CN111004857A - Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer - Google Patents
Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer Download PDFInfo
- Publication number
- CN111004857A CN111004857A CN201911140021.2A CN201911140021A CN111004857A CN 111004857 A CN111004857 A CN 111004857A CN 201911140021 A CN201911140021 A CN 201911140021A CN 111004857 A CN111004857 A CN 111004857A
- Authority
- CN
- China
- Prior art keywords
- soybean
- primer
- molecular marker
- branch number
- population
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 235000010469 Glycine max Nutrition 0.000 title claims abstract description 57
- 244000068988 Glycine max Species 0.000 title claims abstract description 57
- 239000003147 molecular marker Substances 0.000 title claims abstract description 33
- 230000002068 genetic effect Effects 0.000 claims abstract description 14
- 238000009395 breeding Methods 0.000 claims abstract description 12
- 230000001488 breeding effect Effects 0.000 claims abstract description 10
- 230000000694 effects Effects 0.000 claims abstract description 10
- 238000004458 analytical method Methods 0.000 claims abstract description 6
- 239000000463 material Substances 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000000034 method Methods 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 claims description 3
- 238000010367 cloning Methods 0.000 claims description 3
- 238000004043 dyeing Methods 0.000 claims description 3
- 238000001962 electrophoresis Methods 0.000 claims description 2
- 238000009396 hybridization Methods 0.000 claims description 2
- 229920002401 polyacrylamide Polymers 0.000 claims description 2
- 230000002194 synthesizing effect Effects 0.000 claims description 2
- 239000003550 marker Substances 0.000 abstract description 10
- 108090000623 proteins and genes Proteins 0.000 abstract description 10
- 241000196324 Embryophyta Species 0.000 abstract description 7
- 238000001514 detection method Methods 0.000 abstract description 4
- 238000005204 segregation Methods 0.000 abstract description 4
- 230000000996 additive effect Effects 0.000 abstract description 3
- 238000002474 experimental method Methods 0.000 abstract 1
- 230000002349 favourable effect Effects 0.000 abstract 1
- 238000011835 investigation Methods 0.000 abstract 1
- 108091092878 Microsatellite Proteins 0.000 description 12
- 108020004414 DNA Proteins 0.000 description 7
- 238000012360 testing method Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 238000003199 nucleic acid amplification method Methods 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 230000008030 elimination Effects 0.000 description 2
- 238000003379 elimination reaction Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 108010073771 Soybean Proteins Proteins 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 101150095418 crop gene Proteins 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 238000012268 genome sequencing Methods 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 230000010354 integration Effects 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 230000000877 morphologic effect Effects 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 230000002035 prolonged effect Effects 0.000 description 1
- 235000018102 proteins Nutrition 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 235000019710 soybean protein Nutrition 0.000 description 1
- 238000010186 staining Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 235000019871 vegetable fat Nutrition 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 238000012800 visualization Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Botany (AREA)
- Bioinformatics & Computational Biology (AREA)
- Evolutionary Biology (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker primer of a major QTL site of soybean branch number and application thereof, wherein F of C025 and JD18 is used as a primer2And F2:3Performing field experiments and character investigation on family segregation populations to obtain phenotypic data of the characters of the soybean branch number; binding F2Separating the genotype and genetic map of the population, carrying out QTL detection, and obtaining the major gene locus for controlling the soybean branch number on the M linkage group, wherein the contribution rate of the major gene locus to the soybean branch number is 15.7%, the additive effect is 1.2, and the dominant effect is 1.8. F derivatized to amphiphiles by the label3The generation carries out genotype analysis, and the average value of the number of the selected single plant branches carrying favorable genes exceeds the average value of the single plant carrying unfavorable genes, so that the marker is used for auxiliary selection to quickly select high-yield breeding.
Description
Technical Field
The invention relates to the technical field of molecular biology and genetic breeding, in particular to a molecular marker primer of a major QTL site of soybean branch number and application thereof.
Background
Soybean is one of seven crops in China, and is a main source of human vegetable fat and protein. At present, the consumption of soybeans in China is almost more than 1 hundred million tons every year, wherein 1400 million tons are produced by oneself, so that the supply and demand of the soybeans in China are short, the external dependence is high, and the imported quantity accounts for more than 60% of the total imported quantity of the soybeans in the world. Under the situation that the urbanization scale of China is continuously enlarged and the cultivated land area is further reduced, the improvement of the yield per unit of soybean is one of the most urgent tasks at present. With the increasing demand for soybean, it will become more and more important to improve soybean yield using genetic improvement of soybean varieties. Optimizing the morphological structure of plants and cultivating soybean varieties with optimal branches are the breeding targets that plant breeders always pursue.
With the rapid development of soybean genomics and sequencing technologies, soybean molecular marker research is also concerned. The molecular marker assisted breeding technology can effectively combine molecular genetics with traditional phenotype selection to achieve the purposes of improving the selection efficiency of target characters and shortening the breeding period. Simple Sequence Repeats (SSR) markers have been widely used in studies such as crop gene localization, molecular marker-assisted selection, material purity identification, etc. (Guojunjiao et al, 2019; Chuan Yiming et al, 2019). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, low cost and the like, and are widely introduced to molecular marker-assisted selection for a long time.
Most important agronomic characters (such as yield, quality, resistance and the like) show the genetic characteristics of quantitative characters, and phenotypes are continuously distributed and are easily influenced by environmental conditions, so that the conventional breeding method based on phenotypic selection has poor selection effect on complex quantitative characters, the breeding efficiency is low, and the breeding period is prolonged. Due to the development and integration of molecular marker technology and quantitative genetics, one has decomposed complex quantitative traits into single Quantitative Trait Loci (QTL) and then studied multiple genes that control quantitative traits like the study of quality traits. QTL positioning is that on the basis of genetic segregation population, quantitative trait phenotypic data of the segregation population are analyzed by using QTL mapping software by means of molecular markers and genetic maps, so that the position and the effect of quantitative trait genes on chromosomes are determined.
Disclosure of Invention
The invention aims to overcome the technical defects and provides a molecular marker primer of a major QTL site of the soybean branch number and application thereof, aims to screen the QTL site related to the soybean branch number through QTL positioning and is used for marker-assisted selection of soybean yield traits.
In order to achieve the purpose of the invention, the invention adopts the technical scheme that: the molecular marker primer of the major QTL site of the soybean branch number is as follows: GACATTACACTTAAAGGAGAGTGTTG, and TTGGACCCGTTATTTCCTGA.
Further, the primer is applied to soybean map-based cloning.
Furthermore, the primer is applied to soybean breeding.
Furthermore, the primer is applied to soybean molecular marker-assisted selection.
Further, the acquisition of the QTL site of the soybean branch number comprises the following steps:
(1) hybrid F Using the hybridization of Soybean materials C025 and JD18, which have very significant differences in the number of soybean branches1Generation selfing to produce F2Population and F thereof2:3Family members.
(2) Extraction of parent C025, JD18 and F by CTAB method2Isolating the total DNA of the leaves of the population;
(3) synthesizing SSR primers which are published and autonomously developed by soybeans, carrying out PCR amplification on parent DNA, carrying out electrophoresis on a product in modified polyacrylamide gel, distinguishing the size of a band after dyeing and developing, and screening polymorphic primers;
(4) using polymorphic primer pair F2Carrying out molecular marker analysis on the separated population to obtain genotype data;
(5) handle F2Inputting the genotype data of the segregating population into Joinmap4.0 software to construct a genetic linkage map;
（6）F2genotype data of the population, restricted to markers mapped to the genetic map, and F2Population and F thereof2:3Inputting branch number character data of the family into WinQTLcut2.5 software to carry out QTL positioning; wherein, the QTL positioned on the N linkage group can be repeatedly detected in the two groups, and the effect value and the contribution rate are larger.
The invention has the beneficial effects that: the invention locates the important QTL locus of the soybean material C025 and JD18 controlling the branch number, the genetic distance of the marker from the major gene locus is very close and the marker is a codominant SSR marker based on the genome sequence information, thereby being reliable and convenient to use. In the conventional breeding method, the phenotypic identification of the branch number character is required to wait for mature test seeds, which wastes time and labor and has low selection efficiency. By detecting the main effective gene locus of the branch number character, elimination can be carried out in the seedling stage, so that the production cost is saved and the selection efficiency is greatly improved. The main effective gene locus of the invention has definite position, and the detection method is convenient and rapid and is not influenced by the environment. The mark is used for detecting the offspring group derived from the amphiphilic sample, so that the effect is proved, and the detection method is convenient and quick and is not influenced by the environment. The number of branches can be predicted by detecting the molecular markers related to the branch number characters, so that the materials beneficial to improving the soybean yield can be accurately and quickly screened.
Drawings
FIG. 1 is F2And F2:3Frequency distribution graph of branch number when planting in different environment.
Detailed Description
The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The molecular marker primer of the major QTL site of the soybean branch number is as follows: GACATTACACTTAAAGGAGAGTGTTG, and TTGGACCCGTTATTTCCTGA.
F2Group genotype analysis, genetic linkage map construction and QTL positioning, which comprises the following steps:
(1) extraction of F by CTAB method2DNA of 182 individuals in the population;
(2) selecting polymorphic primer pair F2DNA from 182 individuals of the population was amplified by PCR, and the PCR products were subjected to polyacrylamide gel electrophoresis, visualization, staining and banding pattern interpretation. The molecular markers to which the invention relates are co-dominant markers, i.e. the differential bands show variations in position (i.e. amplification product size), and the banding patterns of the segregating population are read as A, B and H, respectively, indicating the banding patterns from C025, JD18 and heterozygous banding patterns, respectively.
(3) And (4) judging the band type of the molecular marker obtained after dyeing to obtain the genotype data of the molecular marker.
(4) Using the Joinmap4.0 software for F2The molecular marker genotype data of the population is subjected to linkage analysis to construct a molecular marker genetic linkage map, and 20 linkage populations are obtained.
(5) Based on the genetic map, F2Genotype data of the population, and F2Population and F thereof2:3QTL detection is carried out on branch number trait data of families by using QTLCart2.5 software, a main effect QTL locus with good repeatability is detected near an SSR marker SSR03-16293 (table 1) of an N chromosome, the LOD value and the contribution rate of the main effect QTL locus are both large (table 2), the contribution rate to the soybean branch number is 19.2%, the additive effect is 2.1, and the dominant effect is 1.7.
By utilizing the technical measures, a major QTL site for controlling the branching number of the soybean is finally obtained, the major QTL site is tightly linked with SSR marker SSR03-16293 which is autonomously developed by an applicant, and the primer sequence of the major QTL site is 5'-GACATTACACTTAAAGGAGAGTGTTG-3' aiming at SSR 03-16293F; SSR03-16293R: 5'-TTGGACCCGTTATTTCCTGA-3'. The contribution rate of the soybean protein to the number of soybean branches is 19.2 percent, the additive effect is 2.1 percent and the dominant effect is 1.7 percent according to analysis by using WinQTLCart2.5 software.
The application of the molecular marker SSR03-16293 primer of the major QTL site of the soybean branch number comprises the application of the primer provided by the invention, and the primer can be used for breeding the soybean branch number, map-based cloning of the soybean or auxiliary selection of the soybean molecular marker.
The primers designed aiming at the SSR03-16293 molecular marker are shown in Table 1, and a band with the size of 249bp is obtained by amplification in C025 by using the primers and is marked as A in the invention; a band obtained by amplification in JD18, the size of which is 243bp, is marked as B in the invention; two bands, 249bp and 243bp, were amplified in the heterozygotes.
TABLE 1 primer sequence of major QTL linkage marker SSR03-16293 for N linkage group branch number
| Marking | Forward primer | Reverse primer |
| SSR03-16293 | GACATTACACTTAAAGGAGAGTGTTG | TTGGACCCGTTATTTCCTGA |
TABLE 2 basic information of major QTL for the number of branches of N linkage groups
Constructing a soybean branch number segregation population and determining properties: in this example, the soybean material C025 and JD18 were used to hybridize, hybrid F1Generation selfing to produce F2Population and F thereof2:3. Planting F in Dongyang base of academy of agricultural sciences of Shanxi province in 20172Population, planting in 2018F2:3A family group. The branching number phenotype of both parents and segregating populations is identified by seed test after harvest at maturity. The test data show that: the mean values of the branch numbers in 2 environments are normally distributed, which shows the quantitative genetic characteristics of the branch number characters, and the results show that the branch number types are normally distributed and the variation range is wide, which proves that the branch numbers belong to the quantitative characters, as shown in figure 1.
Development and synthesis of primers: SSR primers utilized by applicants include two classes: one is the published primer sequences in published articles and soybean databases (https:// soybase. org /); the other is SSR primers developed by the applicant according to soybean genome sequencing information; all primers were synthesized by Biotechnology engineering (Shanghai) Inc.
The process of screening primer polymorphism includes the following steps:
(1) 10 DNA strains randomly selected from each parent were mixed in equal amounts and used as templates for screening primers.
(2) Carrying out PCR amplification on the parent DNA by using the dissolved primer,
PCR amplification reaction (20. mu.l):
template (diluted to 25 ng/. mu.l) 2. mu.l
Buffer (10×) 2 μl
dNTPs（10mM） 0.4 μl
Primer-F（10μM） 1 μl
Primer-R（10μM） 1 μl
Taq enzyme (5U/. mu.l) 0.2. mu.l
ddH2O 13.4 μl
PCR amplification procedure: 1) denaturation at 94 deg.C for 3 min; 2) 94 ℃ for 30s, 58 ℃ for 45s, and 72 ℃ for 45 s; 34 cycles of treatment; 3) stretching at 72 ℃ for 5 min;
(3) and (5) judging the gel electrophoresis band type.
The validity verification of the main QTL linkage marker SSR03-16293 of the branch number comprises the following steps:
(1) selecting F in field planting2F of Individual plant3Seeds are used for planting at multiple points for many years.
(2) After final singling, for F3Sampling the single plant, extracting the total DNA of the leaves, and analyzing the genotype of the major QTL of the branch number by utilizing a molecular marker SSR 03-16293.
(3) To F3The number of individual branches was recorded. The results showed that individuals with the 249bp band as the parent C025 had more branches (mean 3.0-4.1), while individuals with the 243bp band as the parent JD18 had fewer branches (mean 1.1-1.8) (Table 3). Therefore, the elimination in the seedling stage not only saves the production cost but also greatly improves the selection efficiency, and further, multi-branch strains can be quickly screened out for soybean breeding.
TABLE 3F selection assisted by SSR marker SSR03-162933Branch number test data of single plant
| Single plant | Genotype(s) | TY2017F2 | TY2018F23 |
| No.1 | |
4 | 3 |
| No.2 | |
2 | 5 |
| No.3 | |
3 | 4 |
| No.4 | |
2 | 2 |
| No.5 | |
2 | 7 |
| No.6 | |
1 | 3 |
| No.7 | |
6 | 3 |
| No.8 | |
4 | 4 |
| No.9 | |
3 | 6 |
| No.10 | |
4 | 5 |
| No.11 | |
2 | 4 |
| No.12 | |
2 | 4 |
| No.13 | |
3 | 3 |
| No.14 | |
4 | 5 |
| No.15 | |
3 | 4 |
| Mean value | 3.0 | 4.1 | |
| No.1 | |
3 | 2 |
| No.2 | |
0 | 0 |
| No.3 | |
1 | 2 |
| No.4 | |
0 | 2 |
| No.5 | |
1 | 1 |
| No.6 | |
2 | 1 |
| No.7 | |
1 | 3 |
| No.8 | |
1 | 2 |
| No.9 | |
3 | 5 |
| No.10 | |
1 | 3 |
| No.11 | |
0 | 1 |
| No.12 | |
1 | 1 |
| No.13 | |
1 | 3 |
| No.14 | |
0 | 1 |
| No.15 | |
3 | 1 |
| No.16 | |
0 | 1 |
| No.17 | |
1 | 1 |
| No.18 | |
1 | 2 |
| Mean value | 1.1 | 1.8 | |
| PValue of | 4.15E-05 | 5.40E-06 |
Note: A. b represents the molecular marker band patterns derived from the parents C025 and JD18, respectively.
The present invention and the embodiments thereof have been described above, but the description is not limited to the embodiments, but only one of the embodiments of the present invention, and the actual embodiments are not limited thereto. In summary, those skilled in the art should appreciate that they can readily use the disclosed conception and specific embodiments as a basis for designing or modifying other structures for carrying out the same purposes of the present invention without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> institute for crop variety resources of academy of agricultural sciences of Shanxi province
Molecular marker primer of <120> major QTL site of soybean branch number and application thereof
<140>2019111400212
<141>2019-11-20
<150>2019111400212
<151>2019-11-20
<160>2
<170>SIPOSequenceListing 1.0
<210>2
<211>26
<212>DNA
<213> Artificial sequence ("")
<400>2
gacattacac ttaaaggaga gtgttg 26
<210>2
<211>20
<212>DNA
<213> Artificial sequence ("")
<400>2
Claims (6)
1. The molecular marker primer of the major QTL site of the soybean branch number is characterized in that: the primer is as follows: GACATTACACTTAAAGGAGAGTGTTG, and TTGGACCCGTTATTTCCTGA.
2. The application of the molecular marker primer of the major QTL site of the soybean branch number is characterized in that: the primer is applied to soybean map-based cloning.
3. The molecular marker primer of major QTL site of soybean branching number as claimed in claim 1 and application thereof, characterized in that: the primer is applied to soybean breeding.
4. The molecular marker primer of major QTL site of soybean branching number as claimed in claim 1 and application thereof, characterized in that: the primer is applied to soybean molecular marker-assisted selection.
5. The molecular marker primer of the major QTL site of soybean branching number according to claim 1 or 2 and the application thereof, characterized in that: the acquisition of the QTL site of soybean branch number includes the following steps:
(1) hybrid F Using the hybridization of Soybean materials C025 and JD18, which have very significant differences in the number of soybean branches1Generation selfing to produce F2Population and F thereof2:3Family members.
(2) extracting parent C025, JD18 and F by CTAB method2Isolating the total DNA of the leaves of the population;
(3) synthesizing SSR primers which are published and autonomously developed by soybeans, carrying out PCR amplification on parent DNA, carrying out electrophoresis on a product in modified polyacrylamide gel, distinguishing the size of a band after dyeing and developing, and screening polymorphic primers;
(4) using polymorphic primer pair F2Carrying out molecular marker analysis on the separated population to obtain genotype data;
(5) handle F2Inputting the genotype data of the segregating population into Joinmap4.0 software to construct a genetic linkage map;
（6）F2genotype data of the population, restricted to markers mapped to the genetic map, and F2Population and F thereof2:3Inputting branch number character data of the family into WinQTLcut2.5 software to carry out QTL positioning; wherein, the QTL positioned on the N linkage group can be repeatedly detected in the two groups, and the effect value and the contribution rate are larger.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911140021.2A CN111004857B (en) | 2019-11-20 | 2019-11-20 | Molecular marker primer of soybean branch number major QTL locus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911140021.2A CN111004857B (en) | 2019-11-20 | 2019-11-20 | Molecular marker primer of soybean branch number major QTL locus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111004857A true CN111004857A (en) | 2020-04-14 |
| CN111004857B CN111004857B (en) | 2023-11-24 |
Family
ID=70112711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911140021.2A Active CN111004857B (en) | 2019-11-20 | 2019-11-20 | Molecular marker primer of soybean branch number major QTL locus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111004857B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111676308A (en) * | 2020-06-01 | 2020-09-18 | 中国农业科学院作物科学研究所 | QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) marker related to quantitative traits of soybean branches and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180255732A1 (en) * | 2017-03-09 | 2018-09-13 | Syngenta Participations Ag | Soybean cultivar cl1463812 |
| CN109234423A (en) * | 2017-07-04 | 2019-01-18 | 中国农业科学院作物科学研究所 | The application of soybean molecular labeling and its polymorphism in identification soybean branch amount character |
-
2019
- 2019-11-20 CN CN201911140021.2A patent/CN111004857B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180255732A1 (en) * | 2017-03-09 | 2018-09-13 | Syngenta Participations Ag | Soybean cultivar cl1463812 |
| CN109234423A (en) * | 2017-07-04 | 2019-01-18 | 中国农业科学院作物科学研究所 | The application of soybean molecular labeling and its polymorphism in identification soybean branch amount character |
Non-Patent Citations (1)
| Title |
|---|
| 杨玉花等: "大豆单株荚数QTL定位及整合", 华北农学报, vol. 34, no. 4, pages 90 - 95 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111676308A (en) * | 2020-06-01 | 2020-09-18 | 中国农业科学院作物科学研究所 | QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) marker related to quantitative traits of soybean branches and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111004857B (en) | 2023-11-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109825621B (en) | Wheat spikelet number QTL (quantitative trait locus) linked SNP (single nucleotide polymorphism) molecular marker and application thereof | |
| CN110295251B (en) | SNP molecular marker linked with wheat effective tillering number QTL and application thereof | |
| CN113774161B (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN114134247B (en) | Molecular marker closely linked with millet plant height character, primer sequence and application thereof | |
| CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN110004242B (en) | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN108624710B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN116516054A (en) | SNP molecular marker related to cabbage type rape dwarf trait and application thereof | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN111549172B (en) | Watermelon leaf posterior green gene linkage site and CAPS marker | |
| CN114164294A (en) | SNP site related to green-keeping property of Chinese cabbage and application thereof | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| CN108165657B (en) | SSR (simple sequence repeat) marker related to cucumber fruit length traits and application thereof | |
| CN111004858B (en) | Molecular marker primer of soybean single pod number major QTL (quantitative trait locus) locus and application thereof | |
| CN112779350A (en) | Molecular marker closely linked with wheat spikelet grain number QTLQGns | |
| CN111996280A (en) | SNP marker co-separated from cabbage type rape short stalk compact character and application | |
| CN116640878B (en) | Molecular marker of wheat floret number QTL per spike developed based on novel mode of multi-single-combined-standard-evidence and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |