CN105505981B - A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof - Google Patents
A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof Download PDFInfo
- Publication number
- CN105505981B CN105505981B CN201511022465.8A CN201511022465A CN105505981B CN 105505981 B CN105505981 B CN 105505981B CN 201511022465 A CN201511022465 A CN 201511022465A CN 105505981 B CN105505981 B CN 105505981B
- Authority
- CN
- China
- Prior art keywords
- soybean
- genetically engineered
- sequence
- dna
- engineered soybean
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
- C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8275—Glyphosate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01019—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
Abstract
The invention discloses a kind of resistance glyphosate genetically engineered soybeans and the preparation method and application thereof.The present invention provides a kind of methods for cultivating genetically engineered soybean to obtain genetically engineered soybean for the 50th, 543,767-50,543,792 interdigits that exogenous dna fragment is inserted into No. 19 chromosome of purpose soybean genome.Genetically engineered soybean of the invention has tolerance to the glyphosate of high dose, can be further by being improved with elite soybean strain cross to optimize other economical characters such as yield, quality etc..Detection method of the invention can identify the T-DNA of insertion and the bond area of plant genome DNA and further identify genetically engineered soybean and its cell, tissue, organ, the product of offspring etc..
Description
Technical field
The present invention relates to plant gene engineering technology or breeding field, in particular it relates to genetically engineered soybean and its
Using more particularly it relates to a kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof.
Background technique
Soybean (Glycine max (L.) .Merr) is oil crops important in the world and economic work originating from China
The main source of object and edible vegetable oil and phytoprotein.Weeds as the important component in Agro-ecological System,
The resources such as light, water, nutrient can be competed with crop, to make crop failure.Therefore, effectively preventing and kill off for soybean in field weeds is big
One of the key factor of beans high and stable yields.Traditional artificial weeding is time-consuming including manual uprooting weed and using simple farm implements weeding etc.
Effort, effect is low and is unable to large area and prevents and kill off in time.The use of chemical herbicide substantially increases the prevention and treatment efficiency of farmland weed,
But residual is serious in the soil, pollutes environment for traditional herbicide such as chlorimuronethyl, metsulfuron-methyl etc., limits these herbicides
Use scope.
Glyphosate (Glyphosate) is inner sucting conduction type, wide spectrum steriland herbicide, has broad weed-killing spectrum, efficient, low
It is the advantages that poison, noresidue, especially small to toxicity to man and livestock, it is most wide one of the herbicide of global application range.The effect of glyphosate
Mechanism is the resistance by irreversibly combining with EPSPS synthase in plant (5- enolpyruvylshikimate -3- phosphate synthase)
The metabolic pathway of shikimic acid in disconnected plant and microbial body, so as to cause plant intracellular metabolite process disorder, interferencing protein is closed
At preventing the formation of secondary metabolite, finally make plant dead；Another important role mechanism is the photosynthetic phosphoric acid for inhibiting plant
Change.As a kind of nonselective herbicide, glyphosate also injures soybean while killing weeds, therefore passes through transgenic technology
Resistance glyphosate genetically modified crops are cultivated, crop resistance glyphosate characteristic is assigned, is that cover crop is not injured by glyphosate, improve weeds
One of the important channel of integrated control efficiency.Existing research and genetically modified crops commercialized development history identity soybean are sweet to grass
The tolerance of phosphine herbicide will be useful traits for weed control, management.
For the tolerance for assigning crops glyphosate, researcher, which concentrates on to import into plant, can increase glyphosate tolerance
The gene of property, such as EPSPS, EPSPS gene typically from microorganism, the architectural characteristic of codase prevent glyphosate from
It is combined, thus their catalytic activity (PCT/CN03/00651) can still be maintained in the presence of glyphosate.
The glyphosate resistant transgenic crop overwhelming majority of Present Global commercial growth is for designed by EPSPS.
N-acetyl-transferase (GAT) can make glyphosate effectively be dropped by N- acetylation in plant tissue
Solution, so that herbicidal activity is lost, and the glyphosate of acetylation cannot be effectively combined with the intracorporal EPSPS of plant, to assign
Plant is given to the tolerance (2,005 1 0086626.X of ZL) of glyphosate.Further, since the degradation of glyphosate, utilizes N- acetyl
The means of change, which cultivate genetically modified crops, can apply glyphosate in the entire growth cycle of plant, not by growth and development stage
Limitation.
Summary of the invention
It is an object of the present invention to provide a kind of methods for cultivating genetically engineered soybean.
Method provided by the invention, for exogenous dna fragment is inserted into the 50th of No. 19 chromosome of purpose soybean genome the,
543,767-50,543,792 interdigits replace the 50th, 543,767-50,543, the 792 interdigit 24bp's of No. 19 chromosome
Base sequence obtains genetically engineered soybean；
The glyphosate resistance of the genetically engineered soybean is higher than the purpose soybean；
The exogenous dna fragment is to shift containing 5- enolpyruvylshikimate -3- phosphate synthase gene and N- acetyl
The DNA molecular of enzyme gene.
In the above method, the 5- enolpyruvylshikimate -3- phosphate synthase gene is G2-aroA；
The N-acetyl-transferase gene is GAT；
The exogenous dna fragment be in sequence table sequence 10 or sequence 1 from the nucleotide of 5 ' end 6217-10855.
In the above method, the exogenous dna fragment is that the purpose is big in the upstream flanking fragment of the genetically engineered soybean
The length extended from the 50,543,767th nucleotide to its updrift side of No. 19 chromosome of beans genome be 0 to
Any one DNA fragmentation of 5Kb；
The upstream flanking fragment is specially nucleotide shown in sequence 8 in sequence table；
The exogenous dna fragment is the purpose soybean genome the 19th in the downstream flanking fragment of the genetically engineered soybean
The length of number chromosome extended from the 50,543,792nd nucleotide to direction downstream be 0 to 5Kb it is any one
A DNA fragmentation；
The downstream flanking fragment is specially nucleotide shown in sequence 9 in sequence table.
The upstream flanking fragment is the piece in the transgenic soybean gene group close to the 5 ' end of exogenous dna fragment
Section；The downstream flanking fragment is the segment in the transgenic soybean gene group close to the 3 ' end of exogenous dna fragment；
In the above method, the exogenous dna fragment imports the mesh by the recombinant vector containing the exogenous dna fragment
Soybean；
The nucleotide sequence of the recombinant vector is specially sequence 1 in sequence table.
In the above method, the purpose soybean is conventional soy kind Jack.
It is also the scope of protection of the invention by genetically engineered soybean prepared by the above method.
Above-mentioned genetically engineered soybean is for T2 for genetically engineered soybean GE-J16 homozygous lines (being named as GE-J16) in 2015
It was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address: Beijing on December 29
The institute 3 of city Chaoyang District North Star West Road 1, Institute of Microorganism, Academia Sinica, postcode 100101), deposit number CGMCC
No.11686, classification naming are soybean Glycines max.
Another object of the present invention is to provide for detecting or assisting whether detection plant sample derives from above method system
Standby genetically engineered soybean or its offspring or for detect or assist detection product whether containing the above method preparation transgenosis
The method of soybean or its offspring.
Method provided by the invention, including the following steps: to detect in the genomic DNA of the plant sample or its product is
It is no containing DNA fragmentation A,
The DNA fragmentation A be it is following 1) or 2):
1) it is wanted by the exogenous dna fragment in claim 3 in the upstream flanking fragment of the genetically engineered soybean, right
Ask the exogenous dna fragment in 3 and the exogenous dna fragment in claim 3 in the downstream side of the genetically engineered soybean
Fin section composition；
2) with 1) shown in DNA fragmentation A homology be greater than 95% DNA fragmentation；
If the plant sample is or candidate is the genetically engineered soybean or its offspring containing the DNA fragmentation A；
If not containing the DNA fragmentation A, the plant sample is not or candidate is not the genetically engineered soybean or thereafter
Generation.
In the above method,
The method be it is following 1) or 2) or 3):
1) genomic DNA of direct Sequencing plant sample or product judges that the sequencing plant sample contains the DNA piece
Section A；
2) PCR amplification is carried out with primer pair 1 or primer pair 2, if there is purpose amplified production, the plant sample or product
Contain the DNA fragmentation A；
The primer pair 1 is that can expand to be held by the exogenous dna fragment 5 ' and close to its upstream flanking sequence
The primer pair of the DNA molecular first of part or all of segment composition；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand to hold containing the exogenous dna fragment 3 ' and close to its downstream flank sequence
The primer pair of the DNA molecular second of some or all of column composition；Its corresponding purpose amplified production is the DNA molecular second；
3) with can DNA molecular first or its DNA molecular second described in specific bond probe to the plant sample DNA to be measured into
Row Southern hybridization, obtains hybridized fragment if can hybridize, and the plant sample is from the genetically engineered soybean or thereafter
Generation.
In the above method, sequence in the single strand dna as shown in sequence 4 in sequence table of primer pair 1 and sequence table
The composition of single strand dna shown in 11；
The corresponding purpose specific fragment size of the primer pair 1 is 1529bp, and nucleotide sequence is specially sequence 14；
It is single shown in sequence 13 in the single strand dna as shown in sequence 12 in sequence table of primer pair 2 and sequence table
Ssdna molecule composition；
The corresponding purpose specific fragment size of the primer pair 2 is 2203bp, and nucleotide sequence is specially sequence 15；
3) in, the nucleotides sequence of the probe is classified as sequence 6.
The offspring of the genetically engineered soybean be with the genetically engineered soybean be transgenic line derived from parent, including with institute
It states genetically engineered soybean mutagenesis or the derivative offspring or the mutagenesis that hybridize with other soybean or filial generation derives again
Obtained offspring.
Third purpose of the present invention is to provide for whether test sample to derive from the genetically engineered soybean or its offspring
Kit.
Kit provided by the invention, including the 1) exogenous dna fragment, 2) primer pair 1,3) primer pair 2
Or 4) the probe.
Mentioned reagent box can also record the specification of the above method.
The offspring of the genetically engineered soybean be with the genetically engineered soybean be transgenic line derived from parent, including with institute
It states genetically engineered soybean mutagenesis or the derivative offspring or the mutagenesis that hybridize with other soybean or filial generation derives again
Obtained offspring.
Application of the genetically engineered soybean of above method preparation in breeding and/or production and processing.
The experiment proves that the present invention is used at 50,543,767 to 50,543,792 of No. 19 chromosome of soybean
It is inserted into exogenous dna fragment between setting, obtains the genetically engineered soybean containing exogenous dna fragment；Exogenous dna fragment includes glyphosate resistance
Gene G2-aroA and glyphosate degradation gene N-acetyl-transferase gene GAT gene；Genetically engineered soybean is higher than glyphosate resistance
The Wild-type soy of non-transgenosis.The genetically engineered soybean to high dose glyphosate have tolerance, can further by with it is excellent
Good soybean strain cross is improved to optimize other economical characters such as yield, quality, disease and insect resistance etc..The trans-exogenous DNA fragmentation
Soybean co-expresses Glyphosate resistance gene EPSPS (G2-aroA) and glyphosate degradation gene N-acetyl-transferase gene (GAT),
In seedling stage (cotyledon be unearthed and true leaf period undeployed) single plant to glyphosate isopropyl amine salt (Roundup) stoste of 1-1.5 μ l at
Reason has tolerance, and field has tolerance to about 3 to 12 liters of per hectare of glyphosate isopropyl amine salt (Roundup) processing.It obtains
The total standard metering for obtaining good Weeds distribution changes between per hectare 3-6 liter according to weed pressure.Transgenosis in the present invention
When even higher concentration (12 liter/hectare) is handled when soybean is managed at these concentrations, herbicide treatment holds plant vigor and leaf
The characters such as green do not generate any measurable influence.
Detailed description of the invention
Fig. 1 is T0It is identified for transgenic soy bean EPSPS (G2-aroA) and GAT gene PCR.
Fig. 2 is T0For the copy number analysis of genetically engineered soybean GE-J16 external source T-DNA.
Fig. 3 is T1For Resistance Identification of the genetically engineered soybean GE-J16 in the case where 3L/ hectares of glyphosate isopropyl amine salts are handled.
Fig. 4 is T2For genetically engineered soybean GE-J16 homozygous lines in the case where 12L/ hectares of glyphosate isopropyl amine salts are handled resistance.
Fig. 5 is T2For the PCR Molecular Detection of genetically engineered soybean GE-J16 homozygous lines.
Fig. 6 is T2For genetically engineered soybean GE-J16 homozygous lines external source T-DNA insertion point and Integration Mode schematic diagram.
Fig. 7 is that genetically engineered soybean GE-J16 verifies primer location diagram.
Fig. 8 is the genetically engineered soybean GE-J16 Progeny plants qualitative PCR amplification figure.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Soybean varieties are that (Jack, unified editing number: WDD01579 is recorded in the following literature: < < Chinese soybean kind Jack
Resource TOC (sequel 2) > >, the town Chang Ru, Sun Jianying, Qiu Lijuan, old dance chief editor, Chinese agriculture publishing house, 1996, Gong Zhongke
It is obtained from Institute of Crop Science, Chinese Academy of Agricultural Science, takes the cotyledonary node of Jack as the material of genetic transformation；
Agrobacterium tumefaciems (Agrobacterium tumefaciens) bacterial strain is Ag10, is recorded in the following literature: journey
Primary Study (D) the Hunan Normal University of big .AtMGT4 gene ectopic expression in rice, 2012；The public can be from Chinese agriculture
Crop science research institute of the academy of sciences obtains.
Soyabean tissue's culture medium is based on MS and B5 medium, 121 DEG C of sterilizing 15-20min.
Germination medium: B5+20g/L sucrose+8g/L agar powder, pH5.8；
Co-culture base: 1/10B5+30g/L sucrose+3.9g/L 2- (N- morpholine) ethanesulfonic acid (MES)+1.67mg/L 6-
BA+39mg/L acetosyringone+0.25mg/L gibberellin (GA3)+1mmol/L dithiothreitol (DTT)+1mmol/L sodium thiosulfate+
1mmol/L cysteine+5g/L agar powder, pH5.4；
Co-culture media: 1/10B5+30g/L sucrose+3.9g/L 2- (N- morpholine) ethanesulfonic acid (MES)+1.67mg/L 6-
BA+39mg/L acetosyringone+0.25mg/L gibberellin (GA3)；
Inducing clumping bud culture medium: B5+30g/L sucrose+8g/L agar powder+0.6g/L 2- (N- morpholine) ethanesulfonic acid
(MES)+1.67mg/L 6-BA+150mg/L cephalothin+400mg/L carbenicillin+15mg/L glyphosate,
pH5.7；
Bud elongation medium: MS+B5 organic+30g/L sucrose+8g/L agar powder+0.6g/L 2- (N- morpholine) ethanesulfonic acid
(MES)+50mg/L aspartic acid+50mg/L glutamine+0.3mg/L indole-3-acetic acid (IAA)+0.5mg/L gibberellin
(GA3)+150mg/L cephalothin+400mg/L carbenicillin+0.1mg/L zeatin (Ze)+5mg/L glyphosate,
pH5.7；
Root media: MS+B5 organic+30g/L sucrose+8g/L agar powder+0.6g/L 2- (N- morpholine) ethanesulfonic acid
(MES) 50mg/L aspartic acid+50mg/L glutamine, pH5.7；
Agrobacterium culture YEP and LB culture medium.
Acetosyringone, MS and B5 dehydrated medium and acetosyringone are sigma Products, 2- (N- morpholine) second
Sulfonic acid (MES), cephalothin, carbenicillin, agar powder, zeatin, aspartic acid, glutamine, gibberellin element (GA3) and
6- benzyl aminoadenine (6-BA) is Biodee Products, and sucrose is domestic reagent.
Following examples further describe materials and method used when obtaining the present invention and subsequent result, they are logical
It crosses illustration to provide, and their narration is not considered as prescription and limitation of the invention.
The genetic transformation of embodiment 1, genetically engineered soybean
1, the acquisition of recombinant vector
(1) composition sequence after G2-EPSPS (G2-aroA) gene optimization is added according to A.thaliana-rbcS, redesigned
PCR primer, upstream are XbaI with restriction enzyme site, and downstream has restriction enzyme site SacI, PCR amplification rbcS-G2-EPSPS
(aroA) segment (sequence 1 from the nucleotide of 5 ' end 8204-9784), is connected on T-A carrier, obtains plasmid prbcS-
G2-EPSPS (aroA), digestion and sequence verification.
(2) pBI 121 (Wang Huaxin, Cao Jiashu, to the quick of 121 expression vector establishment of the .pBI such as Xun and its transformed plant
Identify journal of Zhejiang university (agricultural and life science version), 2008,34 (2): 137-142；The public can be from the Chinese Academy of Agricultural Sciences
Crop science research institute obtains) and pCAMBIA2300 (the plant expression vector such as Gong Yuanyong, Feng Yongkun, Ni Wanchao
The building of pCAMBIA2300-35S-GUS-CaMVterm and verifying Chinese biological engineering magazine, 2013,33 (3): 86-91；It is public
Crowd can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science) III/EcoR of Hind, I double digestion is used, pBI 121 is had
The 3.0kb segment of p35S-GUS-Nos is connected into pCAMBIA2300, forms intermediate vector p35S-2300-GUS；
(3) after p35S-2300-GUS carrier and prbcS-G2-EPSPS (aroA) use I digestion of XbaI/Sac, 9.8kb's
P35S-2300-GUS carrier framework is connect with 1.5kb rbcS-G2-EPSPS (aroA) segment, obtains intermediate vector p35S-
2300-rbcS-G2-EPSPS (aroA), the carrier are by the rbcS-G2-EPSPS in prbcS-G2-EPSPS (aroA)
(aroA) the GUS segment in the corresponding restriction enzyme site of p35S-2301-GUS that segment replacement (2) obtains is formed.By p35S-
2300-rbcS-G2-EPSPS (aroA) removes selectable plant marker kan with XhoI single endonuclease digestion, collects 10.4kb intermediate vector and carries
Body skeleton.
(4) according to GAT gene chemical synthesis sequence after optimization, gene upstream and downstream has single endonuclease digestion site XhoI, after connection optimization
The intermediate vector carrier framework that GAT gene and above-mentioned (3) obtain is to recombinant vector pKT-rGE；Its total order is classified as sequence 1.
It is to lead peptide Rbcs and glyphosate resistance base from the nucleotide of 5 ' end 9789-10360 in sequence table in sequence 1
Because the enhanced 35S of promoter of Rbcs-EPSPS (G2-aroA), the nucleotide of 5 ' end 8204-9784 be lead peptide Rbcs and
Glyphosate resistance gene Rbcs-EPSPS (G2-aroA), the nucleotide of 5 ' end 7926-8196 are Glyphosate resistance gene
EPSPS (G2-aroA) terminator NOS, the nucleotide of 5 ' end 6903-7673 are glyphosate degradation gene N-acetyl-transferase
Genes amplification type 35S, the nucleotide of 5 ' end 6456-6896 are glyphosate degradation gene N-acetyl-transferase gene GAT, 5 '
The nucleotide of end 6248-6455 is glyphosate degradation gene N-acetyl-transferase gene terminator CaMV 35S polyA.
2, the acquisition of genetically engineered soybean
1) acquisition of agrobacterium tumefaciens is recombinated
The recombinant vector pKT-rGE that above-mentioned 1 is obtained is imported in Agrobacterium tumefaciems Ag10, obtains recombinational agrobacterium Ag10/
pKT-rGE。
2) acquisition of regenerable soybean plant
Recombinational agrobacterium Ag10/pKT-rGE converts the cotyledonary node explant of soybean (Glycine max) Jack of in vitro culture
Body, Agrobacterium and explant co-culture 3 days after infecting altogether, induce under the screening environment containing glyphosate through neomorph approach
Transgenic plant, inducing clumping bud stage use the glyphosate (Sigma company) of 15mg/L concentration as selective agent, induce 3-6
Week；Bud induction period is extended, uses the glyphosate (sigma company) of 5mg/L concentration as selective agent, induces 4-8 weeks；Induction and
The elongation stage replaces a subculture every 2 weeks, regenerates transformed cells, for the fast-growth for inhibiting Agrobacterium tumefaciems, is inducing
With the carbenicillin of the cephalothin and 400mg/L concentration that add 150mg/L concentration in elongation medium respectively, bud to be extended
When elongation is to 4-6cm, it is transferred to root induction in root media, obtains regenerable soybean plant.
3) identification of genetically engineered soybean
(1)T0The glyphosate of transgenic line screens
Transplantation of Regenerated Plantlets is continued to cultivate in incubator into potting, illumination condition is that 18h illumination and 6h are dark, training
After supporting 1 week, tender young leaves is selected to be marked with marking pen, and puts and apply 1 μ l glyphosate isopropyl amine salt (Roundup) stoste to T0Again
Raw plant carries out glyphosate tolerant analysis.After glyphosate point applies 2 weeks, the reaction of each plant pair glyphosate processing is investigated,
In 1 transformant GE-J16 processing applied to 1 μ l glyphosate isopropyl amine salt (Roundup) stoste point show stronger tolerance,
Vigorous compared with adjoining tree (Jack) growth, growth vigor is unaffected, and blade does not find the symptom of flavescence chlorisis, transformant GE-
J16 is T0For genetically engineered soybean, T0It is higher than Wild-type non-transgenic soybean Jack for the glyphosate resistance of genetically engineered soybean.
(2) PCR is screened
Polymerase chain reaction (PCR) is used to identify the presence of EPSPS (G2-aroA) and GAT gene, from number GE-J16
T0It is placed in 2mL centrifuge tube for the fresh tender leaf of 20-50mg is collected on Transgenic soybean plants for extracting plant base
The method introduced by a group DNA, DNA extraction method referring to Murray and Thompson (1980).It is produced with Takara company
EX-Taq PCR kit carries out PCR reaction, 20 μ l PCR reaction system 2 μ containing 10 × EX-Taq buffer referring to specification
2 μ l of l, 2mM dNTPs, each 0.2 μ l of 0.5 μ l, EX-Taq enzyme of 10 μM of gene specific upstream and downstream primer, moisturizing to 20 μ l；
PCR response procedures are 94 DEG C, 4min (1 circulation)；94 DEG C, 30s (denaturation), 60 DEG C, 30s (annealing), 72 DEG C, 45s (extension) 35
Circulation；72 DEG C of (extending eventually) 10min (1 circulation).
The primer pair (EP-F1/R1) of EPSPS (G2-aroA) is expanded, can amplify 743bp product is the positive:
5 '-ACCAGGAGCCTTGTACCTTGAG-3 ' (sequence 2) and 5 '-ATCGGGTTCGATCAGGTAATC-3 ' (sequence
3)
The primer pair (GAT-F2/R2) of GAT gene is expanded, can amplify 257bp product is the positive:
5 '-GCGATTTACTTCGTGGTGCAT-3 ' (sequence 4) and 5 '-GTAGTAGCCTGAGGCGGATGTC- ' (sequence
5)
PCR qualification result is as shown in Figure 1, M is 200bp DNA Marker；1 compares for wild type Jack；2 be sterile water
Control；3 be plasmid pKT-rGE positive control；4 be T0For genetically engineered soybean GE-J16；The result shows that number is turning for GE-J16
The PCR result of two foreign genes of transgenic soybean is positive, show to be transferred to foreign gene EPSPS (G2-aroA) and
GAT。
There is the genetically engineered soybean of glyphosate resistance with traditional cultivation and the breeding of breeding method, harvest the genetically engineered soybean
Seed.
The glyphosate resistance analysis of embodiment 2, genetically engineered soybean
To obtained T in embodiment 10Hair is analyzed for the genetically engineered soybean GE-J16 glyphosate resistance for carrying out continuous multi-generation
It is existing, there is significant resistance to glyphosate than non-transgenic wild type control Jack, specific as follows:
Collect T0For genetically engineered soybean GE-J16 seed, sowing obtains T1For genetically engineered soybean GE-J16, first to third
The compound leaf phase sprays 3L/ hectares (200ml/ mus) glyphosate isopropyl amine salt (Roundup) solution to it, investigates phytotoxicity after 2 weeks.
Not anti-plant phenotype is leaves water loss chlorisis, leaf roll song, shrinkage, apical meristem necrosis, until whole strain is dead；
Resistant plant phenotype is that growth tendency is vigorous, blade not chlorisis, not curled, not shrinkage.
T1For genetically engineered soybean GE-J16 result as shown in figure 3, A: negative control Jack is untreated；B: negative control Jack
Spray 3L/ hectares (200ml/ mus) of glyphosate isopropyl amine salt (Roundup) solution processing；C:T1For genetically engineered soybean GE-J16
Spray 3L/ hectares (200ml/ mus)) glyphosate isopropyl amine salt (Roundup) solution processing (1,2,5:T1For genetically engineered soybean
The single plant of GE-J16 resistance glyphosate；3,4:T1For the single plant of genetically engineered soybean GE-J16 not resistance glyphosate) show T1For transgenosis
Soybean GE-J16 is first to the third compound leaf phase to 3L/ hectares (200ml/ mus) glyphosate isopropyl amine salt (Roundup) solution
There is separation in the drug resistance for spraying processing, glyphosate sprays the T survived after processing1Single plant is compared with the negative wild type that glyphosate is handled
Check variety Jack resistance is obvious；Compared with the untreated negative control Jack of glyphosate, resistance T1For genetically engineered soybean GE-
J16 plant plant height, growth tendency are not inhibited, and relatively compare indifference, blade not chlorisis.
Using traditional breeding method, resistance T is collected1For the seed of genetically engineered soybean GE-J16, sowing obtains T2In generation, turns base
Because of soybean GE-J16.
To T2The grass for carrying out 3L/ hectares, 6L/ hectares and 9L/ hectares respectively for genetically engineered soybean GE-J16 difference strain is sweet
Phosphine isopropyl amine salt (Roundup) solution sprays identification, therefrom selects the unseparated T of resistance2For genetically engineered soybean as T2In generation, turns base
Because of soybean GE-J16 homozygous lines, it is named as GE-J16；
To T212 liter/hectare glyphosate isopropyls are carried out for genetically engineered soybean GE-J16 homozygous lines and wild type control Jack
Amine salt (Roundup) solution sprays processing, and it is sweet to grass that transgenic homozygous strain GE-J16 and its negative control Jack is investigated after 2 weeks
The phytotoxicity reaction of phosphine.
As a result as shown in figure 4, above-mentioned homozygous lines are without the withered death of plant, above-mentioned homozygous lines growth is not compared with negative control
It is suppressed, blade not chlorisis, not shrinkage, the glyphosates phytotoxicity reaction such as no young leaves yellow.Under above-mentioned sprayed dose, Jack does not have
Standby any resistance, plant is all withered after 2 weeks, dead；
Above-mentioned T2There is important breeding prospect and utility value for genetically engineered soybean GE-J16 homozygous lines.
Resistance glyphosate genetically engineered soybean GE-J16 obtains homozygous lines, and anti-performance stablizes heredity in offspring.
Exogenous DNA copy number and molecule integrate stability analysis in embodiment 3, genetically engineered soybean
1, the copy number of the external source T-DNA integrated
Pass through the Southern to the restriction fragment extended except the left and right border sequence of conversion carrier used
Blotting analysis measurement T0For the copy number for the exogenous dna fragment integrated in the genome of genetically engineered soybean GE-J16.
The probe of Southern blotting analysis is to set from the vector DNA sequence of carrier T-DNA regional choice 338bp
It counts probe (sequence 6), referring to the PCR method DIG labelling kit operation instruction of Beijing Mei Laibo medical science and technology Co., Ltd production
Book prepares the probe of digoxigenin labeled.
Referring to the digoxin hybridization kit operation instructions of Beijing Mei Laibo medical science and technology Co., Ltd production, weight used
Group plasmid pKT-rGE is positive control, and the genomic DNA of the genetic transformation receptor Jack of non-transgenic wild type is negative right
According to.
Extract the T that above-described embodiment 2 obtains0For the genomic DNA of genetically engineered soybean GE-J16, with the limitation of 5 units
Property restriction endonuclease in the total volume of 200 μ l in 37 DEG C digest 50-70 μ g genomic DNA 5-10h, make digestion DNA precipitating simultaneously
It is redissolved in the sterile water of 25 μ l, every sample adds 6 μ l 6 × Loading Buffer, DNA, positive control, the yin of digestion
Property control, standard molecular size mark (DNA molecular weight marker III, Digoxigenin-labeled
(Roche) and λ Hind III marker), separate DNA on the agarose gel electrophoresis of 0.8-1.0% under 45V voltage.Use bromine
Change second ingot and observe DNA, and carries out camera shooting record including fluorescence scale.Then Whatman Schleicher&Schuell is referred again to
The operation instructions of the Rapid Downward transfer system of company, DNA are transferred on Hybond nylon membrane, institute
It states and hybridizes with probe, show results of hybridization (Beijing Mei Laibo medical science and technology Co., Ltd) with chemical explicit representation.
Copy number measurement can be carried out by the analysis to the genomic DNA for closing on right boundary region, with restricted interior
Enzyme cutting DraI, HindIII, XbaI digested genomic dna.
Southern blotting results of hybridization after different digestions is as shown in Fig. 2, 1:DIG Marker, 2: plasmid
PKT-rGE positive control, 3: negative control Jack-HindIII, 4:GE-J16-DraI (DraI digestion T0For genetically engineered soybean
GE-J16), 5:GE-J16-HindIII (HindIII digestion T0For genetically engineered soybean GE-J16), 6:GE-J16-XbaI (XbaI
Digestion T0For genetically engineered soybean GE-J16)；The result shows that the exogenous DNA of integration is single copy insertion.
2, the PCR analysis of homozygous resistant strain
Extract obtained T in embodiment 22For the genome of the different single plants of genetically engineered soybean GE-J16 homozygous lines
DNA, in the PCR reaction system of 20ul, the genomic DNA of about 50ng is used as template DNA, and using expanding in embodiment 1
EPSPS (G2-aroA) primer pair (EP-F1/R1) and amplification GAT gene primer carry out PCR amplification to (GAT-F2/R2) respectively.
As a result as shown in figure 5,1:200bp DNA marker；2: wild type Jack control；3: sterile water control；4: plasmid
PKT-rGE is positive control；5-25:T2For genetically engineered soybean GE-J16 homozygous lines difference single plant；The result shows that T2In generation, turns base
Because all single plants of soybean GE-J16 homozygous lines are in the PCR positive.Glyphosate resistance can be completely corresponding with the PCR molecule positive.
Exogenous DNA molecule insertion position determines in embodiment 4, genetically engineered soybean
T is extracted with the CTAB method of improvement2For genetically engineered soybean GE-J16 homozygous lines genomic DNA, with what is announced
Soybean genome (http://phytozome.jgi.doe.gov/pz/portal.html#！Info? alias=Org_Gmax；
It 2010) is reference, to above-mentioned T2Full-length genome weight sequencing analysis is carried out for genetically engineered soybean GE-J16 homozygous lines, passes through comparison
Analysis is found in T2For in genetically engineered soybean GE-J16 homozygous lines, T-DNA is inserted into No. 19 chromosome physical locations of soybean and is
50,543,767-50,543,792 interdigits are not inserted into known soybean endogenous gene area.Genome is substituted in T-DNA integration
Upper 24bp base sequence, being replaced sequence is 5 ' GATCAGTAATATGAAACTTATTGT 3 ' (sequence 7), this is replaced sequence
Soybean endogenous gene area is not destroyed.
PCR amplification is carried out to the bond area of the genomic DNA of external source T-DNA and insertion position to verify external source T-DNA
As a result insertion position further demonstrates the correctness of T-DNA insertion point, T2For genetically engineered soybean GE-J16 homozygous lines T-
DNA is inserted into result as shown in fig. 6, T2Upstream is held for the 5 ' of the external source T-DNA being inserted into genetically engineered soybean GE-J16 homozygous lines
Flanking sequence is sequence 8, and 3 ' the end downstream flanking sequences of external source T-DNA are sequence 9.
Further, by sequencing analysis, insertion T2 is obtained for the complete external source T-DNA sequence of genetically engineered soybean GE-J16
For sequence 10, integrating external source insertion exogenous DNA molecule is 4639bp, and genetically engineered soybean exogenous DNA molecule integration is free of carrier
Frame sequence.
The above results show T2 for genetically engineered soybean GE-J16 homozygous lines be Glyphosate resistant plants, through flanking sequence
It is analyzed with insertion point, is that sequence 10 in sequence table or sequence 1 is non-from the nucleotides inserted of 5 ' end 6217-10855
50th, 543,767-50,543,792 interdigits of No. 19 chromosome of transgenosis Wild-type soy Jack genome replace
The 50th, 543,767-50 of No. 17 chromosome, the base sequence of 543,792 interdigit 24bp obtain genetically engineered soybean, and from
The nucleotides sequence of 50,543,767 upstreams and the upstream flanking fragment close to the 50th, 543,767 nucleotide is classified as sequence 8,
Sequence is classified as from the nucleotides sequence in the 50,543,792nd downstream and the downstream flanking fragment close to the 50,543,792nd nucleotide
Column 9；Sequence 10 is the DNA containing 5- enolpyruvylshikimate -3- phosphate synthase gene and N-acetyl-transferase gene points
Son.
As can be seen that the insertion position of exogenous DNA molecule and the flanking sequence of two sides can be used to identify whether be or source
From intended transgenic soybean (T2 is for genetically engineered soybean GE-J16 homozygous lines).
During T2 has been preserved on December 29th, 2015 for genetically engineered soybean GE-J16 homozygous lines (being named as GE-J16)
State's Microbiological Culture Collection administration committee common micro-organisms center (abbreviation CGMCC, address: BeiChen West Road, Chaoyang District, BeiJing City 1
Number institute 3, Institute of Microorganism, Academia Sinica, postcode 100101), deposit number is CGMCC No.11686, and classification naming is
Soybean Glycines max.
Embodiment 5, the method for detecting genetically engineered soybean
According to the position of the exogenous DNA molecule insertion in embodiment 4 and its upstream and downstream flanking gene sequence, exploitation specificity
Primer establishes T2 for genetically engineered soybean GE-J16 homozygous lines and its selfing or the qualitative PCR identification method of filial generation.
The external source at 5 ' ends Soybean genomic DNA upstream flanking sequence (sequence 8) and insertion of the external source T-DNA according to insertion
GAT genetic fragment design primer JackP-1 and GAT-F2 (primer pair 1) in T-DNA (sequence 10)；External source T- according to insertion
3 ' end Soybean genomic DNA downstream flanking sequence (sequences of EPSPS genetic fragment and the external source T-DNA of insertion in DNA (sequence 10)
Column 9) design primer G2EP-R2 and JackP-2 (primer pair 2) (Fig. 7).
Sequence is as follows:
Primer pair 1:
Primer JackP-1:5'CAGCTAAAGATATAGTGTCAAGAACCT 3'(sequence 11)
Primer GAT-F2:5'GCGATTTACTTCGTGGTGCAT 3'(sequence 4).
Primer pair 2:
Primer G2EP-R2:5'ACCACCATCAATCTCGAAACG 3'(sequence 12)
Primer JackP-2:5'CAATTCAAGACAGAAAATACGATGA 3'(sequence 13).
The extraction of Soybean genomic DNA and PCR reaction carries out PCR with above-mentioned primer pair 1 referring to the method in embodiment 1
Root, stem, leaf, flower and the seed of amplification, water and non-transgenic WT lines are without amplified band, T2For genetically engineered soybean GE-J16
The roots of homozygous lines, stem, leaf, flower and seed genomic DNA amplify target stripe, as a result as shown in Figure 8 A, M:
200bpDNA Marker；1,3,5,7,9:T2For the root of genetically engineered soybean GE-J16 homozygous lines, stem, leaf, flower, seed；2,4,
6,8,10: root, stem, leaf, flower, the seed of non-transgenic Wild-type soy Jack；11: sterile water.Amplification shows T2In generation, turns
Transgenic soybean GE-J16 homozygous lines root, stem, leaf, flower, seed genomic DNA amplification obtain specificity 1529bp purpose
Segment, the specific nucleotide sequence of the target fragment is as shown in sequence 14.
The extraction of Soybean genomic DNA and PCR reaction carries out PCR with above-mentioned primer pair 2 referring to the method in embodiment 1
Root, stem, leaf, flower and the seed of amplification, water and non-transgenic WT lines are without amplified band, T2For genetically engineered soybean GE-J16
The roots of homozygous lines, stem, leaf, flower and seed genomic DNA amplify target stripe, as a result as shown in Figure 8 B, M:
200bpDNA Marker；1,3,5,7,9:T2For the root of genetically engineered soybean GE-J16 homozygous lines, stem, leaf, flower, seed；2,4,
6,8,10: root, stem, leaf, flower, the seed of non-transgenic Wild-type soy Jack；11: sterile water.Amplification shows T2In generation, turns
Transgenic soybean GE-J16 homozygous lines root, stem, leaf, flower, seed genomic DNA amplification obtain specificity 2203bp purpose
Segment, and the specific nucleotide sequence of the target fragment is as shown in sequence 15.
From the above, it can be seen that the genomic DNA for extracting sample to be tested is carried out as template with primer pair 1 and primer pair 2
PCR amplification detects pcr amplification product:
If the amplification of primer pair 1 obtains 1529bp target fragment or the amplification of primer pair 2 obtains 2203bp target fragment, to be checked
Surveying genetically engineered soybean is the T2 of the acquisition of embodiment 4 for genetically engineered soybean ZH10-6 homozygous lines；
If not above situation, then genetically engineered soybean to be measured is not the T2 of the acquisition of embodiment 4 for genetically engineered soybean ZH10-6
Homozygous lines.
Test explanation carries out PCR amplification using the flanking sequence of genetically engineered soybean GE-J16, and detection that can be specific turns
The characterization of molecules of transgenic soybean GE-J16, for identifying above-mentioned genetically engineered soybean and its offspring, cell, seed, nutrition organs etc..
Claims (10)
1. a kind of method for cultivating genetically engineered soybean, for exogenous dna fragment is inserted into No. 19 chromosome of purpose soybean genome
The 50th, 543,767-50,543,792 interdigits, replace the 50th, 543,767-50,543,792 interdigits of No. 19 chromosome
The base sequence of 24bp, obtains genetically engineered soybean；
The glyphosate resistance of the genetically engineered soybean is higher than the purpose soybean；
The exogenous dna fragment is to contain 5- enolpyruvylshikimate -3- phosphate synthase gene and N-acetyl-transferase base
The DNA molecular of cause.
2. according to the method described in claim 1, it is characterized by:
5- enolpyruvylshikimate -3- the phosphate synthase gene is G2-aroA；
The N-acetyl-transferase gene is GAT；
The exogenous dna fragment be in sequence table sequence 10 or sequence 1 from the nucleotide of 5 ' end 6217-10855.
3. method according to claim 1 or 2, it is characterised in that: the exogenous dna fragment is in the genetically engineered soybean
Upstream flanking fragment is for No. 19 chromosome of the purpose soybean genome to thereon from the 50,543,767th nucleotide
Any one DNA fragmentation that the length that roam all around the would is obtained to extension is 0 to 5Kb；
The exogenous dna fragment is the purpose soybean genome the 19th dye in the downstream flanking fragment of the genetically engineered soybean
Any one DNA that the length of colour solid extended from the 50,543,792nd nucleotide to direction downstream is 0 to 5Kb
Segment.
4. method according to claim 3, it is characterised in that:
The upstream flanking fragment is nucleotide shown in sequence 8 in sequence table；
The downstream flanking fragment is nucleotide shown in sequence 9 in sequence table.
5. method according to claim 1 or claim 2, it is characterised in that: the exogenous dna fragment is by containing the exogenous DNA
The recombinant vector of segment imports the purpose soybean；
The nucleotide sequence of the recombinant vector is specially sequence 1 in sequence table；
The purpose soybean is soybean varieties Jack.
6. for detecting or assisting whether detection plant sample derives from the transgenosis of any the method preparation of claim 1-5
Soybean or its offspring or for detecting or assisting whether detection product containing claim 1-5 any the method preparation turns base
Because of soybean or the method for its offspring, includes the following steps: to detect in the genomic DNA of the plant sample or product and whether contain
DNA fragmentation A,
The DNA fragmentation A be it is following 1) or 2):
1) by the exogenous dna fragment in claim 3 in the upstream flanking fragment of the genetically engineered soybean, claim 3
In the exogenous dna fragment and claim 3 in the exogenous dna fragment the genetically engineered soybean downstream side flap
Duan Zucheng；
2) with 1) shown in DNA fragmentation A homology be greater than 95% DNA fragmentation；
If the plant sample or product are or candidate is the genetically engineered soybean or its offspring containing the DNA fragmentation A；
If not containing the DNA fragmentation A, the plant sample or product be not or candidate be not the genetically engineered soybean or its
Offspring.
7. according to the method described in claim 6, it is characterized by:
The method be it is following 1) or 2) or 3):
1) genomic DNA of direct Sequencing plant sample or its product judges whether contain in the sequencing plant sample or product
There is the DNA fragmentation A；
2) PCR amplification is carried out with primer pair 1 or primer pair 2, if there is purpose amplified production, the plant sample or product contain
The DNA fragmentation A；
The primer pair 1 is that can expand to be held by the exogenous dna fragment 5 ' and close to its upstream flanking sequence part
Or the primer pair of the DNA molecular first of whole segment compositions；Its corresponding purpose amplified production is the DNA molecular first；
The primer pair 2 is that can expand to hold containing the exogenous dna fragment 3 ' and close to its downstream flanking sequence
The primer pair of the DNA molecular second partly or entirely formed；Its corresponding purpose amplified production is the DNA molecular second；
3) probe of the DNA molecular first described in energy specific bond or its DNA molecular second treats measuring plants sample or product DNA is carried out
Southern hybridization, obtains hybridized fragment if can hybridize, and the plant sample or its product derive from the genetically engineered soybean
Or its offspring.
8. according to the method described in claim 7, it is characterized by:
2) single shown in sequence 4 in the single strand dna as shown in sequence 11 in sequence table of primer pair 1 and sequence table in
Ssdna molecule composition；
Single stranded DNA shown in sequence 13 in the single strand dna as shown in sequence 12 in sequence table of primer pair 2 and sequence table
Molecular composition；
3) in, the nucleotides sequence of the probe is classified as sequence 6；
It is transgenic line derived from parent that the offspring of the genetically engineered soybean, which is with the genetically engineered soybean, including with described turn
Transgenic soybean mutagenesis or the derivative offspring hybridized with other soybean or the mutagenesis or filial generation are derived to obtain again
Offspring.
9. whether deriving from the genetically engineered soybean or the kit of its offspring for test sample or product comprising: 1) it weighs
Benefit require exogenous dna fragment described in 6,2) primer pair 1 described in claim 7,3) primer pair 2 described in claim 7 or
4) probe described in claim 7；
The kit also specifically records the specification of any the method in claim 1-8.
10. application of the genetically engineered soybean of any the method preparation in breeding and/or production and processing in claim 1-5.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511022465.8A CN105505981B (en) | 2015-12-30 | 2015-12-30 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
| PCT/CN2016/083001 WO2017113573A1 (en) | 2015-12-30 | 2016-05-23 | Glyphosate-resistant transgenic soybean and preparation method and application thereof |
| ARP160104073A AR107260A1 (en) | 2015-12-30 | 2016-12-29 | A TRANSGENIC SOYBEAN RESISTANT TO GLYPHOSATE AND THE SAME PREPARATION METHOD |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511022465.8A CN105505981B (en) | 2015-12-30 | 2015-12-30 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105505981A CN105505981A (en) | 2016-04-20 |
| CN105505981B true CN105505981B (en) | 2018-12-25 |
Family
ID=55714274
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511022465.8A Active CN105505981B (en) | 2015-12-30 | 2015-12-30 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN105505981B (en) |
| AR (1) | AR107260A1 (en) |
| WO (1) | WO2017113573A1 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105505981B (en) * | 2015-12-30 | 2018-12-25 | 中国农业科学院作物科学研究所 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
| CN106350532A (en) * | 2016-08-28 | 2017-01-25 | 浙江大学 | Glyphosate-resistant Fusion Gene, Encoding Protein and Application |
| CN108179147B (en) * | 2018-02-03 | 2022-02-11 | 吉林省农业科学院 | High-oleic acid transgenic soybean event E2D9050 exogenous insert flanking sequence and application thereof |
| CN108179146B (en) * | 2018-02-03 | 2022-02-11 | 吉林省农业科学院 | Disease-resistant transgenic soybean event B5C9120-3 exogenous insert flanking sequence and application thereof |
| CN108239639B (en) * | 2018-02-03 | 2022-02-11 | 吉林省农业科学院 | Flanking sequence of exogenous insert of stress-tolerant transgenic soybean event WB1 and application thereof |
| CN112359123A (en) * | 2020-10-10 | 2021-02-12 | 浙江省农业科学院 | Real-time fluorescence quantitative detection method for g10evo-epsps transgenic soybean and kit thereof |
| CN112322631B (en) * | 2020-11-06 | 2022-08-16 | 武汉天问生物科技有限公司 | Cultivation method of glyphosate-resistant transgenic soybean |
| CN114807221B (en) * | 2022-04-28 | 2023-06-06 | 宁波大学科学技术学院 | Mutant, protein and expression vector of rice root elongation regulatory gene OsDRP1C and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1769488A (en) * | 2005-10-21 | 2006-05-10 | 天津师范大学 | Transgenic soybean detection method and the primer |
| CN101100676A (en) * | 2007-06-15 | 2008-01-09 | 中国农业科学院生物技术研究所 | Bivalent expression carrier for culturing anti-glyphosate plants |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101278053A (en) * | 2005-07-29 | 2008-10-01 | 孟山都技术有限公司 | Development of novel germplasm using segregates from transgenic crosses |
| TW201231655A (en) * | 2010-12-15 | 2012-08-01 | Syngenta Participations Ag | Soybean event SYHT04R and compositions and methods for detection thereof |
| CN104450755B (en) * | 2014-11-14 | 2017-07-11 | 重庆大学 | The application of a kind of Asiatic migrotory locust atp synthase α subunit genes and its dsRNA in control of insect |
| CN105505981B (en) * | 2015-12-30 | 2018-12-25 | 中国农业科学院作物科学研究所 | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof |
-
2015
- 2015-12-30 CN CN201511022465.8A patent/CN105505981B/en active Active
-
2016
- 2016-05-23 WO PCT/CN2016/083001 patent/WO2017113573A1/en active Application Filing
- 2016-12-29 AR ARP160104073A patent/AR107260A1/en unknown
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1769488A (en) * | 2005-10-21 | 2006-05-10 | 天津师范大学 | Transgenic soybean detection method and the primer |
| CN101100676A (en) * | 2007-06-15 | 2008-01-09 | 中国农业科学院生物技术研究所 | Bivalent expression carrier for culturing anti-glyphosate plants |
Non-Patent Citations (1)
| Title |
|---|
| 外援抗草甘膦EPSPs基因在大豆基因组中的整合与定位;王晓波;《作物学报》;20101231;第36卷(第3期);365-375 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AR107260A1 (en) | 2018-04-11 |
| WO2017113573A1 (en) | 2017-07-06 |
| CN105505981A (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105505981B (en) | A kind of resistance glyphosate genetically engineered soybean and the preparation method and application thereof | |
| CN104450775B (en) | Resistance glyphosate genetically engineered soybean and preparation method and application | |
| CN106086010B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008 | |
| CN107129993B (en) | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| CN106086011B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004 | |
| CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN103667309A (en) | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof | |
| CN104878091A (en) | Nucleic acid sequence for detecting corn plant DBN9978 and detection method of nucleic acid sequence | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| CN107245480A (en) | Acetolactate synthase mutain and its application with Herbicid resistant | |
| CN104830846A (en) | Nucleic acid sequence used for detecting herbicide-tolerant corn plant DBN9898 and detection method thereof | |
| CN111247255A (en) | Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof | |
| CN111406117A (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof | |
| Wan et al. | Development of elite rice restorer lines in the genetic background of R022 possessing tolerance to brown planthopper, stem borer, leaf folder and herbicide through marker-assisted breeding | |
| CN104878092A (en) | Nucleic acid sequence for detecting corn plant DBN9953 and detecting method thereof | |
| CN104878095B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858 | |
| Kole | Cereals and millets | |
| CN104830983B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9968 | |
| Madhusudan et al. | Stacking of Pup1 QTL for low soil phosphorus tolerance and bacterial blight resistance genes in the background of APMS6B, the maintainer line of rice hybrid DRRH-3 | |
| CN106119245B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 | |
| CN107299149B (en) | Method for culturing herbicide-resistant imazethapyr japonica rice variety with assistance of molecular marker | |
| CN107779522B (en) | Specific codominant molecular marker of brown planthopper resistant gene Bph15 of rice and application thereof | |
| Ming-hui et al. | Breeding of newly licensed wheat variety Huapei 8 and improved breeding strategy by anther culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |