CN105457028B - The stress sensitivity microRNA of regulating and controlling effect is played in bon e formation - Google Patents

Abstract

The present invention relates to the stress sensitivity microRNA that regulating and controlling effect is played in bon e formation.Disclosing miR-103a for the first time is a new mechanics sensitivity miRNA and plays an important role in osteoblast differentiation, can be used as the target of prevention and treatment bone metabolic disease (including osteoporosis, Osteoblast Differentiation exception, bone loss etc.).The lower adjustment of miR-103a can improve lacked as stress caused by osteoporotic phenotype.

Description

The stress sensitivity microRNA of regulating and controlling effect is played in bon e formation

Technical field

The invention belongs to field of biotechnology, more particularly it relates to play answering for regulating and controlling effect in bon e formation Power sensibility microRNA.

Background technique

Mechanical stress stimulation is most important for the regulating and controlling effect of bone remoulding stable state by signal transduction approach.As A kind of dynamics organ, the structure and function of bone tissue are largely dependent upon locating mechanical environment.By osteocyte, The mechanical signals receptor such as osteoblast experience mechanical stress stimulation and by transduction be transferred to bone surface master for biological signals The effector cell's (osteoblast and osteoclast) wanted completes associated responses.The differentiation of osteoblast can be stimulated by mechanical stress to be situated between Serial hormone, growth factor, the cascade reaction of transcription factor etc. are led and caused, and then influences cell proliferation and differentiation.Clinically, it carries Lotus missing is chronically at that gravity missing environment such as astronaut can lead to bone loss and then rapid progression is such as long-term bedridden patients Disuse osteoporosis.And long-term over burdening state such as athletes will lead to bone trabecula micro fractures and then progress to stress Property fracture or fatigue fracture.

MicroRNAs (miRNAs) is that life is single-stranded in one kind, and length is about the small molecule non-coding RNA of 22 nucleotide, Important regulating and controlling effect is played in many biological processes.By adjustment mechanism after transcription, miRNAs passes through 3 ' with target gene mRNA UTR seed region, which combines, degrades or inhibits target gene to translate and then inhibit expression of target gene.MiRNA adjust the mankind about three/ One protein coding gene prompts its key effect in controlling gene expression.A plurality of miRNAs is horizontal in vitro to be demonstrate,proved Osteoblast Differentiation process can be regulated and controled in the expression of Osteoblast Differentiation relative specific gene by target in fact.

However, the regulating and controlling effect about the correlation of mechanical stress load and miRNA and in Osteoblast Differentiation is also It is to be studied, need to be found the miRNA molecule for being suitable for regulating and controlling Osteoblast Differentiation.

Summary of the invention

The purpose of the present invention is to provide the stress sensitivity microRNA that regulating and controlling effect is played in bon e formation.

In the first aspect of the present invention, the lower adjustment of miR-103a a kind of is provided in preparation prevention or treatment bone metabolic disease (for stress correlation bone metabolic disease, the load as caused by the long-term space microgravity environment of astronaut or long-term bedridden patients Lack caused by disuse osteoporosis) drug in purposes.

In a preferred embodiment, the miR-103a inhibitor includes: chemically synthesized miR-103a inhibitor；With table Virus and non-viral product up to the inhibition miR-103a that plasmid is carrier；The nucleic acid sequence or tract complementary with miR-103a Section.

In another preferred example, the lower adjustment of the miR-103a is selected from: antagomir-103a, nucleotide sequence As shown in SEQ ID NO:49；Or inhibitor-103a, nucleotide sequence is as shown in SEQ ID NO:47.

In another preferred example, the lower adjustment of the miR-103a is modified lower adjustment, and the modification includes (but being not limited to): methoxylation modification, thio-modification, cholesterol modification, alkyl modified (such as carry out alkyl in 2 ' positions of ribose Modification), lock nucleic acid modification, peptide nucleic acid modification, and/or phosphoric acid backbone by phosphatide connection replace GEM 132；Preferably, institute The modification of the antagomir-103a stated includes: that 3 ' ends carry out cholesterol modification, 5 ' the two thio backbone modifications in end, 3 ' four, ends Thio backbone modification, full chain methoxyl group modification.

In another preferred example, the drug is also used to:

Increase the expression of Runx2 albumen；

Enhance the expression of ALP and Ocn in osteoblast differentiation；Or

Enhance extracellular matrix mineralising.

In another aspect of this invention, the purposes of miR-103a a kind of is provided, for screening prevention or treatment bone metabolism disease The drug of disease.

In a preferred embodiment, the bone metabolic disease includes: osteoporosis, Osteoblast Differentiation exception, bone loss.

In another aspect of this invention, a kind of drug prevented or treat bone metabolic disease is provided, the drug is The lower adjustment of miR-103a, is selected from: antagomir-103a, nucleotide sequence is as shown in SEQ ID NO:49；Or Inhibitor-103a, nucleotide sequence is as shown in SEQ ID NO:47.

In another aspect of this invention, a kind of method of screening prevention or the potential substance for treating bone metabolic disease is provided, The described method includes:

(1) system of expression miR-103a is handled with candidate substances；With

(2) expression of miR-103a in the system is detected；

Wherein, if the candidate substances can reduce the expression of miR-103a, show that the candidate substances are prevention or treatment The potential substance of bone metabolic disease.

In a preferred embodiment, Runx2 albumen is also expressed in the system, the method also includes: detect the body The expression of Runx2 albumen in system；

Wherein, it (preferably dramatically increases, such as increases if the candidate substances are increased by the expression of downward miR-103a 20% or more, preferably increase by 50% or more；More preferably increase by 80% or more) expression of Runx2 albumen, then show the candidate Matter is the potential substance of prevention or treatment bone metabolic disease.

In another preferred example, step (1) include: in test group, by candidate substances be added to expression miR-103a or In the system for co-expressing miR-103a and Runx2 albumen；And/or

Step (2) includes: the expression of miR-103a and/or Runx2 albumen in the system for detect test group, and and control group Compare, wherein the control group is the system for not adding the expression miR-103a and/or Runx2 albumen of the candidate substances；

If the expression of miR-103a is statistically lower than in test group (preferably significantly lower than, such as low 20% or more, compared with Good low 50% or more；More preferably low 80% or more) control group, or the expression of Runx2 albumen is dramatically increased, it indicates that The candidate is the potential substance of prevention or treatment bone metabolic disease.

In another preferred example, the system is selected from: cell system (or cell culture system), subcellular system, Solution system, organizational framework, organ systems or animal system.

In another preferred example, the method further include: further cell experiment is carried out to the potential substance of acquisition And/or animal experiment, further to select and determine from candidate substances for preventing or treating the useful object of bone metabolic disease Matter.

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

Fig. 1, stress loading promote internal bone remoulding, bon e formation.

(a) experimental mouse model designs BS, baseline benchmark group.WB, weightbearing load-bearing group.HU, hind- Limb unloading hindlimb unloading group；

(b-h) BS, WB, HU group mouse distal femoral bone remoulding relevant parameter index analysis.(b) WB group and HU group mouse stock Bone general form changes (c) BS, WB, HU group mouse femur distal end microCT bone structure.Scale, 1mm.(d) BS, WB, HU group are small The indexs such as mouse distal femur microCT three-dimensional bone bone density.(e) the double mark experiment reflection new bone formations of calcein in each group mouse Situation.Scale, 10 μm.(f) BS, WB, HU group Mouse Bone histomorphometric analysis: bon e formation relevant parameter index (Ob.S/BS, MAR and N.Ob/B.Pm) detection.(g) BS, WB, HU group mouse distal femoral TRAP dye (Tartrate-resistant acid Phosphatase, TRAP, tartaric-resistant dyeing).Scale, 100 μm.(h) BS, WB, HU group mouse tissue Morphological analysis: bone resorption relevant parameter index (Oc.S/B.S, N.Oc/B.Pm) analysis.

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, there was no significant difference.P value, which calculates, is based on Student ' s t test.Data are indicated with mean+SD, represent 4 independent experiments.

Fig. 2, CMS load level modulation osteoblast differentiation in vitro

(a) (A three-dimensional finite element, FE, contain human femur proximal end finite element analysis model 29841 finite element elements).FE is analysis shows that the stress loading of human femur proximal end bone tissue carrying is about 815 ± 57 μ ε (375 μ ε ~1,583 μ ε).(b) 8%CMS load load hFOB1.19 human osteoblast cell is after 3 days, and qRT-PCR detects Ocn, ALP, Col1a1 expression, using standing group as reference.(c) 8%CMS load load hFOB1.19 human osteoblast cell is that ALP is fixed after 3 days Amount detection, using standing group as reference.(d) 8%CMS load load hFOB1.19 human osteoblast cell is ALP dyeing detection after 3 days, Using standing group as reference.Scale, 10mm.(e) 8%CMS load load hFOB1.19 human osteoblast cell is cytoskeleton after 3 days Immunofluorescence dyeing, which is shown, occurs centrality permutatation compared with standing group cytoskeletal filament.(f) 8%CMS load loads HFOB1.19 human osteoblast cell is 3 days, and there was no significant difference for cell Proliferation, using standing group as reference.(g) 8%CMS load loads HFOB1.19 human osteoblast cell is after 3 days, and it is living that Western blot detects Wnt/ β-catenin and Erk1/2MAPK signal path Change degree.(h) 8%CMS load load hFOB1.19 human osteoblast cell is after 3 days, and Western blot detects Runx2 albumen table Change up to level, using standing group as reference.(i) 8%CMS load load hFOB1.19 human osteoblast cell is qRT-PCR after 3 days The mRNA expression variation for detecting Runx2, using standing group as reference.

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, there was no significant difference.P value, which calculates, is based on Student ' s t test；Data are indicated with mean+SD, represent 3 independent experiments.

Fig. 3, miR-103a are horizontal in vitro to inhibit function of osteoblast in Runx2 by target.

(a) Target Scan, miRDB, miRanda and miRWalk miRNA microRNA target prediction screen software biological information Learn Analysis and Screening Runx2 target.(b) it is after 3 days that 8%CMS, which loads hFOB1.19 human osteoblast cell, and qRT-PCR detects prescreening The expression of miRNAs changes.The expression changing ratio scalar multiple of miRNAs is to stand control group as reference.(c) In hFOB1.19 human osteoblast cell system, 12 screening miRNAs and U6 internal references are reported 3 ' UTR Dual-Luciferase of WT Runx2 and are carried The active influence of body.(d) in hFOB1.19 human osteoblast cell system, Western blot is detected in 12 screening miRNAs and U6 Join the influence to Runx2 protein expression level.(e) mimic-103a is transfected respectively in hFOB1.19 human osteoblast cell system, Referring to after (mimic-NC, inhibitor-NC), qRT-PCR detects the table of miR-103a by inhibitor-103a and its corresponding NC Change up to level.(f) mimic-103a is transfected respectively in hFOB1.19 human osteoblast cell system, inhibitor-103a and its right Answer NC referring to after (mimic-NC, inhibitor-NC), Western blot detects the variation of Runx2 protein expression.(g) exist Mimic-103a, inhibitor-103a and its corresponding NC are transfected in hFOB1.19 human osteoblast cell system respectively referring to (mimic- NC, inhibitor-NC) after, the mRNA level in-site that qRT-PCR detects Runx2 expresses variation.(h) the bis- fluorescence of WT Runx23 ' UTR 3 ' UTR Dual-Luciferase report carrier simplified schematic diagram of plain enzyme report carrier and Mutant Runx2.HRluc, human Renilla luciferase people's Renilla luciferase.(i) mimic-103a, inhibitor- are transfected respectively in hFOB1.19 103a and its corresponding NC detect 3 ' UTR of WT Runx2 referring to after, and 3 ' UTR luciferase reporter gene of MUT Runx2 is living Property.

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, there was no significant difference.P value, which calculates, is based on Student ' s t test；Real-time PCR is using GAPDH as internal reference.*P<0.05；**P<0.01；Data indicate with mean+SD, generation 3 independent experiments of table.

Negative regulation is played to Osteoblast Differentiation during Fig. 4, miR-103a osteoblast differentiation that CMS is mediated in vitro

(a) qRT-PCR shows that the hFOB1.19 human osteoblast cell that 8%CMS is mediated is the expression water of miR-103a in differentiation Flat (8%elongation, Sin, 0.5Hz, 3d).The expression of miR-103a is to stand group control as reference.(b) miR-103a and MiR-107 positions simplified schematic diagram in genome.The exon of PANK gene indicates that introne is identified with curve with rectangle. (c) it is after 3 days that 8%CMS, which loads hFOB1.19 human osteoblast cell, and qRT-PCR detects PANK2 and PANK3 expression.(d) 8% It is 21 days that CMS, which loads hFOB1.19 human osteoblast cell, and qRT-PCR is detected in osteoblast differentiation maturation extracellular matrix mineralization process MiR-103a expression (on)；Western blot detection Runx2 protein expression level (under).(e) 8%CMS is loaded HFOB1.19 human osteoblast cell is 21 days, and qRT-PCR detects Ocn in osteoblast differentiation maturation extracellular matrix mineralization process, ALP, Runx2mRNA expression.

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, P value that there was no significant difference, which calculates, is based on Student ' s t test.Real-time PCR is using GAPDH as internal reference.*P<0.05；**P<0.01；All data are with mean+SD table Show, represents 3 independent experiments.

Fig. 5, miR-103a in vitro stress stimulation mediate osteoblast differentiation during inhibit osteoblast activity and Extracellular matrix mineralising

(a) the analogies mimic-103a, inhibitor-103a and NC of miR-103a are transfected respectively referring to after, 8%CMS Loading hFOB1.19 human osteoblast cell is 3 days, and qRT-PCR detects Ocn respectively, and ALP, Runx2mRNA are horizontal.(b) it transfects respectively For the analogies mimic-103a, inhibitor-103a and NC of miR-103a referring to after, 8%CMS loads hFOB1.19 people's skeletonization Cell line 3 days, detection ALP activity.(c) respectively transfect miR-103a analogies mimic-103a, inhibitor-103a and For NC referring to after, it is 3 days that 8%CMS, which loads hFOB1.19 human osteoblast cell, detection ALP dyeing.Scale, 10mm.(d) it transfects respectively For long-acting the analogies agomir-103a, antagomir-103a and NC of miR-103a referring to after, 8%CMS loads hFOB1.19 people Osteoblast system 21 days, qRT-PCR detect miR-103a expression.(e) the long-acting analogies of miR-103a are transfected respectively Referring to after, it is 21 days that 8%CMS, which loads hFOB1.19 human osteoblast cell, by agomir-103a, antagomir-103a and NC, detection Alizarin red staining.Scale, 10mm.(f) the knockout Efficiency testing of Runx2 specific siRNA (siRNA-Runx2), with siRNA- NC is reference.(g) referring to after, 8%CMS adds by cotransfection siRNA-Runx2, mimic-103a, inhibitor-103a and NC Carrying hFOB1.19 human osteoblast cell is 3 days, and qRT-PCR detects Ocn, and ALP mRNA level in-site and ALP are quantitative.(h) it applies respectively Wnt/ β-catenin signal pathway inhibitor IWR-1 and Erk1/2MAPK signal pathway inhibitor U0126 blocks two accesses Afterwards, it is 3 days that 8%CMS, which loads hFOB1.19 human osteoblast cell, and qRT-PCR detects miR-103a expression.

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, there was no significant difference.P value, which calculates, is based on Student ' s t test.Real-time PCR is using GAPDH as internal reference.*P<0.05；**P<0.01；All data are with mean+SD table Show, represents 3 independent experiments.

Fig. 6, given by internal intervention the long-acting inhibitor antagomir-103a partial rescue of miR-103a due to Bone amount caused by stress lacks declines osteoporotic phenotype

(a) Hsa-miR-103a precursor secondary structure simplified schematic diagram, and maturation miR-103a sequence in lactation/vertebra Sequence compares simplified schematic diagram in animal.(b) qRT-PCR analysis miR- in C57BL/6J Mouse Bone and other each major organs 103a gene expression abundance.(c) qRT-PCR analyzes in WB and HU mouse in femur miR-103a expression (using BS group mouse as school Just).(d) experimental design simplified schematic diagram (every group of experiment C57/BL6J mouse, n=6).The HU of HU+PBS, tail vein injection PBS are small Mouse；The HU mouse of HU+Antagomir-103a, tail vein injection antagomir-103a.(e) qRT-PCR analysis is in HU, HU+ MiR-103a expression (being correction with WB group mouse) in PBS, HU+Antagomir-103a group mouse femur.(f) Western blot is analysis shows that Runx2 protein level in WB, HU, HU+PBS, HU+Antagomir-103a mouse femur.(g) WB, HU, HU+PBS, HU+Antagomir-103a mouse distal femoral microCT three-dimensional reconstruction.Scale, 1mm.(h) WB, HU, HU+PBS, HU+Antagomir-103a mouse distal femoral microCT three-dimensional reconstruction bon e formation relevant parameter.(i) new bone formation Rate detection: the double mark detections of WB, HU, HU+PBS, HU+Antagomir-103a mouse calcein.Scale, 10 μm.(j) bone tissue Morphological analysis: bon e formation relevant parameter (Ob.S/BS, MAR and in WB, HU, HU+PBS, HU+Antagomir-103a mouse N.Ob/B.Pm (k) WB, HU, HU+PBS, HU+Antagomir-103a mouse distal femoral TRAP dyeing) are detected.Scale, 100 μ M (l) bone tissue morphological analysis: bone resorption relevant parameter (Oc.S/ in WB, HU, HU+PBS, HU+Antagomir-103a mouse B.S, N.Oc/B.Pm) detection

* P < 0.001 P < 0.05, * * P < 0.01, * * *.NS, there was no significant difference.P value, which calculates, is based on Student ' s t test.Real-time PCR is using GAPDH as internal reference.*P<0.05；**P<0.01；All data are with mean+SD table Show, represents 3 independent experiments.

Fig. 7, pmiR-RB-REPORT^TMDual-Luciferase report carrier map.

Specific embodiment

The present inventor pass through in-depth study, it has unexpectedly been found that, miR-103a be a new mechanics sensitivity miRNA and Play an important role in osteoblast differentiation, can be used as prevention and treatment bone metabolic disease (including osteoporosis, Osteoblast Differentiation it is abnormal, Bone loss etc.) target.The lower adjustment of miR-103a can improve lacked as stress caused by osteoporotic phenotype.

MiR-103a and application thereof

In the present invention, the miR-103a is the micro ribonucleic acid (hsa- with nucleic acid sequence shown in SEQ ID NO:1 MiR-103a-3p, MIMAT0000101):

AGCAGCAUUGUACAGGGCUAUGA(SEQ ID NO:1)

MiR-103a is a kind of it has been found that can promote lipid metaboli and then regulate and control the small ribose of the stable state of glycolipid metabolism Nucleic acid, the effect in terms of bone metabolism in the prior art there is no report on.

The present inventor by constructing stress loading cell model and double hindlimb unloading mouse under load respectively in vivo and in vitro Model verifies mechanical stress loading and Osteoblast Differentiation and bone remoulding is acted in vivo and in vitro.Pass through bioinformatics method Screening target miRNA simultaneously carries out follow-up function verifying with qRT-PCR, screens and identifies that obtaining miR-103a is a new mechanics Sensitive miRNA simultaneously plays an important role in osteoblast differentiation.MiR-103a and its host gene PANK3 is stimulated in mechanical stress (8%CMS, 0.5Hz, Sin) obviously is lowered in the osteoblast differentiation of mediation, and Runx2 protein level raises.It is overexpressed MiR-103a significantly reduce Runx2 protein level, inhibit miR-103a lower Runx2 protein level, prompt miR-103a at Inhibit Runx2 expression in osteocyte.MiR-103a pairs has been abolished after 3 ' the UTR binding sites of miR-103a and Runx2 are mutated The activity inhibition of 3 ' UTR luciferase reporter gene carrier of Runx2 prompts miR-103a to pass through 3 ' with Runx2 UTR seed region, which combines, inhibits its expression.Osteoblast Differentiation correlation marker genetic test and Osteoblast Differentiation phenotype show miR- 103a plays negative regulation in the osteoblast differentiation that mechanical stress stimulation mediates.Osteoblast Differentiation and extracellular matrix mineralising into Cheng Zhong, miR-103a play inhibiting effect.The obvious up-regulation of miR-103a expression, may pass through inhibition in hindlimb unloading mouse Runx2 expression is horizontal in vivo to play negative regulation to bon e formation, and giving its long-acting inhibitor analogies by tail vein can portion Osteoporotic phenotype caused by dividing redemption to be lacked as stress.

Therefore, miR-103a, which is one, new can be used as prevention and treatment bone metabolic disease (including osteoporosis, Osteoblast Differentiation is different Often, bone loss etc.) marker.

Adjusted under miR-103a and application thereof

Above-mentioned new discovery based on the present inventor, the present invention provides the purposes adjusted under a kind of miR-103a, for making The standby composition (such as drug) prevented or treat bone metabolic disease.It is adjusted under the miR-103a by inhibition miR-103a's Expression, to realize the preventive and therapeutic effect to abnormal bone metabolism (such as osteoporosis).It is adjusted under miR-103a and is also used to promote Runx2 The expression of albumen；Enhance the expression of ALP and Ocn in osteoblast differentiation；Or enhancing extracellular matrix mineralising.

As used herein, " the adjusting under miR-103a " includes antagonist, inhibitor, retarding agent, blocking agent etc., As long as they can lower the expression of miR-103a.They can be compound, chemical small molecule, biomolecule.It is described Biomolecule can be nucleic acid level (including DNA, RNA), be also possible to inhibit miR-103a expression viral product.

The stabilization that adjustment refers to any activity for reducing miR-103a, reduces miR-103a under the miR-103a Property, lower miR-103a expression, reduce the substance of miR-103a effective acting time, these substances are used equally for the present invention, As the substance useful for downward miR-103a, so as to the growth for improving bone metabolic disease.For example, the downward Agent is: nucleic acid inhibitor, protein inhibitor, nuclease, nucleic acid binding molecule, as long as its expression that can lower miR-103a.

As a kind of preferred embodiment of the invention, the lower adjustment is selected from: being adjusted under chemically synthesized miRNA；With table Virus and non-viral product up to the inhibition miRNA that plasmid is carrier；The nucleic acid sequence or sequence fragment complementary with miR-103a.

As preferred mode of the invention, adjustment is that the miRNA by special modification is short of money under the miR-103a Anti-agent, for example including but be not limited to: methoxylation modification, alkyl modified (such as ribose 2 ' positions carry out alkyl modified), lock The GEM 132 that nucleic acid modification, peptide nucleic acid modification, thio-modification and phosphoric acid backbone are replaced by phosphatide connection.

As preferred mode of the invention, under the miR-103a adjust be antagomir-103a or inhibitor-103a.It includes: that 3 ' ends carry out cholesterol modification, 5 ' the two thio backbone modifications in end, 3 ' four sulphur in end that it, which is modified, For backbone modification, full chain methoxyl group modification to increase its stability, promotes its validity.Antagomir-103a is logical It crosses and inhibits miRNA hair with the strong competitive binding of intracorporal maturation miRNA, the complementary pairing of prevention miRNA and its target gene mRNA The effect of waving.Compared with common inhibitor, miRNA antagomir is outer in animal body to be had higher stability and inhibits effect Fruit, and the obstacles such as internal cell membrane, tissue can be overcome to be enriched in target cell.Antagomir does not need to transfect in cell experiment Reagent, the complex steps so as to avoid transfection reagent packaging process and its influence to experiment.It can be used in animal experiments complete Body or the methods of locally injecting, sucking, medicine feed are administered, and the function and effect duration is 6 weeks.

The present invention also provides a kind of composition (such as drugs), it contains effective quantity (such as 0.000001-50wt%；Preferably 0.00001-20wt%；More preferably, 0.0001-10wt%) the miR-103a under adjust and pharmaceutically acceptable Carrier.The composition can be used for adjusting bone metabolism.The lower adjustment agent of any miR-103a above-mentioned is used equally for combining The preparation of object.

As used herein, described " effective quantity " refer to people and/or animal can be generated function and can be by people and/or animal The amount received." pharmaceutically acceptable carrier " refers to the carrier for Therapeutic Administration, including various excipient and dilute Release agent.The term refers to medicament carriers some in this way: themselves be not necessary active constituent, and do not have after applying it is excessive Toxicity.Suitable carrier is well known to those of ordinary skill in the art.Pharmaceutically acceptable carrier can contain in the composition There is liquid, such as water, salt water, buffer.In addition, there is likely to be complementary substances in these carriers, such as filler, lubrication Agent, glidant, wetting agent or emulsifier, pH buffer substance etc..Lipofectamine can also be contained in the carrier.

After the purposes adjusted under knowing the miR-103a, a variety of methods well known in the art can be used institute The regulator stated or its pharmaceutical composition deliver medicine to mammal.Including but not limited to: subcutaneous injection, is percutaneously given at intramuscular injection It gives, administer locally to, being implanted into, being sustained and give；Preferably, the administration mode is that non-bowel is given.The lower adjustment Administration mode is also possible to the drug administration by injection of part, such as can take the mode of intra-articular administration.

The effective quantity of the lower adjustment of miR-103a of the present invention can with administration mode and disease to be treated it is tight Weight degree etc. and change.Preferred a effective amount of selection can be determined depending on various factors by those of ordinary skill in the art (such as passing through clinical test).The factor includes but is not limited to: the pharmacokinetics of the lower adjustment of the miR-103a Parameter such as bioavailability, metabolism, half-life period etc.；Patient the severity of disease to be treated, the weight of patient, patient Immune state, the approach of administration etc..For example, dosage separated several times can be given once daily by an urgent demand for the treatment of situation, Or dosage is reduced pari passu.

Drug screening

Knowing the close of miR-103a and bone metabolic disease (including osteoporosis, Osteoblast Differentiation exception or bone loss) After cutting correlation, the substance for inhibiting the expression of miR-103a can be screened based on this feature.It can be found from the substance For preventing or treating the actually useful drug of bone metabolic disease.

Therefore, the present invention provides a kind of method of the potential substance of screening inhibition bone metabolic disease, and the method includes: The system of expression miR-103a is handled with candidate substances；With the expression for detecting miR-103a in the system；If the candidate Matter can inhibit the expression of miR-103a, then shows that the candidate substances are the potential substances for inhibiting bone metabolic disease.The expression The system of miR-103a for example can be cell (or cell culture) system, and the cell can be endogenous expression miR- The cell of 103a；Or it can be the cell of recombinant expression miR-103a.The system of the expression miR-103a can also be sub- (such as animal model, preferably non-human mammal is dynamic for cell system, solution system, organizational framework, organ systems or animal system Object model, such as mouse, rabbit, sheep, monkey) etc..

In a preferred embodiment of the present invention, when being screened, change to be more easily observable the expression of miR-103a Become, also settable control group, the control group can be the system for not adding the expression miR-103a of the candidate substances.

In a preferred embodiment of the present invention, Runx2 albumen is also expressed in the system, the method also includes: detection The expression of Runx2 albumen in the system；Wherein, if the candidate substances can be increased by lowering the expression of miR-103a The expression of Runx2 albumen then shows that the candidate substances are to prevent and treat the potential substance of bone metabolic disease.

As preferred embodiment of the invention, the method further include: the potential substance of acquisition is carried out further thin Born of the same parents' experiment and/or animal experiment, further to select and determine the substance for inhibiting bone metabolic disease actually useful.

The present invention does not have the expression of miR-103a or Runx2 albumen, activity, amount or the detection method for secreting situation There is special limitation.Conventional protein quantification or half-quantitative detection technology can be used, such as (but not limited to): SDS-PAGE Method, Western-Blot method etc..

On the other hand, the present invention also provides the potential objects of the inhibition bone metabolic disease obtained using the screening technique Matter.The substance that these preliminary screenings go out may make up a screening library, in order to people may finally be screened out from it can be for Inhibit the expression and activity of miR-103a, and then the substance for inhibiting bone metabolic disease useful.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

Material and method

1. experimental animal model constructs

6 monthly age C57BL6/J mouse (Shanghai Shrek experimental animal company) are respectively divided into 3 groups: basic (BS) group hangs tail (HU) group stands control (WB) group.HU group mouse is with medical wide adhesive tape (15cm × 0.5cm) to rear screw from before rat-tail 1/3 Shape winding, adhesive tape are fixed on cage top, and it is hanging in 30 ° to make mouse pair hind legs and cage bottom, but do not influence the activity of its forelimb, make it can be certainly It is fed by drinking-water, it is for 4 weeks, it is daily to observe rat-tail blood supply situation, prevent ischemic necrosis.It weighs weekly and observes its growth hair twice Educate situation.WB group mouse is blank control, no specially treated.

2.hFOB1.19 human osteoblast cell is mechanical stress load induced osteogenesis cell differentiation mould under culture and varying strength Type is established

HFOB1.19 is incubated at 10mm culture dish and trains completely containing 10%FBS, 1% dual anti-and 0.3mg/mL G418 DMEM It supports in base, in 34 DEG C, 5%CO₂It is incubated for culture in concentration, 95% humidified incubator, takes P3 for cell with 2.0 × 10⁵Density inoculation In common six well culture plate and the BioFlex of coating type i collagen^TMSix well culture plates change the liquid once for every 2 days；Cell is long to 90% After fusion, by BioFlex^TMSix well culture plates are placed in FX-5000^TMTraining in FLEXCELL TENSION PLUS stress loading device It supports, setting incubator temperature is 34 DEG C, 5%CO₂Concentration, 95% humidity, and timing 0 day, it changes the liquid once within every 2 days, loads 3 respectively It, 7 days；It is control with standing group；Stress loading program setting are as follows: 8%CMS (8% deformation, 80000 μ ε, Sin, 0.5Hz, CMS), wherein CMS:cyclic mechanical stretch.

3. the extraction of cell total rna

Suitable TRIZOL (Invitrogen, USA) is added into cell, until clarification is advisable, jelly is located in -80 DEG C or directly Reason；The chloroform of 0.2ml is added in the TRIZOL reagent of every 1ml, acutely concussion test tube 15 seconds, stands EP pipe 2-3min；12000rpm, 4 DEG C of centrifugation 15min.Upper strata aqueous phase solution is shifted into new EP pipe, the isopropanol of 0.5ml is added in the TRIZOL reagent of every 1ml, mixes It is even；Samples of incubation 30min on ice.12000rpm, 4 DEG C, 10min.The white glue of RNA is attached to tube bottom side.Supernatant is abandoned, is added Enter 1ml75% ethyl alcohol, it is light 2-3 times reverse up and down；7500rpm, 4 DEG C of centrifugation 5min；RNA sample dries 5-10min；With DEPC water After (20-50 μ l) sample dissolution, UV detector A260/280 measures the concentration of extract RNA, and -80 DEG C save, or directly Carry out qRT-PCR.

4.ALP alkaline phosphatase staining

Culture solution is sucked, PBS is washed 3 times；4% paraformaldehyde room temperature fixes 10 minutes, and PBS is rinsed, and air dries；Alkaline phosphorus Sour enzyme staining reagent kit (the green skies) working solution is prepared；Dyeing mixed liquor is made by operation manual；1ml dyeing mixing is added in every hole Liquid (6 orifice plates), 37 DEG C of incubation 1h；Flowing water rinses, and dries；Piece is taken the photograph, the dynamic place of enzyme activity is in azarin particle.

5. alkaline phosphatase activities test (ALP is quantitative)

Cell sample collection freezes (- 20 DEG C)；It is centrifuged after melting when use, cell mass is sunk into tube bottom, 4 DEG C, 2000rpm, 2min abandon supernatant；Distilled water 100-500 μ l (visual cell, which measures, to be added) is mixed, and is vibrated when necessary using shaker；Instead Multiple freeze thawing: freezing 10min × 3 time, -80 DEG C, and room temperature is melted after freezing every time, and multigelation makes cell cracking, and albumen is precipitated；Mix from The heart, 4 DEG C, 1000rpm, 3min take supernatant.Liquid is taken with the every 4 μ l of pipe of every 200 μ l, the B liquid of pipe of A liquid.It calculates total amount to mix, takes 200 μ l 96 orifice plates are added in × 2 (multiple holes), separately have blank (blank) hole to add distilled water；It is added 20 μ l cell conditioned mediums in every hole, 37 DEG C 30min is incubated for, and is had purple at albumen；Continuous wavelength scans microplate reader and measures BCA, and two groups take mean value.DEA:pnpp=2:1 is mixed It closes, adds a pipe blank tune background, 150 μ l mixed liquors and 50 μ l cell conditioned mediums are added in every pipe, and blank Guan Zhongjia distilled water mixes It is even；37 DEG C of water-bath 15min (yellow is the positive)；400 μ l of 1N NaOH is added in every pipe and stops reaction, shakes up, centrifugal drying lower cover Middle liquid；Take 200 l × 2 μ (multiple holes) that 96 orifice plates are added in every pipe；Continuous wavelength scans microplate reader measurement, and two groups take mean value. Pnpp/BCA obtains relative quantification value.

6. influence detection of the mechanical stress stimulation to hFOB1.19 cellular morphology and cytoskeleton arrangement

After 8%CMS stress loading 3 days, Lycra inverted microscope observes cell arrangement direction, metamorphosis, with standing group Control；BioFlex^TMAfter 3 days, PBS is washed three times six well culture plate 8%CMS stress loadings；With 4% paraformaldehyde (PBS preparation) room Temperature fixes cell 1h, and PBS is washed 3 times；Cell is led on ice with fresh permeable membrane liquid (0.1%Triton X-100,0.1% sodium citrate) Saturating 5min, PBS are washed 3 times；With 3%BSA closing cell 2h；It is incubated for phalloidine；PBS is cleaned 3 times；Core is contaminated with Horchest； PBS is cleaned 3 times；Mountant mounting；Cytoskeleton arrangement situation is observed under laser confocal microscope, standing group is control.

7. alizarin red calcium tubercle dyes

40mM Alizarin red staining liquid (Alizin Red): 1.3692g alizarin red powder (Sigma) is dissolved in 100ml PBS, PH value is adjusted to 4.1-4.3, it is spare to be put in room temperature.Culture solution is sucked, PBS is rinsed twice；4% paraformaldehyde room temperature is fixed 15min；ddH₂O is rinsed twice；The Alizarin red staining liquid of the 40mM in the hole 1ml/, incubation at room temperature 20min and slight oscillatory is added；It inhales Unbonded dyestuff is taken, ddH is used₂O is rinsed and is vibrated 5min and is repeated 4 times；Slant setting 2min draws extra ddH₂O；It is inverted Micro- sem observation photographs to record.

8. mechanical stress stimulation detects hFOB1.19 proliferative capacity

Collect the hFOB1.19 cell (cell about 70-80% fusion before digesting) in vigorous proliferation；Pass through cell count Cell density is adjusted, by 4 × 10³A/hole is inoculated in gusset and common 6 orifice plates, and light mix keeps inoculum density consistent；Cell in 34 DEG C, 5%CO₂Culture is incubated in incubator；Respectively at 12h, for 24 hours, AlamarBlue is added in 36h, 48h, when 60h, 72h (10% concentration), it is light to mix, put back to 34 DEG C, 5%CO₂Supernatant is collected in 96 orifice plates after being incubated for culture 2h in incubator；Enzyme mark Instrument measures 570nm/650nm light absorption value, and standing group is control, records data, draws standard curve.

9.Runx2 vector construction

Using PCR method, according to 3 ' UTR sequence information design its amplimer of Runx2 (human), with 293T cell base Because of the 3 ' UTR sequences that group DNA is template PCR amplifications Runx2 gene, it is cloned into pmiR-RB-REPORT^TMDual-Luciferase Report carrier is by the sharp rich biological Co., Ltd's building in Guangzhou, the reporter fluorescence of used carrier is hRluc, and correction fluorescence is hluc (doing internal reference correction).Gene order and carrier sequence are analyzed, using XhoI, two restriction enzymes of NotI are by target gene Segment is cloned into carrier, Vector map such as Fig. 7.

It is as follows to design amplimer:

RUNX2-3UTR-F:5 ' CCGCTCGAGAATTCCTCAGCAGTGGC 3 ' (SEQ ID NO:2)；

RUNX2-3UTR-R:5 ' GAATGCGGCCGCTAACAAAACCAAAAAAGCCATTTTATTG 3 ' (SEQ ID NO: 3)；

Be arranged XhoI, NotI restriction enzyme site sequence, presequence be protection base, primer amplification total length be 3798bp. The positive clone of sequencing identification.

10.Real-time PCR (real-time quantitative PCR)

TRIZOL (Invitrogen) method extracts bone tissue or cell total rna.Preparation cDNA reverse transcription system (1 μ g of RNA, 1 μ l, DEPC water of Oligo d (T) is supplied), after mixing, 70 DEG C of 5min are immediately placed at least 1min on ice, continue in reaction system 5 × RevertAid buffer, 4 μ l, dNTP mixed liquor, 2 0.5 μ l of μ l, RevertAid is added, after mixing, 42 DEG C of 1h, sample It is put in -20 DEG C of preservations.After 10 times of RT product dilution, Real-time PCR reaction system is prepared.Response procedures: 95 DEG C of denaturation 10sec → 95 DEG C 10sec, 60 DEG C of 30sec, continue 40 circulations → enter solubility curve detecting step (illustrating according to instrument)； Calculation method is using GAPDH as internal reference.Remainder data analysis is shown relative to pair according to Ct value (2- Δ Δ Ct) method in figure According to expression quantity change multiple value；The primer sequence is as follows:

GAPDH: positive: 5 '-CCTCTGACTTCAACAGCGAC-3 ' (SEQ ID NO:4)；

It is reversed: 5 '-TCCTCTTGTGCTCTTGCTGG-3 ' (SEQ ID NO:5)；

Col1a1: positive: 5 '-CAGCCGCTTCACCTACAGC-3 ' (SEQ ID NO:6)；

It is reversed: 5 '-TTTTGTATTCAATCACTGTCTTGCC-3 ' (SEQ ID NO:7)；

Runx2: positive: 5 '-GCCTTCAAGGTGGTAGCCC-3 ' (SEQ ID NO:8)；

It is reversed: 5 '-CGTTACCCGCCATGACAGTA-3 ' (SEQ ID NO:9)；

OCN: positive: 5 '-GAAGCCCAGCGGTGCA-3 ' (SEQ ID NO:10)；

It is reversed: 5 '-CACTACCTCGCTGCCCTCC-3 ' (SEQ ID NO:11)；

OPN: positive: 5 '-GCCGAGGTGATAGTGTGGTT-3 ' (SEQ ID NO:12)；

It is reversed: 5 '-CAATCAGAAGGCGCGTTCAG-3 ' (SEQ ID NO:13)；

OPG: positive: 5 '-CCTCTCATCAGCTGTTGTGTG-3 ' (SEQ ID NO:14)；

It is reversed: 5 '-TATCTCAAGGTAGCGCCCTTC-3 ' (SEQ ID NO:15)；

RANKL: positive: 5 '-CACTATTAATGCCACCGAC-3 ' (SEQ ID NO:16)；

It is reversed: 5 '-GGGTATGAGAACTTGGGATT-3 ' (SEQ ID NO:17)；

PANK3: positive: 5 '-TTTTGGCCGAAGAGGGAACTT-3 ' (SEQ ID NO:18)；

It is reversed: 5 '-TAGCACCGTCTGCAATGTTGA-3 ' (SEQ ID NO:19)；

PANK2: positive: 5 '-TTGACTCAGTCGGATTCAATGG-3 ' (SEQ ID NO:20)；

It is reversed: 5 '-CAGAAGCAGAGGATACGGATTTT-3 ' (SEQ ID NO:21)；

11.Western blot

Cell abandons supernatant, and pre-cooling PBS is washed one time；RIPA lysate (containing 1%PMSF) is added, cracks 15min on ice.

Piping and druming is collected cell and is managed in 1.5ml EP, 12,000rpm centrifugation 15min；Taking supernatant is total protein, -80 DEG C of guarantors It deposits spare；BCA method protein quantification.50 μ g albumen are taken, 5 × sample-loading buffer is added, are mixed, 95 DEG C of heating 10min become albumen Property, disulfide bond is opened；Preparative separation glue and concentration glue；Electrophoretic buffer is added in electrophoresis tank, take 5 μ l of albumen marker and The albumen of denaturation is added loading hole, 80V electrophoresis about 30 minutes, until bromjophenol blue enters separation gel, is changed to 120V voltage, electrophoresis about 1 Hour；PAGE gel carefully is removed, with pvdf membrane, qualitative filter paper and fiber mat are placed in electrophoresis tank transferring film buffer, It is clipped by pressing from both sides in a manner of sandwich (being successively fiber mat, filter paper, gel, pvdf membrane, filter paper, fiber mat from the bottom to top), is thoroughly caught up with It except air entrapment, is put into the transfer groove equipped with transferring film buffer, is put into ice chest, with 300A constant current transferring film 1.5 hours；It will turn to have The pvdf membrane of albumen takes out, label orientation, immerses confining liquid, is incubated at room temperature 1 hour on shaking table to close nonspecific proteins knot Coincidence point；Pvdf membrane is cut off according to the molecular weight of corresponding albumen, primary antibody is incubated for, and 4 DEG C overnight；Primary antibody is sucked, with TBST in shaking Film 3 times are washed on bed, each 5min；The secondary antibody of horseradish peroxidase-labeled is added, room temperature on shaking table in being incubated for 1 hour；It sucks Secondary antibody, with TBST in washing film 3 times on shaking table, each 5min；Colour developing and tabletting: it after developing solution 1:1 is mixed, is added on film, room Temperature colour developing 1-5 minutes, with X- photographic film tabletting appropriate time, punching.Image input computer is used into albumen again with scanner Strip analysis software Gel-Pro Analyzer3.0 (Media Cybernetics, USA) quantifies GAP-associated protein GAP.

12. the tectology of mouse detects

HU group mouse (7 monthly age) and WB load-bearing control group mice (7 by BS base set (6 monthly age), after continuously hanging tail 4 weeks Monthly age) cervical dislocation execution, bilateral hind leg is taken, attachment muscular soft tissues are rejected；Sample table is rinsed well with PBS buffer solution body The sludged blood in face；Materials tissue is fixed on 12h in 4% paraformaldehyde；Right hind is stored in progress microCT inspection in paraformaldehyde It surveys, the double marks of calcein；Left hind extracts RNA in bone tissue with SPEX6770 full-automatic refrigeration grinder；Hind leg sample is through flowing Water rinses overnight (12h), completely removes the fixer ingredient in sample；Sample is put in 12.5%EDTA decalcifying Fluid, at room temperature Decalcification surrounding replaces a decalcifying Fluid every three days.When with syringe needle can without obvious resistance pass through sample when, show decalcification base This completion；The sample of label is rinsed overnight (12h) through flowing water, completely removes the decalcifying Fluid ingredient in sample；According to following mistake Journey serial dehydration: (1) 75% alcohol: 12h；(2) 85% alcohol: 16h；(3) 95% alcohol I:4h；(4) 95% alcohol II:4h； (5) 100% alcohol I:2h；(6) 100% alcohol II:2h；(7) 100% alcohol III:2h；According to the following steps: (1) dimethylbenzene I: 7min, (2) dimethylbenzene II:7min, observes the transparency of sample at any time in clearing process, until sample observation is in completely thoroughly It is taken out when bright shape；Sample is dipped in 60 DEG C of waxes after transparent, and the time is as follows: (1) benzene wax I:4h；(2) benzene wax II:4h；(3) paraffin I: 4h；(4) paraffin II:4h；(5) paraffin III:12h；After conventional method embedding, wax stone, packet marking are modified；Do 5 μm continuously cut Piece fishes out on piece to glass slide, stays overnight in 37 DEG C of roasting pieces on roasting piece platform；SCANCO Medical μ CT (SCANCO Medical AG, Switzerland) 64 bit image processing software row bone tissue morphology indexs of correlation of prepackage detection.TV(total tissue volume；Contains both trabecular and cortical bone), BV/TV (trabecular bone Volume per tissue volume), Tb.Th (trabecular thick-ness), Tb.Sp (trabecular Separation), SMI (structure model index), Conn.Dn (connectivity density).

13. the double mark detections of calcein

Calcein 100mg is protected from light preparation with PBS, and 0.22uM sterile filters filter, ready-to-use, mouse number, and tail is quiet Arteries and veins injection；Mouse puts to death the calcein that materials give 10 μ g/g weight of intraperitoneal injection for first 10 days and first 3 days respectively；It anaesthetizes small Mouse, cervical dislocation are put to death, and anatomical isolation two sides femur and tibia is placed in 70% ethyl alcohol and fixes 24 hours, is protected from light fixed preservation；Row Sclerous tissues' embedding and ultra-thin section (specific steps are shown in that sclerous tissues embed), slice is kept in dark place, and takes the photograph piece immediately；Fresh tissue is cut Piece acquires image in fluorescence microscopy microscopic observation；Image quantitative analysis is carried out with IPP software, quantitative target includes: minerals Deposition (Mineral apposition rate, MAR).Calcein deposits line width/double injection time to MAR=twice It is spaced number of days.It is analyzed with SPSS15.0 statistical software.

14.Trap dyeing

Material is collected: mouse femur being taken to reject soft tissue；Fixed for the first time: 4% paraformaldehyde, 10% formalin are molten Liquid.

Second fixed: absolute alcohol；Degreasing, decalcification: decalcifying Fluid is that ZnSO4 adds EDTA solution, and decalcification device is Histra-DC (common luminosity) is operated continuously at 8~16 DEG C；Dehydration, embedding: at ETP (Sakura Finetek Japan) Reason 16 hours is that 58~60 DEG C of hard paraffins embed using fusing point；Thinly-sliced, dry: production 4um slice is unfolded 30 minutes at 43 DEG C Afterwards, dry at 37 DEG C；Dyeing, mounting: being dyed with TRAP staining kit (SIGMA, USA), and after 37 DEG C of dryings, dimethylbenzene is de- The transparent 3 each 5min of wax；Slice Re-hydrate sections is placed in 100% alcohol, 95% alcohol, and 70% alcohol is each 2min is repeated twice, distilled water flushing；Slice sets 37 DEG C of incubation 2h of pre-assigned TRAP dye liquor, distilled water flushing；Haematoxylin is redyed 1min (redye time depend on color depth), distilled water rinsing；Mounting, microscopy, staining analysis.

15.miRNAs agonists mimic object mimics and inhibitor

hsa-miR-7

5’UGGAAGACUAGUGAUUUUGUUGU 3’(SEQ ID NO:22)

3’CAACAAAUCACAGUCUGCCAUA 5’(SEQ ID NO:23)

hsa-miR-22

5’AGUUCUUCAGUGGCAAGCUUUA 3’(SEQ ID NO:24)

3’AAGCUGCCAGUUGAAGAACUGU 5’(SEQ ID NO:25)

hsa-miR-23b

5’UGGGUUCCUGGCAUGCUGAUUU 3’(SEQ ID NO:26)

3’AUCACAUUGCCAGGGAUUACC 5’(SEQ ID NO:27)

hsa-miR-103a(mimic-103a)

5’AGCAGCAUUGUACAGGGCUAUGA 3’(SEQ ID NO:28)

3’AGCUUCUUUACAGUGCUGCCUUG 5’(SEQ ID NO:29)

hsa-miR-107

5’AGCAGCAUUGUACAGGGCUAUCA 3’(SEQ ID NO:30)

3’UCGUCGUAACAUGUCCCGAUAGU 5’(SEQ ID NO:31)

hsa-miR-143

5’GGUGCAGUGCUGCAUCUCUGGU 3’(SEQ ID NO:32)

3’UGAGAUGAAGCACUGUAGCUC 5’(SEQ ID NO:33)

hsa-miR-154

5’UAGGUUAUCCGUGUUGCCUUCG 3’(SEQ ID NO:34)

3’AAUCAUACACGGUUGACCUAUU 5’(SEQ ID NO:35)

hsa-miR-221

5’ACCUGGCAUACAAUGUAGAUUU 3’(SEQ ID NO:36)

3’AGCUACAUUGUCUGCUGGGUUUC 5’(SEQ ID NO:37)

hsa-miR-320d

5’AAAAGCUGGGUUGAGAGGA 3’(SEQ ID NO:38)

3’UUUUCGACCCAACUCUCCU 5’(SEQ ID NO:39)

hsa-miR-374b

5’AUAUAAUACAACCUGCUAAGUG 3’(SEQ ID NO:40)

3’CUUAGCAGGUUGUAUUAUCAUU 5’(SEQ ID NO:41)

hsa-miR-375

5’UUUGUUCGUUCGGCUCGCGUGA 3’(SEQ ID NO:42)

3’AAACAAGCAAGCCGAGCGCACU 5’(SEQ ID NO:43)

hsa-miR-384

5’AUUCCUAGAAAUUGUUCAUA 3’(SEQ ID NO:44)

3’UAAGGAUCUUUAACAAGUAU 5’(SEQ ID NO:45)

U6 internal reference: CGCTTCACGAATTTGCGTGTCAT (SEQ ID NO:46)

Inhibitor inhibitor-103a:5 ' UCAUAGCCCUGUACAAUGCUGCU 3 ' (SEQ ID NO:47)

Agomir-103a: being modified in antisense strand, and 3 ' ends carry out cholesterol modification, and 5 ' hold two thio backbone modifications, 3 ' the four thio backbone modifications in end, full chain methoxyl group modification, following (wherein, the S- thio-modification of sequence；Chol- cholesterol is repaired Decorations):

5’-A_SG_SUAUCGGGACAUGUUACGA_SC_SG_SA_S(SEQ ID NO:48)-Chol-3'；

The end antagomir-103a:3 ' carries out cholesterol modification, 5 ' the two thio backbone modifications in end, 3 ' the four thio bones in end Un-wheeling repair decorations, full chain methoxyl group modification, sequence are as follows:

5’-U_SC_SAUAGCCCUGUACAAUGCU_SG_SC_SU_S(SEQ ID NO:49)-Chol-3’

NC internal reference:

The siRNA of Runx2:

RNA oligo sequences 21nt guide(5′→3′)21nt passenger(5′→3′)

UGGAUUUGUACCAUUCUUCUG(SEQ ID NO:50)

GAAGAAUGGUACAAAUCCAAG(SEQ ID NO:51)

3 ' the bis- fluoresceins of UTR of saltant type (MUT) Runx2 of the binding site region mutagenesis of 16.miR-103a and Runx2 The building of enzyme Reporter gene vector

Using PCR method, according to 3 ' UTR sequence information design its amplimer of Runx2 (people), with 293T cellular genome DNA is 3 ' UTR sequences of template PCR amplifications Runx2 gene, is cloned into pmiR-RB-REPORT^TMDual-Luciferase report In carrier, the reporter fluorescence of used carrier is hRluc, and correction fluorescence is hluc (doing internal reference correction).To gene order and carrier Sequence analysis, using XhoI, target gene fragment is cloned into carrier by two restriction enzymes of NotI.

It is as follows to design amplimer:

RUNX₂- 3 ' UTR-F:5 ' CCGCTCGAGAATTCCTCAGCAGTGGC 3 ' (SEQ ID NO:52)；

RUNX₂3 ' (SEQ ID of -3 ' UTR-R:5 ' GAATGCGGCCGCTAACAAAACCAAAAAAGCCATTTTATTG NO:53)；

XhoI, NotI restriction enzyme site sequence are set on primer, and the presequence of restriction enzyme site sequence is protection base, and primer expands The total length for increasing production object is 3798bp.The positive clone of sequencing identification.

Using the recombinant vector of acquisition as template, with QuikChange site-directed Mutagenesis kit (Stratagene, La Jolla, CA, http://www.stratagene.com) introduces seven base mutations in target site, Construct saltant type target gene luciferase reporter gene carrier.As a result plasmid is confirmed through digestion with restriction enzyme and DNA sequencing Middle insertion is required sequence.The AUGCUGC of combination complementary with 3 ' the UTR seed regions of Runx2 is converted into UACGACG, gives up In addition to 3 ' the UTR seed zones and miRNA-103a of Runx2 are specifically bound.

17. statistical analysis

All experiments are at least in triplicate.Data are with mean+SD (mean ± standard deviation) table Show.For gene relative expression analysis, the average value of control group is defined as 1.Student ' s t-test is used for two groups of data It is for statistical analysis.One-way ANOVA is used for for statistical analysis to multi-group data.Think poor with conspicuousness in P < 0.05 It is different.

Embodiment 1, load missing leads to bone loss disuse osteoporosis in hindlimb unloading mouse model

To study influence of the mechanical stress stimulation missing to bone remoulding stable state, the present inventor constructs double lower limb and goes the small of load Mouse model (Hindlimb unloading, HU), this model is initially by US National Aeronautics and Space Administration (National Aeronautics and Space Administration, NASA) it is used to study in weightlessness of space state in building in 1980 Influence to astronaut's bone amount is then widely used in the research of every research mechanics and kinematic system (Fig. 1 a).Compared with Benchmark group (Baseline group, BS) and standing control group (Weight-bearing group, WB) mouse, HU group mouse tail It is hanging that its double hind leg of 28 angels are suspended in portion in midair, but double forelimbs can freely walk, and does not influence its drinking-water feed.In experiment process, respectively Group mouse, which is weighed weekly 2 times, observes its growth and development situation, observes its tail blood circulatory condition daily, levies if any ischemic necrosis As immediately treating.

After experiment, WB and HU group mouse basal body mass and experiment terminal weight no significant difference (28.6 ± 2.7g vs.30.1±2.5g；P<0.05).The femur of HU mouse is presented obvious thin short and brittleness increase compared with WB group and is easy to sign of fracturing (Fig. 1 b).It takes mouse hind leg femur to carry out microCT scanning and carries out bone histomorphometric correlation analysis, the results show that HU Apparent bone amount decline, osteoporotic phenotype (Fig. 1 c, d) is presented compared with BS group and WB group in group mouse femur distal end.

Embodiment 2, CMS mediate the regulation of Runx2 post-transcriptional level in osteoblast differentiation

To probe into CMS for the regulating and controlling effect of osteoblast differentiation, the present inventor detects stock using finite element analysis (FEA) Bone proximal segment load-bearing situation (Fig. 2 a).It is reported according to existing literature, the stress of normal human tissue horizontal bearing is often less than 1000με.FEA detection discovery Proximal femur institute bearing stress is about 815 ± 57 μ ε (Fig. 2 a).However, tissue level and cellular water Flat load is not identical concept, and there are amplification mechanism when stress loading is transferred to cellular level via tissue level, this is Cellular level ess-strain expands mechanism.In osteoblast, the stress of bone tissue horizontal bearing can quilt when being conducted to cell membrane Expand 20 to 100 times.Therefore, the present inventor chooses 8%CMS (8% deformation, 80000 μ ε, Sin, 0.5Hz, CMS) and loads on people Osteoclast precursor hFOB1.19 carries out subsequent experimental.After stress loading 3 days, qRT-PCR is shown compared with standing group, 8%CMS group Related osteoblast differentiation relative specific gene: Alkaline phosphatase (ALP), osteocalcin (Ocn) and (Fig. 2 b) is remarkably reinforced in collagen type I alpha 1 (Col1a1) expression water.Equally, 8%CMS group ALP dyeing and ALP Quantitative enhancing (Fig. 2 c, d).In addition, cytoskeleton is sent out the inventors discovered that CMS group cellular morphology stretches compared with standing group Raw the permutatation of stress centrality (Fig. 2 e).However, cell Proliferation and no significant difference (Fig. 2 f) between each group.Wnt/β-catenin And important function of the ERK1/2MAPK access in terms of mechanical stress has been found.In the present invention, the inventors discovered that 8%CMS Wnt/ β-catenin and ERK1/2MAPK access (Fig. 2 g) can significantly be activated.

Significant, the present inventor's selection in experiment below is used as in promoting osteoblast differentiation in view of 8%CMS This intensity load as induced osteogenesis cell differentiation the density of load and study the table of key transcription factor Runx2 in Osteoblast Differentiation Up to variation.Runx2 is the most key transcription factor in Osteoblast Differentiation, and in Osteoblast Differentiation, Runx2 and multiple protein turn The factor is recorded, signal path etc. collectively forms cascade network regulation Osteoblast Differentiation.The inventors discovered that compared with standing group, 8%CMS can The protein expression of Runx2 is significantly increased, and its mRNA level in-site is only made slightly to increase (Fig. 2 h, i).The mRNA of the above this Runx2 Horizontal and protein level the inconsistent prompt of expression: in the osteogenic differentiation process of mechanical stress stimulation induction there may be MiRNA regulates and controls the post-transcriptional level of Runx2.

Embodiment 3, miR-103a mechanical stress stimulation mediate osteoblast differentiation in directly target in Runx2

Bioinformatics finds that the 3 ' UTR of Runx2 are about 3777 length of nucleotides.Select following miRNA biological information Learn forecasting software: TargetScan, miRDB, miRanda and miRBase database filter out potential target in Runx2 base respectively Because of the miRNAs in the 3 ' areas UTR, its intersection is taken.It rejects document and has reported the miRNA for having determining regulating and controlling effect to Runx2, obtain 12 Item can be combined in the miRNAs of 3 ' UTR seed zone of Runx2 (seed region), comprising: miR-7, miR-22, miR-23b, MiR-103a, miR-107, miR-143, miR-154, miR-221, miR-320d, miR-374b, miR-375and miR-384 (Fig. 3 a).

Whether 12 miRNAs are screened by mechanical stress stimulation regulation in order to verify, and the present inventor loads using 8%CMS HFOB1.19 human osteoblast cell is 3 days, and extracting miRNA is detected 12 miRNAs stress loadings front and backs in hFOB1.19 respectively Middle expression variation.QRT-PCR shows that 7 miRNAs include miR-103a, miR-23b and miR-374b in stress stimulation Expression in osteoblast differentiation is mediated to be remarkably decreased.In contrast, miR-107, miR-143 and miR-154 expression rise (Fig. 3 b).In order to further verify the whether direct target of screened miRNAs in Runx2, the present inventor constructs wild type (WT) 3 ' UTR luciferase reporter gene carrier of Runx2.By 3 ' UTR luciferase reporter gene carrier of WT Runx2 Respectively with miRNAs agonists mimic object mimics and the U6 internal reference that is screened in hFOB1.19 human osteoblast cell system cotransfection. Remaining miRNAs can inhibit Luciferase in various degree other than miR-107, miR-143 and miR-154 as the result is shown 3 ' UTR Dual-Luciferase report carrier activity of Runx2WT, wherein especially with the inhibiting effect of mimic-103a (figure the most significant 3c).By the mimics transfection hFOB1.19 human osteoblast cell system of the miRNAs of screening, Western after 8%CMS is loaded 3 days Blot detects Runx2 protein level, it is found that testing consistent with Luciferase is that mimic-103a makes Runx2 albumen water Flat downward is the most significant (Fig. 3 d).In above 12 miRNA, miR-103a and miR-107 are with source capsule miRNA, they are only There is the difference of a nucleotide in 3 ' tail ends.MiR-103a/miR-107, which is initially found in obesity mice, expresses up-regulation, into And it plays an important role in terms of being found in insulin sensitivity.However it is interesting that in the present invention the inventors discovered that miR-107 Play a part of to completely contradict with miR-103a in Luciferse experiment, and transfects its analogies mimic-107 to Runx2 Protein level also have no significant downward effect (Fig. 3 c, d).Result above prompts homologous miRNAs to there may come a time when in a certain regulation Play a part of to completely contradict in the process.The expression of Runx2, the present inventor can be significantly inhibited in the above experiment in view of miR-103a Therefore research focus is anchored to miR-103a, sequence AGCAGCAUUGUACAGGGCUAUGA in research below (hsa-miR-103a-3p MIMAT0000101；SEQ ID NO:1).

In order to verify miR-103a, whether direct target is in Runx2 in the osteoblast differentiation that stress stimulation mediates, originally Inventor carry out respectively miR-103a afunction and the acquired experimental verification of function its whether to Runx2 exist transcription after Level modulation.Transfect simulation agonist mimic-103a and the inhibition of miR-103a respectively in hFOB1.19 human osteoblast cell system Agent inhibitor-103a is overexpressed and lowers respectively miR-103a, and after 8%CMS is loaded 3 days, qRT-PCR detects endogenous The expression of miR-103a finds that it is simulated agonist mimic-103a and can significantly raise miR-103a level, and it is simulated It is horizontal (Fig. 3 e) that inhibitor inhibitor-103a can significantly lower miR-103a.After 8%CMS is loaded 3 days, two kinds of expression ways MiR-103a (transfection mimic-103a), which can be all overexpressed, can significantly inhibit Runx2 protein expression and lower miR-103a (transfection Inhibitor-103a Runx2 protein expression level (Fig. 3 f)) can be increased.However the mRNA level in-site of Runx2 is without obvious in each group Change (Fig. 3 g).

For the action site for further verifying miR-103a and Runx2mRNA, the present inventor is constructed according to biological information Learn 3 ' UTR Dual-Luciferase of saltant type (MUT) Runx2 report of the binding site region mutagenesis of prediction miR-103a and Runx2 Genophore (Fig. 3 h).3 ' UTR luciferase reporter gene carrier of MUT Runx2 is swashed with the simulation of miR-103a respectively Dynamic agent and inhibitor mimic-103a, the inhibitor-103a cotransfection in hFOB1.19 human osteoblast cell is. Luciferase experiment display mimc-103a inhibits and inhibitor-103a enhances 3 ' UTR Dual-Luciferase report of WT Runx2 Carriers Active is accused, but (Fig. 3 i) both is had no significant effect to 3 ' UTR Dual-Luciferase report carrier activity of MUT Runx2.

The above result shows that miR-103a is by being incorporated into key transcription in the osteoblast differentiation that stress stimulation mediates 3 ' the UTR seed regions of factor R unx2 and directly target Runx2 in post-transcriptional level inhibits its expression.

Embodiment 4, miR-103a rise in the osteoblast differentiation that mechanical stress stimulation mediates as stress sensitive miRNA Regulating and controlling effect

In order to verify whether miR-103a is stress loading sensibility miRNA, the present inventor loads using 8%CMS HFOB1.19 human osteoblast cell is 3 days, and compared with standing group, reinforcing group miR-103a level is decreased obviously for qRT-PCR detection discovery (Fig. 4 a).

There are the locus sites of two miR-103a precursor pre-miR-103a on human genome.Humanized miR- The loop-stem structure (stem-loop) of 103a-1 is positioned at No. 5 chromosome of people, and the loop-stem structure of miR-103a-2 is positioned at people On No. 20 chromosome.For all known vertebra species, miR-103a/107 is embedded in coding PANK with source capsule miRNA In the introne of (pantothenate kinase enzyme, PANK) gene.Mature miR-103a-1 and miR-103a-2 It is respectively derived from its host gene PANK3 and PANK2 introne-intron 5 (Fig. 4 b).PANK3 and PANK2 gene is coacetylase Synthesis and glycolipid metabolism in important enzyme.In order to which whether proof stress stimulation passes through the host gene of regulation miR-103a The expression of PANK3 and PANK2 and then the expression for influencing miR-103a.The present inventor loads hFOB1.19 people's skeletonization using 8%CMS Cell line 3 days, the mRNA level in-site of detection stress loading front and back PANK3 and PANK2.Under qRT-PCR shows 8%CMS selectively It has adjusted the mRNA expression of PANK3 but the mRNA level in-site of PANK2 has been had no significant effect.MiR-103a after this change and reinforcing Situation of change it is consistent (Fig. 4 c).Result above prompt: 1. maturation miR-103a are mainly by the miR- in its precursor double-strand 103-1 shearing, miR-103-1 derive from Pank3 gene locus.The expression variation of caused miR-103a is main after reinforcing Selectively derived from the precursor miR-103-1 for the miR-103a for being embedded in Pank3 gene locus；2. being positioned in its host gene The expression of miRNAs containing son is usually consistent with the expression of its host gene.

Further to probe into the expression variation that CMS mediates miR-103a in lower osteoblast differentiation maturation overall process, The present inventor is to detect the expression of miR-103a every three days to 21 days using 8%CMS load culture hFOB1.19 human osteoblast cell It is horizontal.The inventors discovered that miR-103a it is horizontal Osteoblast Differentiation early stage it is significant lower (0~9 day), then gradually slowly under It is adjusted to 21 days (Fig. 4 d, on), Runx2 protein level obviously raises (day 3) when Osteoblast Differentiation starts and maintains high-level table 21 days mineralising phases (mineralization stage) is reached, be then remarkably decreased (Fig. 4 d, under).Meanwhile Runx2, ALP, Ocn MRNA level in-site in the process significantly raise (Fig. 4 e).The mRNA level in-site of this Runx2 and the expression of protein level are inconsistent Caused by may be the regulation due to miR-103a for the post-transcriptional level of Runx2.In conjunction with the expression of miR-103a and Runx2, It can be understood as at Osteoblast Differentiation initial stage, the level of miR-103a is decreased obviously, and the restraining factors of high inhibition Osteoblast Differentiation are unexpected Unlock, so that differentiation process is started；And entering the differentiation terminal phase, the expression of miR-103a remains unchanged so that skeletonization The process of differentiation is terminated in due course.

The above result shows that miR-103a and its host gene PANK3 is for stress stimulation sensitivity, miR-103a may be The effect of regulation process initiation and terminator is played in the Osteoblast Differentiation process that mechanical stress stimulation mediates.MiR-103a conduct Stress stimulation sensitivity miRNA passes through target regulating and controlling effect in transcription factor Runx2 is in osteoblast differentiation.

Embodiment 5, miR-103a mechanical stress stimulation mediate osteoblast differentiation in inhibit osteoblast activity and Extracellular matrix mineralising

In order to probe into the effect for regulating and controlling osteoblast activity of miR-103a, the present inventor is in hFOB1.19 human osteoblast cell The simulation agonist mimic-103a and inhibitor inhibitor-103a of miR-103a are transfected in system respectively.8%CMS load 3 After it, being compared with internal reference, mimic-103a significantly reduces the mRNA expression of ALP and Ocn in osteoblast differentiation, Inhibitor-103a then enhances their expression (Fig. 5 a).Equally, being overexpressed miR-103a reduces in osteoblast differentiation ALP activity and ALP dyeing, inhibit miR-103a expression to enhance ALP activity and ALP dyeing (Fig. 5 b, c).

In order to further probe into function of the miR-103a in extracellular matrix mineralising, the present inventor is long-acting with miR-103a's (miRNA antagomir/agomir, is repaired through special chemical by agonist and inhibitor agomir-103a and antagomir-103a MiRNA long-acting antagonists/agonist of decorations) and NC internal reference be overexpressed and inhibit miR-103a respectively in hFOB1.19 cell Expression.In order to maintain the expression of stablizing of miR-103a, agomir-103a and antagomir-103a supplement addition one every three days It is secondary.QRT-PCR confirms that agomir-103a and antagomir-103a effectively can be overexpressed and knock out endogenous cellular miR-103a Expression (Fig. 5 d).After 8%CMS stress loading 21 days, Alizarin red staining, which is shown, compares space management control group and NC control Group, agomir-103a processing group extracellular matrix mineralising obviously weaken, and antagomir-103a processing group extracellular matrix mineralising increases (Fig. 5 e) by force.

In order to verify miR-103a this Regulate Osteoblast Differentiation effect whether be Runx2 must and dependence, The specific siRNA that the present inventor constructs Runx2 interferes its expression, and then studies it and make to miR-103a regulation Osteoblast Differentiation Influence (Fig. 5 f).The inventors discovered that after being knocked out with the siRNA of Runx2, Runx2 downstream gene in Osteoblast Differentiation The mRNA level in-site and ALP of ALP, Ocn are quantitatively significantly inhibited (Fig. 5 g).However, working as the siRNA and miR-103a of Runx2 Analogies mimic-103a and inhibitor inhibitor-103a cotransfection after, quilt the effect of the chemical simulation object of miR-103a It blocks completely, the mRNA level in-site and ALP of ALP, Ocn quantitatively maintain low-level.Result above prompts miR-103a in machinery The regulating and controlling effect in osteogenic differentiation process that stress mediates is that Runx2 must be with dependence (Fig. 5 g).

Classical access Wnt/ β-catenin and ERK1/2MAPK access conducts in stress, the key effect in response by Document confirms extensively.But it is on the knees of the gods with the presence or absence of mutual Cascade Regulation between miR-103a and above-mentioned two accesses.Exist for verifying Whether the expression of miR-103a is by ERK1/2MAPK and Wnt/ β-catenin in the osteoblast differentiation that mechanical stress stimulation mediates The regulation of access, the present inventor use access the blocking agent U0126 and IWR-1 of ERK1/2MAPK and Wnt/ β-catenin respectively (U0126, ERK1/2 access blocking agent；IWR-1, Wnt/ β-catenin access blocking agent) hFOB1.19 human osteoblast cell is added The expression (Fig. 5 h) of miR-103a detects respectively in system.The logical of ERK1/2MAPK and Wnt/ β-catenin is added in qRT-PCR display Road blocking agent U0126 and IWR-1 has no significant effect the expression of miR-103a.

Result above prompt: miR-103a is in the osteoblast differentiation and extracellular matrix mineralising that mechanical stress stimulation mediates Inhibiting effect is played dependent on Runx2.This regulating and controlling effect and ERK1/2MAPK and Wnt/ β-catenin signal of miR-103a Without interaction between access.

Embodiment 6, miR-103a long-acting inhibitor can save hindlimb unloading mouse model bone loss phenotype

Above inventors have established that miR-103a the horizontal Osteoblast Differentiation mediated to load can play important regulating and controlling in vitro Effect, following the present inventor will verify whether miR-103a can equally regulate and control bon e formation in vivo.It is sent out by bioinformatics It is well-conserved that several species are presented in existing miR-103a in vertebrate.Prompt can be studied in mouse the expression of miR-103a with And its relationship (Fig. 6 a) with bon e formation.It is each main dirty in C57BL/6J Mice Body that the present inventor has detected miR-103a first Device tissue includes the gene expression abundance in bone tissue.Gene expression abundance of the miR-103a in bone tissue is apparently higher than other as the result is shown Main organs prompt miR-103a to play more important regulating and controlling effect (Fig. 6 b) in bone tissue reconstruction.

In order to verify the influence whether expression of miR-103a in horizontal bone tissue in vivo is similarly subjected to stress, the present invention People detects the expression of miR-103a in hindlimb unloading mouse and control group mice femur respectively.QRT-PCR is shown: compared with BS Base set and WB control group mice, the expression of miR-103a obviously rises (Fig. 6 c) in hindlimb unloading mouse femur. Counteracting can be effectively inverted as caused by stress missing in order to further verify the exogenous supplement Antagomir-103a that gives HU group mouse (HU+Antagomir-103a, Antagomir-103a, dosage 80mg/ is respectively set in bone loss, the present inventor Kg), PBS group mouse (HU+PBS, PBS, dosage 0.3ml) is continuously injected 3 times (Fig. 6 d) before hanging tail by tail vein.In order to The stabilization gene expression abundance of miR-103a in vivo is maintained, HU group mouse (HU+Antagomir-103a mice) is injected in first time Third week receives another one injection afterwards.All mouse were put to death at hind limb suspension 28 days.The inventors discovered that compared with HU group and HU+ PBS group mouse, miR-103a expression is lower in HU+Antagomir-103a group mouse femur and Runx2 protein expression is higher, and The expression no significant difference (Fig. 6 e, f) of miR-103a and Runx2 in HU group and HU+PBS group mouse.

The above result shows that: 1.antagomir-103a can effectively lower the gene expression abundance of miR-103a in bone tissue； 2.antagomir-103a can partial inversion Runx2 in the bone tissue as caused by hindlimb unloading expression lower.It is prior It is that microCT is as the result is shown as going the decline of bone amount caused by load can be by antagomir-103a partial rescue (Fig. 6 g, h).Bone Tectology correlation analysis is shown, compared with HU group and HU+PBS group mouse, the bon e formation of HU+Antagomir-103a group mouse Relevant parameter (Ob.S/BS, MAR, N.Ob/B.Pm) apparent increase (Fig. 6 i, j), and bone resorption relevant parameter (Oc.S/BS, N.Oc/B.Pm) in HU, HU+PBS, no significant difference (Fig. 6 k, l) in HU+Antagomir-103a group mouse.

The above result shows that: expression of the 1.miR-103a and Runx2 in bone tissue is regulated and controled by stress loading；2. in vivo Level, the decline of Runx2 protein level caused by load lacks and bone loss increase related to the expression of miR-103a；3. in HU In mouse, the inhibitor by giving miR-103a can partial inversion bone amount decline phenotype caused by load missing.Therefore, The inhibitor (lower to adjust) of miR-103a can significantly improve osteoporosis or bone loss.

Embodiment 7, drug screening

HFOB1.19 cell is taken, which can endogenous expression miR-103a.Using this kind of cell as being used to screen prevention and treatment The cell model of the drug of bone metabolic disease.

Test group: with the culture for the above-mentioned cell that candidate substances are handled；

Control group: without the culture for the above-mentioned cell that candidate substances are handled.

Appropriate time after treatment measures the expression of the miR-103 of the cell.If compared with the control group, test group In the expression of miR-103 be remarkably decreased 30% or more, then illustrate that the candidate substances are the objects of potential prevention and treatment bone metabolic disease Matter.

Using antagomir-103a and agomir-103a as candidate substances, above-mentioned cell is transfected.As a result, it has been found that Antagomir-103a may make the expression of the miR-103 in test group to be remarkably decreased 90% or more.Therefore, antagomir- 103a is a kind of useful drug candidate.

It discusses

Mechanical stress stimulation is most important for the effect of bone remoulding.The present invention is prompted from clinical picture, with bone weight It builds stable state angle to start with, explores what mechanical stress stimulation mediated osteoblast differentiation influence and miRNA in mechanical stress Regulating and controlling effect and mechanism in Osteoblast Differentiation.The present invention is excavated by bioinformatics method and to verify load in Osteoblast Differentiation quick Perceptual miRNA probes into its expression under mechanical stress regulation and the Osteoblast Differentiation and bon e formation in mechanical stress stimulation mediation In regulating and controlling effect and mechanism.The inventors discovered that miR-103a is new not as one kind under physiology and pathology loaded-up condition It is found the specific power sensitivity miRNA reported regulation Osteoblast Differentiation and bon e formation.It is horizontal in vitro, it is stimulated in mechanical stress In the osteoblast differentiation and bon e formation of mediation, miR-103a is existed by target key transcription factor Runx2 in Osteoblast Differentiation Post-transcriptional level inhibits it to express and play inhibiting effect to osteoblast differentiation and bon e formation.It is horizontal in vivo, it is gone in double hind legs In load HU mouse, the experiment in vivo result prompt of the present inventor regulates and controls internal miR-103a level by therapeutic pre-administration can The decline of bone amount caused by partial rescue is lacked by stress, osteoporotic phenotype.For now, miR-103a is as a kind of new Power sensibility miRNA provides the Osteoblast Differentiation bone mediated about miRNA in stress loading for the first time in osteoclast precursor The assistant evidence of regulating and controlling effect and mechanism in formation.Also prompt miR-103a can be used as potential medicine target in clinic and treat clinical stress Disuse osteoporosis caused by lacking.

Mechanical stress, which is initially reported in a variety of organism physiologies and pathogenesis, plays important regulating and controlling effect.Wherein, with machine Tool stress is studied the most extensive in terms of cardiovascular system, Musculoskeletal and lung physiology.However, about mechanical stress The effect of osteoblast differentiation is still needed to be clarified in vivo.The present invention discloses osteoblast outside receiving in vivo and in vitro respectively When boundary's load stimulates, it will occur to be in particular on cell function and morphosis the rapid adaptability of load.Present invention hair Existing mechanical stress load can significantly promote osteoblast differentiation and bon e formation.

Osteoblast differentiation will lead to a series of transcription factors, hormone hormone, growth by after mechanical stress stimulation starting The cascade reaction of factor response promotes osteoblast differentiation and bon e formation.As the most key and required turn in Osteoblast Differentiation The factor is recorded, Runx2 can be combined in the special cis element 2 of osteoblast of all main Bone formation-related gene promoter regions (osteoblast-specific cis-element 2, OSE2).The mouse that Runx2 is knocked out entirely is i.e. dead in embryonic period, embryonic phase, in vivo Without osteoblast, thus also without bone tissue, only cartilage exists.The hybrid mice of (Runx2- /+) that Runx2 half is knocked out is in Now specific skeleton development impairment property extremely similar with people's heredity skeleton development.The mouse of heterozygous deletion Runx2 shows Character and a kind of typical mutant mice: cleidocranial dysplasia (Cleidocranial Dysplasia, CCD) is small Mouse is closely similar.The heterozygous mutant of the DNA binding structural domain of any Runx2, including deletion mutation and base Substitution, all can CCD character is presented.The inventors discovered that mechanical stress, which stimulates, can obviously raise Runx2 protein level in the present invention, and its mRNA Horizontal only slight rising.This promotes the present inventor to go further to probe into the regulation that wherein whether there is post-transcriptional level, such as The regulation of miRNA exists.

MiRNAs is since being found because it is in the important regulating and controlling effect in a variety of physiology, pathogenesis and by increasingly Extensive concern.Some researchs confirm in various kinds of cell system in vitro that mechanical stress includes shearing force and circulation Tension Adjustable control one The expression of serial miRNAs.These miRNAs are also involved in the response that cell stimulates mechanical stress.In recent years, a plurality of miRNAs quilt It confirms exist in bone remoulding as important regulating and controlling factor, is existed by the expression for regulating and controlling bone remoulding related gene in post-transcriptional level It plays an important role in clinical many bone metabolic diseases such as osteoporosis.However, the osteoblast point mediated in mechanical stress stimulation The regulating and controlling effect of the expression and its target gene of correlation miRNA in the process is not yet known completely in change.The present invention for the first time will The expression of miRNA is stimulated with mechanical stress and bone remoulding stable state is associated.

As shown in experimental result, miR-103a (being homologous gene with miR-107) is raised and is pressed down under 8%CMS stress loading 3 ' UTR highly conserved sequence of Runx2 processed matches and then inhibits Osteoblast Differentiation.MiR-103a/miR-107 is included by miRBase There are highly conserved in human genome and in more vertebrate/mammalian species.They are initially found in obesity mice Middle expression increases and then plays key regulatory in terms of being found in insulin sensitivity, prompts it may be as treatment 2 types sugar Urinate the potential medicine target of disease.In addition, also having been reported that miR-103a relevant for chronic ache.As other many miRNAs, MiR-103a, in high expression, prompts miR-103a that may play important work in tumor development process in many tumour cells With.In recent years, some researchs confirm that miR-103a may promote lipid metaboli and then regulate and control the stable state of glycolipid metabolism.It is ground however, there is no Study carefully the effect for confirming miR-103a in Regulate Osteoblast Differentiation.

Effect of the ERK1/2MAPK and Wnt/ β-catenin signal path in Osteoblast Differentiation is confirmed extensively.β- Differentiation of the mescenchymal stem cell to osteoblast of the inactivation block of catenin prompts β-catenin osteoblast point in vivo Play key regulatory in change.In the present invention, the inventors discovered that mechanical stress load can obviously activate ERK1/2 and β- Catenin signal path is gone forward side by side one the expression for promoting all polygenes downstream to include Runx2.However, the present invention does not have found There are interactions between miR-103a and ERK1/2MAPK and Wnt/ β-catenin signal path, prompt in mechanical stress Load mediate osteoblast differentiation in miR-103a expression may be not under the regulation of two accesses and and independently deposit ?.

The mechanical stress stimulation of appropriate intensity also can be used as the treatment means for treating certain bone metabolic diseases.Dynamic stress carries Lotus loads on osteoblast and can activate/activate Wnt- β-catenin access and then promote osteoblast differentiation/generation.By adding The mechanical stress load for carrying appropriate intensity, which can promote osteoblast differentiation and reach maturity, promotes union for osteocyte.Skeletonization is thin Born of the same parents and the osteocyte stress stimulation different for intensity play response.Titanic micro-plates make the repair tissue of fracture site exist after fracture Strain under physiological stress completely eliminates, and the healing of fracture macroscopic poroma does not occur and reaches adhesion.And it is elastic Interior fixation includes the mediate agglutination of intramembranous ossification and entochondrostosis, its main feature is that poroma is formed.Result of the present invention is taken off in vivo Show that a kind of new miR-103a regulates and controls the new mechanism of bon e formation in vivo.MiR-103a is in high abundance table in bone tissue It reaches, prompts it that may play important regulating and controlling effect in bone remoulding.Research shows that expression of the miR-103a under mechanical stress stimulation Corresponding change occurs for the protein level that variation can lead to Runx2.The variation of Runx2 expression will further influence skeletonization point downstream Change the expression of related specific gene.In hindlimb unloading mouse, pass through the therapeutic long-acting inhibitor for giving miR-103a Antagomir-103a can invert by miR-103a caused under abnormal pathologic stress state exception increase, partial rescue due to Bone loss phenotype caused by stress lacks.

In short, the research of the present inventor finds and demonstrates miR-103a as a kind of new stress loading sensibility MiRNA regulates and controls Osteoblast Differentiation, and miR-103a is in Osteoblast Differentiation by realizing it in Runx2 in post-transcriptional level direct target Adjusting function.This prompt is external in vivo, can using miR-103a as a kind of new potential medicine target, by regulate and control its in physiology and Expressing to achieve the purpose that regulate and control bon e formation under pathology stress state.These discoveries are not only research stress loading conduction aspect A kind of New view is provided, and is also provided a kind of using miRNA molecule as the way of regulation bone tissue engineer regenerative medicine Diameter.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can be with The present invention is made various changes or modifications, these equivalent forms also fall within the scope of the appended claims of the present application.

Claims (8)

1. a kind of purposes of the lower adjustment of miR-103a in the drug of preparation prevention or treatment bone metabolic disease；Wherein, described Bone metabolic disease be that osteoporosis caused by stress missing, Osteoblast Differentiation be abnormal, bone loss；Under the miR-103a Adjustment is selected from:

Inhibitor-103a, nucleotide sequence is as shown in SEQ ID NO:47；Or

Modified inhibitor-103a, the modification are methoxylation modification, thio-modification and/or cholesterol modification.

2. purposes as described in claim 1, which is characterized in that the lower adjustment of the miR-103a is antagomir- 103a, nucleotide sequence is as shown in SEQ ID NO:49；The modification of the antagomir-103a are as follows: 3 ' ends carry out gallbladder It is sterol-modified, 5 ' the two thio backbone modifications in end, 3 ' the four thio backbone modifications in end, full chain methoxyl group modification.

3. purposes as described in claim 1, which is characterized in that the drug is also used to:

Increase the expression of Runx2 albumen；

Enhance the expression of ALP and Ocn in osteoblast differentiation；Or

Enhance extracellular matrix mineralising.

4. a kind of purposes of miR-103a, which is characterized in that for screening the drug of prevention or treatment bone metabolic disease；The use Way is non-diagnostic or therapeutic purposes；The bone metabolic disease is osteoporosis caused by stress missing.

5. a kind of method of the potential substance of screening prevention or treatment bone metabolic disease, which comprises

(1) system of expression miR-103a is handled with candidate substances, the system is cell culture system；With

(2) expression of miR-103a in the system is detected；

Wherein, if the candidate substances can reduce the expression of miR-103a, show that the candidate substances are prevention or treatment bone generation Thank to the potential substance of disease；

Wherein, the bone metabolic disease is osteoporosis caused by stress missing, Osteoblast Differentiation exception, bone loss.

6. method as claimed in claim 5, which is characterized in that also express Runx2 albumen in the system, the method is also It include: the expression of Runx2 albumen in the detection system；

Wherein, if the candidate substances increase the expression of Runx2 albumen by lowering the expression of miR-103a, show the time Selecting substance is the potential substance of prevention or treatment bone metabolic disease.

7. method as claimed in claim 5, which is characterized in that step (1) includes: that candidate substances are added in test group Into the system of expression miR-103a；With

Step (2) includes: the expression of miR-103a in the system for detect test group, and compared with the control group, wherein pair It is not add the system of the expression miR-103a of the candidate substances according to group；

If the expression of miR-103a is statistically lower than control group in test group, indicate that the candidate is prevention or treatment The potential substance of bone metabolic disease.

8. method as claimed in claim 6, which is characterized in that step (1) includes: that candidate substances are added in test group Into the system of coexpression miR-103a and Runx2 albumen；With

Step (2) includes: the expression of miR-103a and Runx2 albumen in the system for detect test group, and compared with the control group, Described in control group be do not add the candidate substances coexpression miR-103a and Runx2 albumen system；

If the expression of miR-103a is statistically lower than control group in test group, and the expression of Runx2 albumen dramatically increases, Indicate that the candidate is the potential substance of prevention or treatment bone metabolic disease.