CN104306988B - Uses of miR-431 in preparation of muscular disease treatment medicines - Google Patents

Abstract

The invention relates to a use of miR-431 in the preparation of muscular disease treatment medicines, concretely relates to functions of miR-431 in skeletal muscle stem cells and muscular disease treatment, especially relates to a use of miR-431 in muscle injuries and muscular dystrophy, and also relates to a use of miR-431 in the preparation of skeletal muscle stem cell activation, proliferation and differentiation promotion medicines, and an miR-431-containing medicinal composition for treating muscular diseases.

Description

Purposes in the medicine of preparation treatment muscle disease for the miR-431

Technical field

The present invention relates to medical domain, in particular to miR-431 in treatment muscle disease, particularly muscle injury and Purposes in muscular dystrophy.

Background technology

Skeletal muscle plays very important effect in the vital movement of organism.It not only plays motion and supports work( Can, it is an important metabolic organ simultaneously.The metabolism in skeletal muscle of the material such as sugar that body is absorbed and lipid produces energy Amount, this plays very important effect to the steady statue maintaining whole body.Many diseases such as tumor, HIV, chronic The patients such as the heart failure symptom that late skeletal muscle being accompanied by gradually decrease more.Additionally, skeletal muscle or important endocrine organ Official, secretes some regulatory factors, such as muscle mass (Myostatin), IL-6, IL-8, IL-15 and FGF21 etc..These regulation and control The factor also participates in other physiology and pathological process [1] in addition to adjusting the growth promoter of skeletal muscle itself.

Satellite cell is the main stem cell of skeletal muscle, and satellite cell is in the list between muscle fiber sarolemma and basement membrane Nucleuss [2].Satellite cell expresses a series of molecular marked compounds, such as Pax7, M- cadherin, c-Met, MNF, NCAM and VCAM-1 etc..It is different in the quantity of the different phase satellite cell of different plant species and growth.Newborn mice centre halfback astrocyte Quantity account for whole flesh core 30% about grow up after, the ratio of satellite cell is reduced to 4%, to after old age, mouse satellite cell Ratio drop to 2% about.

One marked feature of skeletal muscle tissue can be regenerated after injury, and satellite cell regenerates in Skeletal muscle injury During play critical function.Satellite cell is in quiescent condition in normal state, when by environmental stimuli such as damage or fortune In the case of dynamic, the satellite cell being in quiescent condition is activated, and the satellite cell of activation, through propagation, differentiation, merges and formed New core, in central skeletal muscle fiber, has part cell to maintain stablizing of skeletal muscle satellite cell storehouse by self renewal simultaneously Property.This process is that hight coordinate is unified [3,4].At nominal conditions, skeletal muscle passes through the new skeleton being formed of injury regeneration The form of flesh and function do not have difference with the skeletal muscle not having to damage.A lot of myopathies the later stage deteriorate be because satellite cell self Renewal is suppressed caused by leading to the activation of satellite cell exhaustion or satellite cell, propagation to be suppressed.So research skeleton Muscle satellite cell is bred, and the mechanism of differentiation and self renewal is significant for treatment skeletal muscle disease.

The non-coding microRNA that microRNA (also writing miRNA or miR) has regulation activity as a class is (usual 18 to 25nt), the growth of the various histoorgan of wide participation is occurred with disease.MiRNA participates in the positive evidence of skeletal development The skeletal development coming from mice after skeletal muscle tissue conditionality knocks out Dicer gene occurs extremely, including skeleton Flesh etc. reduces, muscle fiber paramophia.The albumen of Dicer gene code is necessary nucleic acid in the miRNA maturation course of processing Restriction endonuclease, this shows that miRNA plays a significant role during skeletal development.Now it has been reported that there being many miRNA to participate in The process [5-8] of Skeletal muscle injury regeneration.First is reported in occur that expression changes during injury repairing is miR-181, Significantly raise [9] in the final stage miR-181 expression of injury regeneration.MiR-351 is in the early expression amount of CTX injury regeneration It is instantly increased, miR-351 passes through the propagation [10] suppressing cell cycle inhibitors E2F3 to promote satellite cell.MiR-206 exists After CTX damages, expression significantly raises, this prompting miR-206 function, this and miR-206 in Skeletal muscle injury regeneration In knock out mice, Skeletal muscle injury regeneration function is badly damaged consistent [11].The expression of miR-206 raises and can press down The expression of many genes processed, including Pax7, Notch3, IGFBP5 [11] and HMGB3 [12], and all these gene all presses down Atomization processed.Additionally, the expression of miR-1 raises the expression [13] also contributing to suppress Pax7 in damage process.Equally In ground, after CTX damages, miR-26a expression raises.After striking low miR-26a expression in tibialis anterior, Skeletal muscle injury The process of regeneration slows down [14].In identical model, miR-125b expression after CTX damage raises, miR-125b downstream Target gene IMA-IGF2BP3-001 (IGF-2) expression increase [15].IGF-2 can regulate and control myogenic differentiation process and suppress Injury regeneration process [15] afterwards.Additionally, during regeneration, the increase of miR-133 expression is to prevent satellite cell from becoming brown fat Fat cell [16].During increasing miRNA participates in Skeletal muscle injury regeneration, ectogenic miRNA intervenes damage Regenerative process is probably a direction of future therapeutic muscle disease.

Muscle mass (also referred to as growth and differentiation tactor-8, growth and differentiation factor-8, GDF8) it is TGF-β family member [17].Myostatin gene knock-out mice whole body skeletal muscle significantly increases.Meanwhile, multiple kinds The animal (for example, double flesh cattle [18-19], dog [20], sheep [21] and people [22] etc.) belonging to, because myostatin gene is natural After mutation, all the phenotype similar with myostatin gene knock-out mice skeletal muscle in skeletal muscle.Therefore, muscle mass It has been regarded as since finding from 1997 controlling the negative regulatory factor of muscle development, and cause extensive concern.Muscle suppresses Effect in plain skeletal development after birth is mainly reflected in two aspects：First, muscle mass is to normal bone after birth The regulation and control of bone flesh growth promoter；Second, in the case of various muscle injurys, stimulation or myopathy, muscle mass damages to skeletal muscle The impact that wound is repaired.Although a lot of evidences show, sarcoplast and satellite cell are that the target that muscle mass acts in vivo is thin Born of the same parents, but other cell is likely to be regulated and controled by muscle mass.After overexpression muscle mass in adult mice, can induce into Year, cachexia (cachexia) in mice, and whole body skeletal muscle and fatty tissue substantially reduce.These animals skeletal muscles reduce Degree and speed are difficult to only be explained with muscle mass suppression satellite cell.Therefore, muscle mass is likely to directly Act on myotube.There are some researches show now, muscle mass can suppress the albumen of the myotube being broken up by C2C12 to synthesize.This Outward, muscle mass makes fatty tissue quick depletion, and this prompting muscle mass has direct effect to fatty tissue.In HIV sense Under the disease event such as dye, cachexia and chronic heart failure, skeleton muscle size reduces in a large number, simultaneously the expression of muscle mass Raise.Show that muscle mass may participate in the morbidity of these myopathies or the Skeletal muscle injury that causes of these diseases was repaired Journey.Therefore, intervene the expression of muscle mass or suppress its activity, may have and can alleviate the skeleton human body being caused by these diseases Long-pending decline and the forfeiture of function, (sarcopenia), muscular dystrophy (dystrophy) etc. are levied in such as old skeletal muscle decay.

Muscle disease (muscular disorders) typically refers to skeletal muscle disease.Muscular dystrophy is one group and is primary in The heredopathia of muscular tissue.The skeletal muscle atrophy that clinical signs increase for progressive is false with powerless, tendon reflex disappearance, muscle Loose.Position is involved according to patient muscle's atrophy and can be divided into polytype：Duchenne/Becker type muscular dystrophy (DMD/ BMD), face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal type myotrophy be not Good, ocular myopathy type muscular dystrophy, eye muscle-pharynx flesh type muscular dystrophy.DMD type muscular dystrophy is most common A class progressive muscular dystrophy.Prevalence is 3.3/10 ten thousand, accounts for the 20-30/10 ten thousand of birth boy baby, is X- linked recessive Heredity.Mainly boy's morbidity, women is the carrier of Disease-causing gene.Usual 5 years old about morbidity.The flesh of being by property of amyotrophy Meat disease, poor prognosis, typically lethal with myocardial function exhaustion or dyspnea etc. when 20-30 year.Currently for this disease, cure Educational circles there is no effective therapy.Mdx mice is dystrophin (dystrophin) genetic flaw Mus, is that research skeletal muscle is done Cell-stimulating, the most frequently used model of propagation, differentiation regulatory mechanism and Skeletal muscle injury-regeneration mechanism.

Initial research reports that the sarcoplast of In vitro culture can make dystrophin recover weight in Mdx mice New expression, this has evoked the very big enthusiasm [23] to the treatment of clinical muscular dystrophy.It is true that autoplastic by satellite cell The sarcoplast developing in clinical practice in the reparation of cardiac muscle, also all some positive result simultaneously.But, have Several big obstacles have slowed down to the research based on satellite cells for treatment myotrophy disorders.Autoplastic satellite cell is still not Dystrophin can be expressed, only the satellite cell using heteroplastic transplantation compensates the myotrophy of disappearance in DMD patient Not dystrophin.Therefore, there is following problem, be the immunologic rejection of host first, next to that depositing after transplanting satellite cell Work, self renewal and migration are all poor.It is the theoretical basiss of future therapeutic muscular dystrophy to the research of as above problem, have Potential applicability in clinical practice well.

Content of the invention

In view of above technical problem, according to the disclosure some embodiment there is provided miR-431 is in preparation treatment muscle Purposes in the medicine of disease.

In the disclosure, muscle disease refers to skeletal muscle disease, and it is selected from muscle injury and muscular dystrophy.Real at some Apply in mode, described muscle injury is acute muscle injury.In some embodiments, described muscular dystrophy is selected from： Duchenne/Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type flesh Malnutrition, distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type myotrophy are not Good.In some specific embodiments, muscular dystrophy is Duchenne/Becker type muscular dystrophy.

In the disclosure, the nucleotide sequence of described miR-431 such as UGUCUUGCAGGCCGUCAUGCA (SEQ ID No.1, Genbank no.MIMAT0001418) shown in.

In some embodiments, described treatment is selected from following one or more：Promote myoblastic differentiation, promotion Skeletal muscle injury regenerates, improves pathology and physiological phenotype.

In some embodiments, the myoblastic differentiation of described promotion refers to improve myogenin and/or myosin weight The expression of chain.

In some embodiments, described promote Skeletal muscle injury regeneration refer to promote the activation of satellite cell, propagation and Differentiation.

In some embodiments, described improve pathology and physiological phenotype refers to selected from following one or more：Reduce Serum creatine kinase level, improvement fatigue and raising muscle fiber tension force.

According to the disclosure other embodiment there is provided miR-431 preparation promote muscle stem cell activation, propagation And the purposes in the medicine of differentiation.

According to other embodiments of the disclosure, provide a kind of pharmaceutical composition for treating muscle disease, its bag MiR-431 containing therapeutically effective amount.Described muscle disease is selected from muscle injury and muscular dystrophy.In some embodiments, Described muscle injury is acute muscle injury.In some embodiments, described muscular dystrophy is selected from：Duchenne/ Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, Distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy.In some tools In the embodiment of body, muscular dystrophy is Duchenne/Becker type muscular dystrophy.

In some embodiments, described pharmaceutical composition is prepared to be adapted for the form of microinjection or is suitable to turn The form of dye.

In some specific embodiments, described pharmaceutical composition is in vitro administration：By miR-431 or being capable of table The carrier reaching miR-431 imports or transfection of mammalian is autologous or variant cell in vitro, after vitro cell expansion, the defeated time food in one's mouth Newborn animal body.In other specific embodiments, described pharmaceutical composition is internal administration：MiR-431 or can The carrier of expression miR-431 is introduced directly in mammal body.This carrier can be virus type or non-viral, even naked DNA or RNA.

Described mammal is selected from the mankind, mice, Canis familiaris L., rabbit, cattle or monkey；The preferably mankind or mice；The most preferably mankind.

As needed, pharmaceutical composition also includes pharmaceutical acceptable carrier, and it includes but is not limited to：Diluent, buffer agent, suspension Agent, Emulsion, granule, encapsulation agents, excipient, filler, binding agent, spray, cutaneous permeable agent, wetting agent, disintegrating agent, suction Receive accelerator, surfactant, coloring agent, correctivess or absorption carrier.

Brief description

Fig. 1 is shown in miR-431 in microarray and knocks out the expression in Mus and wild-type mice in myostatin gene.

In Fig. 2 display real-time quantitative PCR checking microarray, miR-431 knocks out Mus in myostatin gene and wild type is little The result of the expression in Mus.

Fig. 3 shows expression in the satellite cell that myostatin gene knocks out Mus and wild-type mice for the miR-431.

It is thin that Fig. 4 display processes C2C12 using the muscle mass of restructuring with different dosage (0,0.5,1,1.5 μ g/ml) The expression of miR-431 after born of the same parents.

Fig. 5 show using restructuring muscle mass with 1 μ g/ml dosage process respectively C2C12 cell different time (12, 24th, 36,48h) miR-431 afterwards expression.

Fig. 6 shows that to be jointly processed by C2C12 using muscle mass and its inhibitor follicostatin (Follistatin) thin The expression of born of the same parents miR-431 after 24 hours.

Fig. 7 show inhibitor PD98059 and the muscle mass of Mek be jointly processed by C2C12 cell after p-Erk in albumen water Flat expression.

Fig. 8 shows that the inhibitor PD98059 of Mek and muscle mass are jointly processed by the table of miR-431 after C2C12 cell Reach.

Fig. 9 shows that muscle mass processes C2C12 (DN-Ras) cell and the matched group C2C12 of the mutation of Ras negativity simultaneously After cell, p-Erk, p-Mek are in the expression of protein level.

Figure 10 shows that muscle mass processes C2C12 (DN-Ras) cell and the matched group C2C12 of the mutation of Ras negativity simultaneously The expression of miR-431 after cell.

Figure 11 shows gene expression abundance in the different tissues of adult mice for the miR-431.

Figure 12 shows expression change in C2C12 cell differentiation procedure for the miR-431.

Figure 13 shows expression change in skeletal muscle satellite cell atomization for the miR-431.

Myogenin after Figure 14 display C2C12 cell differentiation matched group and stable transfection miR-431 after 24 hours (Myognin, MyoG immunofluorescent staining result).

Myoglobulin heavy chain after Figure 15 display C2C12 cell differentiation matched group and stable transfection miR-431 after 36 hours (MHC) immunofluorescent staining result.

After Figure 16 display C2C12 cell differentiation matched group and stable transfection miR-431 after 24 hours, myogenin is in transcription water Flat expression.

After Figure 17 display C2C12 cell differentiation matched group and stable transfection miR-431 after 24 hours, myogenin is in albumen water Flat expression.

Myosin after Figure 18 and Figure 19 display C2C12 cell differentiation matched group and stable transfection miR-431 after 36 hours Heavy chain is in the expression of transcriptional level and protein level.

Flesh (TA flesh) cross section HE dyeing before Figure 20 display CTX induction 8-10 week 7 days ossa tibiale posteriuses of mouse muscle injury regeneration Result.

After Figure 21 display muscle injury, the crosscutting superior facial nucleus of 7 days tibialis anterior is in central muscle fiber number ration statisticses.

(green) immunity of MyoD after Figure 22 display miR-431 transgenic mice and wild-type mice reason after CTX damages 1 day Fluorescence staining result, DAPI dyeing (red) positioning nucleus.

Figure 23 shows MyoD positive cell quantity statistical result, more than 10 visuals field of every group of statistics.

Figure 24 display miR-431 transgenic mice and wild-type mice Pax7 and MyoD protein level after CTX damages 1 day Testing result, GAPDH is as quantitative control.

Pax7 (red) MyoD after Figure 25 display miR-431 transgenic mice and wild-type mice reason after CTX damages 3 days (green) immunofluorescence dyeing result, DAPI dyeing (blue) positioning nucleus.

Figure 26 shows Pax7 and MyoD double positive cells quantity statistics result, more than 10 visuals field of every group of statistics.

Figure 27 display miR-431 transgenic mice and wild-type mice Pax7 and MyoD protein level after CTX damages 3 days Testing result, GAPDH is as quantitative control.

Figure 28 and Figure 29 shows the table of miR-431 transgenic mice and wild-type mice eMHC after CTX damages 3 and 7 days Reach the testing result of level.

Figure 30 shows and breaks up 36 hours with separating culture after satellite cell wild-type mice from miR-431 transgenic mice The immunofluorescent staining result of MHC afterwards.

Figure 31 shows and breaks up 36 hours with separating culture after satellite cell wild-type mice from miR-431 transgenic mice The number of MHC positive cell afterwards, the visual field that each statistics is more than 10.

Figure 32 shows and breaks up 36 hours with separating culture after satellite cell wild-type mice from miR-431 transgenic mice The detection of the expression of MHC afterwards.

Figure 33 shows from miR-431 transgenic mice with to separate suspension culture 72 after single muscle fiber wild-type mice little The result that Shi Houfen Pax7 (red), MyoD (green) and DAPI (blue) dye respectively.

Figure 34 display differentiation (Pax7^-/MyoD⁺) Status satellite cell ratio.

Figure 35 A and 35B is mdx::MiR-431 (B) and mdx (A) tibialis anterior azovan blue EBD infiltration (red) area And the immunofluorescence dyeing of Lamin (green) display cell membrane.

Figure 36 is shown as mdx::The area system that in miR-431 and mdx tibialis anterior tibialis anterior (TA), azovan blue is contaminated Meter result.

Figure 37 shows mdx::Creatine kinase horizontal detection result in miR-431 and mdx tibialis anterior (TA) serum.

Figure 38 is shown as mdx::MiR-431 and mdx mice is run and tests movement time record result.

Figure 39 and 40 is shown as mdx::MiR-431 and mdx muscle strength testing result.

Specific embodiment

Muscle injury model described in the disclosure refers to snake venom cardiotoxin (Cardiotoxin/CTX) intramuscular injection shin The acute muscle injury model that before bone, flesh causes.This model preferably provides muscle stem cell function after muscle injury Process.

Muscular dystrophy model of the present invention refers to, using mdx mouse model, be widely used as DMD muscular dystrophy Model, this model simulates human muscular's disease in gently progressive mode.

C2C12 cell is mouse muscle-forming cell system.

Embodiment 1. muscle mass passes through the expression of Ras/Raf/Mek/Erk signal path negative regulation miR-431

1. screen the miR-431 by muscle mass negative regulation

The miR-431 selecting up-regulated in myostatin gene knock-out mice skeletal muscle tissue is as candidate MiRNA is studied to its function and oneself expression regulation and control.In 5 stages of skeletal development, miR-431 suppresses in muscle Expression in plain gene knock-out mice is above wild-type mice (as Fig. 1).From (the purchase of myostatin gene knock-out mice From：Nanjing model animal institute) and wild type siblings mice (littermate control of knock out mice) different developmental phases (E15.5, 4 weeks, 10 weeks, 16 weeks and 40 weeks) skeletal muscle tissue in extract total serum IgE, using miRNA chip of expression spectrum method screening and identify The miRNA of differential expression in myostatin gene knock-out mice and wild-type mice skeletal muscle tissue.By statistical analysis, Identify the miR-431 having differences in myostatin gene knock-out mice with the expression of wild-type mice skeletal muscle.

The result of Fig. 1 shows：MiR-431 expresses higher than wild-type mice prompting in myostatin gene knock-out mice The expression of muscle mass negative regulation miR-431.

2. (Real-time) checking in real time

Take myostatin gene knock-out mice and wild type siblings mice different developmental phases (E15.5,4 weeks, 10 weeks, 16 weeks and 40 weeks) skeletal muscle tissue total serum IgE.

(1) reverse transcription：Following reagent is added in the PCR reaction tube of 0.2mL：

16 DEG C of reactions open hairpin structure in 30 minutes, and 42 DEG C are reacted 30 minutes, 85 DEG C of inactivators 5 minutes；

(2) real-time PCR：The real-time PCR of MicroRNA：Following reagent is added in 96 orifice plates：

The result of Fig. 2 shows：It is higher than wild-type mice that miR-431 expresses in myostatin gene knock-out mice, real Real muscle mass negative regulator miR-431 of checking.

3. in myostatin gene knock-out mice and wild-type mice satellite cell miR-431 expression detection

(1) the disconnected neck of 3-4 week old myostatin gene knock-out mice and wild-type mice is taken to put to death, alcohol disinfecting.From foot Toe direction is torn skin and is taken tibialis anterior, gastrocnemiuss, quadriceps femoris respectively, avoids getting tendon as far as possible, avoids being stained with Mus as far as possible Hair；With shears, muscle is shredded into gravel size in 35mm culture dish；(2) add 2ml Digestive system, put into incubator and digest 15 points Clock, then dispels separating muscle tissue with pipette tips as far as possible；(3) it is placed again into incubator to digest 15 minutes, then blow again as far as possible Dissipate, until there is no bulk tissue；(4) add in 3ml culture medium and Digestive system；(5) add the tissue of 8ml PBS dilution digestion； (6) 40 μm of filtrations；(7) 1500rpm centrifugation 10min；(8) abandon the proliferated culture medium re-suspended cell of supernatant 6ml；(9) add Differential velocity adherent 1 hour in the culture dish of 10cm；(10) supernatant is transferred in the 60mm culture dish being coated with collagen, is simultaneously introduced 2.5ng/ml bFGF Inhibited differentiation, is incubated in 5%CO237 DEG C of incubator；(11) pass on (1 after 4-5 days:2)；Receive simultaneously The RNA of proliferation period (GM).(12) 0.25% trypsin are diluted 3 times with PBS；(13) take 1.5ml peptic cell, plus 1.5ml is complete Full culture medium neutralization；(14) collect the idiophase RNA of (DM) with equal densities repopulating cell after breaking up 36 hours.(15) examine in real time Survey expression in proliferation period and idiophase satellite cell for the miR-431.

The result of Fig. 3 shows：MiR-431 expression in the satellite cell of myostatin gene knock-out mice is higher than open country Raw type mice, experimental result proves muscle mass negative regulation miR-431 further.

4. the muscle mass of vitro recombination processes C2C12 cell

First with 2 × 10⁴Cell/cm²Repopulating cell changes division culture medium simultaneously with various dose (0,0.5 μ after 12 hours G/mL, 1 μ g/mL, 1.5 μ g/mL) process C2C12 cell receive RNA (Fig. 4) after 24 hours；Then processed respectively with 1 μ g/mL dosage The different time points of C2C12 cell (12h, 24h, 36h, 48h) receives RNA (Fig. 5) afterwards；Finally it is simultaneously introduced with 1 μ g/mL dosage Follinstatin is jointly processed by C2C12 cell and receives RNA in 24 hours.Then detect respectively in various dose, different time and with When add Follinstatin after miR-431 expression (Fig. 6).

The result of Fig. 4, Fig. 5 and Fig. 6 shows：Experiment in vitro is further characterized by the table of muscle mass negative regulation miR-431 Reach.

5. muscle mass lowers miR-431 expression by Mek/Erk signal path.

First with 2 × 10⁴Cell/cm²Repopulating cell changes the inhibitor that division culture medium is simultaneously introduced Mek after 12 hours After PD98059 half an hour, add the muscle mass of 1 μ g/mL dosage to process C2C12 cell after 24 hours, receive protein with RNA.First detection muscle mass and PD98059 function, then detects the expression of miR-431.Western blot detects The phosphorylation of Eek determines PD function.

The result of Fig. 7, Fig. 8 shows：Muscle chalone passes through Mek/Erk signal path negative regulation miR-431.

6. muscle mass lowers miR-431 expression by Ras/Raf signal path.

First with 2 × 10⁴Cell/cm²Plantation DN-Ras C2C12 cell changes division culture medium after 12 hours and is simultaneously introduced After the inhibitor PD98059 half an hour of Mek, the muscle mass of the dosage of 1 μ g/mL is added to process C2C12 cell 24 hours Afterwards, protein and RNA are received.First detect muscle mass function, then detect the expression of miR-431.

The result of Fig. 9, Figure 10 shows：Muscle mass passes through the expression of Ras/Raf signal path negative regulation miR-431.

Conclusion：The above results show that internal and Vitro Experimental Results confirm the expression of muscle mass negative regulation miR-431, Experiment in vitro is further characterized by the expression that muscle mass passes through Ras/Raf/Mek/Rrk signal path negative regulation miR-431.

Embodiment 2.miR-431 is enriched with and the differentiation with C2C12 cell and satellite cell in skeletal muscle tissue camber Process expression increases.

For studying function in skeletal muscle for the miR-431, the express spectra of miR-431 is studied.Initially with Northern trace has surveyed gene expression abundance in 8 each histoorgan of week old mice for the miR-431.In order to further determine that miR- 431 expression, have detected expression under C2C12 cell difference differentiation state for the miR-431, also have detected miR-431 simultaneously and exist The expression of skeletal muscle satellite different differentiation phases.

MiR-431 is enriched with skeletal muscle tissue camber

Experimentation：From the mice of 8 week old, collect respectively lung, liver, heart, spleen, skeletal muscle, kidney, pancreas, small intestinal, Brain and gastric tissue extract RNA first respectively and then carry out Northern Blot hybridization.Process is as follows：

(1) RNA extracts

Take fresh or frozen tissue material 50-100mg, liquid feeding nitrogen grind into powder in mortar, by a small amount of liquid of powder Nitrogen transferss, in 15ml centrifuge tube, add 5ml Trizol homogenate, and room temperature stands 5 minutes.Plus 1ml chloroform (every milliliter of Trizol Plus 0.2ml chloroform) concussion mixing, room temperature standing 10 minutes.12000g, 4 DEG C are centrifuged 15 minutes.By supernatant transfer to new from Heart pipe adds 2.5ml isopropanol (every milliliter of Trizol adds 0.5ml isopropanol) to mix, and room temperature stands 10 minutes.12000g, 4 DEG C Centrifugation 10 minutes.By precipitation 75% washing with alcohol of 5ml, it is dried, how much is dissolved in appropriate DEPC water depending on precipitation, is placed in On ice.

(2) the denaturing formaldehyde gel electrophoresis of RNA

Prepare denaturing formaldehyde glue (1.2%)：Weigh 1.2g agarose, plus 87ml DEPC H₂O, heating and melting；To be cooled During to 60 DEG C, add 10 × MOPS buffer of 10ml and 37% formaldehyde 3ml, mix；Plus fluorescent dye EB is to final concentration 0.5 μg/ml；Pour in ready agarose gel groove.

The preparation (10-15 μ g) of RNA sample：By 10 × MOPS buffer of 2.5 μ l, 4.4 μ l 37% formaldehyde, 12.5 μ l Methanamide mixing；Add the RNA of 10-15 μ g, add DEPC H2O to 25 μ l；In 55 DEG C of heating in water bath 15min；Plus 5 μ l first The sample-loading buffer of amide, point sample.

Denaturing formaldehyde gel electrophoresis：Dilution 10 × MOPS buffer, to 1 × MOPS, is poured in the electrophoresis tank of cleaning；To make The gel got ready is placed in the electrophoresis tank of 1 × MOPS buffer, and prerunning is intact with testing equipment；Point sample；In 2v/cm voltage drop Lower electrophoresis, moves to gel edges to bromjophenol blue and stops；Transferring film after photograph.

(3) transferring film：After electrophoresis terminates, gel is soaked in deionized water 30 minutes；By gel be placed in 10 × SSC (or 20 × SSC) soak 30min；After nylon membrane water-soaked, put into and in 10 × SSC (or 20 × SSC), soak 10min；By gel Groove is buckled in as support in pallet, and lengthen bar 3MM filter paper bridge, spreads two-layer and glue size identical 3MM filter paper on support, The gel handled well tips upside down on support, puts nylon membrane, then puts two-layer 3MM filter paper, puts the thick absorbent paper of a folded 7-8cm； Pour 10 × SSC (or 20 × SSC) in pallet into, coated with preservative film, 500g weight in face pressure in absorbent paper, overnight (6 hours with On).After transferring film terminates, after observing nucleic acid transfer completely under the uviol lamp in darkroom, control gel pencil is in nylon membrane subscript Note loading wells and the position of molecular weight Marker or 28SrRNA, 18SrRNA.Finally clip nylon membrane with two-layer 3MM filter paper, purple Nucleic acid on the fixing film of external crosslinking, also can put 2 hours of 80 DEG C of baking oven heat fixations.Film through fixing be placed in be dried place up to Hybridization.

(4) probe labelling, purification and degeneration

Probe labelling：Make template mark probe with the PCR purified product or plasmid enzyme restriction recovery purifying product of purpose fragment, Commonly use random primering at present, labelling reaction by specification carries out (Promega).

Probe Purification：The purpose of purified probes be in order to remove the free α that is not incorporated into-³²P-dCTP, can pass through Sephadex G-50 sieve chromatography by the free α being not incorporated into-³²P-dCTP is separated with the nucleic acid fragment of labelling, collects eluting Liquid i.e. containing the good nucleic acid fragment of labelling free α-³²P-dCTP can be trapped in chromatography media.There is commercialization at present Sephadex G-50 molecular sieve chromatography, centrifugation after loading can collect the nucleic acid fragment of labelling.

Probe degeneration：The good probe of purification boils degeneration in 5 minutes through 100 DEG C, is immediately placed in 2 minutes on ice, and centrifugation is a little. Be stored in -20 DEG C standby.

(5) prehybridization and hybridization

Prehybridization：Nylon membrane is put into hybrid pipe, plus appropriate hybridization solution, 68 DEG C (being not added with the hybridization solution of Methanamide) or 42 DEG C (plus hybridization solution of 50% Methanamide) prehybridization is more than half an hour.

Hybridization：Add the probe of degeneration in hybrid pipe, the amount adding probe is typically in every milliliter of hybridization solution 2 × 10⁵--1 ×10⁶cpm.68 DEG C (being not added with the hybridization solution of Methanamide) or 42 DEG C (plus hybridization solution of 50% Methanamide) hybridize more than 8 hours.

(6) wash film

Film is washed in hybridization after terminating, remove the free probe of not hybridization, you can tabletting autography.

(7) tabletting autography

With preservative film, nylon membrane is wrapped, be fixed in X- light magazine, coated with X- mating plate, magazine be placed in -70 DEG C of refrigerators Autoradiography, the general autography time is 3-5 days, and signal is weaker sometimes can autography more than one week.

(8) punching

After autography terminates, use developer solution and fixative solution punching in darkroom, the swimming lane having hybridization signal can be in X- mating plate The band of a black in relevant position.

The result of Figure 11 shows：MiR-431 is enriched with skeletal muscle tissue camber；The result of Figure 12, Figure 13 shows：miR- 431 with skeleton satellite cell atomization expression increase.

Conclusion：The above results display miR-431 is enriched with simultaneously with myoblast differentiation process table in skeletal muscle camber The amount of reaching increases this and points out miR-431 may participate in skeletal development also myoblastic atomization.

Embodiment 3.miR-431 promotes C2C12 cell differentiation.

In order to study function in skeletal muscle for the miR-431, C2C12 cell have detected the function of miR-431.First First, the stably transfected cell line of overexpression miR-431 (60 times about) is constructed in C2C12 cell line, and using the mistake set up The C2C12 cell line of expression miR-431 has carried out following functions detection.

First plant the cell of stable transfection mi-431 with certain density, after breeding 24 hours, change division culture medium, point Change 24 hours, after 36 hours, detection differentiation early molecule labelling molecule myogenin (Myogenin) and late differentiation markers divide respectively The expression of sub- MHC.Found by immunofluorescent staining, after breaking up 24 hours, overexpression miR-431 significantly increases into flesh The quantity of plain positive cell, simultaneously the expression of myogenin dramatically increase in transcriptional level and protein level；After differentiation 36 hours, Overexpression miR-431 significantly increases the quantity of MHC positive cell, and the expression of MHC is in transcriptional level and protein water simultaneously Put down and dramatically increase.The above results show that overexpression miR-431 promotes C2C12 cell differentiation.

(1) build the cell line of stable transfection

First day

Before test, virus is placed in thaw on ice (slow viruss-GPF is comparison)；In 35mm²Culture dish in add 1mL training Foster base, prepares the centrifuge tube of 2 1.5mL；Peptic cell counts, and takes 1mL 2 × 10⁵Individual cell is in the centrifuge tube of 1.5mL；Plus 20 μ L virus, in centrifuge tube, is gently mixed with pipette tips；Plus 3.2 μ L polybrene pipette tips gently mix；The cell mixing is dripped It is added in 35mm²Culture dish in, put into incubator culture.

Second day

Cell is transferred to 60mm²Culture dish in.

3rd day

Cell is transferred to 10cm²Culture dish in, add final concentration of 1.5 μ g/mL puromycins；Transfect slow two days later The cell almost all of virus-GPF matched group is died, and the cell of test group keeps good growth conditions, shows surely to turn cell System successfully constructs.Detection expression efficiency, passes on conservation.

(2) Immunofluorescence test

Fixative：37% formalin is diluted to final concentration 2%-4% in PBS；Saturatingization liquid：0.5% TritonX-100/PBS；Confining liquid：1-3%BSA/PBS；Mountant：Prepare 90% with the 2%DABCO/PBS preparing in advance Glycerite.

Step：Immersion 2h in concentrated acid, drying at room temperature after cleaning are inserted in coverslip gradation.Coverslip through acid treatment is thrown Enter in the Poly-L-Lysine Solution of ten times of dilutions, room temperature is taken out after placing 5min and 1h is dried in 60 DEG C.With front, coverslip is soaked At least 30min in 75% ethanol.Transfection or carry out the cell of respective handling with PBS 3 times, drains away the water, with fixative Room temperature fixes 10min；PBS rinses 3 times.Under room temperature, cell is permeabilized 3 × 10min with 0.5%Triton-X100/PBS.With 1-3%BSA/PBS closing cell, 37 DEG C of 30min；Parafilm film add 40 μ L dilute by a certain percentage with PBS-T (logical Normal 1：50) one resists, and is sealed in wet box, 37 DEG C of 1h.Under room temperature, 0.5%Triton-X100/PBS rinses 3 × 10min.? 40 μ L are added to dilute (usual 1 by a certain percentage with PBS-T on Parafilm film：80) two resist, and are sealed in 37 DEG C in wet box, 1h.Under room temperature, 0.5%Triton-X100/PBS rinses 3 × 10min.1 is added when rinsing for second:10000DAPI(DAPI/ 0.5%Triton)；Deionized water rinsing is desalted.10 μ L mountant are taken to drop on microscope slide.Use fluorescence microscope or laser at once Confocal microscopy is simultaneously taken a picture.

Conclusion：Figure 14 to Figure 19 result shows that miR-431 can promote the differentiation of C2C12 cell.

Embodiment 4.miR-431 promotes the process of Skeletal muscle injury regeneration.

Experimentation

MiR-431 transgenic mice constructed by the model animal of Nanjing, wild-type mice three littermate control in test.For true Determine function in skeletal injury regeneration for the miR-431, construct miR-431 transgenic mice CTX damage model, mice right lower limb shin 50 μ L × 10 μM CTX are penetrated in intramuscular injection before bone, and left lower limb injection compares just as the PBS of volume, after injury 1,3, collect respectively within 7 days Skeletal muscle tissue, dyes process and the form observing anathrepsis by HE.By immunofluorescence dyeing and western blot skill Art detects the expression of Pax7 or MyoD.Study the function of skeletal muscle satellite cell in vivo, one of common method is by little Murine skeletal muscle tissue injection CTX sets up skeletal muscle tissue injury regeneration model.

It is inflammatory reaction first after Skeletal muscle injury, substantial amounts of inflammatory factor is released, and is in the skeletal muscle of quiescent condition Satellite cell is activated, and a large amount of propagation of satellite cell of activation is merged with the muscle fiber damaging subsequently into differentiation program, utilizes MyoD positive cell number come to assess profit activation satellite cell number.After skeletal muscle tissue damages 3 days, satellite cell increases in a large number Grow, the process of satellite cell propagation can be assessed by detecting the number of satellite cell；Damage 7 days after formed a large amount of cores in The muscle fiber of the new formation of centre, by comparing the sectional area size of the muscle fiber horizontal stroke in central new formation for the core and the dynamic of eMHC Change and to assess the process of differentiation.

(1) paraffin embedding and haematoxylin and Yihong (HE) dyeing：The tibialis anterior taking off is fixed on 10% formalin (formalin 1：10 are dissolved in PBS) in 24-48 hour；Soak each 1 hour through 70%, 80%, 95%, 100% ethanol after fixation To being dehydrated completely；It is transferred to dimethylbenzene transparent each half an hour twice after dehydration；In the saturating wax of 50-60 DEG C of temperature and embedding (Leica The full-automatic embedding machine of EG1150)；Finishing wax stone sample, section 3-4 micron (Leica RM2255 fully-automatic rotation microtome)；Will Section separates, and puts into exhibition piece (Leica HI1220 spreads out piece machine) bak stay in 40 DEG C of tepidarium and, to microscope slide, is scalding Upper 60 DEG C of plate (Leica HI1210 bakes piece machine) is dried；Tissue slice is placed in dimethylbenzene and soaks 10 minutes, after changing dimethylbenzene Soak 10 minutes again.Soak 5 minutes in dehydrated alcohol；Soak 5 minutes in 95% ethanol；Soak 5 minutes in 70% ethanol；Finally Enter distilled water immersion 2 minutes；Entered the section after distilled water and put into dyeing 5 minutes in hematoxylin aqueous solution.Sour water and ammonia Middle color separation, each several seconds.Flowing water enters distilled water a moment after rinsing 5 minutes.Enter to be dehydrated in 70% and 90% ethanol each 5 minutes.Enter Ethanol eosin stains liquid dyes 23 minutes.It is dehydrated through absolute alcohol after dyeing, then makes section transparent through dimethylbenzene, use neutral gum Mounting.

(2) photograph and data statisticss：With just putting photo under microscope (Olypums BX 53) × 20 times of mirrors, manual count In damage field unit area, the new core being formed is in central muscle fiber number.

(3) frozen section preparation：The fresh tibialis anterior muscular tissue taken off is put into and fills embedding medium (oriental cherry, 4583) Mould in, by mould immersion liquid nitrogen so that it is solidified, with full-automatic slicing machine (Leica CM3050), embedded block is cut into slices to 10 Micron is thick, and thin section is labelled on microscope slide, puts in -70 DEG C of refrigerators and preserves.

(4) Pax7 immunofluorescence dyeing：Frozen section is taken out from -70 DEG C of refrigerators placement room temperature to dry；In 4% poly 20 minutes are fixed in formaldehyde (4 grams of paraformaldehydes (Sigma) are dissolved in 100 milliliters of PBS)；Cleaning 3 times in PBS, 5 minutes every time； - 20 DEG C of methanol permeates 6 minutes；Cleaning 3 times in PBS, 5 minutes every time；(0.294 gram of 0.01M sodium citrate buffer solution of configuration Two citric acid monohydrate trisodiums are dissolved in 100 milliliters of PBS, regulation pH value to 6.0), it is preheated to 90 DEG C；Fructus Citri Limoniae by section immersion heat Sour sodium buffer, 80 DEG C are incubated 5 minutes, renew the sodium citrate buffer solution of preheating, 80 DEG C are incubated 5 minutes again；Room temperature cooling is cut Piece, cleaning 3 times in PBS, 5 minutes every time；Room temperature envelope in 4%BSA (0.4 gram of BSA (Jackson) is dissolved in 10 milliliters of PBS) Close 2-3 hour；Clean 2 minutes in PBS；Dilution FAB (Jackson) 1:In 100 to PBS, in FAB, room temperature is closed 30 minutes； Clean 2 minutes in PBS；With Pax7 antibody (DSHB, 1:20 are dissolved in 4%BSA) in 4 DEG C of overnight incubation；Clean 2 minutes in PBS； 3 times are washed in 0.1%BSA, 10 minutes every time；In GaM-Biotin (Jackson, 1:1000 are dissolved in 4%BSA) incubated at room 45 minutes；Clean 2 minutes in PBS；3 times are washed in 0.1%BSA, 10 minutes every time；In Cy3-Strep (Jackson, 1:1000 It is dissolved in 4%BSA) incubated at room 30 minutes；Cleaning 3 times in PBS, 10 minutes every time；DAPI contaminates core, cleans 10 minutes in PBS； Mounting is taken a picture.

(5) MyoD immunofluorescence dyeing：Frozen section is taken out from -70 DEG C of refrigerators placement room temperature to dry；In 4% poly 20 minutes are fixed in formaldehyde；Cleaning 3 times in PBS, 5 minutes every time；- 20 DEG C of methanol permeates 6 minutes；Clean 3 times in PBS, 5 minutes every time；5%BSA room temperature is closed 2 hours；With MyoD antibody (Santa Cruz, 1:50 are dissolved in 5%BSA) incubate in 4 DEG C Educate overnight；Cleaning 3 times in PBS, 10 minutes every time；Two anti-incubated at room 1 hour；Cleaning 3 times in PBS, 10 minutes every time；DAPI Dye core, cleans 10 minutes in PBS；Mounting is taken a picture.

Conclusion：In Figure 20-21 display miR-431 transgenic mice, injury regeneration process is significantly faster than wild-type mice.Figure 22-24 display miR-431 transgenic mice has more MyoD positive cells after damaging 1 day, Figure 25-27 display miR-431 turns DNA murine has the double positive cell of more Pax7+/MyoD+ after damaging 3 days.Figure 28-29 display miR-431 transgenic is little The differentiation of Mus centre halfback astrocyte is faster than wild-type mice.The activation that above-mentioned data display miR-431 passes through to accelerate satellite cell increases Grow and break up and to accelerate the injury regeneration process of satellite cell.

Embodiment 5.miR-431 promotes skeletal muscle satellite differentiation.

Experimentation

In order to confirm miR-431 promote skeletal muscle satellite cell differentiation function, separate miR-431 transgenic mice and The skeletal muscle satellite cell of wild-type mice, is planted in 12 orifice plates with identical density, after differentiation 36, is broken up by dyeing The expression of marker gene MCH positive cell and detection MHC mRNA has also separated single myofibrillar isolated culture simultaneously, point Do not contaminate different types of satellite cell respectively with Pax7, MyoD, DAPI.

The single muscle fiber of separating mouse skeletal muscle

Preparation：0.2% collagenase I is dissolved in plasma-free DMEM medium；Cleaning mixture：Serum DMEM culture medium, plus 2% Dual anti-；Muscle fiber proliferated culture medium：DMEM cultivates, plus 20% hyclone (FBS), that 1% chick embryo extract adds 1% is dual anti-；With Hyclone (FBS) is coated culture dish.

Test procedure

Take the male Mus 1 of 6-10 week old, disconnected neck is put to death, and sprays alcohol disinfecting.Tear skin from direction of toe of last, do not hinder as far as possible To tibialis anterior, first use dissecting needle in the tendon of direction of toe of last separation tibialis anterior (TA) and extensor digitorum longus (EDL), determine tibia The position of front flesh (TA), so as to separate with extensor digitorum longus (EDL), then cuts off the tendon of quadriceps femoris, carefully at knee joint Separate the upper end tendon finding extensor digitorum longus (EDL), then cut off with scalpel, in toe end gently by complete extensor digitorum longus (EDL) take away.(this step is whole Success in Experiment whether key)；Complete extensor digitorum longus (EDL) are put into equipped with 2ml 40-60 minute is digested at 37 DEG C, until seeing that the fiber having hairline sample stops digestion in 0.2% collagenase I Digestive system；Aobvious Under micro mirror, muscle fiber single in Digestive system is transferred in cleaning mixture one by one with 10 μ L pipette tips, after single muscle fiber washs 2 times Transfer in muscle fiber proliferated culture medium, cultivate 72 hours；By immunofluorescence dyeing detect Pax7 or MyoD expression thus Labelling satellite cell, the quantity of satellite cell on the single muscle fiber of manual count.

Conclusion

As shown in Figure 30-32, miR-431 can promote the differentiation of skeletal muscle satellite cell, miR-431 as shown in Figure 33-34 The satellite cell being in the idiophase in transgenic mice is significantly more than wild-type mice.As above experiment proves that miR-431 promotes skeleton The differentiation of muscle satellite cell.

Embodiment 6.miR-431 can significantly improve the Pathophysiology phenotype of mdx mice

Experimentation

Mdx mice is the model mice of Du Shi muscular dystrophy disease.It is because the dystrophin gene of Xp21 is dashed forward Become and cause dystrophin on skeletal muscle sarolemma to lack wholly or in part and cause.Dystrophin connect cell interior with The stability aspect of external structure, signal transduction and cell membrane plays important function.In Mdx mouse disease model, due to The disappearance of Dystroglycan leads to the breakage of muscle cell membrane structure, and intracellular matter such as creatine kinase leaks, and the fragility of muscle increases Plus, contracts last ability reduces.The damage of myocyte can activate satellite and carry out injury repairing, form core in central new granulation promoting Fiber.Due to the presence of dystrophin mutant gene, the new sarcolemma being formed is damaged quickly, and muscle fiber is impaired, stimulates Satellite cell carries out injury repairing again.Therefore, Mdx mice is constantly in the damaged circulation with injury repairing of muscle fiber.

The result of preceding embodiment shows that miR-431 can accelerate Skeletal muscle injury again by promoting the differentiation of satellite cell Raw process, then whether miR-431 can alleviate the Pathology of Mdx disease model mice to a certain extent.By detection In myocyte, creatine kinase leaks concentration in serum and azovan blue penetrates into Skeletal Muscle Cell through damaged sarcolemma In the degree of injury to judge Mdx Muscle Tissue for the situation.Pass through run test and the in vitro skeletal muscle of mice simultaneously The test of fibre tension is assessing Mdx mice skeletal function.

For determining whether miR-431 can be in the Pathology to a certain degree improving Mdx disease model mice and physiology work( Can, first Mdx mice is copulationed with miR-431 transgenic mice, the male Mdx obtaining:MiR-431 is used with Mdx mice In experiment, B6 mice normal control mice, thus detecting whether miR-431 can improve the Pathology of Mdx mice.

(1) in serum CK level detection

General 2-4 hour detection CK value after mice is run；

Pluck eyeball and take blood；

4 DEG C standing 1-2 hours, 12000rpm be centrifuged 10 minutes by serum transfers in new EP pipe；

Configuration reactant liquor：Every hole adds 10 μ L substrates, the enzyme of the reaction buffer of 100 μ L and 1 μ L；

110 μ L are added in enzyme mark version：100μL H₂O and 10 μ L standard substance (Calibrator) and 100 μ L reactant liquors and 10 μ The 37 DEG C of incubations of L blood utilize the light absorption value that microplate reader reads 340nm for 20 minutes, then proceed to be incubated the suction reading 340nm for 20 minutes Light value, then calculates CK value using formula once.

(2) mice is run and tests

Mdx:MiR-431, Mdx and B6 mice under identical rearing conditions, run in flat board by running test experiments (Exer3/6Columbus Instruments) is carried out on machine.Experiment is divided into training and official testing, using 20 degree during experiment Descending inclination angle.Train before official testing twice, carry out every other day.Running condition setting is as follows：10 ms/min of starting velocity, After three minutes, accelerate to 20 ms/min with 1 m/min of speed, then go to mice fatigue always with 20 ms/min of speed Till, typically setting NOS (mice is parked in the number of times on stimulator) is 100.After training, start official testing, altogether survey Examination 4 times, is to carry out every other day every time.

(3) the in vitro pull test of skeletal muscle

Configuration electrolyte is adjusted to PH=7.0, adds in four chamber water baths, general tissue temperature is in 37 ° of Mdx skeletal muscle Adjust temperature and be 25 °, wherein pass through 95% oxygen -5% carbon dioxide, more than half an hour.

Separate complete extensor digitorum longus (EDL) according to the method separating in single muscle fiber, skeletal muscle tissue is detached complete Whether whole very big on testing last result impact.Completely detached EDL is fixed between another electrode (the step in electricity Operate in solution liquid, action is as far as possible fast).First balance 10 minutes in the electrolytic solution.

The condition of tic tension force detection：Using 10V voltage, the persistent period is the square wave of 0.3ms.It is repeated 3 times, every septum secundum 10 Second is once.

The condition of tetanic tension detection：Using 10V voltage, the persistent period is a string ripple of 200ms, and wherein each is lasting Time is the square wave of 0.3ms.It is repeated 3 times, every minor tick 3 minutes.

Conclusion

miR-431::Mdx mice muscle group azovan blue is contaminated area and is significantly reduced (Figure 35 A and 35B)；As representative, only Show the picture (Figure 36) of azovan blue dip-dye muscle injury in tibialis anterior, Figure 37 shows miR-431::Mdx mice group blood Middle clearly creatine kinase level substantially reduces compared with matched group.Figure 38 shows miR-431::Mdx mice group running achievement is better than comparison Group.Figure 39 and 40 display miR-431::Mdx mice group synthetic data Mdx mouse muscle pulling force is better than matched group.

Summary miR-431 overexpression miR-431 in mankind DMD disease model Mdx mice can significantly improve The Pathology of Mdx mice and physiological function.

List of references

1.Lancaster,G.I.and M.A.Febbraio,Skeletal muscle:not simply an organ for locomotion and energy storage.J Physiol,2009.587(Pt 3):p.509-10.

2.Mauro,A.,Satellite cell of skeletal muscle fibers.J Biophys Biochem Cytol,1961.9:p.493-5.

3.Grounds,M.D.and Z.Yablonka-Reuveni,Molecular and cell biology of skeletal muscle regeneration.Mol Cell Biol Hum Dis Ser,1993.3:p.210-56.

4.Kuang,S.,M.A.Gillespie,and M.A.Rudnicki,Niche regulation of muscle satellite cell self-renewal and differentiation.Cell Stem Cell,2008.2(1): p.22-31.

5.Lepper,C.,T.A.Partridge,and C.M.Fan,An absolute requirement for Pax7-positive satellite cells in acute injury-induced skeletal muscle regeneration.Development,2011.138(17):p.3639-46.

6.McCarthy,J.J.,et al.,Effective fiber hypertrophy in satellite cell- depleted skeletal muscle.Development,2011.138(17):p.3657-66.

7.Murphy,M.M.,et al.,Satellite cells,connective tissue fibroblasts and their interactions are crucial for muscle regeneration.Development, 2011.138(17):p.3625-37.

8.Sambasivan,R.,et al.,Pax7-expressing satellite cells are indispensable for adult skeletal muscle regeneration.Development,2011.138 (17):p.3647-56.

9.Naguibneva,I.,et al.,The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation.Nat Cell Biol, 2006.8(3):p.278-84.

10.Chen,Y.,et al.,MiR-351 transiently increases during muscle regeneration and promotes progenitor cell proliferation and survival upon differentiation.Physiol Genomics,2012.44(21):p.1042-51.

11.Liu,N.,et al.,microRNA-206 promotes skeletal muscle regeneration and delays progression of Duchenne muscular dystrophy in mice.J Clin Invest, 2012.122(6):p.2054-65.

12.Maciotta,S.,et al.,Hmgb3 is regulated by microRNA-206 during muscle regeneration.PLoS One,2012.7(8):p.e43464.

13.Chen,J.F.,et al.,microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7.J Cell Biol,2010.190(5):p.867-79.

14.Dey,B.K.,et al.,miR-26a is required for skeletal muscle differentiation and regeneration in mice.Genes Dev,2012.26(19):p.2180-91.

15.Ge,Y.,Y.Sun,and J.Chen,IGF-II is regulated by microRNA-125b in skeletal myogenesis.J Cell Biol,2011.192(1):p.69-81.

16.Yin,H.,et al.,MicroRNA-133 controls brown adipose determination in skeletal muscle satellite cells by targeting Prdm16.Cell Metab,2013.17(2): p.210-24.

17.McPherron,A.C.and S.J.Lee,Double muscling in cattle due to mutations in the myostatin gene.Proc Natl Acad Sci U S A,1997.94(23):p.12457- 61.

18.Kambadur,R.,et al.,Mutations in myostatin(GDF8)in double-muscled Belgian Blue and Piedmontese cattle.Genome Res,1997.7(9):p.910-6.

19.Grobet,L.,et al.,A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle.Nat Genet,1997.17(1):p.71-4.

20.Mosher,D.S.,et al.,A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs.PLoS Genet, 2007.3(5):p.e79.

21.Clop,A.,et al.,A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep.Nat Genet,2006.38(7):p.813-8.

22.Schuelke,M.,et al.,Myostatin mutation associated with gross muscle hypertrophy in a child.N Engl J Med,2004.350(26):p.2682-8.

23.Partridge,T.A.,et al.,Conversion of mdx myofibres from dystrophin- negative to-positive by injection of normal myoblasts.Nature,1989.337(6203): p.176-9.

Claims (9)

1. Purposes in the medicine of preparation treatment muscle disease for the miR-431 shown in 1.SEQ ID No.1, wherein said muscle disease Disease is selected from muscle injury and muscular dystrophy.
2. 2. purposes according to claim 1, described treatment refers to selected from following one or more：Promote myoblastic Differentiation, promotion Skeletal muscle injury regenerate, improve pathology and physiological phenotype.
3. 3. purposes according to claim 2, the myoblastic differentiation of described promotion refers to improve myogenin and/or flesh ball egg The expression of Bai Chonglian.
4. 4. purposes according to claim 2, described promotion Skeletal muscle injury regeneration refers to promote skeletal muscle satellite cell Activation, propagation and differentiation.
5. 5. purposes according to claim 2, described improves pathology and physiological phenotype is selected from：Reduce serum creatine kinase water Flat, improvement fatigue, raising muscle fiber tension force and combinations thereof.
6. 6. purposes according to claim 1, wherein said muscle injury is acute muscle injury.
7. 7. purposes according to claim 1, wherein said muscular dystrophy is selected from：Duchenne/Becker type myotrophy Bad, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal type myotrophy are not Good, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy.
8. 8. purposes according to claim 7, wherein said muscular dystrophy is for Duchenne/Becker type myotrophy not Good.
9. MiR-431 shown in 9.SEQ ID No.1 promotes the use in the medicine of muscle stem cell activation, propagation and differentiation in preparation On the way.