CN106434948B - The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application - Google Patents
The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application Download PDFInfo
- Publication number
- CN106434948B CN106434948B CN201610945758.1A CN201610945758A CN106434948B CN 106434948 B CN106434948 B CN 106434948B CN 201610945758 A CN201610945758 A CN 201610945758A CN 106434948 B CN106434948 B CN 106434948B
- Authority
- CN
- China
- Prior art keywords
- rice
- bph31
- brown planthopper
- primer
- molecular labeling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 67
- 235000009566 rice Nutrition 0.000 title claims abstract description 66
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 49
- 241001556089 Nilaparvata lugens Species 0.000 title claims abstract description 43
- 238000002372 labelling Methods 0.000 title claims abstract description 36
- 240000007594 Oryza sativa Species 0.000 title claims 2
- 241000209094 Oryza Species 0.000 claims abstract description 66
- 241000607479 Yersinia pestis Species 0.000 claims abstract description 23
- 210000000349 chromosome Anatomy 0.000 claims abstract description 15
- 239000000463 material Substances 0.000 claims description 23
- 238000009395 breeding Methods 0.000 claims description 9
- 230000001488 breeding effect Effects 0.000 claims description 9
- 238000012216 screening Methods 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 8
- 238000001514 detection method Methods 0.000 claims description 7
- 239000012634 fragment Substances 0.000 claims description 6
- 238000006243 chemical reaction Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 238000005498 polishing Methods 0.000 claims description 3
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 2
- 230000003321 amplification Effects 0.000 claims description 2
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 2
- 230000003139 buffering effect Effects 0.000 claims 1
- 239000007788 liquid Substances 0.000 claims 1
- 241000196324 Embryophyta Species 0.000 abstract description 31
- 235000019082 Osmanthus Nutrition 0.000 abstract description 18
- 241000333181 Osmanthus Species 0.000 abstract description 18
- 241001498622 Cixius wagneri Species 0.000 abstract description 9
- 238000013507 mapping Methods 0.000 abstract description 2
- 230000008485 antagonism Effects 0.000 abstract 1
- 238000012254 genetic linkage analysis Methods 0.000 abstract 1
- 238000000034 method Methods 0.000 description 14
- 239000003550 marker Substances 0.000 description 8
- 230000000694 effects Effects 0.000 description 6
- 101000988395 Homo sapiens PDZ and LIM domain protein 4 Proteins 0.000 description 5
- 108700001097 Insect Genes Proteins 0.000 description 5
- 240000000125 Oryza minuta Species 0.000 description 5
- 238000004519 manufacturing process Methods 0.000 description 5
- 230000006798 recombination Effects 0.000 description 5
- 238000005215 recombination Methods 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 238000007400 DNA extraction Methods 0.000 description 3
- 239000003147 molecular marker Substances 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 241000238631 Hexapoda Species 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 210000001161 mammalian embryo Anatomy 0.000 description 2
- 230000008775 paternal effect Effects 0.000 description 2
- 238000009331 sowing Methods 0.000 description 2
- 230000009466 transformation Effects 0.000 description 2
- 208000002109 Argyria Diseases 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 108700003861 Dominant Genes Proteins 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 239000004677 Nylon Substances 0.000 description 1
- 241000819999 Nymphes Species 0.000 description 1
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 1
- 241001674048 Phthiraptera Species 0.000 description 1
- 108700005079 Recessive Genes Proteins 0.000 description 1
- 102000052708 Recessive Genes Human genes 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 208000027418 Wounds and injury Diseases 0.000 description 1
- 241000746966 Zizania Species 0.000 description 1
- 235000002636 Zizania aquatica Nutrition 0.000 description 1
- 230000009471 action Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000009402 cross-breeding Methods 0.000 description 1
- 230000006378 damage Effects 0.000 description 1
- 239000003398 denaturant Substances 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 238000012252 genetic analysis Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 208000014674 injury Diseases 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000010899 nucleation Methods 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000035764 nutrition Effects 0.000 description 1
- 229920001778 nylon Polymers 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 238000006116 polymerization reaction Methods 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000000644 propagated effect Effects 0.000 description 1
- 238000012797 qualification Methods 0.000 description 1
- 238000012772 sequence design Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000002689 soil Substances 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses the molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its applications, by genetic linkage analysis, hybridize the F obtained with the kind osmanthus 1025 of high sense brown paddy plant hopper using the kind K41 of high brown planthopper resistant2:3Family group and recombinant inbred lines, brown planthopper resistant gene in rice Bph31 (t) on finely positioning Chromosome 4 in Rice, by the assignment of genes gene mapping between molecular labeling MG81 and RM471 in the section of 135kb, the efficiency of selection of 1 molecular labeling MG96 antagonism single plant in the section is 97% or so.There are also MG81 and RM471 with the molecular labeling of the gene linkage.Whether the molecular labeling in the present invention can be used to detect in pest-resistant cultivar K41 and its derived varieties (being) containing the gene, sift out the BPH-resistant rice varieties containing Bph31 (t) gene.
Description
[technical field]
The present invention relates to molecular biology field, in particular to the molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and
It is applied.
[background technique]
Brown paddy plant hopper is a kind of important pests in Rice Production, and not only direct hazard rice, is also propagated during feeding
Other diseases and virus seriously threaten the safety in production of China's rice.Excavate and identify new anti insect gene, breeding pest-resistant cultivar
It is most economical effectively preventing means.
Since in the 1960s, screen scientist both at home and abroad and identification brown planthopper resistant material, in cultivated rice and wild
It has had found large quantities of pest-resistant resources in rice material successively, so far, 36 Brown Planthopper Resistance bases has been shared according to Document system
Because being identified, wherein 21 are dominant gene, 15 are recessive gene, wherein the anti insect gene of 30 main effects is named.
Only 2 anti insect gene Bph14 and BPH29 by successful clone (Qiu Yongfu etc., 2014；Du et al.,2009；Jena and
Kim,2010；Huang et al.,2013；He et al.,2013；Wu et al.,2014；Wang et al.,2015).One
A little identified anti insect genes are widely used in the molecular mark of brown planthopper resistant, and achieve significantly into
Exhibition.However research in recent years is found, only the rice varieties with some main effect anti insect gene easily lose resistance in production, and
Some kinds with minor gene are played an important role in terms of durable resistance by its modification to major gene resistance.For example,
Rice varieties IR64 is still able to maintain the resistance to brown paddy plant hopper after continuously plantation many years, finds it in addition to carrying one by identification
It also include several minor effect quantitative trait loci (Quantitatives relevant to resistance except the resistant gene Bph1 of a main effect
Trait loci, QTL) (Cohen et al., 1997).So far, using different rice materials, researchers have been detected
To Brown Planthopper Resistance QTL be distributed in all chromosome of rice (Wu Changjun etc., 2005；Sun et al.,2007；Liu et
al.,2009)。
In early-stage study, we hybridize with cultivated rice IR24, are returned using Oryza minuta, in conjunction with embryo rescue and molecule
Marker assisted selection technology constructs a set of Oryza minuta introgressive line, is identified by brown planthopper resistant, and it is brown that screening obtains highly resistance
Plant hopper and the stable rice strain K41 (Guo Sibin etc., 2012) of economical character.In order to excavate resistant gene in K41 and its tight
Close chain molecular labeling, the present invention to feel worm kind osmanthus 1025 for female parent, using pest resistant strain K41 as paternal hybrid, obtain respectively
The F arrived1It is selfed again, to construct F2Segregating population, each F2Single plant obtains corresponding F by selfing2:3Family, 300 F2
Single plant uses single seed descent, obtains recombinant inbred lines (RILs, F by being continuously selfed7).With there is polymorphism between parent
SSR marker analyzes F2The genotype of single plant, in combination with corresponding F3The average pest-resistant rank of family carries out QTL positioning.
The result shows that LOD value is there are the QTL site of a main effect between rice chromosome long-armed RM3917 and RM471
22.5, resistance contribution rate is 34.3%, temporary entitled Bph31 (t).In order to find and the chain closer label of Bph31 (t), use
RM3917 and RM471 has screened 5000 F3Single plant.Further 61 weights are obtained using the detection screening of these polymorphism primers
Group single plant genotype, in conjunction with its Resistance Identification as a result, finally Bph31 (t) is positioned between MG81 and RM471, and with mark
MG96 close linkage is remembered, with reference to OryzasativaLcv.Nipponbare genome sequence it is found that physical distance about 135kb between MG81 and MG96.It is inciting somebody to action
After the resistant gene hybridizes transformation to other materials, reached using accuracy rate existing for molecular labeling MG96 detection resistant gene
97% or more, therefore, identify that the presence of Bph31 (t) has very high efficiency using molecular labeling MG96 between the two,
The Breeding progress of BPH-resistant rice varieties is also substantially increased in this way.
[summary of the invention]
In view of above content, hybridize acquisition with the kind osmanthus 1025 of high sense brown paddy plant hopper using the kind K41 of high brown planthopper resistant
F2:3Family group and recombinant inbred lines, by Resistance Identification and genetic analysis, rice the 4th dyeing of finely positioning
A brown planthopper resistant gene in rice Bph31 (t) on body obtains the Practical economy of the based on PCR amplification of close linkage therewith
Molecular labeling.The label can predict whether rice material is resistant to brown paddy plant hopper, improve the choosing of BPH-resistant rice varieties
Select efficiency.
In order to achieve the above objectives, the technical scheme adopted by the invention is that:
A kind of molecular labeling of brown planthopper resistant gene in rice Bph31 (t), by the primer pair of one of the following through PCR amplification
It obtains:
(1) labeled primer MG81
Forward primer sequence: GGCAAACTCTTCTGATATGCTCTCC,
Reverse primer sequences: GCGCCAGAGATTGTGTGATCC；
(2) labeled primer MG96
Forward primer sequence: ACAATTCATCCTATGCTTCTAGGC,
Reverse primer sequences: TCTATGCACGACGCCACGGAAGGTCCTAGCCA；
(3) labeled primer RM471
Forward primer sequence: AGAAATGGATCGGACTGAACATGC,
Reverse primer sequences: AGACACTCGGACGCACAAGC；
Wherein, the amplification length of labeled primer (1)-(3) is respectively 140bp, 184bp and 198bp.
In the present invention, as further explanation, one of described labeled primer (1)-(3) expand rice genome to be checked
DNA,
If the amplified fragments of 140bp can be amplified with primer MG81,
Or the amplified fragments of 184bp can be amplified with primer MG96,
Or the amplified fragments of 198bp can be amplified with primer RM471,
The rice to be checked is then indicated there are brown planthopper resistant gene in rice Bph31 (t), which is located at rice genome
In the section of No. 4 chromosome 18,200,000-19,000,000bp.
In the present invention, as further explanation, the gene Bph31 (t) comes from rice pest-resistant cultivar K41 or rice
The derived material of pest-resistant cultivar K41 or the material for carrying brown planthopper resistant gene Bph31 (t).
To illustrate that the acceptor material of brown planthopper resistant gene in rice Bph31 (t) involved in the present invention includes Oryza institute
There is material, such as cultivated rice and wild rice.
The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) as described above is anti-in breeding brown planthopper resistant rice or screening
Application in property genetic resources.
In the present invention, as further explanation, the reaction system of the PCR amplification: using the reaction system of 10 μ L, mould
Plate DNA 10ng, positive, each 0.8 μm of ol of reverse primer, 10 × PCR buffer, 1 μ L, dNTPs 0.2mmol, Taq DNA polymerization
Enzyme 0.25U, with ddH2O polishing to 10 μ L；PCR amplification program are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 50s, 55 DEG C of annealing 45s, 72
DEG C extend 1min, 35 circulation；72 DEG C of extension 5min.
Compared with prior art, the invention has the following advantages:
1. brown planthopper resistant new gene of the invention and the Brown Planthopper Resistance being located on Chromosome 4 in Rice reported at present
Gene is all different.The resistance gene of brown planthopper being located on Chromosome 4 in Rice at present has 10.Wherein, Bph12,
Bph15, Bph17, Bph20 are located on Chromosome 4 in Rice galianconism, between label RM8213 and RM5953；bph12,
Bph16, BPH27 (t), Bph6 be located at Chromosome 4 in Rice it is long-armed on, label RM3643 and RM5742 between；qBPH29
(t) it is located between label RM401 and RM3917 between label RM471 and RM3643 with BPH27.And Bph31 (t) is located at
It marks between RM3917 and RM471, it is all different from above 10 resistant genes, it is derived from Oryza minuta gene transgression system K41
A brown planthopper resistant new gene site.
2. the screening of the new gene label obtained through the invention, can obtain and significantly improve water to Brown Planthopper Resistance level
Rice new varieties.
3. the present invention can detect pest-resistant cultivar K41 and its derived varieties using the molecular labeling of Bph31 (t) close linkage
Whether contain the gene in (being), sifts out the new material of brown planthopper resistant.Molecular labeling of the invention can be used for rice brown planthopper resistant
Molecular marker assisted selection breeding and pyramiding breeding, the genotype selection of breeding population, effectively identifies brown planthopper resistant in seedling stage
Individual, be convenient for timely selection cross, accelerate breeding process.
[Detailed description of the invention]
Fig. 1 is the brown planthopper resistant gene Bph31 (t) of rice strain K41 carrying in the long-armed upper and molecule mark of rice chromosome
Remember the close linkage relation distribution map of MG96；
Appended drawing reference: the Primary Location of A-Bph31 (t)；Vertical line indicates rice chromosome；Horizontal dashes indicate dyeing
Molecular labeling on body；The genetic distance (cM) between numerical tabular indicating note in bracket；The finely positioning of B-Bph31 (t)；
Bph31 (t) is positioned at the section of 135kb between MG81 and RM471, molecular labeling MG96 and resistant gene close linkage.N is indicated
The F3 recombination single plant sum of screening；
Fig. 2 is the electrophoresis detection banding pattern of molecular labeling MG96 amplified production in different rice materials；
Appended drawing reference: 1 is Marker；2 be K41；3 be osmanthus 1025；4-35 is K41 and 1025 crossbreeding offspring of osmanthus is single
Strain；
Fig. 3 is K41 and the result figure of 1025 filial generation single plant seedling stage Brown Planthopper Resistance of osmanthus performance identification；
Appended drawing reference: 6 be pest-resistant control RH；7 compare TN1 for sense worm；1-5 and 8-12 is 1025 filial generation of K41 and osmanthus
Single plant.
[specific embodiment]
All features disclosed in this specification or disclosed all methods or in the process the step of, in addition to mutually exclusive
Feature and/or step other than, can combine in any way.
Any feature disclosed in this specification (including any accessory claim, abstract), unless specifically stated,
It is replaced by other equivalent or with similar purpose alternative features.That is, unless specifically stated, each feature is a series of
An example in equivalent or similar characteristics.
Reagent, kit and instrument used in the following embodiment can be obtained from commercially available, method used in embodiment
It is consistent with conventional use of method if be not specifically noted.
Embodiment 1: the acquisition of molecular labeling
(1) osmanthus 1025/K41 F2The building and phenotypic evaluation of family group and RILs
1, in early-stage study, hybridized using Oryza minuta with cultivated rice IR24, be returned, in conjunction with embryo rescue and molecule mark
Remember assisted Selection technology, construct a set of Oryza minuta introgressive line, identified by brown planthopper resistant, it is brown winged that screening obtains highly resistance
Lice and the stable rice strain K41 of economical character.In order to excavate the molecular labeling of resistant gene and its close linkage in K41,
The present invention is respectively to feel worm kind osmanthus 1025 for female parent, using pest resistant strain K41 as paternal hybrid, obtained F1It is selfed again, thus
Construct F2Segregating population, each F2Single plant obtains corresponding F by selfing2:3Family, 300 F2Single plant uses single seed descent,
Recombinant inbred lines (RILs, F are obtained by being continuously selfed7)。
2, worm processing is connect using seedling stage, to parent, F2:3Family and RILs carry out insect resistance identification.To ensure parent, F2:3Family
System is consistent with Material growth each in RILs, and all materials to be tested distinguish presoaking and germinating prior to seeding.Each each 50 kinds of material
Son is sowed at a long 45cm, wide 35cm, high 8cm, and fills in the irony pallet of 5cm thickness Nutrition Soil.Each material of each disk
2 repetitions are broadcast, wherein sowing parent and TN1 (control of sense worm) each 2 repetitions at random.Sick and weak seedling is eliminated in thinning after sowing 7 days.
When seedling grew to for two Ye Yixin phases, 2-3 age brown paddy plant hopper nymph, nylon gauze on most back cover are inoculated in the ratio of 8/seedling.Work as sense
When worm control TN1 is all dead, 0,1,3,5,7 or 9 grade of the progress of each single plant of resistance is commented referring to the method for Qiu etc. (2012)
Valence (table 1), passes through the resistance rank of the weighted average calculation material to every part of material, and above-mentioned insect resistance identification is repeated twice, makes even
Resistance rank of the mean value as the material, and speculate its genotype.
The grade scale of 1 rice seedling brown planthopper resistant of table identification
| Resistance rank | Extent of injury (is investigated) when 90% or more TN1 death | Resistance level |
| 0 | Plant strain growth health, on-bladed are aggrieved | Anti- (R) |
| 1 | 1 leaf Huang | Anti- (R) |
| 3 | 1 to 2 leaf Huang or 1 leaf are withered | In resist (MR) |
| 5 | 2 to 3 leaf Huangs or 2 leaves are withered | In resist (MR) |
| 7 | 3 to 4 leaf leaves are withered, but plant is not dead | Feel (S) |
| 9 | Whole strain is dead | Feel (S) |
(2) osmanthus 1025/K41 F2The molecular marker analysis of group
1, parent and F are extracted using CTAB method (Murray and Thompsom, 1980)2The blade base of each single plant of group
Because of a group DNA.
2, the SSR marker announced according to the website Gramene (http://www.gramene.org/) is according to more uniform something lost
Pass the molecular labeling of distance selection certain amount.In addition, the location area section last based on the gene, with reference to rice varieties OryzasativaLcv.Nipponbare
Corresponding genome sequence utilizes SSR research tool SSRIT (http://www.gramene.org/db/marker/
Ssrtool it) finds SSR motif, and according to its flanking sequence design primer, is alternate labels.Wherein, parameter is arranged in SSIT
Are as follows: minimum motif length is 3 aggressiveness, and minimum repeat number is 5, searches all SSR motifs of element.It selects all to be greater than 15 base (bases
Sequence length × repeat number) SSR motif, finally be based on the last location area section of the gene, compare the section in rice strain 9311
And the corresponding genome sequence of OryzasativaLcv.Nipponbare, have discrepant section design STS label in the two and is used for finely positioning.
2 polymorphism mark primer pair of table, amplified production size and the position on rice chromosome
3, DNA extraction, PCR amplification and gel electrophoresis:
With reference to the DNA extraction method of (2000) Temnykh etc., genomic DNA is extracted respectively to each single plant.
PCR amplification system uses the reaction system of 10 μ L, template DNA 10ng, positive, reverse primer each 0.8 μm of ol, and 10
1 μ L, dNTPs 0.2mmol, Taq archaeal dna polymerase 0.25U of × PCR buffer, with ddH2O polishing to 10 μ L.PCR amplification program
Are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 50s, 55 DEG C of annealing 45s, 72 DEG C of extension 1min, 35 recycle；72 DEG C of extension 5min.PCR
Product is detected in 6% polyacrylamide denaturant gel and silver staining development process, or takes conventional detection skill known in the art
Art.
4, according to F2The pest-resistant rank of single plant selects the leaf of 15 extremely pest-resistant single plants and 15 extreme sense worm single plants respectively
The mixing building of piece genomic DNA is anti-, feels pond.The anti-pond sense DNA is screened respectively using the primer for having polymorphism between parent, is had
The molecular labeling of polymorphism, such polymorphism mark are likely to resistant gene be chain.Then, where selection linked marker
There is polymorphism primer to screen F on chromosome between parent2Each single plant of segregating population obtains group's genotype data.According to
Chain exchange rule constructs rice part genetic map using group's genotype data, and obtain by software JoinMap 3.0
Obtain the genetic distance of each molecular labeling.Finally, in conjunction with F2The genotype data and corresponding Brown Planthopper Resistance of each single plant of group
The pest-resistant rank of identification carries out QTL site scanning to target chromosome using software NetWork QTL 3.0.
(3) F of molecular marker screening osmanthus 1025/K41 and Lemont/K41 is utilized3Recombinate single plant finely positioning Bph31
(t)
According to the positioning result of QTL, F is screened using the SSR marker RM3917 and RM471 of Primary Location two sides3Single plant obtains
Obtain the single plant recombinated between two labels.More the drawing with polymorphism between parent is screened in Primary Location section simultaneously
Object investigates the case where label is isolated with pest-resistant phenotype in conjunction with the genotype and phenotype of recombination single plant.
(4) result and analysis
Seedling stage group's method connects worm qualification result and shows that the average pest-resistant rank in K41 and osmanthus 1025 is respectively 2.5 and 9.0, this
Show K41 high brown planthopper resistant and the high sense brown paddy plant hopper in osmanthus 1025.190 F2:3Frequency of the family to the average pest-resistant rank of brown paddy plant hopper
Distribution is in continuously distributed, minimum value 1.5, maximum value 9.0.Part recombinates the genotype and phenotype (being shown in Table 3) of single plant.
F is analyzed with the SSR marker for having polymorphism between parent2The genotype of single plant, in combination with corresponding F3Family is put down
Pest-resistant rank carries out QTL positioning.The result shows that there are main effects between rice chromosome long-armed RM3917 and RM471
QTL site, LOD value 22.5, resistance contribution rate are 34.3%.
Physical distance of the molecular labeling RM3917 and RM471 in the japonica rice variety OryzasativaLcv.Nipponbare genome sequence of sequencing is about
0.7Mb has screened 5000 with RM3917 and RM471 with the chain more accurate molecular labeling of Bph31 (t), the present invention to find
A F3Single plant.It is screened in Primary Location section more between parent with the primer of polymorphism simultaneously.Further utilize these
Polymorphism primer detection screening obtains the genotype of 61 recombination single plants, in conjunction with its Resistance Identification as a result, finally by Bph31
(t) be positioned between MG81 and RM471, and with label MG96 close linkage (Fig. 1, table 3), can with reference to OryzasativaLcv.Nipponbare genome sequence
Know, the about 135kb of the physical distance between MG81 and RM471.By the resistant gene hybridize transformation to other materials after, using point
Accuracy rate existing for son label MG96 detection resistant gene reaches 97% or more (Fig. 2), therefore, utilizes molecule between the two
Presence of the label MG96 to identify Bph31 (t) also substantially increases BPH-resistant rice varieties with very high efficiency in this way
Breeding progress.
The genotype and phenotype of 3 part of table recombination single plant
Remarks: A, K41 homozygous genotype；B, 1025 homozygous genotype of osmanthus；H, heterozygous genotypes；R resists；MR, in resist；S
Sense；Through analysis recombination single plant genotype and pest-resistant rank, finally by Bph31 (t) assignment of genes gene mapping between MG81 and RM471.
Embodiment 2: the verifying of molecular labeling
(1) materials and methods
Negative kind: 30 parts, sense worm strain osmanthus 1025, Lemont, TN1 are the conventional rice material that this laboratory saves
Expect, 27 parts of worm family are felt in the 1025/K41 cross combination offspring of osmanthus.
Positive kind: 30 parts, 29 parts of pest-resistant family in pest resistant strain K41, osmanthus 1025/K41 cross combination offspring.
Molecular labeling primer: MG81, MG96 and RM471.
DNA extraction method and the analysis method of molecular labeling are the same as embodiment 1.
(2) result
In aforementioned manners, respectively to the genome of 60 parts of rice strain K41, osmanthus 1025, Lemont, TN1 etc. different samples
DNA carries out PCR amplification.The result shows that can be amplified in positive sample corresponding 140bp segment, 184bp segment and
198bp segment, and these segments cannot be amplified in negative sample.Thus illustrate, molecular labeling side provided by the invention
Method can accurately filter out the sample containing brown planthopper resistant major gene resistance, to significantly improve the selection of brown planthopper resistant rice material
Efficiency.
The aforementioned description to specific exemplary embodiment of the invention is in order to illustrate and illustration purpose.These descriptions
It is not wishing to limit the invention to disclosed precise forms, and it will be apparent that according to the above instruction, can much be changed
And variation.The purpose that exemplary implementation is selected and described is to explain the specific principles of the present invention and its practical application,
So that those skilled in the art can be realized and utilize a variety of different exemplary implementation schemes of the invention and each
Kind different selection and change.The scope of the present invention is intended to have the right claim and its equivalent form is limited.
<sequence table>
<110>Guangxi Academy of Agricultural Sciences's rice research institute
<120>molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application
<160> 6
<170>Primer5.0
<210> 1
<211> 25
<212> DNA
<213>artificial sequence
<223>MG81 (5 end ˊ primer sequence)
<400> 1
GGCAAACTCTTCTGATATGCTCTCC 25
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<223>end MG81(3 ˊ primer sequence)
<400> 2
GCGCCAGAGATTGTGTGATCC 21
<210> 3
<211> 24
<212> DNA
<213>artificial sequence
<223>MG96 (5 end ˊ primer sequence)
<400> 3
ACAATTCATCCTATGCTTCTAGGC 24
<210> 4
<211> 32
<212> DNA
<213>artificial sequence
<223>end MG96(3 ˊ primer sequence)
<400> 4
TCTATGCACGACGCCACGGAAGGTCCTAGCCA 32
<210> 5
<211> 24
<212> DNA
<213>artificial sequence
<223>RM471 (5 end ˊ primer sequence)
<400> 5
AGAAATGGATCGGACTGAACATGC 24
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<223>end RM471(3 ˊ primer sequence)
<400> 6
AGACACTCGGACGCACAAGC 20
Claims (5)
1. a kind of molecular labeling of brown planthopper resistant gene Bph31 (t), which is characterized in that using rice K41 as template, by following
One of primer pair obtained through PCR amplification:
(1) labeled primer MG81
Forward primer sequence: GGCAAACTCTTCTGATATGCTCTCC,
Reverse primer sequences: GCGCCAGAGATTGTGTGATCC；
(2) labeled primer MG96
Forward primer sequence: ACAATTCATCCTATGCTTCTAGGC,
Reverse primer sequences: TCTATGCACGACGCCACGGAAGGTCCTAGCCA；
(3) labeled primer RM471
Forward primer sequence: AGAAATGGATCGGACTGAACATGC,
Reverse primer sequences: AGACACTCGGACGCACAAGC；
Wherein, the amplification length of labeled primer (1)-(3) is respectively 140bp, 184bp and 198bp.
2. the detection method of the molecular labeling of brown planthopper resistant gene Bph31 (t) described in claim 1, which is characterized in that described in it
One of labeled primer (1)-(3) expand oryza sativa genomic dna to be checked,
If the amplified fragments of 140bp can be amplified with primer MG81,
Or the amplified fragments of 184bp can be amplified with primer MG96,
Or the amplified fragments of 198bp can be amplified with primer RM471,
The rice to be checked is then indicated there are rice K41 brown planthopper resistant gene Bph31 (t), which is located at rice genome the 4th
In the section of number chromosome 18,200,000-19,000,000bp.
3. the molecular labeling of brown planthopper resistant gene Bph31 (t) according to claim 1, which is characterized in that the gene
Derived material of the Bph31 (t) from rice pest-resistant cultivar K41 or rice pest-resistant cultivar K41.
4. the molecular labeling of brown planthopper resistant gene Bph31 (t) is in breeding brown planthopper resistant rice or screening according to claim 1
Application in resistant gene resource.
5. the molecular labeling of brown planthopper resistant gene Bph31 (t) according to claim 1, which is characterized in that the PCR amplification
Reaction system: using the reaction system of 10 μ L, template DNA 10ng, positive, reverse primer each 0.8 μm of ol, 10 × PCR buffering
1 μ L, dNTPs0.2mmol, Taq archaeal dna polymerase 0.25U of liquid, with ddH2O polishing to 10 μ L；PCR amplification program are as follows: 94 DEG C pre-
It is denaturalized 5min；94 DEG C of 50s, 55 DEG C of annealing 45s, 72 DEG C of extension 1min, 35 recycle；72 DEG C of extension 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610945758.1A CN106434948B (en) | 2016-10-26 | 2016-10-26 | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610945758.1A CN106434948B (en) | 2016-10-26 | 2016-10-26 | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106434948A CN106434948A (en) | 2017-02-22 |
| CN106434948B true CN106434948B (en) | 2019-10-18 |
Family
ID=58178423
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610945758.1A Expired - Fee Related CN106434948B (en) | 2016-10-26 | 2016-10-26 | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434948B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113234850B (en) * | 2021-06-28 | 2022-06-24 | 广西壮族自治区农业科学院 | Breeding method of drum leaf brown planthopper-resistant rice restorer |
| CN114292951B (en) * | 2022-01-17 | 2023-06-20 | 广西壮族自治区农业科学院 | InDel molecular marker linked with brown planthopper resistant major gene bph41 (t) of rice, and primers and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766625A (en) * | 2012-07-20 | 2012-11-07 | 广西大学 | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof |
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112014024861B1 (en) * | 2012-04-06 | 2021-11-16 | Monsanto Technology Llc | INSECT INHIBITOR POLYPEPTIDE, POLYNUCLEOTIDE ENCODING SAME, BACTERIAL HOST CELL, INSECT INHIBITORY COMPOSITION, GOODS AND METHODS OF CONTROLLING A HEMIPTERA PEST AND MAKING GOODS |
-
2016
- 2016-10-26 CN CN201610945758.1A patent/CN106434948B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766625A (en) * | 2012-07-20 | 2012-11-07 | 广西大学 | Molecular marker of rice major gene bph22 (t) resistant to brown planthoppers and application thereof |
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 小粒野生稻导入系对稻飞虱的抗性鉴定与分析;郭嗣斌 等;《植物遗传资源学报》;20121231;第13卷(第5期);第754-758页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106434948A (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10844399B2 (en) | Methods and compositions for Goss' Wilt resistance in corn | |
| US11041167B2 (en) | Methods and compositions for selecting soybean plants resistant to Phytophthora root rot | |
| CN103882146B (en) | Four-primer molecular marking method for identifying different genotypes of rice grain length gene GS3 | |
| CN105349684B (en) | With the molecular labeling of the anti-rough dwarf disease main effect QTL compact linkage of corn | |
| CN103882145B (en) | A kind of PCR molecule marking method identifying paddy rice grain length gene qGL3 allelic variation | |
| CN102181440B (en) | Molecular marker of brown planthopper-resistant major gene bph7 of rice and application thereof | |
| CN101914531A (en) | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof | |
| US20170022574A1 (en) | Molecular markers associated with haploid induction in zea mays | |
| CN106434948B (en) | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application | |
| CN111479460A (en) | Cabbage plants having resistance to downy mildew bulbs or heads | |
| Budak et al. | Potential uses of molecular markers in crop improvement | |
| AU2014268142B2 (en) | Disease resistance loci in onion | |
| JP7094681B2 (en) | Xanthomonas resistant Brassica oleracea plant | |
| CN114959096A (en) | SNP molecular marker related to mung bean weevil resistance and application of SNP molecular marker in genetic breeding | |
| Kim et al. | Screening of rice blast resistance genes from aromatic rice germplasms with SNP markers | |
| CN106480066B (en) | The new gene Wbph9 (t) and its molecule labelling method of a kind of Rice Resistance white backed planthopper and application | |
| CN108165649B (en) | Molecular marker of major gene qBph4(t) for resisting brown planthopper of rice and application thereof | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN104328168B (en) | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof | |
| CN109355426B (en) | Diagnostic molecular marker for detecting powdery mildew resistance gene Pm2a of wheat and application thereof | |
| CN115039694A (en) | Methods for improving resistance of plants to soybean cyst nematodes and compositions thereof | |
| Mir et al. | Association analysis for Fusarium wilt resistance in castor (Ricinus communis L.) | |
| CN111004858A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of single pod number of soybean and application of molecular marker primer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201211 Address after: No. 319, building a, No. 19, Guokai Avenue, Jiangnan District, Nanning City, Guangxi Zhuang Autonomous Region Patentee after: NANNING WILKING BIOLOGICAL TECHNOLOGY Co.,Ltd. Address before: 530007, 174 East University Road, the Guangxi Zhuang Autonomous Region, Nanning Patentee before: RICE Research Institute GUANGXI ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20191018 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |