CN105087649B - The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application - Google Patents
The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application Download PDFInfo
- Publication number
- CN105087649B CN105087649B CN201510336709.3A CN201510336709A CN105087649B CN 105087649 B CN105087649 B CN 105087649B CN 201510336709 A CN201510336709 A CN 201510336709A CN 105087649 B CN105087649 B CN 105087649B
- Authority
- CN
- China
- Prior art keywords
- muc
- aav
- viral vectors
- associated virus
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of recombined glandulae correlation viral vectors carrying 1 antigen genes of MUC and construction method and applications.The rAAV is will to be inserted into 1 antigen genes of MUC in gland relevant viral vector at deleted adeno-associated virus structural gene position to obtain.1 antigen genes of MUC that the rAAV of the present invention can be carried are conveyed into monocytic dendritic cell shape cell line, be used to stimulate the effector cell of immune system.It is demonstrated experimentally that by the CTL that are induced of DC of the viral vector infection of the rAAV of the present invention in vitro or patient's body can effectively inhibit 1 antigen positives of MUC malignant cell growth or kill tumour cell.The recombined glandulae correlation viral vectors or its Related product of the present invention can be used for preparing the drug for treating a variety of 1 antigen positive tumours of MUC.
Description
Technical field
The present invention relates in biological field carrier and its application, more particularly to carry mucoprotein (Mucin 1, MUC-
1) recombined glandulae correlation viral vectors of antigen gene and its construction method with it in the tumour medicine for preparing the anti-MUC-1 positives
Using.
Background technology
Adeno-associated virus (Adeno-associated virus；AAV gene structure) has been accredited.Nineteen eighty-three,
Samulski et al. describe AAV end repeated fragment (5 ' end fragment of upstream, 3 ' end fragment of downstream) (Samulski RJ,
Srivastava A,Berns KI,Muzyczka N.Rescue of adeno-associated virus from
recombinant plasmids:gene correction within the terminal repeats of
AAV.Cell.33:135-143.).1984, Hermonat et al. described the replication protein (rep) of the low infectious particles of AAV
Gene and envelope protein (cap) gene (1.Hermonat PL, Labow MA, Wright R, Berns KI, Muzyczka
N.Genetics of adeno-associated virus:isolation and preliminary
characterization of adeno-associated virus type 2mutants.J Virol.51:329-
339.2.Hermonat,P.L.,and Muzyczka,N.Use of adeno-associated virus as a
mammalian DNA cloning vector:transduction of neomycin resistance into
mammalian tissue culture cells.Proc.Natl.Acad.Sci.U.S.A.81:6466-6470.)。1986
Year, Labow et al. identifies p5 promoters (Labow MA, Hermonat between 5 ' end fragment of upstream and rep genes
PL,Berns KI.Positive and negative autoregulation of the adeno-associated
virus type 2genome.J Virol.160:251-258.)。
1984, U.S. Paul L.Hermonat took the lead in proving that AAV carriers can be used for the gene therapy of human diseases
(Hermonat,P.L.,and Muzyczka,N.Use of adeno-associated virus as a mammalian
DNA cloning vector:transduction of neomycin resistance into mammalian tissue
culture cells.Proc.Natl.Acad.Sci.U.S.A.81:6466-6470.).Currently, mainly American-European countries into
The clinical test of gene therapy human diseases of the row based on AAV.It is counted according to U.S.'s grain and drug administration, existing more than ten
Gene Therapy Clinical Trials of the item based on AAV are carrying out, and the AAV viruses that will mainly carry therapeutic gene inject patient
In vivo, make its expression treatment gene in vivo, to achieve the purpose that treat disease.There is Parkinson mainly for the disease for the treatment of
The Non-cancerous such as the silent syndrome in syndrome, rheumatic arthritis, hemophilia, heart failure, progressive myatrophy and Olds sea
Disease.On November 2nd, 2012, the Glybera products of European Union approval UniQure companies were used in 27 member states of European Union, this is west
First granted gene therapy medicament of Fang Guojia, it is that adeno-associated virus I types (AAV-1) foreign gene-carrying is utilized to be used for
Treat the genomic medicine of lipoprotein lipase deficiency hereditary disease (LPLD).
AAV is a kind of defective virus of non-pathogenic, needs the gene outcome auxiliary of other viral (such as adenovirus),
It can be assembled into infective virion.AAV can be divided into 12 kinds of serotypes (AAV-1~AAV-12) at present.Wherein, 2
Type adeno-associated virus (AAV-2) carrier becomes because having many advantages, such as wide no pathogenicity, host range, target gene long-term expression
One of most potential viral vectors in current gene therapy.About 4700 base-pair (bp) of AAV-2 full-length genomes, both ends are end
It is viral structural gene, including replication protein (Rep) and envelope protein (Cap) gene to hold repeated fragment (TR), centre.Due to
There are the unstability of AAV viruses itself and its allogenic gene (therapeutic gene) limited length etc. defect is carried, therefore
It is necessary to it is carried out genetic recombination formed recombinant adeno-associated virus (recombinant adeno-associated virus,
rAAV).Existing numerous studies show to delete the structural gene in AAV genomes, can obviously increase the appearance of allogenic gene
Amount.It is inserted into rAAV, is prepared into infective rAAV virions in addition, will have medicative allogenic gene.
The recombinant adeno-associated virus and its Related product for how building the drug that can be used for preparing treatment disease are this fields
The direction that technical staff makes great efforts.
Invention content
The technical problem to be solved by the present invention is to：There is provided that a kind of stability is high, carries mucoprotein (MUC-1) antigen gene
Recombinant adeno-associated virus (Recombinant Adeno-associated virus；RAAV) carrier and construction method with answer
With.
The technical problem of the present invention is resolved by technical solution below：
A kind of recombined glandulae correlation viral vectors carrying MUC-1 antigen genes, are by the gland phase in gland relevant viral vector
The structural gene for closing virus replaces with the recombined glandulae correlation viral vectors that MUC-1 antigen genes obtain.
Preferably, the p5 promoters in the recombined glandulae correlation viral vectors can be replaced in following three kinds of promoters
It is a kind of：Cytomegalovirus promoter, beta-actin promoter and SV40 early promoters.
A kind of construction method for the recombined glandulae correlation viral vectors carrying MUC-1 antigen genes, by gland relevant viral vector
In adeno-associated virus structural gene reject, then on the position of rejecting be inserted into MUC-1 antigen genes, obtain recombination gland phase
Close viral vectors.
Preferably, further comprising the steps of：P5 promoters in the recombined glandulae correlation viral vectors are replaced with following
One kind in three kinds of promoters：Cytomegalovirus promoter, beta-actin promoter and SV40 early promoters.
Preferably, include the following steps：
1) AAV-2 type pBR322 plasmids are reconstructed：Using restriction enzyme Bst98I and Hpa I by AAV-2 types pBR322
Structural gene excision in AAV-2 type adeno-associated virus in plasmid, then will contain restriction enzyme EcoR I and EcoR
The nucleotide sequence CGAATTCATGCGATATCGTT of V restriction enzyme sites is inserted into the AAV-2 types pBR322 plasmids, retains both ends
TR sequences or respectively at the 75th nucleotide sequence of the complete TR sequences in both ends be inserted into 9 nucleotide CTGCGCTGG
The segment of composition；
2) by promoter inserting step 1) in the obtained AAV-2 type pBR322 plasmids of reconstruction, structure carries promoter
2 type pBR322 plasmids of AAV；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus
Promoter, beta-actin promoter and SV40 early promoters；
3) MUC-1cDNA is obtained；
4) by the MUC- for carrying the AAV-2 type pBR322 plasmids of promoter and step 3) obtains of step 2) structure
1cDNA carries out digestion with restriction enzyme BamH I and Pst I respectively, then carries out DNA connections reaction, obtains carrying
State the recombined glandulae correlation viral vectors of promoter and MUC-1 antigen genes.
Preferably, include the following steps in the step 3)：31) it is extracted from the tumor tissues of MUC-1 antigen positives total
MRNA carries out reverse transcription reaction by total mRNA, synthesizes total cDNA；32) using total cDNA as template, in primer 1：
GCCTGCCTGAATCTGTT and primer 2：PCR amplification is carried out under the guiding of AACCTGAGTGGAGTGG, obtains the MUC-
1cDNA。
It is a kind of to recombinate gland with the relevant product of recombined glandulae correlation viral vectors for carrying MUC-1 antigen genes, including MUC-1
The plasmid vector of correlated virus, the viral vectors of MUC-1 recombinant adeno-associated virus, by the MUC-1 recombinant adeno-associated virus
Viral vector infection or the cell line of transfection；The plasmid vector of the MUC-1 recombinant adeno-associated virus is by described or described
The obtained recombined glandulae correlation viral vectors for carrying MUC-1 antigen genes of construction method be made；The MUC-1 recombinations gland is related
The viral vectors of virus carries out cell culture by the plasmid vector of the MUC-1 recombinant adeno-associated virus and obtains.
A kind of preparation method with the relevant product of recombined glandulae correlation viral vectors for carrying MUC-1 antigen genes, MUC-1
The preparation of the plasmid vector of recombinant adeno-associated virus：MUC-1 antigenic sites will be carried made from described or described construction method
The recombined glandulae correlation viral vectors quiding gene engineering colon bacillus DH5 α competent cells of cause, with containing 100 μ g/mL ammonia benzyl moulds
The LB tablets of element carry out resistance screening, and picking white single bacterium colony is extracted plasmid and purified, obtains MUC-1 recombinant adeno-associated virus
Plasmid vector；
The preparation of the viral vectors of MUC-1 recombinant adeno-associated virus：It is carried with the plasmid of the MUC-1 recombinant adeno-associated virus
Body and pHelper plasmid co-transfection AAVp cells obtain the viral vectors of MUC-1 recombinant adeno-associated virus；
The preparation of the viral vector infection of MUC-1 recombinant adeno-associated virus or the cell line of transfection：It is recombinated with the MUC-1
The viral vector infection or transfection monocyte or Dendritic Cells, the cell line of adeno-associated virus include monocyte-tree
Prominent shape cell line.
A kind of recombined glandulae correlation viral vectors carrying MUC-1 antigen genes or Related product are anti-swollen in preparation
Application in tumor medicine.
The beneficial effect of the present invention compared with the prior art is：
The present invention provides a kind of stability, and recombinant adeno-associated virus that is high, carrying MUC-1 antigen genes ((" will be taken below
Recombinant adeno-associated virus with MUC-1 antigen genes " is known as AAV/MUC-1) carrier.The recombined glandulae correlation viral vectors of the present invention
The MUC-1 antigen genes that can be carried are conveyed into monocyte-Dendritic Cells system, and there are the thin of MUC-1 antigen genes
Born of the same parents be used to stimulate effector cell's (being not limited to T lymphocytes and bone-marrow-derived lymphocyte) of immune system.It is demonstrated experimentally that being sent out by this
The cytotoxic T lymphocyte that the Dendritic Cells of the viral vector infection of bright AAV/MUC-1 is induced can in patient's body
Effectively inhibit associated malignancies cell growth or kill tumour cell, thus, AAV/MUC-1 carriers of the invention or
The cellular immunity that can be used for the malignant tumour for preparing the anti-MUC-1 positives with the relevant product of AAV/MUC-1 carriers of the present invention is controlled
It treats.The present invention has important theoretical and practical significance in the clinical treatment of malignant tumour and application, has a extensive future.
Description of the drawings
Fig. 1 is the structural schematic diagram of the AAV/MUC-1 carriers of the specific embodiment of the invention.
Fig. 2 is that the structure AAV/MUC-1 carriers of the specific embodiment of the invention are prepared with infective AAV/MUC-1
The flow chart of viral vectors.
Fig. 3 is the MUC-1 gene clonings of the specific embodiment of the invention and the double digestion qualification result of AAV/MUC-1 carriers
Figure.
The MUC-1 antigen gene sequences that Fig. 4 is obtained by the specific embodiment of the invention and U.S. NCBI Gene Bank
The Gene sequence comparison figure of announcement.
Fig. 5 is the virus titer testing result figure of the viral vectors of the AAV/MUC-1 of the specific embodiment of the invention.
The viral vector infection tumor patient monocyte that Fig. 6 is the AAV/MUC-1 of the specific embodiment of the invention is base
The killing tumor experiment flow chart of plinth.
Fig. 7 a-7d are respectively the virus of the AAV/MUC-1 respectively containing different promoters of the specific embodiment of the invention
Carrier infects the Efficiency testing result figure of peripheral blood mononuclear cells.
Fig. 8 a ' are that the virus that the promoter of the specific embodiment of the invention is the AAV/MUC-1 of SV40 early promoters carries
The Flow Cytometry testing result figure of the DC expression CD80 levels of body-sensing dye；It is pair with DC expression DC80 non-stimulated in Fig. 8 a
According to.
Fig. 8 b ' are that the virus that the promoter of the specific embodiment of the invention is the AAV/MUC-1 of SV40 early promoters carries
The Flow Cytometry testing result figure of the DC expression CD83 levels of body-sensing dye；It is pair with DC expression DC83 non-stimulated in Fig. 8 b
According to.
Fig. 8 c ' are that the virus that the promoter of the specific embodiment of the invention is the AAV/MUC-1 of SV40 early promoters carries
The Flow Cytometry testing result figure of the DC expression CD86 levels of body-sensing dye；It is pair with DC expression DC86 non-stimulated in Fig. 8 c
According to.
Fig. 9 a are killed by the CTL that the DC of the viral vector infection of the AAV/MUC-1 of the specific embodiment of the invention is induced
The tumour cell of MUC-1 antigen positives and the testing result figure of killing specificity.
The CTL that Fig. 9 b are induced by the DC of the viral vector infection of the AAV/MUC1 of the specific embodiment of the invention has
The restrictive testing result figure of MHC I class molecules.
The CTL that Figure 10 is induced by the DC of 6 viral vector infections through AAV/MUC-1 of the specific embodiment of the invention
The situation of change schematic diagram of blood serum of patients with human breast carcinoma tumor markers CA15-3 antigen levels after treatment.
The CTL that Figure 11 is induced by the DC of the viral vector infection of 5 AAV/MUC-1 of the specific embodiment of the invention is controlled
The situation of change schematic diagram of Stomach Carcinomas patients serum tumor markers CA19-9 antigen levels after treatment.
Specific implementation mode
Below against attached drawing and in conjunction with preferred embodiment, the invention will be further described.
Inventor successfully will be in the pBR322 plasmids (pBR-AAV2) that carry 2 type complete genome DNAs of AAV
The entire infrastructure gene elmination including rep and cap genes of AAV-2 retains end repeated fragment and p5 promoters, or
Only retain end repeated fragment, and be inserted into oligonucleotides segment, with improve rAAV DNA replication dnas efficiency and rAAV viruses it is steady
It is qualitative, thus to obtain the basic framework of AAV carriers.The AAV-2 carriers applied have p5 promoters, by MUC-1 antigen genes
It is inserted.To improve the transcriptional level of MUC-1 antigen genes, the MUC-1 antigen genes can be also inserted into and successfully built
Promoter be cytomegalovirus (CMV) promoter, vacuolating virus of monkey 40 (SV40) early promoter, beta-actin promoter
Instead of in the AAV-2 carriers of p5 promoters, namely the carrying MUC-1 antigen genes of the present invention recombined glandulae correlation viral vectors
Promoter be p5 promoters or CMV promoter or beta-actin promoter or SV40 early promoters.In addition, basic herein
On be successfully prepared for that there is infective rAAV virions (referring to Chinese patent ZL201110125683.X).It is new to develop
RAAV products lay a good foundation.
Mucoprotein (MUC-1) antigen be a kind of high saccharification, high molecular weight albumen, also known as membrane albumen is transmembrane molecule,
Alternatively referred to as Carbohydrate Antigen CA15-3 is a kind of tumor associated antigen.MUC-1 is in addition to that can use immunohistochemistry technique to be sieved
Look into, can also be directed to CA15-3 carry out Serological testing, and the tumor load of the expression quantity of CA15-3 and patient with breast cancer at
Positive correlation.Under normal circumstances, MUC-1 mainly the tissues such as mammary gland, pancreas, alimentary canal, genital tract, organ epithelial cell in table
It reaches, is centrally located at the Cavity surface of glandular epithelium, cytoplasm has no expression, is not easy to be identified by immune system.MUC-1 in cell after canceration
Expression is different from normal cell, is mainly shown as：1. expression quantity significantly increases, 10 times or more when reachable normal, and and tumour
Grade malignancy be proportionate；2. equably branch is in cell surface, and is also shown in cytoplasm；3. glycosylation is incomplete, make just
, there is new epitope in the exposure of hidden epitope in the case of often, has immunogenicity, becomes the target spot of immune cells attack.MUC-1
There is new epitope since its configuration changes in cancerous tumor cell.Herein for MUC-1 ACTL technologies exactly with
New MUC-1 epitopes are target spot, to specifically kill tumour cell, and to normal cell without lethal effect.
The present invention AAV/MUC-1 carriers be inventor succeeded structure AAV-2 carriers skeleton in be inserted into
MUC-1 antigen genes obtain recombined glandulae correlation viral vectors, include plasmid, virus and cell line with the relevant product of the carrier.
Wherein, MUC-1 is tumor associated antigen genes.
Method therefor is conventional method unless otherwise instructed in following embodiments, and specific steps can be found in：
《Molecular Cloning:A Laboratory Manual》(Sambrook, J., Russell, David W.,
Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring
Harbor).The primer, DNA sequence dna synthesis and determined dna sequence are completed by Life Technologies companies of the U.S..
Embodiment 1, recombinant adeno-associated virus (AAV/MUC-1 can be named as) the carrier AAV/ for carrying MUC-1 antigen genes
The structure of MUC-1 and identification
One, material and its source：
1. four kinds of 2 types of AAV (AAV-2) pBR322 plasmids (pBR-AAV2 with different promoters：It is built by inventor
Success (referring to Chinese patent ZL201110125683.X, the reconstruction of 0056~0059 section of pBR-AAV2 plasmid, PCR amplification start
Son, the medium content of pBR-AAV2 plasmids that the promoter of amplification is inserted into reconstruction).Four kinds of promoters are respectively p5, CMV of AAV
Promoter, SV40 early promoters and people's beta-actin (β-actin) promoter.The characteristics of plasmid is that both ends are complete
End repeats disconnected (TR) sequence of dististyle, or is inserted into 9 nucleotide at the 75th nucleotide sequence of both ends TR respectively
CTGCGCTGG segments, it is therefore an objective to which the stability of raising recombination AAV viral (rAAV) and the duplicating efficiency for improving virus, nothing are appointed
What AAV structural gene.
2. human lung carcinoma cell (A549)：It is MUC-1 antigen-positive cell strains from ATCC companies of the U.S..
3. gene magnification nucleotide primer：(the U.S. is designed according to the MUC-1 gene orders published in U.S.'s gene pool
NCBI gene pools：NM_002456.5).
Two, structure the present embodiment carries the recombined glandulae correlation viral vectors (as illustrated in fig. 1 and 2) of MUC-1 antigen genes.
The construction method that the present embodiment is provided is to use restriction enzyme using the method for conventional genetic recombination
First AAV-2 carrier frameworks DNA is cut off, then uses DNA interconnection techniques, by specific antigen gene MUC-1 and cut-off AAV-2
Carrier DNA is attached, and obtains the recombined glandulae correlation viral vectors for carrying MUC-1 antigen genes, i.e. AAV/MUC-1 carriers.It should
The promoter of AAV/MUC-1 carriers is p5 promoters or cytomegalovirus (CMV) promoter or beta actin promoters
Or SV40 early promoters.Detailed process includes the following steps：
1. obtaining total cDNA, specific method is：It is obtained using Trizol reagents (production of Life Technology companies of the U.S.)
Take total mRNA of A549 cell strains.The A549 cell strains for collecting MUC-1 antigen positives first, are added 5ml Trizol, according to it
Specification is operated.It is secondary with the washing of 75% (V/V) ethyl alcohol after centrifugation obtains supernatant, absolute ethyl alcohol is added, centrifugation is heavy
It forms sediment.Concentration is adjusted to 10ng/ μ l, is obtained total mRNA solution by sediment (i.e. total mRNA) with deionized water dissolving.It is total with 10 μ l
MRNA solution be template, carry out reverse transcription reaction, synthesize total cDNA, the reaction system of reverse transcription reaction by taking 25 μ l as an example, including：
0.5 μ g oligo (dT) 15 (Promega companies of the U.S.), 0.5mM dNTPs (Promega companies of the U.S.) and 200U M-MLV
Reverse transcriptase (Promega companies of the U.S.).Reaction condition is 37 DEG C, 1 hour, obtains total cDNA.
2. obtaining MUC-1cDNA, specific method is：Total cDNA is in (such as SEQ ID NO of primer 1:1)：
GCCTGCCTGAATCTGTT and primer 2 (such as SEQ ID NO:2)：PCR amplification is carried out under the guiding of AACCTGAGTGGAGTGG,
Obtain MUC-1cDNA.PCR amplification condition is：First 94 DEG C 4 minutes；94 DEG C 30 seconds again, 60 DEG C 35 seconds, 72 DEG C 70 seconds, totally 30 are followed
Ring；Last 72 DEG C 8 minutes, after reaction, to PCR product carry out 1.2% (W/V) agarose gel electrophoresis detection, in 928bp
There is an expected specific band in place, which is recycled and obtains the MUC-1cDNA that length is 928bp after purification
(such as SEQ ID NO:3), as shown in figure 3, the A figures in Fig. 3 are the knots of the PCR amplification MUC-1 genes from A549 cell strains cDNA
Fruit.Wherein 1 is MUC-1cDNA, length 928bp；2 be DNA molecular amount standard.B figures are the recombinant adeno-associated virus of structure
The double digestion qualification result of AAV/MUC1 carriers, wherein 1-4 are 4 positive colonies；5 be DNA molecular amount standard.DNA is carried out again
Sequencing, nucleotide sequence is as shown in figure 4, the gene sequence that MUC-1cDNA sequences are announced with U.S. NCBI Gene Bank
Row 99% are homologous, further prove that the MUC-1 gene orders of PCR amplification are correct.
3. building AAV/MUC-1 carriers：Respectively to the pBR-AAV2 plasmids and MUC-1cDNA of 4 kinds of different promoters of carrying
After carrying out digestion with restriction enzyme respectively, DNA connections reaction is carried out.Restriction enzyme used is purchased from the U.S.
Promega companies.Endonuclease reaction system is：1 μ g pBR-AAV2 plasmids or MUC-1cDNA；10U restriction enzymes BamH
I and PstI (being purchased from Promega companies of the U.S.), 2.5 μ 10 × buffer solutions of l C and 19.5 μ l deionized waters；Reaction condition is：
Water-bath 4 hours at 37 DEG C.Coupled reaction system is：PBR-AAV2 plasmids after 500ng digestions, 300ng MUC-1cDNA,
10IU T4DNA ligase (is purchased from Promega companies of the U.S.), 1.5 10 × T of μ l4DNA connection buffer solutions and 11.5 μ l go from
Sub- water；Reaction condition is：8 hours at 4 DEG C.Respectively obtain the recombination gland phase of the p5 promoters and MUC-1cDNA that carry AAV
Pass viral vectors, the recombined glandulae correlation viral vectors for carrying CMV promoter and MUC-1cDNA carry SV40 early stage startups
Son and MUC-1cDNA recombined glandulae correlation viral vectors and carry beta-actin promoter and the recombination of MUC-1cDNA
Gland relevant viral vector.
4, that the AAV/MUC-1 carriers after connection are directed respectively into gene engineering colibacillus (E.coli) DH5 α competence is thin
Born of the same parents (Invitrogen companies of the U.S.) carry out resistance screening with the LB tablets containing 100 μ g/mL ampicillins, and picking white is single
Bacterium colony extracts plasmid and purifies, obtains the plasmid vector of a large amount of AAV/MUC-1.
Three, the identification of the plasmid vector of recombinant adeno-associated virus
1. double digestion is identified：Above-mentioned monoclonal plasmid is subjected to the identification of BamH I and PstI double digestions, with can digestion
It is standard of perfection to go out MUC-1cDNA.The detection of 1.2% (W/V) agarose gel electrophoresis is carried out to double digestion product, at 928bp
There is the plamid vector construction success (as shown in Figure 3) that a specific band can be determined as AAV/MUC-1.
2.DNA sequencings:AAV/MUC-1 is subjected to determined dna sequence.The nucleotide sequence of its sequencing result such as Fig. 4
It is shown, further prove the plasmid vector success of structure AAV/MUC-1.
Embodiment 2, recombinant adeno-associated virus (rAAV) viral vectors preparation and virus titer measure (such as Fig. 2,5 institutes
Show)
Material and its source：
A. the AAV/MUC-1 carriers that embodiment 1 is built.
B. the helper plasmid pHelper of the Rep genes containing AAV and Lip/Cap genes：By medical college of University of Arkansas of the U.S.
Affiliated hospital Gene Therapy Center Liu Yong structures (Liu, Y., Chiriva-Internati, M., Grizzi, F.Salati, E.,
Roman,J.J.,Lim S.,and Hermonat,P.L.Rapid induction of cytotoxic T cell
response against cervical cancer cells by human papillomavirus type
16E6antigen gene delivery into human dendritic cells by an adeno-associated
virus vector.Cancer Gene Therapy 8:948-957.)。
C. contain and be integrated in cell chromosome and the adenoviral gene (E1, E2A, E4, VAI and VAII gene) of expression
AAVp cell strains：(Liu, Y., Chiriva- are established by University of Arkansas of U.S. hospital attached to a medical college Gene Therapy Center
Internati,M.,Grizzi,F.Salati,E.,Roman,J.J.,Lim S.,and Hermonat,P.L.Rapid
induction of cytotoxic T cell response against cervical cancer cells by human
papillomavirus type 16E6antigen gene delivery into human dendritic cells by
an adeno-associated virus vector.Cancer Gene Therapy 8:948-957.)。
D. lipofectamine Lipofectin：Purchased from Invotrogen companies of the U.S..
E.DMEM culture mediums and fetal calf serum (or calf serum)：Purchased from Cellgro companies of the U.S..
F.PCR DIG labelling kits and DIG hybridization check kits：Purchased from Roche companies of Switzerland.
G.DNA copy number standards：Respectively 6X108Copy number (copies)/μ l to 3X1010(copies)/μ l, purchased from U.S.
Promege companies of state.
One, the preparation of the viral vectors of recombinant adeno-associated virus (rAAV)
With reference to Fig. 2, with following methods Prepare restructuring adeno-associated virus (rAAV), to prepare a disk 10.0cm Tissue Culture Dish
Virus for, when AAVp cells are grown in carbon dioxide cell incubator accounts for about culture dish area 70%, carry out such as
Lower operation：
A. it is operated according to the operation instruction of Lipofectin：By the plasmid vector of 1.0 μ g AAV/MUC-1,1.0 μ g
The DMEM of pHelper plasmids, 4.0 μ l Lipofectin and 50.0 μ l containing 5% (V/V) fetal calf serum (or calf serum) is cultivated
Base mixing is stored at room temperature 20 minutes.
B. mixed liquor is added in Tissue Culture Dish, continues to be placed in carbon dioxide cell incubator and cultivates.
C.72 after hour, all cells and culture solution in culture dish are harvested.
D. after acutely vibrating 1 minute, centrifugation retains supernatant, i.e. rAAV virus liquids.
E. by the rAAV virus liquid filtration sterilizations of collection.By carrying tumor antigen gene-human melanoma antigen of acquisition
The rAAV viral nomenclatures of full length gene MUC-1cDNA are the viral vectors of AAV/MUC-1.
Two, the virus titer of the viral vectors of AAV/MUC-1 measures
Using conventional spot hybridization, the viral vectors progress virus titer survey to the AAV/MUC-1 that step 1 obtains
Fixed, specific method includes the following steps：Only DNA probe used is the specific probe for MUC-1 genes.
A. conventional DNA phenol/chloroform extraction methods, extraction rAAV virions DNA are used.
B. nylon membrane is placed in Dot blot instrument, the rAAV virion DNA through alkaline denaturation is added, and DNA is added and copies
Shellfish number standard, vacuumizes.
C. after taking out nylon membrane drying, ultraviolet light is fixed.
D. PCR DIG labelling kits are used and prepare the specific probe of DIG labels with reference to kit specification, probe is
" MUC-1cDNA obtained in embodiment 1 ".After PCR amplification, it is solidifying that 1.2% (W/V) agarose is carried out to pcr amplification product
Gel electrophoresis detects pcr amplification product, positive band as a result occurs under ultraviolet light, shows that probe marks successfully.
E. it uses DIG hybridization checks kit and with reference to kit specification, rAAV viral DNAs is carried out in hybrid heater
DNA hybridization.The testing result of the viral vectors of AAV/MUC-1 as shown in figure 5, the virus titer of the viral vectors of AAVMUC-1 extremely
It is 3X10 less10Copy number/ml.
Embodiment 3, AAV/MUC-1 viral vectors import monocyte-Dendritic Cells system killing tumor experiment
Material and its source：
The viral vectors of A.rAAV：The viral vectors of AAV/MUC-1.
B.AIM-V cell culture mediums：Purchased from Life Technologies companies of the U.S..
C. cell factor：Granulocyte colony stimulating factor (GM-CSF), interleukin 2,4,7 (IL-2,4,7) and tumour
Necrosin (TNF-α) is purchased from R＆D companies of the U.S..
The primary tumor cell of the D.MUC-1 positives：The colon cancer that is respectively detached from the tumor tissues of patient, mammary gland
Cancer, stomach cancer cell.
E.MUC-1 positive cell strains：A549 human lung carcinoma cell lines are obtained from American tissue cell storage center (ATCC).
F.MUC-1 feminine gender primary cells：Skin epithelial cell, the pneumonocyte of antigen negative.
One, tumor experiment step is killed
As shown in fig. 6, by killing based on the viral vector infection tumor patient monocyte of the AAV/MUC-1 of the present invention
The whole process of tumor experiment of going out includes the following steps：
A. 50-150 milliliters of peripheral bloods of tumor patient are taken, it is routinely square with haemocyte separator (or lymphocyte separation medium)
Method obtains peripheral blood mononuclear cells (PBMC), after AIM-V culture medium mixings, Tissue Culture Flask is added, is placed in constant temperature dioxy
Change and is cultivated 2 hours in carbon incubator.
B. suspension cell is removed, attached cell (monocyte, monocyte, Mo) is retained.Suspension cell, that is, periphery blood strangury
Bar cell continues to cultivate spare by it with after AIM-V culture medium mixings.Monocyte is Dendritic Cells (Dendritic
Cells, DC) precursor cells, through the cell in vitro factor induction become DC.C. the embodiment of the present invention 2 is added in monocyte
The viral vectors of the AAV/MUC-1 of acquisition, addition is 100~1000MOI (being 100MOI in this example), while adding GM-
CSF (800IU/mL) continues culture 4 hours.
D. the old culture medium of step C is removed, supplement contains GM-CSF, IL-4 (800IU/mL) and TNF-α (20IU/mL)
AIM-V culture mediums continue to cultivate.
E. after cultivating 5 days, ripe DC is harvested, and mix with the peripheral blood lymphocytes cultivated, in AIM-V culture mediums
Middle addition IL-2 (20IU/mL) and IL-7 (500IU/mL), continue to cultivate.
F. it cultivates to after 7-9 days, the cytotoxic T lymphocyte (CTL) for harvesting activation is detected.
Two, the detection of Dendritic Cells (DC) and cytotoxic T lymphocyte (CTL)
The Efficiency testing of the viral vector infection peripheral blood mononuclear cells of A.AAV/MUC-1
Decoration method is marked using conventional fluorescence antibody, (U.S. is purchased from the specific fluorescent antibody for MUC-1 antigens
BD companies) the above-mentioned acquisition of label the viral vector infection by AAV/MUC-1 of the present invention monocyte or immature DC, then
Carry out the quantity of flow cytomery positive cell.The effect of the viral vector infection peripheral blood mononuclear cells of AAV/MUC-1
For the Flow Cytometry testing result of rate as shown in Fig. 7 a-7d, the promoter in Fig. 7 a-7d is respectively p5 promoters, CMV startups
Son, SV40 early promoters and beta-actin promoter, the viral vector infection peripheral blood mononuclear cells of AAV/MUC-1
Efficiency is respectively 94.49%, 83.53%, 80.32%, 88.37%.It is higher to prove that the viral vectors of the rAAV of the present invention has
Efficiency of infection.
B. the detection of the CD molecular levels of Dendritic Cells (DC)
The level and the function of DC of DC expression CD80, CD83 and CD86 are proportionate.With detection side identical with step A
The antibody (being purchased from U.S. company BD) for these three CD molecules of fluorescent marker is respectively adopted to the quilt sheet of above-mentioned acquisition in method
The horizontal of DC expression CD80, CD83 and CD86 for inventing the viral vector infection of AAV/MUC-1 carries out conventional fluidic cell
Technology detects, respectively four kinds of AAV/ of p5 promoters, CMV promoter, SV40 early promoters, beta-actin promoter
The viral vector infection of MUC-1 DC expression CD80, CD83 and CD86 average level it is higher, prompt can effective stimulus Th1 it is anti-
It answers, cell immune response.For example, being control (such as Fig. 8 a) with non-stimulated DC expression D80, promoter is SV40 early promoters
AAV/MUC-1 viral vector infection DC expression CD80 level testing result such as Fig. 8 a ' it is shown；With non-stimulated DC tables
It is control (such as Fig. 8 b) up to DC83, promoter is the DC expression of the viral vector infection of the AAV/MUC-1 of SV40 early promoters
Shown in the testing result of CD83 levels such as Fig. 8 b '；It is control (such as Fig. 8 c), promoter SV40 with non-stimulated DC expression DC86
Shown in testing result such as Fig. 8 c ' of the DC expression CD86 levels of the viral vector infection of the AAV/MUC-1 of early promoter.Detection
As a result illustrate, control is apparently higher than by the CD molecular levels expressed by the DC of the viral vector infection of AAV/MUC-1, it was demonstrated that structure
After the viral vector infection peripheral blood mononuclear cells of the rAAV of the carrying MUC-1 antigen genes of preparation, the work(of the DC induced
It can be powerful.
Three, cytotoxic T lymphocyte (CTL) killing tumor cell is tested
It, will be by AAV/MUC-1's after by the DC of the viral vector infection of AAV/MUC-1 and lymphocyte mixed culture
The cytotoxic T lymphocyte (Cytotoxic T lymphocytes, CTL) that the DC of viral vector infection is induced presses 20:1
(lymphocyte:Target cell) with normal (primary) skin epithelial cell of the tumour cells of the MUC-1 positives or MUC-1 feminine genders or
After pneumonocyte mixing, using traditional51Cr (chromium -51) fragmentation test detects activity, the MHC class of CTL killing tumor cells
I is restricted and killing is specific.Wherein test result as illustrated in figures 9 a and 9b, what the DC that Fig. 9 a are infected by AAV/MUC1 was induced
CTL kills the tumour cell of MUC-1 antigen positives and the testing result of killing specificity, the results showed that：By the present invention's
The tumour that the CTL that the DC of the viral vector infection of AAV/MUC-1 is induced can effectively crack (killing) MUC-1 positives is thin
Born of the same parents, killing rate prompt the effect for killing tumour cell stronger, but to the normal skin of MUC-1 antigen negatives 45% or more
Epithelial cell and pneumonocyte prompt the lethal effect to have MUC-1 antigentic specificities without lethal effect.Fig. 9 b are AAV/MUC1's
The CTL that the DC that the DC of viral vector infection is induced is induced has the restrictive testing result of MHC I class molecules.As a result table
It is bright：And after the processing of MHC Class I antibody, unobvious are acted on for the A549 tumor cytotoxicities of the MUC-1 positives, but right
The A549 tumour cells of MHC Class II antibody treated the MUC-1 positives still have stronger lethal effect, it was demonstrated that this is killed
Wound effect has MHC Class I restricted, is the feature of the lethal effect of CTL.
It is control with the cell of the skin epithelial cell of MUC-1 antigen negatives, pneumonocyte, then is examined with above-mentioned identical method
Survey the specificity for the CTL killing tumor cells that the DC of the above-mentioned viral vector infection by AAV/MUC-1 is induced.Testing result is such as
Shown in Fig. 9 a, the CTL induced by the DC of the viral vector infection for the AAV/MUC-1 that the present invention is built and is prepared is to antigen negative
Cell without lethal effect, it was demonstrated that induced by the DC of the viral vector infection for the AAV/MUC-1 that the present invention is built and is prepared
CTL has antigentic specificity, i.e., to the cell of antigen negative without lethal effect.
For the cell strain of the above-mentioned MUC-1 positives, first carried out with MHC class I antibody (being purchased from R＆D companies of the U.S.) pre-
After processing, then using traditional51Cr (chromium -51) fragmentation test detects the activity of CTL killing tumor cells.Testing result shows
The tumour cell of the MUC-1 positives is not killed substantially, as shown in figure 9b.The result proves the AAV/ for being built and being prepared by the present invention
The CTL that the DC of the viral vector infection of MUC-1 is induced has MHC Class I restricted.
In summary testing result, it was demonstrated that built and prepared the DC institutes of the viral vector infection of AAV/MUC-1 by the present invention
It stimulates the CTL generated that there is apparent killing (cracking) effect to the tumour cell of the MUC-1 positives, can be used for preparing antineoplastic
Object.
Embodiment 4, oncotherapy clinical test
The present embodiment provides a kind of recombined glandulae correlation viral vectors carrying MUC-1 antigen genes or its Related product to exist
Prepare the application in antitumor drug, the especially application in the malignant tumor medicine of the anti-MUC-1 positives, wherein MUC-1 sun
Property malignant tumour include almost all of epithelium gland cancer as but be not limited to cancer of pancreas, gallbladder cancer, breast cancer, colon cancer, gastric cancer
Deng.The active constituent of antitumor drug be above-mentioned carrying MUC-1 antigen genes recombined glandulae correlation viral vectors or with carrying
The relevant product of recombined glandulae correlation viral vectors of MUC-1 antigen genes.The dosage forms such as solvent or pulvis can be used in drug.It is described molten
The selection of agent is diversified, such as cell culture fluid (base), physiological saline or phosphate buffer.Need when
It waits, one or more pharmaceutically acceptable carriers can also be added in said medicine, the carrier may include pharmaceutical field
Conventional diluent, sorbefacient and surfactant etc..
Application method can be first to isolate monocyte in tumor patient body, then by the viral vectors sense of AAV/MUC-1
The monocyte of dye or transfection patient, or ripe the stimulated generation of Dendritic Cells for having MUC-1 antigen genes will be converted
Cytotoxic T lymphocyte feeds back tumor patient.For improve curative effect, said medicine can also with antibiotic, immunostimulant and
Tumor-targeting drug etc. is combined treatment.
The present embodiment also provides a kind of method of killing in vitro tumour, includes the following steps：
It 1) will be natural in system where tumour (system can be generated by way of manual simulation or tumor patient body in)
Monocyte-the Dendritic Cells or T lymphocytes of generation by the viral vector infection of AAV/MUC-1 or transfection, or by with
The relevant product treatment of AAV/MUC-1 carriers, the cell that respectively obtains that treated；
2) tumour is killed in system where tumour being added in treated in step 1) monocyte-Dendritic Cells；Or
By not processed T lymphocytes with described treated that monocyte-Dendritic Cells is mixed to form antigentic specificity
Cytotoxic T lymphocyte, then the Antigen-specific cytotoxic T lymphocyte is added in the system of tumour place to kill and is swollen
Tumor；Or processed T lymphocytes and not processed monocyte-Dendritic Cells are added in the system of tumour place and killed
Tumour.
That is, giving a tumor patient feeds back MUC-1 Antigen-specific cytotoxic T lymphocytes, the cell origin
Spontaneous T lymphocytes derived from patient are generated with the monocyte from the patient-Dendritic Cells mixed culture
's.Before mixed culture, these have been carried the weight of MUC-1 antigen genes in monocyte-Dendritic Cells by the present invention
Group gland relevant viral vector infection or transfection, or by with the relevant product treatment of recombined glandulae correlation viral vectors of the present invention；Or
Person gives a tumor patient and feeds back the monocyte-Dendritic Cells for deriving from patient.Before feedback, these are in monokaryon
Cell-Dendritic Cells by the present invention carry MUC-1 antigen genes recombinant adeno-associated virus viral vector infection or
Person transfect, or by with the relevant product treatment of recombined glandulae correlation viral vectors of the present invention.
It is specially in this example：The tree that the viral vector infection of AAV/MUC-1 in embodiment 3 is detached from tumor patient respectively
The cytotoxic T lymphocyte (CTL) that prominent shape cell (DC) is induced feeds back 6 non-III primary breast cancers patients and 5 III phases
Patients with gastric cancer.
Infused cells number is 1 × 108-5×108(it is 100 l/5 × 10 μ in this example6A monocyte/every time).Treatment is treated
Journey：Usually 6 months, monthly 2 times, the state of an illness can be kept to monthly 1 time after improving, and (dosage and the course for the treatment of all can be according to actual conditions tune
It is whole).Therapeutic effect is substantially reduced to judge with the change of serum C A19-9 of the change of serum C A15-3 antigens of patient with breast cancer and patients with gastric cancer
Standard.Shown in Figure 10 and 11, breast after 6 in Figure 10 CTL treatments induced through the DC of the viral vector infection of AAV/MUC-1
Serum of adenocarcinoma patients's tumor markers CA15-3 antigen levels are decreased obviously except 1 exception, the level of the antigen of 5 patients, 2
Restore normal level.In Figure 11, Stomach Carcinomas is suffered from after 5 CTL treatments induced through the DC of the viral vector infection of AAV/MUC-1
Person's blood serum tumor markers CA19-9 antigen levels are in addition to 1 maintains stable state, under the level of the antigen of 4 patients is apparent
Drop, 3 recovery normal levels.Therefore, the CTL induced by the DC of the viral vector infection of the rAAV of the present invention is in patient's body
Certain curative effect can be played, the level of blood serum tumor related antigen can be effectively reduced, or even it is made to turn out cloudy.And without patient
Occur over the course for the treatment of without apparent toxic side effect.The test result shows that the CTL prepared by this kind of technology not only has
Certain curative effect and safety is higher, can be used for preparing antitumor drug.
Industrial applicability
It is demonstrated experimentally that by the Dendritic Cells of the viral vector infection of MUC-1 recombinant adeno-associated virus rAAV of the present invention and
The cytotoxic T lymphocyte induced can effectively inhibit the growth or killing of associated malignancies cell in patient's body
Tumour cell, thus, MUC-1 recombined glandulae correlation viral vectors of the invention or with MUC-1 recombinant adeno-associated virus of the present invention carry
The relevant product of body can be used for preparing antitumor drug, malignant tumour as but be not limited to colon cancer, cancer of pancreas, gallbladder cancer,
Have great importance in the clinical treatment of breast cancer, gastric cancer etc. and application.
The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that
The specific implementation of the present invention is confined to these explanations.For those of ordinary skill in the art to which the present invention belongs, exist
Several alternative or obvious variations are made under the premise of not departing from present inventive concept, and performance or use is identical, all should be considered as
It belongs to the scope of protection of the present invention.
Claims (5)
1. a kind of recombined glandulae correlation viral vectors carrying MUC-1 antigen genes, it is characterised in that：It is by gland relevant viral vector
In the structural gene of adeno-associated virus replace with the recombined glandulae correlation viral vectors that MUC-1 antigen genes obtain；The recombination
The construction method of gland relevant viral vector includes the following steps：
1）Reconstruct AAV-2 type pBR322 plasmids：Use restriction enzymeBst98 IWithHpa IBy AAV-2 type pBR322 plasmids
In AAV-2 type adeno-associated virus in structural gene excision, then will contain restriction enzymeEcoR IWithEcoR VEnzyme
The nucleotide sequence CGAATTCATGCGATATCGTT of enzyme site is inserted into the AAV-2 types pBR322 plasmids, retains both ends
TR sequences are inserted into 9 nucleotide CTGCGCTGG groups at the 75th nucleotide sequence of the complete TR sequences in both ends respectively
At segment；
2）By promoter inserting step 1）In the AAV-2 type pBR322 plasmids of obtained reconstruction, structure carries promoter
AAV-2 type pBR322 plasmids；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus open
Mover, beta-actin promoter and SV40 early promoters；
3）MUC-1 cDNA are obtained, are included the following steps：31）Total mRNA is extracted from the tumor tissues of MUC-1 antigen positives, by
Total mRNA carries out reverse transcription reaction, synthesizes total cDNA；32）Using total cDNA as template, in primer 1：
GCCTGCCTGAATCTGTT and primer 2：PCR amplification is carried out under the guiding of AACCTGAGTGGAGTGG, obtains sequence such as SEQ ID
NO:The MUC-1 cDNA shown in 3；
4）By step 2）The AAV-2 type pBR322 plasmids and step 3 for carrying promoter of structure）Obtained MUC-1
CDNA uses restriction enzyme respectivelyBamHI andPstI carries out digestion, then carries out DNA connections reaction, obtains carrying described
The recombined glandulae correlation viral vectors of promoter and MUC-1 antigen genes.
2. a kind of construction method for the recombined glandulae correlation viral vectors carrying MUC-1 antigen genes, it is characterised in that：By gland correlation
The structural gene of adeno-associated virus in viral vectors is rejected, and MUC-1 antigen genes are then inserted on the position of rejecting, are obtained
Recombined glandulae correlation viral vectors；Include the following steps：
1）Reconstruct AAV-2 type pBR322 plasmids：Use restriction enzymeBst98 IWithHpa IBy AAV-2 type pBR322 plasmids
In AAV-2 type adeno-associated virus in structural gene excision, then will contain restriction enzymeEcoR IWithEcoR VEnzyme
The nucleotide sequence CGAATTCATGCGATATCGTT of enzyme site is inserted into the AAV-2 types pBR322 plasmids, retains both ends
TR sequences are inserted into 9 nucleotide CTGCGCTGG groups at the 75th nucleotide sequence of the complete TR sequences in both ends respectively
At segment；
2）By promoter inserting step 1）In the AAV-2 type pBR322 plasmids of obtained reconstruction, structure carries promoter
AAV-2 type pBR322 plasmids；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus open
Mover, beta-actin promoter and SV40 early promoters；
3）MUC-1 cDNA are obtained, are included the following steps：31）Total mRNA is extracted from the tumor tissues of MUC-1 antigen positives, by
Total mRNA carries out reverse transcription reaction, synthesizes total cDNA；32）Using total cDNA as template, in primer 1：
GCCTGCCTGAATCTGTT and primer 2：PCR amplification is carried out under the guiding of AACCTGAGTGGAGTGG, obtains sequence such as SEQ ID
NO:The MUC-1 cDNA shown in 3；
4）By step 2）The AAV-2 type pBR322 plasmids and step 3 for carrying promoter of structure）Obtained MUC-1
CDNA uses restriction enzyme respectivelyBamHI andPstI carries out digestion, then carries out DNA connections reaction, obtains carrying described
The recombined glandulae correlation viral vectors of promoter and MUC-1 antigen genes.
3. a kind of relevant product of recombined glandulae correlation viral vectors with carrying MUC-1 antigen genes, it is characterised in that：The production
Product are the plasmid vector of MUC-1 recombinant adeno-associated virus, the viral vectors of MUC-1 recombinant adeno-associated virus or by the MUC-1
The viral vector infection of recombinant adeno-associated virus or the cell line of transfection；The plasmid vector of the MUC-1 recombinant adeno-associated virus
By it is described in claim 1 it is a kind of carry MUC-1 antigen genes recombined glandulae correlation viral vectors or claim 2 described in
The construction method recombined glandulae correlation viral vectors obtained for carrying MUC-1 antigen genes are made；The MUC-1 recombinates gland related diseases
The viral vectors of poison carries out cell culture by the plasmid vector of the MUC-1 recombinant adeno-associated virus and obtains.
4. a kind of relevant production of recombined glandulae correlation viral vectors with carrying MUC-1 antigen genes according to claim 3
The preparation method of product, it is characterised in that：
The preparation of the plasmid vector of MUC-1 recombinant adeno-associated virus：It will a kind of carrying MUC-1 antigens as described in claim 1
MUC-1 antigen genes are carried made from construction method described in the recombined glandulae correlation viral vectors or claim 2 of gene
Recombined glandulae correlation viral vectors quiding gene engineering colon bacillus DH5 α competent cells, with containing 100 μ g/mL ampicillins
LB tablets carry out resistance screening, picking white single bacterium colony, extraction plasmid simultaneously purify, obtain MUC-1 recombinant adeno-associated virus
Plasmid vector；
The preparation of the viral vectors of MUC-1 recombinant adeno-associated virus：With the plasmid vector of the MUC-1 recombinant adeno-associated virus and
PHelper plasmid co-transfection AAVp cells obtain the viral vectors of MUC-1 recombinant adeno-associated virus；
The preparation of the viral vector infection of MUC-1 recombinant adeno-associated virus or the cell line of transfection：Gland phase is recombinated with the MUC-1
It includes monocyte-dendron shape to close the viral vector infection of virus or transfect monocyte or Dendritic Cells, the cell line
Cell line.
5. a kind of recombined glandulae correlation viral vectors or claim 3 as described in claim 1 carrying MUC-1 antigen genes
The Related product application in preparation of anti-tumor drugs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510336709.3A CN105087649B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510336709.3A CN105087649B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087649A CN105087649A (en) | 2015-11-25 |
| CN105087649B true CN105087649B (en) | 2018-10-02 |
Family
ID=54568979
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510336709.3A Active CN105087649B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087649B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753825A (en) * | 2018-06-11 | 2018-11-06 | 北京安斯晨睿生物科技有限公司 | The recombined glandulae correlation viral vectors and its construction method of carrying HER2/ERBB mutant antigen genes and application |
| AU2021360902A1 (en) | 2020-10-15 | 2023-04-27 | Aavocyte, Inc. | Recombinant adeno-associated virus vectors with cd14 promoter and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101426523A (en) * | 2006-04-27 | 2009-05-06 | 财团法人首尔大学校产学协力财团 | B cell-based vaccine loaded with the ligand of natural killer T cell and antigen |
| CN102277384A (en) * | 2007-04-23 | 2011-12-14 | 核力康健生物医药技术(天津)有限公司 | PSA recombinant adeno-associated viral vector and its construction method and application |
| WO2015024664A1 (en) * | 2013-08-21 | 2015-02-26 | Curevac Gmbh | Composition and vaccine for treating prostate cancer |
-
2015
- 2015-06-17 CN CN201510336709.3A patent/CN105087649B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101426523A (en) * | 2006-04-27 | 2009-05-06 | 财团法人首尔大学校产学协力财团 | B cell-based vaccine loaded with the ligand of natural killer T cell and antigen |
| CN102277384A (en) * | 2007-04-23 | 2011-12-14 | 核力康健生物医药技术(天津)有限公司 | PSA recombinant adeno-associated viral vector and its construction method and application |
| WO2015024664A1 (en) * | 2013-08-21 | 2015-02-26 | Curevac Gmbh | Composition and vaccine for treating prostate cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087649A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102268458B (en) | BA46 recombinant adeno-associated virus vector and construction method and application thereof | |
| CN109562191A (en) | For treating the gene therapy of hemophilia A | |
| CN105087648B (en) | The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application | |
| CN105985984B (en) | The recombined glandulae correlation viral vectors and construction method of carrying PAP antigen genes and application | |
| CN107847577A (en) | The cancer vaccine of mRNA comprising coding M-like protein matter | |
| CN105087647B (en) | A kind of recombined glandulae correlation viral vectors carrying Survivin antigen genes and its construction method and application | |
| CN105087649B (en) | The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application | |
| CN105018525B (en) | Carry HPV 16 saltant type E7m91The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| WO2016015684A1 (en) | Nrecombinant adeno-associated virus vector carrying human papillomavirus type 16 mutation e7 antigen gene, construction method therefor, and application thereof | |
| CN105969804B (en) | A kind of recombined glandulae correlation viral vectors carrying SCC antigen genes and its construction method and application | |
| CN105177048B (en) | Carry HPV 16 multipoint mutation type E7mmThe recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN108546715A (en) | A kind of LMP-2 recombined glandulae correlation viral vectors and its construction method and application | |
| CN105177047B (en) | Carry HPV 16 saltant type E7m94The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| RU2678003C1 (en) | Recombinant oncolytic strain of l-ivp_oncoq vaccinia virus, containing genes encoding granulocyte macrophage colony-stimulating factor and polyepitope immunogen consisting of antigen epitopes, overexpressing tumor cells in ovarian cancer | |
| CN105316361B (en) | Carry HPV 16 saltant type E7m58The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN114569709A (en) | Preparation method and application of melanoma autologous tumor vaccine with high ADAM-28 expression | |
| CN117904199A (en) | Fusion gene vector combining P53 and immune check point and application of fusion gene vector in preparation of antitumor biological medicines | |
| CN110885855A (en) | Recombinant adeno-associated virus vector carrying sperm protein 17 antigen gene and application value thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20190903 Address after: 518000 Tongfang Information Port A Block 701, No. 11 Longshan Road, Songpingshan Community, Xili Street, Nanshan District, Shenzhen City, Guangdong Province Patentee after: Shenzhen Yishi Kangning Biomedical Development Co., Ltd. Address before: 518000 Unit 16, Kexing Science Park, No. 19 Keyuan Road, Nanshan District, Shenzhen City, Guangdong Province Co-patentee before: Liu Yong Patentee before: Health-Power Biological Medical Technology (Tianjin) Co., Ltd. |
|
| TR01 | Transfer of patent right |