CN105087648B - The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application - Google Patents
The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application Download PDFInfo
- Publication number
- CN105087648B CN105087648B CN201510336313.9A CN201510336313A CN105087648B CN 105087648 B CN105087648 B CN 105087648B CN 201510336313 A CN201510336313 A CN 201510336313A CN 105087648 B CN105087648 B CN 105087648B
- Authority
- CN
- China
- Prior art keywords
- mage
- aav
- viral vectors
- associated virus
- carrying
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of recombined glandulae correlation viral vectors for carrying MAGE A3 antigen genes and construction method and applications.The rAAV is will to be inserted into MAGE A3 antigen genes in gland relevant viral vector at deleted adeno-associated virus structural gene position to obtain.The MAGE A3 antigen genes that the rAAV of the present invention can be carried are conveyed into monocytic dendritic cell shape cell line, are used for the effector cell of stimulating immune system.It is demonstrated experimentally that by the CTL that are induced of DC of the viral vector infection of the rAAV of the present invention in vitro or patient's body can effectively inhibit MAGE A3 antigen positives malignant cell growth or kill tumour cell.The recombined glandulae correlation viral vectors or its Related product of the present invention can be used for preparing the drug for treating a variety of MAGE A3 antigen positive tumours.
Description
Technical field
The present invention relates to the carrier in biological field and its application, more particularly to carrying melanic related antigen-A3
(Melanoma-associated Antigen-A3；MAGE-A3) the recombined glandulae correlation viral vectors and its structure of antigen gene
Method and its application in the tumour medicine for preparing the anti-MAGE-A3 positives.
Background technology
Adeno-associated virus (Adeno-associated virus；AAV gene structure) has been accredited.Nineteen eighty-three,
Samulski et al. describe AAV end repeated fragment (5 ' end fragment of upstream, 3 ' end fragment of downstream) (Samulski RJ,
Srivastava A,Berns KI,Muzyczka N.Rescue of adeno-associated virus from
recombinant plasmids:gene correction within the terminal repeats of
AAV.Cell.33:135-143.).1984, Hermonat et al. described the replication protein (rep) of the low infectious particles of AAV
Gene and envelope protein (cap) gene (1.Hermonat PL, Labow MA, Wright R, Berns KI, Muzyczka
N.Genetics of adeno-associated virus:isolation and preliminary
characterization of adeno-associated virus type 2mutants.J Virol.51:329-
339.2.Hermonat,P.L.,and Muzyczka,N.Use of adeno-associated virus as a
mammalian DNA cloning vector:transduction of neomycin resistance into
mammalian tissue culture cells.Proc.Natl.Acad.Sci.U.S.A.81:6466-6470.)。1986
Year, Labow et al. identifies p5 promoters (the Labow MA, Hermonat between 5 ' end fragment of upstream and rep genes
PL,Berns KI.Positive and negative autoregulation of the adeno-associated
virus type 2genome.J Virol.160:251-258.)。
1984, U.S. Paul L.Hermonat proved that AAV carriers can be used for the gene therapy of human diseases
(Hermonat,P.L.,and Muzyczka,N.Use of adeno-associated virus as a mammalian
DNA cloning vector:transduction of neomycin resistance into mammalian tissue
culture cells.Proc.Natl.Acad.Sci.U.S.A.81:6466-6470.).At present, be mainly American-European countries into
The clinical test of gene therapy human diseases of the row based on AAV.It is counted according to U.S.'s grain and drug administration, existing more than ten
Gene Therapy Clinical Trials of the item based on AAV are carrying out, and will mainly carry the AAV virus injection patients of therapeutic gene
In vivo, its expression treatment gene in vivo is made, so as to achieve the purpose that treat disease.There is Parkinson mainly for the disease for the treatment of
The Non-cancerous such as syndrome, rheumatic arthritis, hemophilia, heart failure, the silent syndrome of progressive myatrophy and Olds sea
Disease.On November 2nd, 2012, the Glybera products of European Union approval UniQure companies were used in 27 member states of European Union, this is west
First granted gene therapy medicament of Fang Guojia, it is that adeno-associated virus I types (AAV-1) foreign gene-carrying is utilized to be used for
Treat the genomic medicine of lipoprotein lipase deficiency hereditary disease (LPLD).
(AAV-2) carrier becomes current when having many advantages, such as no pathogenicity, host range wide, target gene long-term expression
One of most potential viral vectors in gene therapy.About 4700 base-pair (bp) of AAV-2 full-length genomes, both ends are end weight
Multiple segment (TR), centre is viral structural gene, including replication protein (Rep) and envelope protein (Cap) gene.Due to existing
The unstability of AAV viruses itself and its allogenic gene (therapeutic gene) limited length etc. defect is carried, therefore have must
It is carried out genetic recombination formed recombinant adeno-associated virus (recombinant adeno-associated virus,
rAAV).How to build available for the recombinant adeno-associated virus and its Related product of the drug for preparing treatment disease is this field skill
The direction that art personnel make great efforts.
The content of the invention
The technical problems to be solved by the invention are：It is proposed that a kind of stability is high, carries the restructuring of MAGE-A3 antigen genes
Adeno-associated virus (Recombinant Adeno-associated virus；RAAV) carrier and construction method and application.
The technical issues of of the invention, is solved by following technical solution：
A kind of recombined glandulae correlation viral vectors for carrying MAGE-A3 antigen genes, are by the gland in gland relevant viral vector
The structural gene of correlated virus replaces with the recombined glandulae correlation viral vectors that MAGE-A3 antigen genes obtain.
Preferably, the p5 promoters in the recombined glandulae correlation viral vectors can also be replaced with to following three kinds of promoters
In one kind：Cytomegalovirus promoter, beta-actin promoter and SV40 early promoters.
A kind of construction method for the recombined glandulae correlation viral vectors for carrying MAGE-A3 antigen genes, adeno-associated virus is carried
The structural gene of adeno-associated virus in body is rejected, and MAGE-A3 antigen genes are then inserted on the position of rejecting, are recombinated
Gland relevant viral vector.
Preferably, it is further comprising the steps of：P5 promoters in the recombined glandulae correlation viral vectors are replaced with following
One kind in three kinds of promoters：Cytomegalovirus promoter, beta-actin promoter and SV40 early promoters.
Preferably, comprise the following steps：
1) AAV-2 type pBR322 plasmids are reconstructed：Using restriction enzyme Bst98I and Hpa I by AAV-2 types pBR322
Structural gene excision in AAV-2 type adeno-associated viruses in plasmid, then will contain restriction enzyme EcoR I and EcoR
The nucleotide sequence CGAATTCATGCGATATCGTT of V restriction enzyme sites is inserted into the AAV-2 types pBR322 plasmids, retains both ends
TR sequences or at the 75th nucleotide sequence of the complete TR sequences in both ends be inserted into 9 nucleotide CTGCGCTGG respectively
The segment of composition；
2) by promoter inserting step 1) in the obtained AAV-2 type pBR322 plasmids of reconstruction, structure carries promoter
AAV-2 type pBR322 plasmids；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus
Promoter, beta-actin promoter and SV40 early promoters；
3) MAGE-A3cDNA is obtained；
4) the described of step 2) structure is carried into the AAV-2 type pBR322 plasmids of promoter and step 3) obtains
MAGE-A3cDNA carries out digestion with restriction enzyme BamH I and Pst I respectively, then carries out DNA coupled reactions, is taken
Recombined glandulae correlation viral vectors with the promoter and MAGE-A3 antigen genes.
Preferably, comprise the following steps in the step 3)：31) extracted from the tumor tissues of MAGE-A3 antigen positives
Total mRNA carries out reverse transcription reaction by total mRNA, synthesizes total cDNA；32) using total cDNA as template, in primer 1：
GTGCTCAGACTCACTCTT and primer 2：PCR amplification is carried out under the guiding of AGTCATCATGCCTCTTGA, obtains the MAGE-
A3cDNA。
A kind of relevant product of recombined glandulae correlation viral vectors with carrying MAGE-A3 antigen genes, including MAGE-A3 weights
The plasmid vector of group adeno-associated virus, the viral vectors of MAGE-A3 recombinant adeno-associated virus recombinate gland phase by the MAGE-A3
Close the viral vector infection of virus or the cell line of transfection；The plasmid vector of the MAGE-A3 recombinant adeno-associated virus is by described
Or the obtained recombined glandulae correlation viral vectors for carrying MAGE-A3 antigen genes of the construction method be made；It is described
The viral vectors of MAGE-A3 recombinant adeno-associated virus carries out cell by the plasmid vector of the MAGE-A3 recombinant adeno-associated virus
Culture obtains.
A kind of preparation method with carrying the relevant product of recombined glandulae correlation viral vectors of MAGE-A3 antigen genes,
The preparation of the plasmid vector of MAGE-A3 recombinant adeno-associated virus：Described or described construction method is made
Carrying MAGE-A3 antigen genes recombined glandulae correlation viral vectors quiding gene engineering colon bacillus DH5 α competent cells,
Resistance screening is carried out with the LB tablets containing 100 μ g/mL ampicillins, picking white single bacterium colony is extracted plasmid and purified, obtains
The plasmid vector of MAGE-A3 recombinant adeno-associated virus；
The preparation of the viral vectors of MAGE-A3 recombinant adeno-associated virus：With the matter of the MAGE-A3 recombinant adeno-associated virus
Grain carrier and pHelper plasmid co-transfection AAVp cells obtain the viral vectors of MAGE-A3 recombinant adeno-associated virus；
The preparation of the viral vector infection of MAGE-A3 recombinant adeno-associated virus or the cell line of transfection：With the MAGE-A3
The viral vector infection or transfection monocyte or Dendritic Cells of recombinant adeno-associated virus, it is thin that the cell line includes monokaryon
Born of the same parents-Dendritic Cells system.
The recombined glandulae correlation viral vectors or the Related product of a kind of carrying MAGE-A3 antigen genes exist
Prepare the application in antitumor drug.
The advantageous effect that the present invention is compared with the prior art is：
The present invention provides a kind of stability height, carry the recombinant adeno-associated virus of allogenic gene (MAGE-A3) (below
" recombinant adeno-associated virus for carrying MAGE-A3 antigen genes " is known as AAV/MAGE-A3) carrier.The restructuring gland phase of the present invention
The MAGE-A3 antigen genes that closing viral vectors can be carried are conveyed into monocyte-Dendritic Cells system, and there are MAGE-
The cell of A3 antigen genes is used for effector cell's (being not limited to T lymphocytes and bone-marrow-derived lymphocyte) of stimulating immune system.It is real
Verify it is bright, it is thin by the cytotoxic T that is induced of Dendritic Cells of the viral vector infection of the AAV/MAGE-A3 of the present invention
Born of the same parents can effectively inhibit the growth of associated malignancies cell in patient's body or kill tumour cell, thus, it is of the invention
AAV/MAGE-A3 carriers can be used for preparing the anti-MAGE-A3 positives with the relevant product of AAV/MAGE-A3 carriers of the present invention
The cellular immunotherapy of malignant tumour.The present invention has important theoretical and actual in the clinical treatment of malignant tumour and application
Meaning has a extensive future.
Description of the drawings
Fig. 1 is the structure diagram of the AAV/MAGE-A3 carriers of the specific embodiment of the invention.
Fig. 2 is the structure AAV/MAGE-A3 carriers of the specific embodiment of the invention and prepares with infective AAV/
The flow chart of the viral vectors of MAGE-A3.
Fig. 3 is the PCR qualification result figures of the AAV/MAGE-A3 carriers of the specific embodiment of the invention.
Fig. 4 is the MAGE-A3 antigen gene sequences and U.S. NCBI Gene obtained in the specific embodiment of the invention
The comparison diagram for the gene order that Bank is announced.
Fig. 5 is the virus titer testing result figure of the viral vectors of the AAV/MAGE-A3 of the specific embodiment of the invention.
The viral vector infection tumor patient monocyte that Fig. 6 is the AAV/MAGE-A3 of the specific embodiment of the invention is
The killing tumour cell experiment flow figure on basis.
Fig. 7 a-7d are respectively the disease of the AAV/MAGE-A3 respectively containing different promoters of the specific embodiment of the invention
The Efficiency testing result figure of poisonous carrier infection Dendritic Cells (DC).
Fig. 8 a-8c are respectively the DC expression of the viral vector infection of the AAV/MAGE-A3 of the specific embodiment of the invention
The testing result figure of CD80, CD83 and CD86 level.
The CTL that Fig. 9 is induced by the DC of the viral vector infection of the AAV/MAGE-A3 of the specific embodiment of the invention is killed
The tumour cell of MAGE-A3 antigen positives and killing specific detection result figure.
Figure 10 is virus load of the 4 non-small cell patients with lung adenocarcinoma of the specific embodiment of the invention through AAV/MAGE-A3
After the CTL treatments that the DC of body-sensing dye is induced in serum cyfra21-1 antigen levels situation of change schematic diagram.
Specific embodiment
Below against attached drawing and with reference to preferred embodiment, the invention will be further described.
Inventor is successfully by the AAV-2 in the pBR322 plasmids (pBR-AAV2) for carrying AAV-2 complete genome DNAs
The entire infrastructure gene elmination including rep and cap genes, retain and end repeated fragment and p5 promoters or only protect
End repeated fragment is stayed, and is inserted into oligonucleotides segment, to improve the stability of the efficiency of rAAV DNA replication dnas and rAAV, thus
Obtain the basic framework of AAV-2 carriers.The AAV-2 carriers applied have p5 promoters, and MAGE-A3 antigen genes are inserted into it
In.To improve the transcriptional level of MAGE-A3 antigen genes, also the MAGE-A3 antigen genes can be inserted into the structure that succeeded
Promoter is cytomegalovirus (CMV) promoter, vacuolating virus of monkey 40 (SV40) early promoter, beta-actin promoter take
In the generation AAV-2 carriers of p5 promoters namely the recombined glandulae correlation viral vectors of the carrying MAGE-A3 antigen genes of the present invention
Promoter be p5 promoters or CMV promoter or beta-actin promoter or SV40 early promoters.It is in addition, basic herein
On be successfully prepared for that there is infective rAAV virions (referring to Chinese patent ZL201110125683.X), it is new to develop
RAAV products lay a good foundation.
MAGE-A3 antigens are distributed widely in Several Kinds of Malignancy, and in the normal tissue (except testis and placenta tissue)
It does not express.The antigen gene is located at people X chromosome q28 areas, and containing 3 extrons, the molecular weight of the protein of coding is
48000.It is made of 314 amino acid.At least 5 MHC-I quasi-molecules restricted epitopes and 6 in its protein molecule
MHC-II quasi-molecule restricted epitopes.Its information submission is given to T lymphocytes by corresponding MHC molecule, is directed to so as to generate
The specific cell immunoreaction of MAGE-A3.The antigen be recognized be cellular immunotherapy a preferable target antigen.
The present invention AAV/MAGE-A3 carriers be inventor succeeded structure AAV-2 carriers skeleton in insert
Enter MAGE-A3 antigen genes and obtain recombined glandulae correlation viral vectors, include plasmid vector with the relevant product of the carrier, virus carries
Body and cell line.Wherein, MAGE-A3 is tumor associated antigen genes.
Method therefor is conventional method unless otherwise instructed in following embodiments, and specific steps can be found in：
《Molecular Cloning:A Laboratory Manual》(Sambrook, J., Russell, David W.,
Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring
Harbor)。
The primer, DNA sequence dna synthesis and determined dna sequence are completed by Life Technologies companies of the U.S..
Embodiment 1, the structure of AAV/MAGE-A3 carriers and identification
First, material and its source：
1. four kinds of AAV 2 type (AAV-2) pBR322 plasmids (pBR-AAV2) with different promoters：It is built by inventor
(referring to Chinese patent ZL201110125683.X, the reconstruction of 0056~0059 section of pBR-AAV2 plasmid, PCR amplification start for success
Son, the medium content of pBR-AAV2 plasmids by the promoter insertion reconstruction of amplification).Four kinds of promoters are respectively that AAV p5 start
Son, CMV promoter, SV40 early promoters and people's beta-actin (β-actin) promoter.The characteristics of plasmid, is complete for both ends
Whole end Repeat (TR) sequence, or at the 75th nucleotide sequence of both ends TR it is inserted into 9 nucleotide respectively
The segment of CTGCGCTGG compositions, it is therefore an objective to the stability for improving restructuring AAV viral (rAAV) and the duplication effect for improving virus
Rate, and eliminated the structural gene including replication protein gene (rep) and envelope protein gene (cap) of AAV-2.
2. people's melanoma cancer tissue：From the cancerous tissue of surgery excision, immunohistochemistry turns out to be MAGE-A3 antigens
It is positive.
3. gene magnification nucleotide primer：According to the human melanoma antigen-A3 openly delivered in U.S.'s gene pool
(MAGE-A3) gene order design (U.S.'s NCBI gene pools：BC000340).
2nd, the recombined glandulae correlation viral vectors (as illustrated in fig. 1 and 2) that the present embodiment carries MAGE-A3 antigen genes are built.
The construction method that the present embodiment is provided is using the method for conventional genetic recombination, uses restriction enzyme
First AAV-2 carrier frameworks DNA is cut off, then with DNA interconnection techniques, by specific antigen gene MAGE-A3 with being cut off
AAV-2 carrier DNAs are attached, and obtain AAV/MAGE-A3 carriers.Detailed process comprises the following steps：
1. obtaining total cDNA, specific method is：It is obtained using Trizol reagents (production of Life Technology companies of the U.S.)
Take total mRNA of tumor tissues.After the melanoma cancer tissue of MAGE-A3 antigen positives is milled repeatedly first, 5ml is added in
Trizol is operated according to its specification.It is secondary with the washing of 75% (V/V) ethyl alcohol after centrifugation obtains supernatant, add nothing
Water-ethanol, centrifugation.Concentration is adjusted to 10ng/ μ l, it is molten to be obtained total mRNA by sediment (i.e. total mRNA) with deionized water dissolving
Liquid.Using the total mRNA solution of 10 μ l as template, reverse transcription reaction is carried out, synthesizes total cDNA, the reaction system of reverse transcription reaction is with 25 μ
Exemplified by l, including：0.5 μ g oligo (dT) 15 (Promega companies of the U.S.), 0.5mM dNTPs (Promega companies of the U.S.) with
And 200U M-MLV reverse transcriptases (Promega companies of the U.S.).Reaction condition be 37 DEG C, 1 it is small when, obtain total cDNA.
2. obtaining MAGE-A3cDNA, specific method is：Total cDNA is in (such as SEQ ID NO of primer 1:1)：
GTGCTCAGACTCACTCTT and primer 2 (such as SEQ ID NO:2)：PCR expansions are carried out under the guiding of AGTCATCATGCCTCTTGA
Increase, obtain MAGE-A3cDNA.PCR amplification condition is：First 94 DEG C 4 minutes；94 DEG C 30 seconds again, 60 DEG C 35 seconds, 72 DEG C 70 seconds, altogether
30 Xun Huans；It is last 72 DEG C 8 minutes, after reaction, to PCR product carry out 1.2% (W/V) agarose gel electrophoresis detection,
Occurs an expected specific band at 962bp, it is 962bp's to recycle and obtain length after purification the purpose band
MAGE-A3cDNA (such as SEQ ID NO:3) the PCR testing results of constructed AAV/MAGE-A3 carriers, knot, are illustrated in figure 3
Fruit shows that MAGE-A3cDNA is successively inserted into AAV-2 carriers, wherein 1 represents DNA molecular amount standard, 2-5 is 4 positive colonies.Again
Determined dna sequence is carried out, nucleotide sequence is as shown in figure 4, the MAGE-A3cDNA sequences that recombinant adeno-associated virus (rAAV) carries
The gene order 99% of row and the U.S. NCBI Gene Bank MAGE-A3 announced is homologous, further proves PCR amplification
MAGE-A3 antigen gene sequences are correct.
3. build AAV/MAGE-A3 carriers：Respectively to the pBR-AAV2 plasmids and MAGE- of 4 kinds of different promoters of carrying
After A3cDNA carries out digestion with restriction enzyme respectively, DNA coupled reactions are carried out.Restriction enzyme used is purchased from U.S.
Promega companies of state.Endonuclease reaction system is：1 μ g pBR-AAV2 plasmids or MAGE-A3cDNA；10U restriction enzymes
BamHI and PstI (being purchased from Promega companies of the U.S.), 2.5 μ 10 × buffer solutions of l C and 19.5 μ l deionized waters；Reaction condition
For：When water-bath 4 is small at 37 DEG C.Coupled reaction system is：PBR-AAV2 plasmids after 500ng digestions, after 300ng digestions
MAGE-A3cDNA, 10IU T4DNA ligase (is purchased from Promega companies of the U.S.), 1.5 10 × T of μ l4DNA connection buffer solutions with
And 11.5 μ l deionized waters；Reaction condition is：At 4 DEG C 8 it is small when.Respectively obtain the p5 promoters and MAGE- for carrying AAV
The recombined glandulae correlation viral vectors of A3cDNA, the recombined glandulae correlation viral vectors for carrying CMV promoter and MAGE-A3cDNA,
It carries the recombined glandulae correlation viral vectors of SV40 early promoters and MAGE-A3cDNA and carries beta-actin and open
The recombined glandulae correlation viral vectors of mover and MAGE-A3cDNA.
4. the AAV/MAGE-A3 carriers after connection are directed respectively into gene engineering colibacillus (E.coli) DH5 α competence
Cell (Invitrogen companies of the U.S.) carries out resistance screening, picking with the LB tablets containing 100 μ g/mL ampicillins (Amp)
White single bacterium colony is extracted plasmid and is purified, obtains the plasmid vector of substantial amounts of AAV/MAGE-A3.
3rd, the identification of the plasmid vector of recombinant adeno-associated virus
1.PCR is identified：PCR amplification is carried out under guiding using the above-mentioned primer 1 and primer 2 referred to, can amplify
Existing MAGE-A3cDNA is standard of perfection.PCR amplification condition and reaction system are identical as the above-mentioned.After reaction, it is right
PCR product carries out the detection of 1.2% (W/V) agarose gel electrophoresis, and occurring a specific band at 962bp can be determined as
The plamid vector construction success of AAV/MAGE-A3.The purpose band is recycled and obtains length after purification as 962bp MAGE-
A3cDNA (as shown in Figure 3).
2.DNA sequencings:AAV/MAGE-A3 is subjected to determined dna sequence.The nucleotide sequence of its sequencing result is as schemed
Shown in 4, the plasmid vector success of structure AAV/MAGE-A3 is further proved.
Embodiment 2, recombinant adeno-associated virus (rAAV) viral vectors preparation and virus titer measure (such as Fig. 2,5 institutes
Show)
Material and its source：
A. the AAV/MAGE-A3 carriers that embodiment 1 is built.
B. the helper plasmid pHelper of the Rep genes containing AAV and Lip/Cap genes：By medical college of University of Arkansas of the U.S.
Affiliated hospital Gene Therapy Center Liu Yong structures (Liu, Y., Chiriva-Internati, M., Grizzi, F.Salati, E.,
Roman,J.J.,Lim S.,andHermonat,P.L.Rapid induction of cytotoxic T cell
response against cervical cancer cells by human papillomavirus type
16E6antigen gene delivery into human dendritic cells by an adeno-associated
virus vector.Cancer Gene Therapy 8:948-957.)。
C. containing being integrated in cell chromosome and express the AAVp of adenoviral gene (E1, E2A, E4, VAI and VAII gene)
Cell line：(Liu, Y., Chiriva- are established by University of Arkansas of U.S. hospital attached to a medical college Gene Therapy Center
Internati,M.,Grizzi,F.Salati,E.,Roman,J.J.,Lim S.,andHermonat,P.L.Rapid
induction of cytotoxic T cell response against cervical cancer cells by human
papillomavirus type 16E6antigen gene delivery into human dendritic cells by
an adeno-associated virus vector.Cancer Gene Therapy 8:948-957.)。
D. lipofectamine Lipofectin：Purchased from Invotrogen companies of the U.S..
E.DMEM culture mediums and hyclone (or calf serum)：Purchased from Cellgro companies of the U.S..
F.PCR DIG labelling kits and DIG hybridization check kits：Purchased from Roche companies of Switzerland.
G.DNA copy number standards：Respectively 6X109Copy number (copies)/μ l to 6X1010Copy number (copies)/μ l,
Purchased from Promega companies of the U.S..
First, the preparation of the viral vectors of recombinant adeno-associated virus (rAAV)
With reference to Fig. 2, with following methods Prepare restructuring adeno-associated virus (rAAV), to prepare a disk 10.0cm Tissue Culture Dish
Virus exemplified by, when AAVp cells are grown in carbon dioxide cell incubator accounts for culture dish area 70%, carry out such as
Lower operation：
A. operated according to the operation instruction of Lipofectin：By the plasmid vector of 1.0 μ g AAV/MAGE-A3,1.0 μ
The DMEM of g pHelper plasmids, 4.0 μ l Lipofectin and 50.0 μ l containing 5% (V/V) hyclone (or calf serum) is trained
Base mixing is supported, is stored at room temperature 20 minutes.
B. mixed liquor is added in Tissue Culture Dish, continues to be placed in carbon dioxide cell incubator and cultivate.
C.72 after when small, all cells and culture solution in culture dish are harvested.
D. after acutely vibrating 1 minute, centrifugation retains supernatant, i.e. rAAV virus liquids.
E. by the rAAV virus liquid filtration sterilizations of collection.By carrying tumor antigen gene-human melanoma antigen of acquisition
The rAAV viral nomenclatures of full length gene MAGE-A3cDNA are the viral vectors of AAV/MAGE-A3.
2nd, the virus titer of the viral vectors of AAV/MAGE-A3 measures
Using conventional spot hybridization, to the viral vectors progress virus titer for the AAV/MAGE-A3 that step 1 obtains
It measures, specific method comprises the following steps：DNA probe only used is the specific probe for MAGE-A3 genes.
A. using conventional DNA phenol/chloroform extraction methods, extraction rAAV virions DNA.
B. nylon membrane is placed in Dot blot instrument, adds in the rAAV virion DNA through alkaline denaturation, and add in DNA and copy
Shellfish number standard, vacuumizes.
C. after taking out nylon membrane drying, ultraviolet light is fixed.
D. the specific probe of DIG marks is prepared with PCR DIG labelling kits and with reference to kit specification, probe is
" MAGE-A3cDNA obtained in embodiment 1 ".After PCR amplification, 1.2% (W/V) agarose is carried out to pcr amplification product
Gel electrophoresis detects pcr amplification product, positive band as a result occurs under ultraviolet light, shows that probe marks successfully.
E. with DIG hybridization checks kit and with reference to kit specification, rAAV viral DNAs are carried out in hybrid heater
DNA hybridization.The virus titer testing result of the viral vectors of AAV/MAGE-A3 is as shown in figure 5, the virus load of AAV/MAGE-A3
The virus titer of body is at least 6X1010Copy number/ml.
Embodiment 3, the viral vectors of AAV/MAGE-A3 import the killing tumor experiment of monocyte-Dendritic Cells system
Material and its source：
The viral vectors of A.rAAV：The viral vectors of AAV/MAGE-A3.
B.AIM-V cell culture mediums：Purchased from Life Technologies companies of the U.S..
C. cell factor：Granulocyte colony stimulating factor (GM-CSF), interleukin 2,4,7 (IL-2,4,7) and tumour
Necrosin (TNF-α) is purchased from R＆D companies of the U.S..
The primary tumor cell of the D.MAGE-A3 positives：The separated maligna element respectively from the tumor tissues of patient
Oncocyte, lung adenocarcinoma cell and breast cancer cell.
E.MAGE-A3 positive cell strains：A375 melanoma cell strains are obtained from American tissue cell storage center (ATCC)
.
F.MAGE-A3 feminine gender primary cells：Skin epithelial cell, lung, the mammary glandular cell of antigen negative, obtain from ATCC.
First, tumor experiment step is killed
It as shown in fig. 6, will be based on the viral vector infection tumor patient monocyte of the AAV/MAGE-A3 of the present invention
The whole process for killing tumor experiment comprises the following steps：
A. 50-150 milliliters of peripheral bloods of tumor patient are taken, it is routinely square with haemocyte separator (or lymphocyte separation medium)
Method obtains peripheral blood mononuclear cells (PBMC), after AIM-V culture medium mixings, adds in Tissue Culture Flask, is placed in constant temperature dioxy
When culture 2 is small in change carbon incubator.
B. suspension cell is removed, retains attached cell (monocyte, monocyte, Mo).Suspension cell, that is, periphery blood strangury
Bar cell, by it with after AIM-V culture medium mixings, continuing to cultivate spare.Monocyte is Dendritic Cells (Dendritic
Cells, DC) precursor cells, through the cell in vitro factor induction become DC.
C. the viral vectors for the AAV/MAGE-A3 that the embodiment of the present invention 2 obtains is added in monocyte, addition is
100~1000MOI (in this example be 100MOI), while add GM-CSF (800IU/mL), continue culture 4 it is small when.
D. remove the old culture medium of step C, supplement containing GM-CSF, IL-4 (800IU/mL) and TNF-α (20IU/mL)
AIM-V culture mediums continue to cultivate.
E. after cultivating 5 days, ripe DC is harvested, and is mixed with the peripheral blood lymphocytes cultivated, in AIM-V culture mediums
Middle addition IL-2 (20IU/mL) and IL-7 (500IU/mL), continue to cultivate.
F. cultivate to after 7-9 days, the cytotoxic T lymphocyte (CTL) for harvesting activation is detected.
2nd, the feature and Function detection of Dendritic Cells (DC)
The Efficiency testing of the viral vector infection Dendritic Cells of A.AAV/MAGE-A3
Decoration method is marked using conventional fluorescence antibody, (U.S. BD is purchased from the specific fluorescent antibody for MAGE-A3
Company) the above-mentioned acquisition of mark the viral vector infection by AAV/MAGE-A3 of the present invention Dendritic Cells (DC), then flowed
Formula cell technology detects the quantity of positive cell.The Flow Cytometry of the efficiency of the viral vector infection DC of AAV/MAGE-A3
For testing result as shown in Fig. 7 a-7d, the promoter in Fig. 7 a-7d is respectively p5 promoters, CMV promoter, SV40 early stage startups
Son and beta-actin promoter, the efficiency for infecting DC is respectively 91.5%, 92.1%, 88.35%, 87.0%.It prompts about
90 percent DC can express MAGE-A3 antigens, it was demonstrated that the viral vectors of rAAV of the invention has higher efficiency of infection
And DC intake antigen efficiency.
B. the detection of the CD molecular levels of Dendritic Cells (DC)
The level and the function of DC of DC expression CD80, CD83 and CD86 are proportionate.With the detection side identical with step A
The antibody (purchased from U.S. company BD) for these three CD molecules of fluorescent marker is respectively adopted to the quilt sheet of above-mentioned acquisition in method
The streaming for inventing the horizontal progress routine of DC expression CD80, CD83 and CD86 of the viral vector infection of AAV/MAGE-A3 is thin
Born of the same parents' technology detects.The Flow Cytometry testing result of the expression of tri- kinds of CD molecules of CD80, CD83 and CD86 such as Fig. 8 a-
Shown in 8c, by the CD molecular levels expressed by the DC of the viral vector infection of AAV/MAGE-A3, higher (expression efficiency is respectively
70.1%th, 50.6% and 81.0%).As a result after the constructed viral vector infection DC with the AAV/MAGE-A3 prepared of prompting, institute
The DC of induction stimulates Th1 to react, i.e., cell immune response is powerful.
3rd, cytotoxic T lymphocyte (CTL) killing tumor cell is tested
It, will be by AAV/MAGE-A3 after the DC of the viral vector infection of AAV/MAGE-A3 is mixed with lymphocyte
The cytotoxic T lymphocytes (Cytotoxic T lymphocytes, CTL) that are induced of DC of viral vector infection press 20:
1 (lymphocyte:Tumour cell or lymphocyte:Normal cell) resist with the tumour cell or MAGE-A3 of MAGE-A3 antigen positives
After former negative mixing with cells, using traditional51Cr (chromium -51) fragmentation test detects the activity of CTL killing tumor cells and kills
Wound specificity.Wherein51The cell that the DC of the viral vector infection of Cr (chromium -51) fragmentation test detection AAV/MAGE-A3 is induced
The tumour cell of toxic T lymphocyte (CTL) killing MAGE-A3 antigen positives and killing specific detection result such as Fig. 9 institutes
Show, the cell results as depicted that kill are to repeat 6 average values obtained of the experiment.The result shows that by the present invention's
The CTL that the DC of the viral vector infection of AAV/MAGE-A3 is induced can effectively crack the tumour of (killing) MAGE-A3 positives
Cell, including melanoma cells, lung carcinoma cell, breast cancer cell and A375 cell lines, killed tumour cell averagely exists
More than 70%.Using the skin epithelial cell of MAGE-A3 antigen negatives, pneumonocyte, mammary glandular cell cell as control, then with above-mentioned
The specificity for the CTL killings that the DC that identical method detects the above-mentioned viral vector infection by AAV/MAGE-A3 is induced.Detection
The results are shown in Figure 9, by (induced CTL pairs of the DC of the viral vector infection of AAV/MAGE-A3 that the present invention is built and is prepared
The cell of these MAGE-A3 antigen negatives is without lethal effect, it was demonstrated that by the virus of present invention structure and the AAV/MAGE-A3 prepared
The CTL that are induced of DC of carrier infection have an antigentic specificity, i.e., to the cell of antigen negative without lethal effect, it was demonstrated that the killing
Antigentic specificity of the effect with height complies fully with the feature of the lethal effect of CTL..
Summary testing result, it was demonstrated that built and prepared the restructuring gland phase for carrying MAGE-A3 antigen genes by the present invention
The CTL that the DC of the viral vector infection of pass virus is induced there is apparent cracking (to kill the tumour cell of the MAGE-A3 positives
Wound) effect, available for preparing antitumor drug.
Embodiment 4, the clinical test of oncotherapy
The present embodiment provides a kind of recombined glandulae correlation viral vectors or its Related product for carrying MAGE-A3 antigen genes
Application in antitumor drug is prepared, the especially application in the malignant tumor medicine of the anti-MAGE-A3 positives, wherein
The malignant tumour of the MAGE-A3 positives includes but not limited to melanoma, lung cancer, breast cancer and intestinal cancer of the MAGE-A3 positives etc..
The active ingredient of antitumor drug for above-mentioned carrying MAGE-A3 antigen genes recombined glandulae correlation viral vectors or with
Carry the relevant product of recombined glandulae correlation viral vectors of MAGE-A3 antigen genes.The dosage forms such as solvent or pulvis can be used in drug.
The selection of the solvent is diversified, such as cell culture fluid (base), physiological saline or phosphate buffer.It needs
When, one or more pharmaceutically acceptable carriers can also be added in said medicine, the carrier may include pharmacy
Diluent, sorbefacient and surfactant of field routine etc..
Application method can be first to isolate the in vivo monocyte of tumor patient, then the viral vectors by AAV/MAGE-A3
Infection transfects the monocyte of patient or the Dendritic Cells for converting the maturation for having MAGE-A3 antigen genes is stimulated production
Raw cytotoxic T lymphocyte feeds back tumor patient.To improve curative effect, said medicine can also be with antibiotic, immunostimulation
Agent and tumor-targeting drug etc. are combined treatment.
The present embodiment also provides a kind of method of killing in vitro tumour, comprises the following steps：
It 1) will be natural in system where tumour (system can be generated by way of manual simulation or tumor patient body in)
Monocyte-Dendritic Cells of generation by the viral vector infection of AAV/MAGE-A3 or transfection or by with AAV/MAGE-A3
The relevant product treatment of carrier, the cell that each obtains that treated；
2) tumour is killed in system where treated in step 1) monocyte-Dendritic Cells being added in tumour；Or
By not processed T lymphocytes with described treated that monocyte-Dendritic Cells is mixed to form antigentic specificity
Cytotoxic T lymphocyte, then the Antigen-specific cytotoxic T lymphocyte is added in the system of tumour place to kill and is swollen
Knurl；Or processed T lymphocytes and not processed monocyte-Dendritic Cells is added in the system of tumour place and is killed
Tumour.
That is, giving tumor patient feeds back MAGE-A3 Antigen-specific cytotoxic T lymphocytes, the cell by
Spontaneous T lymphocytes from patient are produced with the monocyte from the patient-Dendritic Cells mixed culture
Raw.Before mixed culture, these have carried MAGE-A3 antigen genes in monocyte-Dendritic Cells by the present invention
Recombinant adeno-associated virus viral vector infection or transfection or by with the relevant production of recombined glandulae correlation viral vectors of the present invention
Product processing；Alternatively, giving a tumor patient feeds back the monocyte-Dendritic Cells for deriving from patient.Before feedback, this
The virus of the recombinant adeno-associated virus of MAGE-A3 antigen genes is carried by the present invention in monocyte-Dendritic Cells a bit
Carrier infect or transfection or by with the relevant product treatment of recombined glandulae correlation viral vectors of the present invention.
It is specially in this example：By in embodiment 3 by the viral vector infection of AAV/MAGE-A3 from the separated tree of tumor patient
The cytotoxic T lymphocyte (CTL) that prominent shape cell (DC) is induced feeds back 4 non-small cell patients with lung adenocarcinoma.
Infused cells number is 1 × 108-5×108(in this example, infusion amount is 100 μ l/5 × 10 to a CTL cells6A monokaryon is thin
Born of the same parents/every time).Treatment course：Usually 6 months, monthly 2 times, the state of an illness can be kept to monthly 1 time after improving, and can be further kept to every
It treats the 1-3 months 1 time (dosage and the course for the treatment of can all be adjusted according to actual conditions).Therapeutic effect is resisted with the serum cyfra21-1 of patient
Former is substantially reduced as criterion.Figure 10 is viral vectors sense of 4 non-small cell patients with lung adenocarcinoma through rAAV/MAGE-A3
The situation of change of serum cyfra21-1 antigen levels after the CTL treatments that the DC of dye is induced.Face by the research of 6 months
Bed therapeutic test observation, as shown in the figure, the results showed that the serum cyfra21-1 levels of patient are decreased obviously or even recover normal.
The effect of certain, can be played in patient's body by the DC of the viral vector infection of the rAAV of the present invention CTL induced, can be had
Effect ground reduces the level of serum cyfra21-1 antigens or even it is made to turn out cloudy, and without patient over the course for the treatment of without apparent poison
Side effect occurs.The result of the test show the CTL prepared by this kind of technology not only there is the effect of certain and also security compared with
Height, available for preparing antitumor drug.
Industrial applicability
It is demonstrated experimentally that by the Dendritic Cells of the viral vector infection of MAGE-A3 recombinant adeno-associated virus of the present invention and institute
The cytotoxic T lymphocyte of induction can effectively inhibit the growth of associated malignancies cell in patient's body or kill swollen
Oncocyte, thus, MAGE-A3 recombined glandulae correlation viral vectors of the invention or with MAGE-A3 recombinant adeno-associated virus of the present invention
The relevant product of carrier can be used for preparing antitumor drug, malignant tumour as but be not limited to melanoma, lung cancer, breast cancer and
Have great importance in the clinical treatment of intestinal cancer etc. and application.
The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, it is impossible to assert
The specific implementation of the present invention is confined to these explanations.For those of ordinary skill in the art to which the present invention belongs, exist
Several replacements or apparent modification are made on the premise of not departing from present inventive concept, and performance or purposes are identical, should all be considered as
It belongs to the scope of protection of the present invention.
Claims (5)
1. a kind of recombined glandulae correlation viral vectors for carrying MAGE-A3 antigen genes, it is characterised in that：It is to carry adeno-associated virus
The structural gene of adeno-associated virus in body replaces with the recombined glandulae correlation viral vectors that MAGE-A3 antigen genes obtain；It is described
The construction method of recombined glandulae correlation viral vectors comprises the following steps：
1）Reconstruct 2 type pBR322 plasmids of AAV-：Use restriction enzymeBst98 IWithHpa IBy AAV-2 type pBR322 matter
Structural gene excision in AAV-2 type adeno-associated viruses in grain, then will contain restriction enzymeEcoR IWithEcoR V
The nucleotide sequence CGAATTCATGCGATATCGTT of restriction enzyme site is inserted into the AAV -2 types pBR322 plasmids, retains two
The TR sequences at end at the 75th nucleotide sequence of the complete TR sequences in both ends are inserted into what is be made of 9 nucleotide respectively
Segment：CTGCGCTGG；
2）By promoter inserting step 1）In the AAV-2 type pBR322 plasmids of obtained reconstruction, structure carries promoter
AAV-2 type pBR322 plasmids；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus open
Mover, beta-actin promoter and SV40 early promoters；
3）MAGE-A3 cDNA are obtained, are comprised the following steps：31）It is extracted from the tumor tissues of MAGE-A3 antigen positives total
MRNA carries out reverse transcription reaction by total mRNA, synthesizes total cDNA；32）Using total cDNA as template, in primer 1：
GTGCTCAGACTCACTCTT and primer 2：PCR amplification is carried out under the guiding of AGTCATCATGCCTCTTGA, obtains sequence such as SEQ
ID NO:The MAGE-A3 cDNA shown in 3；
4）By step 2）The AAV-2 type pBR322 plasmids and step 3 for carrying promoter of structure）Obtained MAGE-A3
CDNA uses restriction enzyme respectivelyBamHI andPstI carries out digestion, then carries out DNA coupled reactions, obtains carrying described
The recombined glandulae correlation viral vectors of promoter and MAGE-A3 antigen genes.
2. a kind of construction method for the recombined glandulae correlation viral vectors for carrying MAGE-A3 antigen genes, it is characterised in that：By gland phase
The structural gene for closing the adeno-associated virus in viral vectors is rejected, and MAGE-A3 antigen genes are then inserted on the position of rejecting,
Obtain recombined glandulae correlation viral vectors；Comprise the following steps：
1）Reconstruct 2 type pBR322 plasmids of AAV-：Use restriction enzymeBst98 IWithHpa IBy AAV-2 type pBR322 matter
Structural gene excision in AAV-2 type adeno-associated viruses in grain, then will contain restriction enzymeEcoR IWithEcoR V
The nucleotide sequence CGAATTCATGCGATATCGTT of restriction enzyme site is inserted into the AAV -2 types pBR322 plasmids, retains two
The TR sequences at end at the 75th nucleotide sequence of the complete TR sequences in both ends are inserted into what is be made of 9 nucleotide respectively
Segment：CTGCGCTGG；
2）By promoter inserting step 1）In the AAV-2 type pBR322 plasmids of obtained reconstruction, structure carries promoter
AAV-2 type pBR322 plasmids；The promoter is one kind in following four kinds of promoters：P5 promoters, cytomegalovirus open
Mover, beta-actin promoter and SV40 early promoters；
3）MAGE-A3 cDNA are obtained, are comprised the following steps：31）It is extracted from the tumor tissues of MAGE-A3 antigen positives total
MRNA carries out reverse transcription reaction by total mRNA, synthesizes total cDNA；32）Using total cDNA as template, in primer 1：
GTGCTCAGACTCACTCTT and primer 2：PCR amplification is carried out under the guiding of AGTCATCATGCCTCTTGA, obtains sequence such as SEQ
ID NO:The MAGE-A3 cDNA shown in 3；
4）By step 2）The AAV-2 type pBR322 plasmids and step 3 for carrying promoter of structure）Obtained MAGE-A3
CDNA uses restriction enzyme respectivelyBamHI andPstI carries out digestion, then carries out DNA coupled reactions, obtains carrying described
The recombined glandulae correlation viral vectors of promoter and MAGE-A3 antigen genes.
3. a kind of relevant product of recombined glandulae correlation viral vectors with carrying MAGE-A3 antigen genes, it is characterised in that：
The product is selected from the virus load of the plasmid vector of MAGE-A3 recombinant adeno-associated virus, MAGE-A3 recombinant adeno-associated virus
Body or by the viral vector infection of the MAGE-A3 recombinant adeno-associated virus or the cell line of transfection；
The plasmid vector of the MAGE-A3 recombinant adeno-associated virus is by a kind of carrying MAGE-A3 antigenic sites described in claim 1
MAGE-A3 antigen genes are carried made from construction method described in the recombined glandulae correlation viral vectors or claim 2 of cause
Recombined glandulae correlation viral vectors are made；The viral vectors of the MAGE-A3 recombinant adeno-associated virus recombinates gland by the MAGE-A3
The plasmid vector of correlated virus carries out cell culture and obtains.
4. a kind of recombined glandulae correlation viral vectors with carrying MAGE-A3 antigen genes according to claim 3 are relevant
The preparation method of product, it is characterised in that：
The preparation of the plasmid vector of MAGE-A3 recombinant adeno-associated virus：It will a kind of carrying MAGE-A3 as described in claim 1
Construction method carrying MAGE-A3 antigens obtained described in the recombined glandulae correlation viral vectors or claim 2 of antigen gene
The recombined glandulae correlation viral vectors quiding gene engineering colon bacillus DH5 α competent cells of gene, with containing 100 μ g/mL ammonia benzyls
The LB tablets of penicillin carry out resistance screening, and picking white single bacterium colony is extracted plasmid and purified, and obtain MAGE-A3 restructuring gland phases
Close the plasmid vector of virus；
The preparation of the viral vectors of MAGE-A3 recombinant adeno-associated virus：It is carried with the plasmid of the MAGE-A3 recombinant adeno-associated virus
Body and pHelper plasmid co-transfection AAVp cells obtain the viral vectors of MAGE-A3 recombinant adeno-associated virus；
The preparation of the viral vector infection of MAGE-A3 recombinant adeno-associated virus or the cell line of transfection：It is recombinated with the MAGE-A3
The viral vector infection or transfection monocyte or Dendritic Cells of adeno-associated virus, the cell line include monocyte-tree
Prominent shape cell line.
5. a kind of recombined glandulae correlation viral vectors or claim 3 described in claim 1 for carrying MAGE-A3 antigen genes
Application of the Related product in antitumor drug is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510336313.9A CN105087648B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510336313.9A CN105087648B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087648A CN105087648A (en) | 2015-11-25 |
| CN105087648B true CN105087648B (en) | 2018-05-25 |
Family
ID=54568978
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510336313.9A Active CN105087648B (en) | 2015-06-17 | 2015-06-17 | The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087648B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753825A (en) * | 2018-06-11 | 2018-11-06 | 北京安斯晨睿生物科技有限公司 | The recombined glandulae correlation viral vectors and its construction method of carrying HER2/ERBB mutant antigen genes and application |
| CN108866098A (en) * | 2018-07-27 | 2018-11-23 | 北京安斯晨睿生物科技有限公司 | The recombined glandulae correlation viral vectors and its construction method of carrying MAGE-A4 mutant antigen gene and application |
| CN108949826A (en) * | 2018-07-27 | 2018-12-07 | 北京安斯晨睿生物科技有限公司 | The recombined glandulae correlation viral vectors and its construction method of carrying MAGE-A3 mutant antigen gene and application |
| AU2021360902A1 (en) | 2020-10-15 | 2023-04-27 | Aavocyte, Inc. | Recombinant adeno-associated virus vectors with cd14 promoter and use thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268457A (en) * | 2007-04-23 | 2011-12-07 | 核力康健生物医药技术(天津)有限公司 | Alpha-fetoprotein (AFP) recombinant adeno associated virus, and construction method and application thereof |
| CN104271748A (en) * | 2012-02-02 | 2015-01-07 | 得克萨斯州大学系统董事会 | Adenoviruses expressing heterologous tumor-associated antigens |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010037408A1 (en) * | 2008-09-30 | 2010-04-08 | Curevac Gmbh | Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof |
-
2015
- 2015-06-17 CN CN201510336313.9A patent/CN105087648B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268457A (en) * | 2007-04-23 | 2011-12-07 | 核力康健生物医药技术(天津)有限公司 | Alpha-fetoprotein (AFP) recombinant adeno associated virus, and construction method and application thereof |
| CN104271748A (en) * | 2012-02-02 | 2015-01-07 | 得克萨斯州大学系统董事会 | Adenoviruses expressing heterologous tumor-associated antigens |
Non-Patent Citations (1)
| Title |
|---|
| MAGE-A 基因亚家族及其在肿瘤临床上的应用前景;吕伟华等;《中国肿瘤生物治疗杂志》;20130430;第20卷(第2期);第242-246页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087648A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102268456B (en) | Her-2/neu recombinant adeno-associated virus vector and construction method as well as application thereof | |
| JP4860886B2 (en) | Double-stranded parvovirus vector | |
| CN105087648B (en) | The recombined glandulae correlation viral vectors and construction method of carrying MAGE-A3 antigen genes and application | |
| CN105985984B (en) | The recombined glandulae correlation viral vectors and construction method of carrying PAP antigen genes and application | |
| CN105087647B (en) | A kind of recombined glandulae correlation viral vectors carrying Survivin antigen genes and its construction method and application | |
| CN105018525B (en) | Carry HPV 16 saltant type E7m91The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| WO2016015684A1 (en) | Nrecombinant adeno-associated virus vector carrying human papillomavirus type 16 mutation e7 antigen gene, construction method therefor, and application thereof | |
| CN105087649B (en) | The recombined glandulae correlation viral vectors and construction method of carrying MUC-1 antigen genes and application | |
| CN105177048B (en) | Carry HPV 16 multipoint mutation type E7mmThe recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN105969804B (en) | A kind of recombined glandulae correlation viral vectors carrying SCC antigen genes and its construction method and application | |
| CN105177047B (en) | Carry HPV 16 saltant type E7m94The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN108546715A (en) | A kind of LMP-2 recombined glandulae correlation viral vectors and its construction method and application | |
| CN105316361B (en) | Carry HPV 16 saltant type E7m58The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN110684800B (en) | Recombinant adeno-associated virus vector carrying tumor-testis antigen 10 gene and application value thereof | |
| CN106282234A (en) | The recombined glandulae correlation viral vectors of the surface antigen S gene of carrier's C genotype hepatitis B virus and construction method thereof and application | |
| CN110885855A (en) | Recombinant adeno-associated virus vector carrying sperm protein 17 antigen gene and application value thereof | |
| CN114569709A (en) | Preparation method and application of melanoma autologous tumor vaccine with high ADAM-28 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20190904 Address after: 518000 Tongfang Information Port A Block 701, No. 11 Longshan Road, Songpingshan Community, Xili Street, Nanshan District, Shenzhen City, Guangdong Province Patentee after: Shenzhen Yishi Kangning Biomedical Development Co., Ltd. Address before: 518000 Unit 16, Kexing Science Park, No. 19 Keyuan Road, Nanshan District, Shenzhen City, Guangdong Province Co-patentee before: Liu Yong Patentee before: Health-Power Biological Medical Technology (Tianjin) Co., Ltd. |