CN104878094A

CN104878094A - Maize plant DBN9888 nucleic acid sequence for detecting weedicide tolerance and detection method thereof

Info

Publication number: CN104878094A
Application number: CN201510219905.2A
Authority: CN
Inventors: 康越景; 郭明欣; 刘海利; 张成伟; 丁德荣; 焦国伟; 魏雪松; 汤波; 夏祖灵; 熊冠军; 徐亮; 鲍晓明
Original assignee: BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2015-04-30
Filing date: 2015-04-30
Publication date: 2015-09-02
Anticipated expiration: 2035-04-30
Also published as: AR104437A1; CN104878094B; WO2016173540A1

Abstract

The invention relates to a maize plant DBN9888 nucleic acid sequence for detecting weedicide tolerance and a detection method thereof. The maize plant nucleic acid sequence comprises SEQ ID NO:1 or complementary sequence thereof, or SEQ ID NO:2 or complementary sequence thereof. The transgenic maize event DBN9888 has favorable tolerance to glyphosate weedicide and glufosinate-ammonium weedicide, and does not influence the yield. The detection method can accurately and quickly identify whether a biological sample comprises the DNA (deoxyribonucleic acid) molecule of the transgenic maize event DBN9888.

Description

For detecting nucleotide sequence and the detection method thereof of herbicide tolerant maize plant DBN9888

Technical field

The present invention relates to a kind of nucleotide sequence for detecting herbicide tolerant maize plant DBN9888 and detection method thereof, particularly relating to the maize plant DBN9888 of a kind of tolerate glyphosate and careless ammonium phosphine and detecting the method whether comprising the DNA molecular of specific transgenic corn events DBN9888 in biological sample.

Background technology

N-phosphonomethylglycine, also referred to as glyphosate, is the chronic wide spectrum steriland herbicide of a kind of inner sucting conduction type.Glyphosate is the competitive inhibitor of the synthesis substrate phosphoenolpyruvic acid (PEP) of 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS), these two kinds of substrates of PEP and 3-phosphoric acid shikimic acid can be suppressed under EPSPS catalysis to the conversion of 5-enol pyruvylshikimate-3-phosphoric acid shikimic acid, thus block the route of synthesis of die aromatischen Aminosaeuren synthesis precursor-shikimic acid, the synthesis of protein is interfered and causes plant and bacterial death.

Glyphosate tolerant can realize by expressing the EPSPS modified.The EPSPS modified has lower affinity to glyphosate, thus deposits in case at glyphosate, and EPSPS maintains their catalytic activity, namely obtains glyphosate tolerant.

Corn (Zea mays L.) in the world a lot of area is all main food crop.In Maize Production, herbicide tolerant is an important economical character, particularly to the tolerance of glyphosate herbicidal.Corn can make glyphosate herbicide tolerant type gene (EPSPS, CP4) express in maize plant by transgenic method to the tolerance of glyphosate herbicidal and obtain, such as corn event NK603, corn event MON88017 etc.

Glyphosate tolerant tillage systems generally adopt and day by day increasing of glyphosate use causes the popular of glyphosate-resistant weeds in recent years.Grower in the face of glyphosate-resistant weeds or the area to more unmanageable weed species transformation, grower can by mixing with other weedicide that can control to omit weeds or being used alternatingly the weakness compensating glyphosate.

Grass ammonium phosphine is a kind of non-systemic, nonselective herbicide in phosphinothricin class weedicide.Controlling after being mainly used in being unearthed of annual or perennial broadleaf weed, is control weeds by the irreversible suppression of L-phosphinothricin (activeconstituents in careless ammonium phosphine) to glutamine synthase (a kind of for the ammonia in plant detoxify required enzyme).To kill root different from glyphosate, and careless ammonium phosphine first kills leaf, can be conducted, between its quick-acting between Paraquat and glyphosate by plant transpiration effect at plant xylem.

The enzyme phosphinothricin N-acetyl transferring enzyme (PAT) be separated from streptomycete is converted into its inactive form by acetylize catalysis L-phosphinothricin.The gene of expressing the plant optimization form of PAT has used to give the tolerance of soybean to careless ammonium phosphine weedicide, such as soybean event A5547-127 in soybean.Therefore combinationally using careless ammonium phosphine weedicide with glufosinate tolerant proterties can as a kind of non-selective means of effective management glyphosate-resistant weeds.

Meanwhile, along with transgenic insect-resistant corn establishing in large scale, the insect/insect survived on a small quantity, after several generations breeding, may produce resistance.Herbicide-resistant transgenic maize, as non-pest-resistant transgenic corns, is planted with certain proportion in the lump with transgenic insect-resistant corn, can delay insect/insect and develop immunity to drugs.

The expression of known foreign gene in plant materials is subject to the impact of their chromosome position, may be because chromatin Structure (as heterochromatin) or transcription regulatory element (as enhanser) are close to integration site.For this reason, usually needing a large amount of event of screening just likely to identify can business-like event (target gene namely imported obtains the event of optimal expression).Such as, the expression amount having observed quiding gene in plant and other biological body may have very big-difference between event; The space of expressing or temporal mode may also there are differences, as relative expression genetically modified between different plant tissue there are differences, the present actual expression pattern of this difference table may be inconsistent with the expression pattern desired by the transcription regulatory element in the gene construct imported.Therefore, usually need to produce hundreds and thousands of individual different events and filter out from these events that there is transgene expression amount desired for the purpose of commercialization and the single incident of expression pattern.The event of the transgene expression amount and expression pattern with expection can be used for adopting conventional breeding methods transgenosis to be penetrated in other genetic backgrounds by sexual outcross.The offspring produced by this Crossing system maintains the transgene expression feature of original transformant.Apply this strategy pattern and can guarantee, in many kinds, there is reliable genetic expression, and these kinds well can adapt to local growth conditions.

The existence that can detect particular event will be useful to determine whether the offspring of sexual hybridization comprises goal gene.In addition, the method detecting particular event also will contribute to observing relevant laws and regulations, and the food such as deriving from restructuring farm crop needs obtain official approval and mark before putting goods on the market.It is all possible for detecting genetically modified existence by any polynucleotide detection method known, such as polymerase chain reaction (PCR) or utilize the DNA hybridization of polynucleotide probes.These detection methods concentrate on the genetic elements commonly used usually, such as promotor, terminator, marker gene etc.Therefore, unless the sequence of the chromosomal DNA (" flanking DNA ") adjacent with the transgenosis DNA inserted is that oneself knows, above-mentioned this method just can not be used for distinguishing different events, particularly those events produced by identical DNA construct.So the normal pair of primers spanning the transgenosis of insertion and the junction of flanking DNA that utilizes identifies transgenosis particular event by PCR at present, specifically comprises the first primer of flanking sequence and comprises the second primer of insertion sequence.

Summary of the invention

The object of this invention is to provide a kind of nucleotide sequence for detecting herbicide tolerant maize plant DBN9888 and detection method thereof, transgenic corn events DBN9888 has good tolerance to glyphosate herbicidal and careless ammonium phosphine weedicide, and whether detection method can comprise the DNA molecular of specific transgenic corn events DBN9888 quickly and accurately in identification of organism sample.

For achieving the above object, the invention provides a kind of nucleotide sequence, to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide and/or SEQ ID NO:4 or its complementary sequence.

Preferably, described nucleotide sequence comprises SEQ ID NO:1 or its complementary sequence and/or SEQ ID NO:2 or its complementary sequence.

Further, described nucleotide sequence comprises SEQ ID NO:3 or its complementary sequence and/or SEQ ID NO:4 or its complementary sequence.

Further, described nucleotide sequence comprises SEQ ID NO:5 or its complementary sequence.

Described SEQ ID NO:1 or its complementary sequence are be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 22 Nucleotide in transgenic corn events DBN9888, described SEQ ID NO:1 or its complementary sequence span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' end of insertion sequence, comprise the existence that described SEQ ID NO:1 or its complementary sequence can be accredited as transgenic corn events DBN9888.Described SEQ ID NO:2 or its complementary sequence are be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 22 Nucleotide in transgenic corn events DBN9888, described SEQ ID NO:2 or its complementary sequence span the DNA sequence dna of 3 ' end of insertion sequence and the flanking genomic DNA sequence of corn insertion point, comprise the existence that described SEQ ID NO:2 or its complementary sequence can be accredited as transgenic corn events DBN9888.

In the present invention, described nucleotide sequence can be at least 11 of any part of transgene insert sequence in described SEQ ID NO:3 or its complementary sequence or more continuously polynucleotide (the first nucleotide sequence), or be at least 11 of any part of 5 ' flank corn gene group DNA region in described SEQ ID NO:3 or its complementary sequence or more continuous polynucleotide (the second nucleotide sequence).Described nucleotide sequence further can for homology in or be complementary to a part of the described SEQ ID NO:3 comprising complete described SEQ ID NO:1.When the first nucleotide sequence uses together with the second nucleotide sequence, the DNA cloning method that these nucleotide sequences are producing amplified production comprises DNA primer group.When using DNA primer to be the amplified production comprising SEQ ID NO:1 to the amplified production produced in DNA cloning method, the existence of transgenic corn events DBN9888 or its offspring can be diagnosed.Well known to those skilled in the art, the first and second nucleotide sequences need not only be made up of DNA, also can comprise the mixture of RNA, DNA and RNA, or DNA, RNA or other is not as the Nucleotide of one or more polysaccharase templates or the combination of its analogue.In addition, probe described in the present invention or primer should be the length of at least about 11,12,13,14,15,16,17,18,19,20,21 or 22 continuous nucleotides, and it can be selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and the Nucleotide described in SEQ ID NO:5.When being selected from the Nucleotide shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, described probe and primer can be the continuous nucleotides of at least about 21 to about 50 or more for length.Described SEQ ID NO:3 or its complementary sequence are be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 960 Nucleotide in transgenic corn events DBN9888, described SEQ ID NO:3 or its complementary sequence are by the corn flanking genomic DNA sequence (the Nucleotide 1-693 of SEQ ID NO:3) of 693 Nucleotide, the DBN10006 construct DNA sequence (the Nucleotide 694-770 of SEQ ID NO:3) of 77 Nucleotide and pr35S promoter sequence 5 ' end DNA sequence (the Nucleotide 771-960 of the SEQ ID NO:3) composition of 190 Nucleotide, comprise the existence that described SEQ ID NO:3 or its complementary sequence can be accredited as transgenic corn events DBN9888.

Described nucleotide sequence can be at least 11 of any part of transgene insert sequence in described SEQ ID NO:4 or its complementary sequence or more continuously polynucleotide (the 3rd nucleotide sequence), or be at least 11 of any part of 3 ' flank corn gene group DNA region in described SEQ ID NO:4 or its complementary sequence or more continuous polynucleotide (the 4th nucleotide sequence).Described nucleotide sequence further can for homology in or be complementary to a part of the described SEQ ID NO:4 comprising complete described SEQ ID NO:2.When the 3rd nucleotide sequence uses together with the 4th nucleotide sequence, the DNA cloning method that these nucleotide sequences are producing amplified production comprises DNA primer group.When using DNA primer to be the amplified production comprising SEQ ID NO:2 to the amplified production produced in DNA cloning method, the existence of transgenic corn events DBN9888 or its offspring can be diagnosed.Described SEQ ID NO:4 or its complementary sequence are be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 753 Nucleotide in transgenic corn events DBN9888, described SEQ ID NO:4 or its complementary sequence are by the tNos terminator sequence (the Nucleotide 1-159 of SEQ ID NO:4) of 159 Nucleotide, the DBN10006 construct DNA sequence dna (the Nucleotide 160-272 of SEQ ID NO:4) of 113 Nucleotide and corn integration site flanking genomic DNA sequence (273-753 of the SEQ ID NO:4) composition of 481 Nucleotide, comprise the existence that described SEQ ID NO:4 or its complementary sequence can be accredited as transgenic corn events DBN9888.

The sequence of described SEQ ID NO:5 or its complementary sequence to be the length characterizing transgenic corn events DBN9888 be 5952 Nucleotide, its genome specifically comprised and genetic elements as shown in table 1.Comprise the existence that described SEQ ID NO:5 or its complementary sequence can be accredited as transgenic corn events DBN9888.

The genome that table 1, SEQ ID NO:5 comprise and genetic elements

Described nucleotide sequence or its complementary sequence can be used for produce amplicon in DNA cloning method, the existence of transgenic corn events DBN9888 or its offspring in the checkout and diagnosis biological sample of described amplicon; Described nucleotide sequence or its complementary sequence can be used in nucleotide detection method, to detect the existence of transgenic corn events DBN9888 or its offspring in biological sample.

For achieving the above object, present invention also offers a kind of method that DNA detecting transgenic corn events DBN9888 in sample exists, comprising:

Detected sample is contacted in nucleic acid amplification reaction with at least two kinds of primers;

Carry out nucleic acid amplification reaction;

Detect the existence of amplified production;

Described amplified production to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence.

Further, described amplified production to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described amplified production comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

In technique scheme, described primer comprises nucleotide sequence described at least one.

Particularly, described primer comprises the first primer and the second primer, and described first primer is selected from SEQ ID NO:8 and SEQ ID NO:10; Described second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.

Make detected sample and probes touch, described probe to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

Described detected sample and described probe are hybridized under stringent hybridization condition;

Detect the hybridisation events of described detected sample and described probe.

Described stringent condition can be in 6 × SSC (Trisodium Citrate), 0.5%SDS (sodium lauryl sulphate) solution, hybridizes, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time at 65 DEG C.

Further, described probe to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described probe has SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

Selectively, at least one fluorophor of probe described at least one marks.

Detected sample is contacted with marker nucleic acid molecule, and described marker nucleic acid molecule to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

Described detected sample and described marker nucleic acid molecule are hybridized under stringent hybridization condition;

Detect the hybridisation events of described detected sample and described marker nucleic acid molecule, and then by the analysis of marker assistant breeding to determine that glyphosate tolerant and/or glufosinate tolerant and marker nucleic acid molecule are chain on genetics.

Further, described marker nucleic acid molecule to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described marker nucleic acid molecule has SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

For achieving the above object, present invention also offers a kind of DNA detection test kit, comprise at least one DNA molecular, described DNA molecular comprises at least 11 continuous print Nucleotide in the homologous sequence of at least 11 continuous print Nucleotide or SEQ ID NO:4 in the homologous sequence of SEQ ID NO:3 or its complementary sequence or its complementary sequence, and it can have specific DNA primer or probe as transgenic corn events DBN9888 or its offspring.

Further, described DNA molecular to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

Further, described DNA molecular has the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or the homologous sequence of its complementary sequence or SEQ ID NO:7 or its complementary sequence.

For achieving the above object, present invention also offers a kind of vegetable cell, comprise the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen, the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or the sequence shown in SEQ ID NO:7.

For achieving the above object, present invention also offers a kind of generation has the milpa of tolerance method to glyphosate herbicidal, comprise and introduce the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

Particularly, the method that described generation has a milpa of tolerance to glyphosate herbicidal comprises:

To glyphosate herbicidal be had to transgenic corn events DBN9888 first parental maize plant of tolerance and lack the second parental maize plant sexual hybridization of glyphosate tolerant, thus produce a large amount of progeny plant;

With progeny plant described in glyphosate herbicidal process;

Select the described progeny plant of tolerate glyphosate.

For achieving the above object, present invention also offers a kind of generation has the milpa of tolerance method to careless ammonium phosphine weedicide, comprise and introduce the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

Particularly, described generation comprises the method that careless ammonium phosphine weedicide has the milpa of tolerance:

To careless ammonium phosphine weedicide be had to transgenic corn events DBN9888 first parental maize plant of tolerance and lack the second parental maize plant sexual hybridization of glufosinate tolerant, thus produce a large amount of progeny plant;

With progeny plant described in careless ammonium phosphine herbicide treatment;

Select the described progeny plant of tolerate glyphosate.

For achieving the above object, present invention also offers a kind of generation has the milpa of tolerance method to glyphosate herbicidal and careless ammonium phosphine weedicide, comprise the nucleotide sequence introducing encodes glyphosate tolerance EPSPS albumen in the genome of described milpa, the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7.

Particularly, described generation comprises the method that glyphosate herbicidal and careless ammonium phosphine weedicide have the milpa of tolerance:

To glyphosate herbicidal and careless ammonium phosphine weedicide be had to transgenic corn events DBN9888 first parental maize plant of tolerance and lack the second parental maize plant sexual hybridization of glyphosate and/or glufosinate tolerant, thus produce a large amount of progeny plant;

With progeny plant described in glyphosate herbicidal and careless ammonium phosphine herbicide treatment;

Select the described progeny plant of tolerate glyphosate and careless ammonium phosphine.

For achieving the above object, present invention also offers a kind of cultivation has the maize plant of tolerance method to glyphosate herbicidal, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of encodes glyphosate tolerance EPSPS and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

Spray described milpa with effective dose glyphosate herbicidal, gather in the crops the plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

The nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

For achieving the above object, present invention also offers a kind of cultivation has the maize plant of tolerance method to careless ammonium phosphine weedicide, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

With milpa described in effective dose grass ammonium phosphine herbicide spray, gather in the crops the plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

For achieving the above object, present invention also offers a kind of cultivation has the maize plant of tolerance method to glyphosate herbicidal and careless ammonium phosphine weedicide, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen, the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

With milpa described in effective dose glyphosate herbicidal and careless ammonium phosphine herbicide spray, gather in the crops the plant compared with other plant without the nucleotide sequence of specific region with the plant injury weakened;

For achieving the above object, present invention also offers the method for a kind of protective plant from the damage caused by weedicide, comprise the large Tanaka weedicide containing effective dose glyphosate and/or careless ammonium phosphine being applied to plantation at least one rotaring gene corn plant, described rotaring gene corn plant comprises and is selected from SEQ ID NO:1 in its genome, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7, described rotaring gene corn plant has the tolerance to glyphosate herbicidal and/or careless ammonium phosphine weedicide.

For achieving the above object, present invention also offers a kind of method controlling weeds in field, comprise the large Tanaka weedicide containing effective dose glyphosate and/or careless ammonium phosphine being applied to plantation at least one rotaring gene corn plant, described rotaring gene corn plant comprises and is selected from SEQ ID NO:1 in its genome, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7, described rotaring gene corn plant has the tolerance to glyphosate herbicidal and/or careless ammonium phosphine weedicide.

For achieving the above object, present invention also offers a kind of method controlling the land for growing field crops glyphosate resistance weeds of glyphosate-tolerant plant, comprise the large Tanaka weedicide containing effective dose grass ammonium phosphine being applied to the rotaring gene corn plant of plantation at least one glyphosate tolerant, the rotaring gene corn plant of described glyphosate tolerant comprises and is selected from SEQ ID NO:1 in its genome, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7, the rotaring gene corn plant of described glyphosate tolerant has the tolerance to careless ammonium phosphine weedicide simultaneously.

For achieving the above object, present invention also offers a kind of method delaying insect-resistant, the large Tanaka being included in the pest-resistant maize plant of plantation plants the rotaring gene corn plant that at least one has glyphosate and/or glufosinate tolerant, and the rotaring gene corn plant of described glyphosate tolerant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome.

For achieving the above object, present invention also offers a kind of agricultural-food or the commodity that comprise the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, described agricultural-food or commodity are Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, W-Gum, corn gluten, corn-dodger, makeup or weighting agent.

In the present invention in the nucleotide sequence that detects antiweed maize plant and detection method thereof, with give a definition and method can define the present invention better and instruct those of ordinary skill in the art to implement the present invention, unless otherwise mentioned, term is understood according to the usage of the routine of those of ordinary skill in the art.

Described " corn " refers to Zea mays (Zea mays), and comprise can with all plant varieties of corn mating, comprise field corn kind.

Term " comprises " and refers to " including but not limited to ".

Vegetable cell complete in the Plant cell and tissue culture thing that term " plant " comprises whole strain plant, vegetable cell, plant organ, plant protoplast, plant can therefrom regenerate, plant callus, vegetation bed (plant clumps) and plant or plant part, described plant part is embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem stalk, root, the tip of a root, flower pesticide etc. such as.The part being interpreted as the transgenic plant in the scope of the invention includes but not limited to vegetable cell, protoplastis, tissue, callus, embryo and flower, stem, fruit, Ye Hegen, and above plant part is derived from the transgenic plant be also therefore made up of transgenic cell at least in part or its filial generation that transform with DNA molecular of the present invention in advance.

Term " gene " refers to the nucleic acid fragment of expressing specific protein, comprises the adjustment sequence (3 ' non-coding sequence) after the adjustment sequence before encoding sequence (5 ' non-coding sequence) and encoding sequence." natural gene " refers to that natural discovery has the gene that himself regulates sequence." mosaic gene " refers to it is not any gene of natural gene, and it comprises adjustment and encoding sequence that non-natural finds." native gene " refers to natural gene, and described natural gene is arranged in its natural place of organism genome." foreign gene " is existing being in biological genome and original non-existent alien gene, also refers to the gene importing recipient cell through Transgenic procedures.Foreign gene can comprise the natural gene or mosaic gene that insert non-native organism." transgenosis " has been introduced into genomic gene by Transformation Program.The site that in Plant Genome, recombinant DNA has been inserted into can be called " insertion point " or " target site ".

External source (allos) DNA that " flanking DNA " can be comprised the genome in the natural organism being present in such as plant or be introduced by conversion process, such as relevant to transformation event fragment.Therefore, flanking DNA can comprise natural and combination that is foreign DNA.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " refer at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 base pairs or longer sequence, and it is positioned at initial external source and inserts the direct upstream of DNA molecular or downstream and to insert DNA molecular adjacent with initial external source.When this flanking region is positioned at downstream, it also can be called " left margin flank " or " 3 ' flank " or " 3 ' genome frontier district " or " genome 3 ' border sequence " etc.When this flanking region is positioned at upstream, it also can be called " right margin flank " or " 5 ' flank " or " 5 ' genome frontier district " or " genome 5 ' border sequence " etc.

Cause the transformant that the Transformation Program of the random integration of foreign DNA can cause containing different flanking region, described different flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, its flanking region can not change usually.Transformant also can contain the joint of the uniqueness between heterologous insertion DNA and the section of genomic dna or between two fragment gene group DNA or between two sections of allogeneic dna sequence DNAs." joint " is the point that two concrete DNA fragmentations connect.Such as, the position being present in inset DNA and connecting flanking DNA is engaged.Juncture is also present in the organism of conversion, and wherein two DNA fragmentations are to modify linking together of the mode that finds in native organism." engage DNA " and refer to the DNA comprising juncture.

The invention provides the transgenic corn events and offspring thereof that are called DBN9888, described transgenic corn events DBN9888 is maize plant DBN9888, it comprises the Plants and Seeds of transgenic corn events DBN9888 and vegetable cell thereof or its renewable part, the plant part of described transgenic corn events DBN9888, include but not limited to cell, pollen, ovule, flower, bud, root, stem, fringe silk, inflorescence, ear fringe, leaf and the product from maize plant DBN9888, such as Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, corn steep liquor, corn silk, W-Gum and the biomass staying corn crop field.

Transgenic corn events DBN9888 of the present invention contains a DNA construct, and when it expresses in vegetable cell, described transgenic corn events DBN9888 obtains the tolerance to glyphosate herbicidal and careless ammonium phosphine weedicide.Described DNA construct comprises the expression cassette of two series connection, first expression cassette comprises for the promotor be applicable to expressed in plant and the polyadenylation signal sequence be applicable to, described promotor be operably connected coding 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) gene, described EPSPS has tolerance to glyphosate herbicidal.Second expression cassette comprises for the promotor be applicable to expressed in plant and the polyadenylation signal sequence be applicable to; described promotor is operably connected the gene of encoding phosphinothricin N-acetyltransferase (PAT), and the nucleotide sequence of described PAT albumen has tolerance to careless ammonium phosphine weedicide.Further, described promotor can be the applicable promotor be separated from plant, comprises composing type, induction type and/or tissue-specific promoter, described applicable promotor includes but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, Tsf1 promotor, ubiquitin protein (Ubiquitin) promotor, Actin muscle (Actin) promotor, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promotor, octopine synthase (OCS) promotor, the yellow leaf curl virus promoter of Cestrum (Cestrum), patatin (Patatin) promotor, ribulose-1,5-bisphosphate, 5-bisphosphate Carboxylase/oxygenase (RuBisCO) promotor, glutathione S-transferase (GST) promotor, E9 promotor, GOS promotor, alcA/alcR promotor, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promotor and Arabidopsis (Arabidopsis) Suc2 promotor.Described polyadenylation signal sequence can for the applicable polyadenylation signal sequence worked in plant, described applicable polyadenylation signal sequence includes but not limited to, derive from the polyadenylation signal sequence of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from cauliflower mosaic virus (CaMV) 35S terminator, derive from pea ribulose-1, 5-bisphosphate Carboxylase/oxygenase E9 terminator, derive from the polyadenylation signal sequence of protease-inhibitor Ⅱ (PIN II) gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

In addition, described expression cassette can also comprise other genetic elements, and described genetic elements includes but not limited to, enhanser and signal peptide/transit peptides.Described enhanser can the expression level of enhancing gene, and described enhanser includes but not limited to, tobacco etch virus (TEV) translates incitant, CaMV35S enhanser and FMV35S enhanser.Described signal peptide/transit peptides can guide specific organoid or compartment in EPSPS albumen and/or PAT Protein transport to extracellular or cell, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum.

Described 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be separated and obtain from soil Agrobacterium (Agrobacterium tumefaciens sp.) CP4 bacterial strain, and by optimizing codon or the polynucleotide otherwise changing coding EPSPS, the stability of transformant transcription thing and the object of utilizability can be increased to reach.Described 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) gene also can as selected marker.

Described " glyphosate " refers to N-phosphonomethylglycine and its salt, refers to use the herbicide formulations that any one contains glyphosate to process with " glyphosate herbicidal " process.In order to reach ebd, the selection of certain glyphosate formulation rate of utilization is no more than to the technical ability of common agronomic technique personnel.The herbicide formulations pack processing that use any one contains glyphosate contains the field of the vegetable material deriving from antiweed maize plant DBN9888, to the weed growth in described field be controlled, and do not affect growth or the output of the vegetable material deriving from herbicide tolerant maize plant DBN9888.

From enzyme phosphinothricin N-acetyl transferring enzyme (the phosphinothricin N-acetyltransferase that streptomycete (Streptomyces viridochromogenes) is separated; PAT) gene is converted into its inactive form by acetylize catalysis L-phosphinothricin, to give the tolerance of plant to careless ammonium phosphine weedicide.Phosphinothricin (PTC, 2-amino-4-methylphosphine-butyric acid) is the inhibitor of glutamine synthetase.PTC is the structure unit of microbiotic 2-amino-4-methylphosphine acyl-alanyl-alanine, and this tripeptides (PTT) has the activity of resisting gram-positive and gram negative bacterium and antimycotic Botrytis cinerea (Botrytis cinerea).Phosphinothricin N-acetyl transferring enzyme (PAT) gene also can as selected marker.

Described " careless ammonium phosphine " has another name called careless fourth phosphine, refers to 2-amino-4-[hydroxyl (methyl) phosphono] butyric acid ammonium, refers to use the herbicide formulations that any one contains careless ammonium phosphine to process with " careless ammonium phosphine weedicide " process.In order to reach ebd, the selection of certain careless ammonium phosphine preparation rate of utilization is no more than to the technical ability of common agronomic technique personnel.The herbicide formulations pack processing that use any one contains careless ammonium phosphine contains the field of the vegetable material deriving from herbicide tolerant maize plant DBN9888, to the weed growth in described field be controlled, and do not affect growth or the output of the vegetable material deriving from herbicide tolerant maize plant DBN9888.

Described DNA construct adopts method for transformation to be introduced in plant, and described method for transformation includes but not limited to, Agrobacterium (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

Described Agrobacterium_mediated method is the common method of Plant Transformation.Between border, the left and right consensus sequence foreign DNA be introduced in plant being cloned into carrier, i.e. T-DNA district.Described carrier is transformed in agrobatcerium cell, and subsequently, described agrobatcerium cell is used for infection plant's tissue, and the described T-DNA district comprising the carrier of foreign DNA is inserted in Plant Genome.

Described Gene Knock-out Mice is the carrier bombardment vegetable cell (biolistic transformation of particle mediation) with comprising foreign DNA.

Described pollen tube channel conversion method is the natural pollen tube channel (having another name called pollen tube transmitting tissue) formed after utilizing pollinate, through megarchidium passage, carries foreign DNA into blastular.

After conversion, must from the plant tissue regenerating plants transformed, and the Marker selection be applicable to be utilized to have the offspring of foreign DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassette.DNA construct preferably can self-replacation in bacterial cell, and the plasmid containing different restriction endonuclease sites, contained restriction endonuclease sites is used for importing provides functioning gene element, i.e. the DNA molecular of promotor, intron, leader sequence, encoding sequence, 3 ' terminator region and other sequences.Expression cassette contained in DNA construct comprise messenger RNA(mRNA) is provided transcribe necessary Genetic elements, described expression cassette can be designed as at prokaryotic cell prokaryocyte or eukaryotic expression.Expression cassette of the present invention is designed to most preferably express in vegetable cell.

Transgenosis " event " is by obtaining by heterologous DNA construct transformed plant cells, namely an expression of nucleic acid box containing target gene is comprised, be inserted in Plant Genome by transgenic method with the plant population produced, regenerate described plant population, and select that there is the specific plant inserting specific gene group site feature.Term " event " refers to comprise the original transformant of allogeneic dna sequence DNA and the offspring of this transformant.The offspring that term " event " also refers to carry out sexual hybridization between transformant and other kind individuality containing allogeneic dna sequence DNA and obtains, even if after repeatedly backcrossing with backcross parent, come from the insertion DNA of transformant parent and flanking genomic dna and be also present in same chromosome position in filial generation.Term " event " also refers to the DNA sequence dna from original transformant, this DNA sequence dna comprises insertion DNA and the flanking genomic sequence closely adjacent with inserting DNA, this DNA sequence dna is expected to be transferred in filial generation, this filial generation is by being (filial generation that such as original transformant and its selfing produce) containing the parent inserting DNA and be not carry out sexual hybridization and produce containing the parent inserting DNA, and this filial generation receives the insertion DNA comprising target gene.

In the present invention " restructuring " refer to and usually can not find at occurring in nature and the form of the DNA therefore produced by manual intervention and/or albumen and/or organism.This manual intervention can produce recombinant DNA molecules and/or recombinant plant.Described " recombinant DNA molecules " is that the sequence section be separated in other cases by artificial combination two kinds is obtained, such as, by chemosynthesis or the nucleic acid segment by gene engineering operation separation.The technology of carrying out nucleic-acid manipulation is well-known.

Term " transgenosis " comprises any cell, clone, callus, tissue, plant part or plant, above genotype changes due to the existence of heterologous nucleic acids, and described " transgenosis " is comprised at first by the Transgenics changed like this and the offspring individual generated by sexual hybridization or vegetative propagation by initial Transgenics.In the present invention, term " transgenosis " does not comprise genomic (the chromosomal or extrachromosomal) change by conventional plant breeding method or natural generation event, and described natural generation event is random cross pollination, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base or spontaneous mutation such as.

In the present invention, " allos " refers to that occurring in nature first molecule is not found and the second molecular combinations usually.Such as, molecule can be derived from the first species and be inserted in the genome of the second species.Therefore this molecule is allos for host and is manually introduced in the genome of host cell.

Cultivate transgenic corn events DBN9888 glyphosate herbicidal and careless ammonium phosphine weedicide to tolerance, pass through following steps: first make the first parental corn plants and the second parental corn plants sexual hybridization, thus create various first-generation progeny plant, described first parental corn plants is made up of the maize plant cultivating transgenic corn event DBN9888 and offspring thereof, this transgenic corn events DBN9888 and offspring thereof obtain by utilizing the expression cassette having tolerance to glyphosate herbicidal and careless ammonium phosphine weedicide of the present invention to transform, second parental corn plants lacks the tolerance to glyphosate herbicidal and/or careless ammonium phosphine weedicide, then select to use the progeny plant with tolerance to glyphosate herbicidal and/or careless ammonium phosphine weedicide, maize plant glyphosate herbicidal and careless ammonium phosphine weedicide to tolerance can be cultivated.These steps may further include make to glyphosate herbicidal and/or careless ammonium phosphine weedicide use the progeny plant and the second parental corn plants with tolerance or the 3rd parental corn plants backcrosses, then by using glyphosate herbicidal, grass ammonium phosphine weedicide or carry out chooser generation by the qualification of the molecular marked compound relevant to proterties (as comprise 5 ' of insertion sequence in transgenic corn events DBN9888 hold and 3 ' hold the DNA molecular of the bond site identified), thus produce maize plant glyphosate herbicidal and careless ammonium phosphine weedicide to tolerance.

It will also be appreciated that two kinds of different transgenic plant also can hybridize to produce containing two independently, the offspring of foreign gene that adds of separate type.It is all homozygous Progeny plants that the selfing of suitable offspring can obtain concerning two foreign genes added.Foregoing to stock plant backcross and and the outcross of non-transgenic plant also it is expected to, vegetative propagation is also same.

The corn of trans Bt gene can kill the insect/insect of such as lepidopteran and Coleoptera, but also there is the insect/insect survived on a small quantity, after several generations breeding, may produce the resistant insects/insect of anti-Bt albumen.This problem of resistance is produced in order to solve insect/insect; USEPA gives following guidance for the use of genetically modified crops, and a certain proportion of sanctuary corn need be provided (to require have 5%, 10%, 20% etc. according to product difference about sanctuary corn.And can be non-insect-resistant transgenic corn (as herbicide tolerant transgenic corns), or the corn of anti-Non-target pests, and not necessarily is non-transgenic corns).After the insect/insect of the overwhelming majority is killed on corresponding transgenic insect-resistant corn, some insect/insect is not dead on sanctuary's corn, ensure that the insect/pest population not having resistance accounts for governance quantity.Even if there is the resistant insects/insect of a small amount of survival like this, and accounts for the non-resistance insect/insect post-coitum resistant gene ruling quantity and also diluted significantly.

Term " probe " is one section of nucleic acid molecule be separated, and is combined with conventional detectable label or reporter molecules above it, such as, and radio isotope, part, chemoluminescence agent or enzyme.A chain of this probe and target nucleic acid is complementary, in the present invention, probe is with complementary from the genomic DNA chain of transgenic corn events DBN9888, no matter this genomic dna is from transgenic corn events DBN9888 or seed or derives from the plant of transgenic corn events DBN9888 or seed or extract.Probe of the present invention not only comprises thymus nucleic acid or Yeast Nucleic Acid, also comprises and is combined with target dna sequence specifically and can be used for detecting polymeric amide and other probe materials of the existence of this target dna sequence.

Term " primer " is one section of nucleic acid molecule be separated, it is by nucleic acid hybridization, and annealed combination, on the target dna chain of complementation, forms heterozygote between primer and target dna chain, then under the effect of polysaccharase (such as archaeal dna polymerase), along target dna chain extension.Primer pair of the present invention relates to its application in target nucleic acid sequence amplification, such as, by the nucleic acid amplification method of polymerase chain reaction (PCR) or other routines.

The length of probe and primer is generally 11 polynucleotide or more, preferably 18 polynucleotide or more, more preferably 24 polynucleotide or more, most preferably 30 polynucleotide or more.This probe and primer are hybridized specifically with target sequence under high stringency conditions.Although be different from target dna sequence and keep the probe of hybridization ability can by conventional design out to target dna sequence, but, preferably, the continuous nucleic acid of the probe in the present invention and primer and target sequence has DNA sequence dna identity completely.

Can be determined by ordinary method based on the primer of flanking genomic dna of the present invention and insertion sequence and probe, such as, by being separated corresponding DNA molecular from the vegetable material deriving from transgenic corn events DBN9888, and determine the nucleotide sequence of this DNA molecular.Described DNA molecular comprises transgene insert sequence and Maize genome flank region, and the fragment of described DNA molecular can be used as primer or probe.

Nucleic acid probe of the present invention and primer are hybridized with target dna sequence under strict conditions.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence deriving from the DNA of transgenic corn events DBN9888 in sample.Nucleic acid molecule or its fragment can carry out specific hybrid with other nucleic acid molecule in any case.As the present invention uses, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementary completely, then one of them nucleic acid molecule is claimed to be another nucleic acid molecule " complement ".As the present invention uses, when corresponding nucleotide complementary with another nucleic acid molecule of each Nucleotide of a nucleic acid molecule, then these two nucleic acid molecule are claimed to demonstrate " complete complementary ".If two nucleic acid molecule can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if two nucleic acid molecule can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecule are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecule as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salt concn.

As the present invention use, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salt concn in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salt concn can all change, and also can one of them to remain unchanged and another variable changes.Preferably, a nucleic acid molecule of the present invention can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with one or more nucleic acid molecule or its complementary sequence in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, or arbitrary fragment generation specific hybrid of above-mentioned sequence.More preferably, a nucleic acid molecule of the present invention under high stringency with one or more nucleic acid molecule or its complementary sequence in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7, or arbitrary fragment generation specific hybrid of above-mentioned sequence.In the present invention, preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary sequence, or arbitrary fragment of above-mentioned sequence.Another preferred marker nucleic acid molecule of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary sequence, or arbitrary fragment of above-mentioned sequence has the sequence iden of 80% to 100% or 90% to 100%.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can as the marker in plant breeding method to identify the offspring of genetic cross.The method that the hybridization of probe and target dna molecule can be well known to those skilled in the art by any one detects, and these methods include but not limited to, fluorescent mark, radio-labeling, antibody class mark and chemiluminescent labeling.

About the amplification using specific amplimer to carry out target nucleic acid sequence (such as, pass through PCR), " stringent condition " refers to and only allows primer pair target nucleic acid sequence that the condition of hybridization occurs in the hot amplified reaction of DNA, there is the primer of the wild-type sequence (or its complementary sequence) corresponding to target nucleic acid sequence, can be combined with described target nucleic acid sequence, and preferably produce unique amplified production, amplified production and amplicon.

Term " specific binding (target sequence) " refers to that probe or primer are only hybridized with the target sequence comprised in the sample of target sequence under stringent hybridization condition.

As the present invention uses, " DNA through amplification " or " amplicon " refer to the nucleic acid amplification product of the target nucleic acid sequence as a nucleic acid-templated part.Such as, in order to determine whether maize plant is produced by sexual hybridization mode by containing transgenic corn events DBN9888 of the present invention, or whether the corn sample gathered from field comprises transgenic corn events DBN9888, or maize extract, such as whether meal, powder or oil comprise transgenic corn events DBN9888, and the DNA extracted from maize plant tissue sample or extract can by using the nucleic acid amplification method of primer pair to be diagnostic amplicon with generation for the existence of the DNA of transgenic corn events DBN9888.Described primer pair comprises first primer derived from the adjacent flanking sequence of foreign DNA insertion point inserted in Plant Genome, and derives from second primer of foreign DNA of insertion.Amplicon has certain length and sequence, and transgenic corn events DBN9888 described in described sequence pair is also diagnostic.The length range of amplicon can be primer pair add a nucleotide base pair in conjunction with length, preferably add about 50 nucleotide bases pair, more preferably add about 250 nucleotide bases pair, most preferably add about 450 nucleotide bases to or more.

Optionally, primer pair can derive from the flanking genomic sequence inserting DNA both sides, to produce the amplicon comprising whole insertion nucleotide sequence.One of deriving from the primer pair of plant genome sequences can be positioned at apart from inserting DNA sequence dna a distance, and the scope of this distance can be that a nucleotide base is to arriving about 20,000 nucleotide bases pair.The use of term " amplicon " eliminates the primer dimer formed in the hot amplified reaction of DNA especially.

Nucleic acid amplification reaction can be realized by any one nucleic acid amplification reaction method known in the art, comprises polymerase chain reaction (PCR).Various nucleic acid amplification method has been well-known to those skilled in the art.PCR amplification method has developed into the genomic dna that can increase and reach 22kb and the phage DNA reaching 42kb.Other DNA cloning methods of these methods and this area may be used for the present invention.The exogenous DNA array inserted and can increasing by utilizing the genome of primer sequence to transgenic corn events DBN9888 that provide from the flanking DNA sequence of transgenic corn events DBN9888, carries out the DNA sequencing of standard to the DNA of pcr amplification or clone after amplification.

DNA detection test kit based on DNA cloning method contains DNA primer molecule, and they are under suitable reaction conditions on specific hybrid to target dna and the diagnostic amplicon that increases.Test kit can provide the many methods based on the detection method of sepharose or the known checkout and diagnosis amplicon of prior art.Containing with any part homology in the Maize genome district of SEQ ID NO:3 or SEQ ID NO:4 or complementation and be provided by the present invention with the test kit of any part homology of the transgenosis insert district of SEQ ID NO:5 or the DNA primer of complementation.Differentiate that primer pair useful in DNA cloning method is SEQ ID NO:8 and SEQ ID NO:9 especially, the diagnostic amplicon of a part of homology in the 5 ' transgenosis/genome district of its amplification and transgenic corn events DBN9888, wherein amplicon comprises SEQ ID NO:1.Other DNA molecular as DNA primer can be selected from SEQ ID NO:5.

The amplicon that these methods produce can be detected by multiple technologies.One of them method is Genetic Bit Analysis, and the method devises one and crosses over the DNA oligonucleotide chain inserting DNA sequence dna and adjacent flanking genomic DNA sequence.This oligonucleotide chain is fixed in the micropore of a microwell plate, after pcr amplification is carried out to target area (in insertion sequence and in adjacent flanking genomic sequence each use primer), single stranded PCR products can be hybridized with fixing oligonucleotide chain, and as the template of single base extension, this extension employs the ddNTPs of archaeal dna polymerase and the base specific markers for next expection.Result can be obtained by fluorescence or ELISA class methods.Signal represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base extension are successful.

Another kind method is Pyrosequencing (Manganic pyrophosphate complex initiation) technology.The method devises one and crosses over the oligonucleotide chain inserting DNA sequence dna and adjacent genomic dna combining site.The single stranded PCR products of this oligonucleotide chain and target area (each in insertion sequence and in adjacent flanking genomic sequence use a primer) is hybridized, then with archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine-5 '-phosphorus vitriol carries out incubation together with luciferin.Add dNTPs respectively, measure the optical signal produced.Optical signal represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base or polybase base extension are successful.

The Fluorescence polarization that Chen etc. (genome research (Genome Res.) 9:492-498,1999) describe also is a kind of method that may be used for detecting amplicon of the present invention.Make to need design one to cross over the oligonucleotide chain inserting DNA sequence dna and adjacent genomic dna combining site in this way.The single stranded PCR products (in insertion sequence and in adjacent flanking genomic sequence each use primer) of this oligonucleotide chain and target area is hybridized, then carries out incubation together with archaeal dna polymerase and a kind of fluorescently-labeled ddNTP.Single-basic extension can cause inserting ddNTP.This insertion can utilize luminoscope to measure the change of its polarization.The change of polarization represents the existence of insertion/flanking sequence, and it illustrates that amplification, hybridization and single base extension are successful.

Taqman is described to a kind of detection and the method for quantitative analysis DNA sequence dna existence, has detailed introduction in the operation instruction that the method provides in manufacturers.Now briefly illustrate as follows, design one and cross over the FRET oligonucleotide probe inserting DNA sequence dna and adjacent flanking genomic combining site.This FRET probe and PCR primer (in insertion sequence and in adjacent flanking genomic sequence each use primer) carry out circulating reaction under heat-stabilised poly synthase and dNTPs exist.The hybridization of FRET probe causes the division of fluorescing fractions and quencher moieties and the release of fluorescing fractions on FRET probe.The generation of fluorescent signal represents the existence of insertion/flanking sequence, and it illustrates that amplification and hybridization are successful.

Based on Hybridization principle, the applicable technology for detecting the vegetable material deriving from herbicide tolerant transgenic corn events DBN9888 can also comprise Southern blot hybridization, Northern blot hybridization and in situ hybridization.Especially, described applicable technology comprises incubation probe and sample, washs to remove unconjugated probe and whether detection probes hybridizes.Described detection method depends on the type of the appended mark of probe, and such as, being exposed by X-ray and develop can the probe of detection of radioactive labels, or realizes by substrate conversion the probe that colour-change can detect enzyme labelling.

Tyangi etc. (Nature Biotechnol (Nat.Biotech.) 14:303-308,1996) describe the application of molecule marker in sequential detection.Brief description is as follows, designs one and crosses over the FRET oligonucleotide probe inserting DNA sequence dna and adjacent flanking genomic combining site.The unique texture of this FRET probe causes it to contain secondary structure, and this secondary structure can keep fluorescing fractions and quencher moieties within closely.This FRET probe and PCR primer (in insertion sequence and in adjacent flanking genomic sequence each use primer) carry out circulating reaction under heat-stabilised poly synthase and dNTPs exist.Through successful pcr amplification, the hybridization of FRET probe and target sequence causes the forfeiture of probe secondary structure, thus fluorescing fractions is spatially separated with quencher moieties, produces fluorescent signal.The generation of fluorescent signal represents the existence of insertion/flanking sequence, and it illustrates that amplification and hybridization are successful.

Other methods described, such as microfluid (microfluidics) provides the method and apparatus of separation and DNA amplification sample.Photoinitiator dye is used for detecting and measuring specific DNA molecular.Comprise electronic sensor for detecting DNA molecular or receive pearl test tube (nanotube) equipment of receiving that thus can be detected in conjunction with specific DNA molecular are useful for detection DNA molecular of the present invention.

That composition of the present invention and DNA detection field describe or known method can be used to develop DNA detection test kit.Described test kit is conducive to identifying the DNA that whether there is transgenic corn events DBN9888 in sample, can also be used for the maize plant of the DNA cultivated containing transgenic corn events DBN9888.Described test kit can contain DNA primer or probe, it is with coming from or be complementary to SEQ ID NO:1,2,3,4 or 5 at least partially, or containing other DNA primer or probe, it is with coming from or be complementary to DNA contained in the transgene genetic element of DNA, these DNA sequence dnas may be used for DNA amplification reaction, or as the probe in DNA hybridization method.The DNA structure of transgene insert sequence that is that contain in Maize genome and that illustrate in Fig. 1 and table 1 and Maize genome combining site comprises: the maize plant DBN9888 flanking gene group region being positioned at transgene insert sequence 5 ' end, from a part of insertion sequence in the left border region (LB) of Agrobacterium, first expression cassette is by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhanser region, be operably connected on the phosphinothricin N-acetyl transferring enzyme (cPAT) of the glufosinate tolerant of streptomycete, and be operably connected on cauliflower mosaic virus 35S terminator (t35S) and form, second expression cassette is by rice actin 1 promotor (prOsAct1), be operably connected on the encoding sequence (spAtCTP2) of Arabidopis thaliana EPSPS chloroplast transit peptides, be operably connected on the 5-enol-pyrovyl shikimic acid-3-phosphate synthase (cEPSPS) of the glyphosate tolerant of Agrobacterium CP4 bacterial strain, the transcription terminator (tNos) being operably connected to nopaline synthase above forms, from a part of insertion sequence in the right side boundary region (RB) of Agrobacterium, and be positioned at the maize plant DBN9888 flanking gene group region (SEQ ID NO:5) of transgene insert sequence 3 ' end.In DNA cloning method, the DNA molecular as primer can be any part deriving from transgene insert sequence in maize plant DBN9888, also can be any part in the region of DNA territory deriving from flank Maize genome in transgenic corn events DBN9888.

Transgenic corn events DBN9888 can combine with other transgenic maize varieties, such as herbicide tolerant is (as 2,4-D, dicamba 98 etc.) corn, or carry the transgenic maize varieties of other anti insect genes (as Cry1Ab, Vip3A etc.).The various combinations of all these different transgenic events, breeding together with transgenic corn events DBN9888 of the present invention, can provide anti-multiple insect pest and tolerate the improvement hybrid transgenic corn variety of multiple weedicide.These kinds can show the more excellent feature such as output lifting compared to the transformed variety of non-transgenic kind and unisexuality shape.

The invention provides a kind of nucleotide sequence for detecting herbicide tolerant maize plant DBN9888 and detection method thereof, transgenic corn events DBN9888 tolerates the phytotoxic effects of the agriculture weedicide containing glyphosate and/or careless ammonium phosphine.The milpa of this dual proterties expresses 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) albumen of the glyphosate resistance of Agrobacterium strains CP4; it gives plant to the tolerance of glyphosate; and express phosphinothricin N-acetyl transferring enzyme (PAT) albumen of the careless ammonium phosphine resistance of streptomycete, it gives plant to the tolerance of careless ammonium phosphine.Dual proterties corn tool has the following advantages: 1) apply the ability controlled for broad-spectrum weeding to corn crop containing the agriculture weedicide of glyphosate; 2) glufosinate tolerant proterties combinationally use careless ammonium phosphine weedicide (mix with glyphosate herbicidal or be used alternatingly) can as a kind of non-selective means of effective management glyphosate-resistant weeds; 3) herbicide tolerant transgenic corns is as non-pest-resistant transgenic corns, plants in the lump with certain proportion with transgenic insect-resistant corn, can delay insect/insect and produce resistance; 4) corn yield does not reduce.In addition, the gene linkage of encodes glyphosate tolerance and glufosinate tolerant proterties is in same region of DNA section, and be present on the genomic term single gene seat of transgenic corn events DBN9888, the transgenic insert that the breeding efficiency making it possible to that this point provides enhancing is followed the trail of with molecule marker in reproductive population and filial generation thereof.Simultaneously in detection method, SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence can as DNA primer or probe to produce the amplified production that be diagnosed as transgenic corn events DBN9888 or its offspring, and the existence identifying the vegetable material deriving from transgenic corn events DBN9888 that can be quick, accurate, stable.

BRIEF DESCRIPTION OF THE SEQUENCES

11 Nucleotide of the insertion point of 5 ' transgenic fragment and every side of corn gene group DNA in SEQ ID NO:1 transgenic corn events DBN9888;

11 Nucleotide of the insertion point of 3 ' transgenic fragment and every side of corn gene group DNA in SEQ ID NO:2 transgenic corn events DBN9888;

Be positioned at 5 ' end of insertion sequence the sequence that the length inserted near junction is 960 Nucleotide in SEQ ID NO:3 transgenic corn events DBN9888;

Be positioned at 3 ' end of insertion sequence the sequence that the length inserted near junction is 753 Nucleotide in SEQ ID NO:4 transgenic corn events DBN9888;

The whole T-DNA sequence of SEQ ID NO:5,5 ' and 3 ' flank maize genomic sequence;

SEQ ID NO:6 is positioned at the sequence of SEQ ID NO:3 inside, spans DBN10006 construct DNA sequence dna and pr35S promoter sequence;

SEQ ID NO:7 is positioned at the sequence of SEQ ID NO:4 inside, spans tNos transcription termination sequence and DBN10006 construct DNA sequence dna;

First primer of SEQ ID NO:8 amplification SEQ ID NO:3;

Second primer of SEQ ID NO:9 amplification SEQ ID NO:3;

First primer of SEQ ID NO:10 amplification SEQ ID NO:4;

Second primer of SEQ ID NO:11 amplification SEQ ID NO:4;

Primer on SEQ ID NO:12 5 ' flanking genomic sequence;

The primer be positioned on T-DNA that SEQ ID NO:13 and SEQ ID NO:12 matches;

Primer on SEQ ID NO:14 3 ' flanking genomic sequence, itself and SEQ ID NO:12 match, and can to detect transgenosis be homozygote or heterozygote;

The primer be positioned on T-DNA that SEQ ID NO:15 and SEQ ID NO:14 matches;

SEQ ID NO:16 Taqman detects the primer 1 of EPSPS;

SEQ ID NO:17 Taqman detects the primer 2 of EPSPS;

SEQ ID NO:18 Taqman detects the probe 1 of EPSPS;

SEQ ID NO:19 Taqman detects the primer 3 of PAT;

SEQ ID NO:20 Taqman detects the primer 4 of PAT;

SEQ ID NO:21 Taqman detects the probe 2 of PAT;

First primer of SEQ ID NO:22 corn native gene Ubiquitin;

Second primer of SEQ ID NO:23 corn native gene Ubiquitin;

The probe of PAT in SEQ ID NO:24 Southern hybridization check;

The probe of EPSPS in SEQ ID NO:25 Southern hybridization check;

SEQ ID NO:26 is positioned at the primer on T-DNA, consistent with SEQ ID NO:13 direction;

SEQ ID NO:27 is positioned at the primer on T-DNA, contrary with SEQ ID NO:13 direction, is used as to obtain flanking sequence;

SEQ ID NO:28 is positioned at the primer on T-DNA, contrary with SEQ ID NO:13 direction, is used as to obtain flanking sequence;

SEQ ID NO:29 is positioned at the primer on T-DNA, consistent with SEQ ID NO:15 direction;

SEQ ID NO:30 is positioned at the primer on T-DNA, contrary with SEQ ID NO:15 direction, is used as to obtain flanking sequence;

SEQ ID NO:31 is positioned at the primer on T-DNA, contrary with SEQ ID NO:15 direction, is used as to obtain flanking sequence.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is the present invention for the transgene insert sequence of nucleotide sequence and detection method thereof detecting herbicide tolerant maize plant DBN9888 and the structural representation of Maize genome combining site;

Fig. 2 is the present invention for the structural representation of the recombinant expression vector DBN10006 of the nucleotide sequence and detection method thereof detecting herbicide tolerant maize plant DBN9888.

Embodiment

The technical scheme of the present invention for the nucleotide sequence and detection method thereof that detect herbicide tolerant maize plant DBN9888 is further illustrated below by specific embodiment.

First embodiment, clone and conversion

1.1, carrier cloning

The gene clone technology of use standard builds recombinant expression vector DBN10006 (as shown in Figure 2).Described carrier DBN10006 comprises the transgene expression cassette of two series connection, first expression cassette is by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhanser region, be operably connected on the phosphinothricin N-acetyl transferring enzyme (cPAT) of the glufosinate tolerant of streptomycete, and be operably connected on cauliflower mosaic virus 35S terminator (t35S) and form; Second expression cassette is by rice actin 1 promotor (prOsAct1), be operably connected on the encoding sequence (spAtCTP2) of Arabidopis thaliana EPSPS chloroplast transit peptides, be operably connected on the 5-enol-pyrovyl shikimic acid-3-phosphate synthase (cEPSPS) of the glyphosate tolerant of Agrobacterium CP4 bacterial strain, the transcription terminator (tNos) being operably connected to nopaline synthase above forms.

Described carrier DBN10006 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat.No:18313-015) in, and with 5-enol pyruvylshikimate-3-phosphate synthase (EPSPS) for selective marker is screened transformant.

1.2, Plant Transformation

Conventional Agrobacterium infestation method is adopted to transform, by the Agrobacterium Dual culture described in the maize immature embryos of sterile culture and the present embodiment 1.1, so that the T-DNA in the recombinant expression vector DBN10006 of structure is transferred in maize chromosome group, to produce transgenic corn events DBN9888.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein the nucleotide sequence of the nucleotide sequence of EPSPS gene and pat gene can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH 5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) at least exist a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (glyphosate).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30 g/L, N-(phosphine carboxymerhyl) glycine 0.25mol/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) upper cultivation, cause the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.

Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N-(phosphine carboxymerhyl) glycine 0.125mol/L, plant gel 3g/L, pH 5.8) on, cultivate differentiation at 25 DEG C.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.

1.3, the qualification of transgenic event and screening

Create altogether 332 separate transgenic T ₀plant.

Pass through TaqMan ^tMwhether the transgenic corn plant analyzing (see the second embodiment) detection regeneration exists EPSPS and pat gene, and characterizes the copy number of tolerate glyphosate and careless ammonium phosphine strain.By screening, the event DBN9888 of have selected is excellent, and it has the performance (see the 5th embodiment) singly copying transgenosis, good glyphosate herbicide tolerance, careless ammonium phosphine herbicide tolerant and economical character.

Second embodiment, carry out transgenic corn events DBN9888 detection with TaqMan

The blade getting transgenic corn events DBN9888 is about 100mg as sample, extracts its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, is detected the copy number of EPSPS gene and pat gene by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

Concrete grammar is as follows:

Step 11, get the blade 100mg of transgenic corn events DBN9888, in mortar, be ground into homogenate with liquid nitrogen, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, measure the genomic dna concentration of above-mentioned sample with NanoDrop 2000 (Thermo Scientific);

Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting EPSPS gene order:

Primer 1:CTGGAAGGCGAGGACGTCATCAATA is as shown in SEQ ID NO:16 in sequence table;

Primer 2: TGGCGGCATTGCCGAAATCGAG is as shown in SEQ ID NO:17 in sequence table;

Probe 1:ATGCAGGCGATGGGCGCCCGCATCCGTA is as shown in SEQ ID NO:18 in sequence table;

Following primer and probe are used for detecting pat gene sequence:

Primer 3:CAGTTGAGATTAGGCCAGCTACAG is as shown in SEQ ID NO:19 in sequence table;

Primer 4:TTCACTGTAGACGTCTCAATGTAATGG is as shown in SEQ ID NO:20 in sequence table;

Probe 2:CAGCTGATATGGCCGCGGTTTGTG is as shown in SEQ ID NO:21 in sequence table;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ L of often kind of primer of 1mM concentration, the probe 50 μ L of 100 μMs of concentration and 860 μ lL1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data, obtain the transgenic corn events DBN9888 of single copy.

3rd embodiment, transgenic corn events DBN9888 detect

3.1, extracting genome DNA

CTAB (cetyl trimethylammonium bromide) method that DNA extraction conveniently adopts: after the blade getting the tender transgenic corn events DBN9888 of 2 grams of childrens is pulverized in liquid nitrogen, add 0.5mL in DNA extraction CTAB Buffer (the 20g/L CTAB of temperature 65 DEG C of preheatings, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetraacetic acid (EDTA)), pH to 8.0 is adjusted with NaOH), fully after mixing, in temperature 65 DEG C of extractings 90 minutes; Add 0.5 times of volume of phenol, 0.5 times of volume of chloroform, puts upside down mixing; Under 12000rpm (rotations per minute) rotating speed centrifugal 10 minutes; Aspirate supernatant, adds 2 times of volume dehydrated alcohols, softly rocks centrifuge tube, leaves standstill 30 minutes in temperature 4 DEG C; Under 12000rpm rotating speed centrifugal 10 minutes again; Collect at the bottom of DNA to pipe; Abandoning supernatant liquor, is the ethanol of 70% by 1mL mass concentration, washing precipitation; Under 12000rpm rotating speed centrifugal 5 minutes; Vacuum is drained or is dried up at super clean bench; DNA is precipitated and dissolved in appropriate TE damping fluid (10mM Tris-HCl, 1mM EDTA, pH 8.0), under being kept at temperature-20 DEG C of conditions.

3.2, the analysis of flanking DNA sequence

Concentration determination is carried out to the DNA sample of said extracted, makes the concentration of testing sample between 80-100ng/ μ L.With the restriction enzyme BamH I, the Xma I that select, Kpn I, Sac II (5 ' end analyze) and Spe I, Pst I, Eco57I (3 ' end analysis) respectively enzyme cut genomic dna.Each enzyme is cut in system and is added the above-mentioned restriction enzyme selected of 26.5 μ L genomic dnas, 0.5 μ L and 3 μ L enzyme cutting buffering liquids, and enzyme cuts 1 hour.Cut after end until enzyme, cut in system to enzyme and add 70 μ L dehydrated alcohols, ice bath 30 minutes, centrifugal 7 minutes of rotating speed 12000rpm, abandons supernatant, dries up, and adds 8.5 μ L distilled water (dd H afterwards ₂o), 1 μ L 10X T ₄buffer and 0.5 μ L T ₄ligase enzyme spends the night in temperature 4 DEG C of connections.Carry out pcr amplification with a series of nested primers and be separated 5 ' and 3 ' transgenosis/genomic dna.Concrete, be separated 5 ' transgenosis/genomic dna combination of primers and comprise SEQ ID NO:13, SEQ ID NO:26 as the first primer, SEQ ID NO:27, SEQ ID NO:28 are as the second primer, and SEQ ID NO:13 is as sequencing primer.Be separated 3 ' transgenosis/genomic dna combination of primers and comprise SEQ ID NO:15, SEQ ID NO:29 as the first primer, SEQ ID NO:30, SEQ ID NO:31 are as the second primer, SEQ ID NO:15 is as sequencing primer, and PCR reaction conditions is as shown in table 3.

The amplicon obtained electrophoresis on 2.0% sepharose, to be separated PCR reactant, to use QIAquick Gel to extract test kit (catalogue #_28704, Qiagen Inc., Valencia, CA) subsequently and is separated object fragment from agarose matrix.Then the PCR primer of purifying checked order (such as, ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyze (such as, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

Use standard pcr confirmation 5 ' and 3 ' flanking sequence and junction sequences.5 ' flanking sequence and junction sequences can use SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26 to confirm.3 ' flanking sequence and junction sequences can use SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ ID NO:15 or SEQ ID NO:29 to confirm.PCR reaction system and amplification condition are as shown in table 2 and table 3.It will be understood by those skilled in the art that other primer sequence also can be used for confirming flanking sequence and junction sequences.

The DNA sequencing of PCR primer provides the DNA that may be used for designing other DNA moleculars, and other DNA moleculars described are as the qualification for the maize plant or seed that derive from transgenic corn events DBN9888 of primer and probe.

What discovery showed in the Nucleotide 1-693 position of SEQ ID NO:5 is the right margin flank (5 ' flanking sequence) of maize genomic sequence at transgenic corn events DBN9888 insertion sequence, and what show in the Nucleotide 5472-5952 position of SEQ ID NO:5 is the left margin flank (3 ' flanking sequence) of maize genomic sequence at transgenic corn events DBN9888 insertion sequence.5 ' junction sequence is listed in SEQ ID NO:1, and 3 ' junction sequence is listed in SEQ ID NO:2.

3.3, PCR zygosity determination

Junction sequence is relatively short polynucleotide molecule, and it is new DNA sequence dna, and the DNA when detecting in analyzing in polynucleotide detection for transgenic corn events DBN9888 is diagnostic.Junction sequence in SEQ ID NO:1 and SEQ ID NO:2 is 11 polynucleotide of the insertion point of transgenic fragment in transgenic corn events DBN9888 and every side of corn gene group DNA.Longer or shorter polynucleotide junction sequence can be selected from SEQ ID NO:3 or SEQ ID NO:4.Junction sequence (5 ' connecting zone SEQ ID NO:1, and 3 ' connecting zone SEQ ID NO:2) is useful as DNA probe or as DNA primer molecule in DNA detection method.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also DNA sequence dna new in transgenic corn events DBN9888, and it also can as DNA probe or the existence as DNA primer Molecular Detection transgenic corn events DBN9888DNA.Described SEQ ID NO:6 (the Nucleotide 694-960 position of SEQ ID NO:3) spans DBN10006 construct DNA sequence dna and pr35S promoter sequence, and described SEQ ID NO:7 (the Nucleotide 1-272 position of SEQ ID NO:4) spans tNos transcription termination sequence and DBN10006 construct DNA sequence dna.

In addition, by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4 to produce amplicon, the diagnostic amplicon of transgenic corn events DBN9888 when described primer is used in PCR method, is produced.

Particularly, produce PCR primer from 5 ' end of transgene insert sequence, this PCR primer be in the genome comprising the vegetable material deriving from transgenic corn events DBN9888 flank in a part for the genomic dna of 5 ' end of T-DNA insertion sequence.This PCR primer comprises SEQ ID NO:3.In order to carry out pcr amplification, the primer 5 (SEQ ID NO:8) that design is hybridized in the genomic dna sequence of 5 ' end of transgene insert sequence with flank, and the primer 6 (SEQ ID NO:9) being positioned at transgenosis tNos transcription termination sequence matched with it.

Produce PCR primer from 3 ' end of transgene insert sequence, this PCR primer to comprise in the genome of the vegetable material deriving from transgenic corn events DBN9888 flank in a part for the genomic dna of 3 ' end of T-DNA insertion sequence.This PCR primer comprises SEQ ID NO:4.In order to carry out pcr amplification, the primer 8 (SEQ ID NO:11) that design is hybridized in the genomic dna sequence of 3 ' end of transgene insert sequence with flank, and the primer 7 (SEQ IDNO:10) being positioned at the pr35S promoter sequence of 3 ' end of inset matched with it.

The DNA cloning condition illustrated in table 2 and table 3 may be used for the test of above-mentioned PCR connectivity with the diagnostic amplicon producing transgenic corn events DBN9888.The detection of amplicon can be undertaken by using Stratagene Robocycler, MJ Engine as shown in table 3, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycler etc., or is undertaken by method known to those skilled in the art and equipment.

Table 2, for the PCR step of the 5 ' transgenic insertions/genome engaging zones qualification of transgenic corn events DBN9888 and reaction mixture condition

Table 3, Perkin-Elmer9700 thermal cycler condition

Mix lightly, if thermal cycler does not have hot top, 1-2 can be added above each reaction solution and drip mineral oil.Use following loop parameter (table 3) at Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) the enterprising performing PCR of thermal cycler.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should run under the pattern calculated.Cooling rate (ramp speed) will be set as maximum value when running by Perkin-Elmer 9700 thermal cycler.

Experimental result shows: primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in the PCR reaction of transgenic corn events DBN9888 genomic dna, produce the amplified production of 960bp fragment, when it is used in the PCR reaction of unconverted corn gene group DNA and non-DBN9888 corn gene group DNA, fragment is not had to be amplified; Primer 7 and 8 (SEQ ID NO:10 and 11), when it is used in the PCR reaction of transgenic corn events DBN9888 genomic dna, produce the amplified production of 753bp fragment, when it is used in the PCR reaction of unconverted corn gene group DNA and non-DBN9888 corn gene group DNA, fragment is not had to be amplified.

PCR zygosity determination also can be used for identifying that the material deriving from transgenic corn events DBN9888 is homozygote or heterozygote.By primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) for amplified reaction to produce the diagnostic amplicon of transgenic corn events DBN9888.The DNA cloning condition illustrated in table 4 and table 5 may be used for the test of above-mentioned connectivity with the diagnostic amplicon producing transgenic corn events DBN9888.

Table 4, zygosity determination reaction solution

Table 5, zygosity determination Perkin-Elmer9700 thermal cycler condition

Use following loop parameter (table 5) at Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) the enterprising performing PCR of thermal cycler.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should run under the pattern calculated.Cooling rate (ramp speed) will be set as maximum value when running by Perkin-Elmer 9700 thermal cycler.

In described amplified reaction, the biological sample containing template DNA contains the DNA that there is situation of transgenic corn events DBN9888 in this sample of diagnosis.Or react and will be produced two different DNA cloning by the biological sample containing the DNA deriving from Maize genome, described in derive from the DNA of Maize genome corresponding relative to the insertion DNA existed in transgenic corn events DBN9888 allelotrope be heterozygosis.These two different amplicons are by the second amplicon that there is situation corresponding to the first amplicon and diagnosis transgenic corn events DBN9888DNA that derive from wild-type corn genomic gene seat.Only produce the maize dna sample of the single amplicon corresponding to the second amplicon described for heterozygous genes group, the diagnosable existence determining transgenic corn events DBN9888 in this sample, and this sample by the allelotrope corresponding relative to the insertion DNA existed in rotaring gene corn plant DBN9888 by the corn seed isozygotied is produced.

It should be noted that, it is diagnostic amplicon that the primer pair of transgenic corn events DBN9888 is used to produce transgenic corn events DBN9888 genomic dna.These primer pairs include but not limited to, primer 5 and 6 (SEQ ID NO:8 and 9), and primer 7 and 8 (SEQ ID NO:10 and 11), in described DNA cloning method.In addition, contrast primer 12 and 13 (SEQ ID NO:22 and 23) for the corn native gene that increases is included, as an inherent standard of reaction conditions.Should comprise the assaypositive tissue DNA extract contrast of a transgenic corn events DBN9888 to the DNA extracting sample analysis of transgenic corn events DBN9888, a negative DNA extract deriving from non-transgenic corn event DBN9888 contrasts and a negative control not containing template maize dna extract.Except these primer pairs, the any primer pair from SEQ ID NO:3 or SEQ ID NO:4 or its complementary sequence can also be used, produce respectively when they are used to DNA amplification reaction and be organized as the diagnostic amplicon comprising SEQ ID NO:1 or SEQ ID NO:2 for what derive from transgenic event maize plant DBN9888.The DNA cloning condition illustrated in table 2-table 5 may be used for using suitable primer pair to produce the diagnostic amplicon of transgenic corn events DBN9888.Produce when testing in DNA cloning method to transgenic corn events DBN9888 be diagnostic amplicon, estimate extract containing the maize plant or seed DNA comprising transgenic corn events DBN9888, or derive from the product of transgenic corn events DBN9888, the template increased can be used as, determine whether there is transgenic corn events DBN9888.

4th embodiment, carry out transgenic corn events DBN9888 detection by Southern blot hybridization

4.1, for the DNA extraction of Southern blot hybridization

The transformation event utilizing T4, T5 generation to isozygoty carries out Southern engram analysis.Utilize mortar and pestle, in liquid nitrogen, grind about 5 to 10g plant tissue.At 12.5mL Extraction buffer A (0.2M Tris pH8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredge base ethanol, 2.5%w/v Polyvinyl-pyrrolidone) middle resuspension plant tissue, with centrifugal 10 minutes of 4000rpm (2755g).After discarding supernatant liquor, at 2.5mL Extraction buffer B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredge base ethanol, 2.5%w/v Polyvinyl-pyrrolidone, 3% sarcosyl, 20% ethanol) in resuspension precipitation, and 37 DEG C of incubations 30 minutes.Between incubation period, with asepsis ring biased sample once.After incubation, adding isopyknic chloroform/primary isoamyl alcohol (24:1), mixing gently by being inverted, with 4000rpm centrifugal 20 minutes.Collect waterbearing stratum, and after interpolation 0.54 volume isopropanol with centrifugal 5 minutes of 4000rpm to precipitate DNA.Discard supernatant liquor, and resuspension DNA precipitates in 500 μ LTE.In order to the RNA of any existence of degrading, at 37 DEG C, by DNA and 1 μ L 30mg/mlLRNAase A incubation 30 minutes, with 4000rpm centrifugal 5 minutes, and deposit in case at 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, by within centrifugal 10 minutes, precipitating DNA with 14000rpm.After discarding supernatant liquor, wash precipitation with the ethanol that 500 μ L massfractions are 70%, and after making its drying in 100 μ L TE resuspension.

4.2, restriction enzyme digestion

Spectrophotometer or fluorometric quantification is utilized to detect DNA concentration (utilizing 1 × TNE and Hoechst dyestuff).

In 100 μ L reaction systems, each digestion 5 μ g DNA.With restriction enzyme Sac I and Hind III digested genomic dna respectively, on T-DNA, the partial sequence of EPSPS and PAT is as probe.For often kind of enzyme, be incubated overnight digest at a proper temperature.Utilize SpeedVac (speed vacuum) rotary sample to reduce volume to 30 μ L.

4.3, gel electrophoresis

Add tetrabromophenol sulfonphthalein Loading Dye to each sample derived from the present embodiment 4.2, and by each sample pipetting volume to containing on 0.7% sepharose of ethidium bromide, electrophoretic separation in TBE electrophoretic buffer, running gel spends the night under 20 volts.

In 0.25M HCl, wash gel 15 minutes to make DNA depurination, then wash with water.Setting Southern blot hybridization is as follows: in dish, place 20 thick dry trace paper, it is placed again 4 thin dry trace paper.Moistening 1 thin trace paper in advance in 0.4M NaOH, and be placed on this pile, then places 1 Hybond-N+ transfer film (Amersham Pharmacia Biotech, #RPN303B) moistening in advance in 0.4M NaOH.Gel is seated in top, guarantees do not have bubble between gel and film.3 trace paper soaked in advance are in addition placed on gel top, and fill up damping fluid dish with 0.4M NaOH.Connect gel stack and damping fluid dish with the wick be immersed in advance in 0.4M NaOH, DNA is transferred on film.At room temperature carry out the DNA transfer of about 4 hours.After transfer, rinsing Hybond film 10 seconds in 2 × SSC, DNA is combined with film by UV is crosslinked.

4.4, hybridize

The DNA sequence dna be applicable to pcr amplification is used for probe preparation.Described DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or with above-mentioned Sequence homology or complementation.25ng DNA probe is boiled 5 minutes in 45 μ LTE, places 7 minutes on ice, then transfer in Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube.5 μ l are added to Rediprime test tube ³²after the dCTP of P mark, 37 DEG C of incubation probes 15 minutes.According to the specification sheets of manufacturers, centrifugal by micro-centrifugal G-50 pillar (Amersham Pharmacia Biotech, #27-5330-01), to remove uncorporated dNTPs, this probe of purifying.Utilize scintillation counter measuring probe active.

By at 65 DEG C of Church prehybridization solution (500mM Na by 20mL pre-heating ₃p0 ₄, 1mM EDTA, 7%SDS, 1%BSA) and this Hybond film moistening 30 minutes, this Hybond film of prehybridization.Boil the probe 5 minutes of mark, and place 10 minutes on ice.Add appropriate probe (every 1mL pre-hybridization buffer 100 ten thousand countings) to pre-hybridization buffer, spend the night at 65 DEG C and hybridize.Second day, discard hybridization buffer, with 20mLChurch rinse solution 1 (40mM Na ₃p0 ₄, 1mM EDTA, 5%SDS, 0.5%BSA) and after rinsing, at 65 DEG C, in 150mL Church rinse solution 1, wash film 20 minutes.With Church rinse solution 2 (40mM Na ₃p0 ₄, 1mM EDTA, 1%SDS) and repeat this process 2 times.This film is exposed to the position that phosphorus shields or X-ray combines with detection probes.

Each Southern comprises three kinds of control samples: (1) from the DNA of the segregant of negative (unconverted), its for the identification of any can with the endogenous corn sequence of element-specific probe hybridization; (2) from the DNA of negative segregant, wherein introduce the DBN10006 that Hind III-digests, its amount is equivalent to a copy number based on probe length, to illustrate when detecting the copy of the individual gene in Maize genome, and the sensitivity of this experiment; (3) the DBN10006 plasmid that the Hind III-being equivalent to a copy number based on probe length digests, it is as the positive control of hybridizing and for illustration of the sensitivity of testing.

The evidence that hybridization data provides confirmation supports TaqMan ^tMpcr analysis, namely maize plant DBN9888 contains the list copy of EPSPS and pat gene.Utilize this EPSPS probe, Sac I and Hind III enzymolysis produce the single band that size is about 7.8kb and 12kb respectively; Utilize this PAT probe, Sac I and Hind III enzymolysis produce the single band that size is about 5.5kb and 4.8kb respectively.This shows that each copy of EPSPS and PAT is present in corn transformation event DBN9888.

The herbicide tolerant of the 5th embodiment, event detects

This test is selected agriculture to reach weedicide (41% glyphosate-isopropylammonium aqua) and is protected examination and reaches weedicide (the careless ammonium phosphine of effective constituent 18%) and spray.Adopt randomized block design, repeat for 3 times.Plot area is 15m ²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation manages, and has the wide isolation strip of 1m between community.Transgenic corn events DBN9888 is carried out respectively following 3 kinds of process: 1) do not spray; 2) spray agriculture by 1680g a.e./ha dosage in the V3 leaf phase and reach weedicide, then again spray agriculture in the V8 phase by same dose and reach weedicide; 3) spray guarantor's examination by 800g a.i./ha dosage in the V3 leaf phase and reach (Basta) weedicide, then again spray guarantor's examination in the V8 phase by same dose and reach (Basta) weedicide.It should be noted that, the glyphosate herbicidal of different content and formulation is converted into the form of equivalent glyphosphonic acid, and the careless ammonium phosphine solution of different concns is converted into above-mentioned equivalent effective constituent grass ammonium phosphine and is all applicable to draw a conclusion.

1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and the corn yield of community is measured when gathering in the crops.Symptom of chemical damage classification is as shown in table 6.Be injured rate as the index of herbicide tolerant evaluating transformation event with weedicide, and particularly, weedicide is injured rate (%)=∑ (peer be injured strain number × number of levels)/(total strain number × highest level); Wherein the weedicide rate of being injured comprises be injured rate and careless ammonium phosphine of glyphosate and to be injured rate, and weedicide rate of being injured is determined according to the poisoning investigation result of 2 weeks after glyphosate or the process of careless ammonium phosphine.The corn yield of each community is the corn grain ultimate production (weight) weighing 3 row in the middle of each community, volume variance between different treatment is measured with the percentile form of output, output percentage (%)=spray output/do not spray output.Transgenic corn events DBN9888 to the result of herbicide tolerant and corn yield result as shown in table 7.

Table 6, weedicide are to the grade scale of corn phytotoxicity degree

Poisoning rank	Symptom describes
		1	Growth is normal, without any damage symptoms
2	Slight poisoning, poisoning is less than 10%
		3	Medium poisoning, can recover later, not affect output
4	Poisoning is heavier, is difficult to recover, and causes the underproduction
		5	Poisoning is serious, can not recover, cause the obvious underproduction or total crop failure

Table 7, transgenic corn events DBN9888 are to the result of herbicide tolerant and corn yield result

Result illustrates, in weedicide (glyphosate and careless ammonium phosphine) rate of being injured: 1) transgenic corn events DBN9888 rate of being injured under glyphosate herbicidal (1680g a.e./ha) process is 0 substantially; Transgenic corn events DBN9888 rate of being injured under careless ammonium phosphine weedicide (800g a.i./ha) process is also 0 substantially; Thus, transgenic corn events DBN9888 has good weedicide (glyphosate and careless ammonium phosphine) tolerance.

In output: not spraying, under glyphosate herbicidal (1680g a.e./ha) and careless ammonium phosphine weedicide (800g a.i./ha) 3 kinds process, output does not have notable difference to transgenic corn events DBN9888; After herbicide spraying, the output of transgenic corn events DBN9888 does not reduce substantially, thus, shows that transgenic corn events DBN9888 has good weedicide (glyphosate and careless ammonium phosphine) tolerance further.

6th embodiment

Such as agricultural-food or commodity can be produced by transgenic corn events DBN9888.If enough expression amounts detected in described agricultural-food or commodity, described agricultural-food or commodity expection are containing the nucleotide sequence that transgenic corn events DBN9888 material can be diagnosed to exist in described agricultural-food or commodity.Described agricultural-food or commodity include but not limited to Semen Maydis oil, hominy grits, Semen Maydis powder, corn gluten, corn-dodger, W-Gum and will as food source for other food any of animal consumption or in addition as the composition in swelling agent or cosmetic composition for cosmetic use etc.Can be developed to detect the transgenic corn events DBN9888 nucleotide sequence shown in such as SEQ ID NO:1 or SEQ ID NO:2 in biological sample based on the nucleic acid detection method of probe or primer pair and/or test kit, wherein probe sequence or primer sequence are selected from the sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, to diagnose the existence of transgenic corn events DBN9888.

In sum, transgenic corn events DBN9888 of the present invention has good tolerance to glyphosate herbicidal and careless ammonium phosphine weedicide, on output without impact, and whether detection method can comprise the DNA molecular of transgenic corn events DBN9888 quickly and accurately in identification of organism sample.

Seed corresponding to transgenic corn events DBN9888 is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center on December 24th, 2014 and (is called for short CGMCC, address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), Classification And Nomenclature: corn (Zea mays), deposit number is CGMCC No.10216.Preserved material will depository's preservation 30 years.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims

1. a nucleotide sequence, is characterized in that, to comprise in SEQ ID NO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide and/or SEQ ID NO:4 or its complementary sequence.

2. nucleotide sequence according to claim 1, is characterized in that, described nucleotide sequence comprises SEQ IDNO:1 or its complementary sequence and/or SEQ ID NO:2 or its complementary sequence.

3. nucleotide sequence according to claim 2, is characterized in that, described nucleotide sequence comprises SEQID NO:3 or its complementary sequence and/or SEQ ID NO:4 or its complementary sequence.

4. nucleotide sequence according to claim 3, is characterized in that, described nucleotide sequence comprises SEQID NO:5 or its complementary sequence.

5. the method that the DNA detecting transgenic corn events DBN9888 in sample exists, is characterized in that, comprising:

Carry out nucleic acid amplification reaction;

Detect the existence of amplified production;

6. the method that the DNA detecting transgenic corn events DBN9888 in sample according to claim 5 exists, it is characterized in that, described amplified production to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

7. the method that the DNA detecting transgenic corn events DBN9888 in sample according to claim 5 or 6 exists, it is characterized in that, described amplified production comprises SEQ ID NO:1 or its complementary sequence, SEQID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

8. the method that the DNA detecting transgenic corn events DBN9888 in sample according to any one of claim 5-7 exists, it is characterized in that, described primer comprises nucleotide sequence described in any one of at least one claim 1-5.

9. the method that the DNA detecting transgenic corn events DBN9888 in sample according to claim 8 exists, it is characterized in that, described primer comprises the first primer and the second primer, and described first primer is selected from SEQ ID NO:8 and SEQ ID NO:10; Described second primer is selected from SEQ ID NO:9 and SEQ IDNO:11.

10. the method that the DNA detecting transgenic corn events DBN9888 in sample exists, is characterized in that, comprising:

The method that 11. DNA detecting transgenic corn events DBN9888 in sample according to claim 10 exist, it is characterized in that, described probe to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

The method that 12. DNA detecting transgenic corn events DBN9888 in sample according to claim 10 or 11 exist, it is characterized in that, described probe has SEQ ID NO:1 or its complementary sequence, SEQID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ ID NO:7 or its complementary sequence.

The method that 13. DNA detecting transgenic corn events DBN9888 in sample according to any one of claim 10-12 exist, it is characterized in that, at least one fluorophor of probe described at least one marks.

The method that 14. 1 kinds of DNA detecting transgenic corn events DBN9888 in sample exist, is characterized in that, comprising:

Detected sample is contacted with marker nucleic acid molecule, and described marker nucleic acid molecule to comprise in SEQ IDNO:3 or its complementary sequence at least 11 continuous print Nucleotide at least 11 continuous print Nucleotide or SEQ ID NO:4 or its complementary sequence;

15. methods existed according to the DNA detecting transgenic corn events DBN9888 in sample described in claim 14, it is characterized in that, described marker nucleic acid molecule to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQ ID NO:2 or its complementary sequence.

The method that 16. DNA detecting transgenic corn events DBN9888 in sample according to claims 14 or 15 exist, it is characterized in that, described marker nucleic acid molecule comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence or SEQ IDNO:7 or its complementary sequence.

17. 1 kinds of DNA detection test kits, it is characterized in that, comprise at least one DNA molecular, described DNA molecular comprises at least 11 continuous print Nucleotide in the homologous sequence of at least 11 continuous print Nucleotide or SEQ ID NO:4 in the homologous sequence of SEQ ID NO:3 or its complementary sequence or its complementary sequence, and it can have specific DNA primer or probe as transgenic corn events DBN9888 or its offspring.

18. according to DNA detection test kit described in claim 17, it is characterized in that, described DNA molecular to comprise in SEQ ID NO:1 or its complementary sequence 1-11 position or 12-22 position continuous nucleotide in 1-11 position or 12-22 position continuous nucleotide or SEQID NO:2 or its complementary sequence.

19. according to claim 17 or 18 DNA detection test kit, it is characterized in that, described DNA molecular comprises the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or the homologous sequence of its complementary sequence or SEQ ID NO:7 or its complementary sequence.

20. 1 kinds of vegetable cells, it is characterized in that, comprise the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen, the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or the sequence shown in SEQ IDNO:7.

21. 1 kinds of generations have the method for the milpa of tolerance to glyphosate herbicidal, it is characterized in that, comprise and introduce the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

22., according to the method producing milpa glyphosate herbicidal to tolerance described in claim 21, is characterized in that, comprising:

With progeny plant described in glyphosate herbicidal process;

Select the described progeny plant of tolerate glyphosate.

23. 1 kinds produce the method careless ammonium phosphine weedicide to the milpa of tolerance, it is characterized in that, comprise and introduce the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region in the genome of described milpa, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

24. methods careless ammonium phosphine weedicide according to producing described in claim 23 to the milpa of tolerance, is characterized in that, comprising:

Select the described progeny plant of the careless ammonium phosphine of tolerance.

25. 1 kinds produce method glyphosate herbicidal and careless ammonium phosphine weedicide to the milpa of tolerance, it is characterized in that, comprise in the genome of described milpa, introduce encodes glyphosate tolerance EPSPS albumen nucleotide sequence, the nucleotide sequence of coding glufosinate tolerant PAT albumen and the nucleotide sequence of specific region, the nucleotide sequence of described specific region is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7.

26. methods glyphosate herbicidal and careless ammonium phosphine weedicide according to producing described in claim 25 to the milpa of tolerance, is characterized in that, comprising:

27. 1 kinds of cultivations have the method for the maize plant of tolerance to glyphosate herbicidal, it is characterized in that, comprising:

Plant at least one corn seed, the genome of described corn seed comprises the nucleotide sequence of encodes glyphosate tolerance EPSPS albumen and the nucleotide sequence of specific region;

Described corn seed is made to grow up to milpa;

Cultivate the method careless ammonium phosphine weedicide to the maize plant of tolerance, it is characterized in that, comprising for 28. 1 kinds:

Described corn seed is made to grow up to milpa;

Cultivate method glyphosate herbicidal and careless ammonium phosphine weedicide to the maize plant of tolerance, it is characterized in that, comprising for 29. 1 kinds:

Described corn seed is made to grow up to milpa;

30. 1 kinds of protective plants are from the method for the damage caused by weedicide, it is characterized in that, comprise the large Tanaka weedicide containing effective dose glyphosate and/or careless ammonium phosphine being applied to plantation at least one rotaring gene corn plant, described rotaring gene corn plant comprises and is selected from SEQ ID NO:1 in its genome, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7, described rotaring gene corn plant has the tolerance to glyphosate herbicidal and/or careless ammonium phosphine weedicide.

31. 1 kinds of methods controlling weeds in field, it is characterized in that, comprise the large Tanaka weedicide containing effective dose glyphosate and/or careless ammonium phosphine being applied to plantation at least one rotaring gene corn plant, described rotaring gene corn plant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome, and described rotaring gene corn plant has glyphosate herbicidal and and/or the tolerance of careless ammonium phosphine weedicide.

32. 1 kinds of methods controlling the land for growing field crops glyphosate resistance weeds of glyphosate-tolerant plant, it is characterized in that, comprise the large Tanaka weedicide containing effective dose grass ammonium phosphine being applied to the rotaring gene corn plant of plantation at least one glyphosate tolerant, the rotaring gene corn plant of described glyphosate tolerant comprises and is selected from SEQ ID NO:1 in its genome, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ IDNO:5, at least one nucleotide sequence in sequence shown in SEQ ID NO:6 and SEQ ID NO:7, the rotaring gene corn plant of described glyphosate tolerant has the tolerance to careless ammonium phosphine weedicide simultaneously.

33. 1 kinds of methods delaying insect-resistant, it is characterized in that, the large Tanaka being included in the pest-resistant maize plant of plantation plants the rotaring gene corn plant that at least one has glyphosate and/or glufosinate tolerant, and the rotaring gene corn plant of described glyphosate tolerant comprises and is selected from least one nucleotide sequence in sequence shown in SEQ ID NO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in its genome.

34. 1 kinds of agricultural-food or commodity comprising the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2, it is characterized in that, described agricultural-food or commodity are Semen Maydis powder, Semen Maydis powder, Semen Maydis oil, W-Gum, corn gluten, corn-dodger, makeup or weighting agent.