys Val Ala Thr

65 70 75 80

Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Ala Leu Ala Asp Ala Leu

85 90 95

Leu Asp Ser Ile Pro Met Val Ala Ile Thr Gly Gln Val Pro Arg Arg

100 105 110

Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu Val Thr

115 120 125

Arg Ser Ile Thr Lys His Asn Tyr Leu Val Leu Asp Val Glu Asp Ile

130 135 140

Pro Arg Val Ile Gln Glu Ala Phe Phe Leu Ala Ser Ser Gly Arg Pro

145 150 155 160

Gly Pro Val Leu Val Asp Ile Pro Lys Asp Ile Gln Gln Gln Met Ala

165 170 175

Val Pro Val Trp Asp Thr Pro Met Ser Leu Pro Gly Tyr Ile Ala Arg

180 185 190

Leu Pro Lys Pro Pro Ser Thr Glu Ser Leu Glu Gln Val Leu Arg Leu

195 200 205

Val Gly Glu Ser Arg Arg Pro Ile Leu Tyr Val Gly Gly Gly Cys Ala

210 215 220

Ala Ser Gly Glu Glu Leu Arg Arg Phe Val Glu Leu Thr Gly Ile Pro

225 230 235 240

Val Thr Thr Thr Leu Met Gly Leu Gly Asn Phe Pro Ser Asp Asp Pro

245 250 255

Leu Ser Leu Arg Met Leu Gly Met His Gly Thr Val Tyr Ala Asn Tyr

260 265 270

Ala Val Asp Lys Ala Asp Leu Leu Leu Ala Phe Gly Val Arg Phe Asp

275 280 285

Asp Arg Val Thr Gly Lys Ile Glu Ala Phe Ala Ser Arg Ser Lys Ile

290 295 300

Val His Ile Asp Ile Asp Pro Ala Glu Ile Gly Lys Asn Lys Gln Pro

305 310 315 320

His Val Ser Ile Cys Ala Asp Val Lys Leu Ala Leu Gln Gly Leu Asn

325 330 335

Asp Leu Leu Asn Gly Ser Lys Ala Gln Gln Gly Leu Asp Phe Gly Pro

340 345 350

Trp His Lys Glu Leu Asp Gln Gln Lys Arg Glu Phe Pro Leu Gly Phe

355 360 365

Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln Val Leu

370 375 380

Asp Glu Leu Thr Lys Gly Glu Ala Ile Ile Ala Thr Gly Val Gly Gln

385 390 395 400

His Gln Met Trp Ala Ala Gln Tyr Tyr Thr Tyr Lys Arg Pro Arg Gln

405 410 415

Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu Pro Ala

420 425 430

Ala Ala Gly Ala Ala Val Ala Asn Pro Gly Val Thr Val Val Asp Ile

435 440 445

Asp Gly Asp Gly Ser Phe Leu Met Asn Ile Gln Glu Leu Ala Leu Ile

450 455 460

Arg Ile Glu Asn Leu Pro Val Lys Val Met Ile Leu Asn Asn Gln His

465 470 475 480

Leu Gly Met Val Val Gln Glu Asp Arg Phe Tyr Lys Ala Asn Arg Ala

485 490 495

His Thr Tyr Leu Gly Asn Pro Glu Asn Glu Ser Glu Ile Tyr Pro Asp

500 505 510

Phe Val Thr Ile Ala Lys Gly Phe Asn Val Pro Ala Val Arg Val Thr

515 520 525

Lys Lys Ser Glu Val Thr Ala Ala Ile Lys Lys Met Leu Glu Thr Pro

530 535 540

Gly Pro Tyr Leu Leu Asp Ile Ile Val Pro His Gln Glu His Val Leu

545 550 555 560

Pro Met Ile Pro Ser Gly Gly Ala Phe Lys Asp Met Ile Met Glu Gly

565 570 575

Asp Gly Arg Thr Ser Tyr

580

<210> SEQ ID NO.10

<211> 1749

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 10

ctccggccct ggggcccgtc cgagccccgc aagggcgccg acatcctcgt cgaggcgctc 60

gagcgctgcg gcatcgtcga cgtattcgcc taccccggcg gcgcgtccat ggagatccac 120

caggcgctga cgcgctcgcc cgtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccggcta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgctg acgccctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga cgcgttccag 360

gagacgccca tagtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc tcgcgtcctc tggccgcccg 480

gggccggtgc tggttgatat ccccaaggat atccagcagc agatggccgt gcctatctgg 540

gacacgccga tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg cgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagcg acgacccact gtctctgcgc 780

atgcttggga tgcatggcac tgtgtatgca aattatgcag tcgataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgactggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatgc tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggcgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgctaccgg tgttgggcag 1200

caccagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tctggtttgg gggcaatggg atttgggtta ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatgga gacggtagtt tcctcatgaa cattcaggag 1380

ttggcattga tccgtattga gaacctccct gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcaaga ggataggttt tacaaggcca atcgggcgca cacatacctt 1500

ggcaacccag aaaatgagag tgagatatat ccagattttg tgacgattgc taaaggattc 1560

aacgttccgg cagttcgtgt gacgaagaag agcgaagtca ctgcagcaat caagaagatg 1620

cttgagaccc cagggccata cttgttggat atcatcgtcc cgcatcagga gcacgtgctg 1680

cctatgatcc caagcggtgg tgctttcaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

<210> SEQ ID NO.11

<211> 1749

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 11

ctccggccgt ggggcccctc cgagccccgc aagggcgccg acatcctcgt cgaggcgctg 60

gagcgctgcg gcatcgtcga cgtcttcgcc taccctggcg gcgcgtccat ggagatccac 120

caggcgctga cgcgctcgcc agtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccgggta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgccg acgctctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga tgcgttccag 360

gagacgccca tcgtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc tcgcatcctc tggccgcccg 480

gggccggtgc tggttgatat ccccaaggac atccagcagc agatggctgt gcctgtctgg 540

gacacgccga tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg tgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagtg acgacccact gtctctgcgc 780

atgctgggga tgcatggcac tgtgtatgca aattatgcag tagataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgaccggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatgc tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggtgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgccaccgg tgttgggcag 1200

catcagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tccggtttgg gtgcaatggg atttgggttg ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatggg gacggtagtt tcctcatgaa cattcaggag 1380

ttggcgttga tccgtattga gaacctccca gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcagga ggataggttt tacaaggcca accgggcgca cacatacctt 1500

ggcaacccag aaaatgagag tgagatatat ccagattttg tgacgattgc taaaggattc 1560

aacgttccgg cagttcgtgt gacgaagaag agcgaagtca ctgcagcaat caagaagatg 1620

cttgagaccc cagggccata cttgttggat atcattgtcc cgcatcagga gcacgtgctg 1680

cctatgatcc caagcggtgg tgcttttaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

<210> SEQ ID NO.12

<211> 1749

<212> DNA

<213>Semen Tritici aestivi（Triticum aestivum）

<400> 12

ctccggccct ggggcccgtc cgagccccgc aagggcgccg acatcctcgt cgaggcgctc 60

gagcgctgcg gcatcgtcga cgtcttcgcc taccccggcg gcgcctccat ggagatccac 120

caggcgctga cgcgctcgcc cgtcatcacc aaccacctct tccgccacga gcagggggag 180

gcgttcgcgg cgtccggcta cgcccgcgcg tccggccgcg tcggcgtctg cgtcgccacc 240

tccggcccgg gggccaccaa cctcgtctcc gcgctcgccg acgccctcct cgactccatc 300

cccatggtcg ccatcacggg ccaggtcccc cgccgcatga tcggcacgga cgcgttccag 360

gagacgccca tagtggaggt cacgcgctcc atcaccaagc acaactacct ggtccttgac 420

gtggaggata tcccccgcgt catccaggaa gccttcttcc ttgcatcctc tggccgcccg 480

gggccggtgc tagttgatat ccccaaggac atccagcagc agatggctgt gcccgtctgg 540

gacactccaa tgagtttgcc agggtacatc gcccgcctgc ccaagccacc atctactgaa 600

tcgcttgagc aggtcctgcg tctggttggc gagtcacggc gcccaattct gtatgttggt 660

ggtggctgcg ctgcatctgg cgaggagttg cgccgctttg ttgagctcac tgggattcca 720

gttacaacta ctcttatggg ccttggcaac ttccccagtg acgacccact gtctctgcgc 780

atgctgggga tgcatggcac tgtgtatgca aattatgcag tcgataaggc tgacctgttg 840

cttgcatttg gtgtgcggtt tgatgatcgt gtgactggga aaatcgaggc ttttgcaagc 900

aggtccaaga ttgtgcacat tgacattgac ccagctgaga ttggcaagaa caagcagcca 960

catgtctcca tttgtgcaga tgttaagctt gctttacagg ggttgaatga tctattaaat 1020

gggagcaaag cacaacaggg tctggatttt ggtccatggc acaaggagtt ggatcagcag 1080

aagagggagt ttcctctagg attcaagact tttggcgagg ccatcccgcc gcaatatgct 1140

atccaggtac tggatgagct gacaaaaggg gaggcgatca ttgccaccgg tgttgggcag 1200

caccagatgt gggcggctca gtattacact tacaagcggc cacggcagtg gctgtcttcg 1260

tctggtttgg gggcaatggg atttgggtta ccagctgcag ctggcgctgc tgtggccaac 1320

ccaggtgtta cagttgttga cattgatgga gacggtagtt tcctcatgaa cattcaggag 1380

ttggcattga tccgtattga gaacctccca gtgaaggtga tgatattgaa caaccagcat 1440

ctgggaatgg tggtgcagga ggataggttt tacaaggcca atcgggcgca cacatacctt 1500

ggcaacccag aaaatgagag tgagatatat ccagattttg tgacgattgc taaaggattc 1560

aacgttccag cagttcgagt gacgaagaag agcgaagtca ctgcagcaat caagaagatg 1620

cttgagaccc cagggccata cttgttggat atcatagtcc cgcatcagga gcacgtgctg 1680

cctatgatcc caagcggtgg tgctttcaag gacatgatca tggagggtga tggcaggacc 1740

tcgtactga 1749

Claims

1. there is the aleuronat of antiweed activity, which is the mutein of Semen Tritici aestivi Acetohydroxyacid synthase, its Aminoacid sequence such as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.7, SEQ ID No.8 or SEQ Shown in ID No.9.

2. there is the gene of antiweed activity, which is the nucleotide sequence for encoding aleuronat described in claim 1.

3. there is the gene of antiweed activity as claimed in claim 2, it is characterised in that the aminoacid sequence such as SEQ The nucleotide sequence of the aleuronat shown in ID No.1 is as shown in SEQ ID No.4, or aminoacid sequence such as SEQ ID The nucleotide sequence of the aleuronat shown in No.2 is as shown in SEQ ID No.5, or aminoacid sequence such as SEQ ID No.3 The nucleotide sequence of shown aleuronat is as shown in SEQ ID No.6, or aminoacid sequence is as shown in SEQ ID No.7 Aleuronat nucleotide sequence as shown in SEQ ID No.10, or aminoacid sequence is as shown in SEQ ID No.8 The nucleotide sequence of aleuronat is as shown in SEQ ID No.11, or aminoacid sequence is little as shown in SEQ ID No.9 The nucleotide sequence of aleuronat matter is as shown in SEQ ID No.12.

4. there is the aleuronat of antiweed activity to be used to cultivate anti-imidazolone type, sulfonylureas as claimed in claim 1 Class and miazines herbicide plant.

5. a kind of method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant, including by claim 1 The encoding gene of the aleuronat is transformed in plant, makes plant produce the Semen Tritici aestivi acetyl hydroxyl with antiweed activity The mutein of acid enzyme.

6. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, nucleotide sequence such as SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, the SEQ ID of the encoding gene Shown in No.10, SEQ ID No.11 or SEQ ID No.12.

7. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the imidazolinone herbicide is at least one in imazethapyr, imazamox and imazapic.

8. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the sulfonylurea herbicide is sulfometuronmethyl.

9. the method for obtaining anti-imidazolone type, sulfonylurea and miazines herbicide plant according to claim 5, which is special Levy and be, the miazines herbicide is bispyribac-sodium.

10. anti-imidazolone type, sulfonylurea and miazines herbicide plant are obtained according to any one of claim 5-9 Method, it is characterised in that the plant is Semen Tritici aestivi, Semen Maydiss or Cotton Gossypii.