CN104846096B - The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms - Google Patents
The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms Download PDFInfo
- Publication number
- CN104846096B CN104846096B CN201510263119.2A CN201510263119A CN104846096B CN 104846096 B CN104846096 B CN 104846096B CN 201510263119 A CN201510263119 A CN 201510263119A CN 104846096 B CN104846096 B CN 104846096B
- Authority
- CN
- China
- Prior art keywords
- genotype
- male
- pulmonary tuberculosis
- polymorphism
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the application in CD40LG gene rs3092923 polymorphisms in the detection compatriots male's pulmonary tuberculosis.The technical scheme that the present invention is protected is to detect the polymorphism of rs3092923 or the material of the genotype application of the polymorphism of rs3092923 or the material of genotype in the product for preparing forecast China people male's lunger's state of an illness in the application in preparing examination Chinese male's pulmonary tuberculosis and detection human genome in human genome.Can will detect that the polymorphism of rs3092923 or the material of genotype are united the product for preparing examination Chinese male lunger or forecast China people male's lunger's state of an illness to other materials (such as detecting the material of other SNPs related with Chinese male's pulmonary tuberculosis or genotype).
Description
Technical field
The present invention relates to the compatriots male's lung knot in the detection of CD40LG genes rs3092923 polymorphisms in biomedical sector
Application in core.
Background technology
Tuberculosis is the communicable disease in the harm whole world caused by infection due to Mycobacterium tuberculosis, is mainly passed by respiratory tract
Broadcast.Tuberculosis is still to cause the most disease of death toll by single pathogen, and revivable gesture is presented in recent years.
Counted according to the World Health Organization, China is one of 22, whole world tuberculosis burden country high, and tuberculosis patient quantity occupies the world the 2nd
Position, is only second to India.Display is studied, exposed to tubercle bacillus, 1/3rd crowd can be infected, in infection population
In, the infected less than 10% develops into tuberculosis, points out individual inherent cause to be played an important role in the disease.Identification
Phthisical tumor susceptibility gene helps to predict the individual risk and group risk that pulmonary tuberculosis occurs, and helps to illustrate and this disease
Related pathogenesis.
CD40LG is CDl54, is a member in Tumor necrosis factor ligand family.D40LG is used as internal specific immunity
The important costimulatory molecules of reaction system, critical effect is played in the cellular immunity and humoral immune reaction of body.
CD40LG is mainly expressed in the T cell of activation, and it interacts with CD40 in B cell, in activation and the propagation point of B cell
Played a crucial role during change, centrum germinativum are formed, antibody is produced and same kind is changed, in T cell activation and responsiveness cell
Important regulative is also played in the secretion process of the factor.Only has one at present on CD40LG gene rs3092923 polymorphic positions
The report with African Gambia crowd pulmonary tuberculosis correlation research is put, but the research is displayed in African Gambia crowd
Rs3092923 pleomorphism sites are uncorrelated to pulmonary tuberculosis occurrence risk.
The content of the invention
The technical problems to be solved by the invention be how examination Chinese male lunger.
In order to solve the above technical problems, present invention firstly provides following A 1)-A6) in any one purposes：
A1) polymorphism of rs3092923 or the material of genotype are preparing examination Chinese male in detection human genome
Application in lunger's product；
A2) polymorphism of rs3092923 or the material of genotype are preparing detection Chinese male in detection human genome
Application in pulmonary tuberculosis neurological susceptibility product；
A3) polymorphism of rs3092923 or the material of genotype are preparing detection with Chinese man in detection human genome
Property the related SNP of pulmonary tuberculosis product in application；
A4) polymorphism of rs3092923 or the material of genotype are preparing identification or auxiliary identification in detection human genome
Application in the product of the SNP related to Chinese male's pulmonary tuberculosis；
A5) polymorphism or genotype of rs3092923 are preparing examination Chinese male lunger in human genome
Product in application；
A6) polymorphism or genotype of rs3092923 are susceptible in preparation detection Chinese male's pulmonary tuberculosis in human genome
Application in property product.
Rs3092923 is a SNP site for two equipotential polymorphisms on people's X chromosome, the variation be conversion (C/T,
It is then G/A on its complementary strand).In women population, the rs3092923 genotype is CC, CT and TT, and the CC is
Rs3092923 sites are homozygous for C's, and the TT is that rs3092923 sites are the homozygous of T, and the CT is rs3092923
Point is the heterozygous of C and T.In males, rs3092923 genotype is T/ (-) and C/ (-), and T/ (-) is male X dyeing
Body rs3092923 sites are the genotype of T, and C/ (-) is the genotype that male X chromosome rs3092923 sites are C.The inspection
The polymorphism or genotype for surveying rs3092923 in human genome specifically can be by detecting that the nucleotides species of rs3092923 determines.
In such use, the polymorphism of rs3092923 or the material of genotype may include to expand in the detection human genome
Increase PCR primer pair and/or Single base extension primer including the genomic DNA fragment including rs3092923.
In such use, the individuality of T/ (-) genotype (or T equipotentials) is in Chinese male lunger colony
Ratio be respectively higher than its ratio in control.
In order to solve the above technical problems, present invention also offers the polymorphism containing rs3092923 in detection human genome
Or the product of the material of genotype.
The product of the material of the polymorphism or genotype of rs3092923 in the human genome containing detection provided by the present invention
Product, are a)-d) in any one：
A) product of the detection SNP related to Chinese male's pulmonary tuberculosis or genotype；
B) product of identification or the auxiliary identification SNP related to Chinese male's pulmonary tuberculosis or genotype；
C) examination Chinese male lunger product；
D) Chinese male's pulmonary tuberculosis neurological susceptibility product is detected.
In the said goods, the polymorphism of rs3092923 or the material of genotype may include to expand in the detection human genome
Increase PCR primer pair and/or Single base extension primer including the genomic DNA fragment including rs3092923.
In the said goods, the individuality of T/ (-) genotype (or T equipotentials) is in Chinese male lunger colony
Ratio be respectively higher than its ratio in control.
In the present invention, the PCR primer pair of the amplification including the genomic DNA fragment including rs3092923 can be by sequence
Single stranded DNA composition in single stranded DNA and sequence table in table shown in SEQ ID No.1 shown in SEQ ID No.2；The single base
The nucleotide sequence of extension primer can be as shown in SEQ ID No.3 in sequence table.
It is demonstrated experimentally that in Chinese's male population, the ratio of the T equipotentials of rs3092923 in case group higher than its
Ratio in control group, with significant difference, illustrates that the T equipotentials of rs3092923 are phthisical risk of Chinese male etc.
Position.In Chinese's male population, in two genotype in rs3092923 sites, the individuality of T/ (-) genotype is in case group
Ratio be higher than its ratio in control group, the individual ratio in case group of C/ (-) genotype is less than it in control group
In ratio.In Chinese's male population, compared with the individuality of C/ (-) genotype is carried, the individuality of T/ (-) genotype is carried
Pulmonary tuberculosis onset risk increases, and odds ratio (Odds ratio, OR) is 1.95, P=0.0033, illustrates that r rs3092923 are polymorphic
Property site it is phthisical with Chinese male generation significantly associate.
In actual applications, the polymorphism of rs3092923 or the material of genotype can will be detected with other materials (as detected
The material of other SNPs related to Chinese male's pulmonary tuberculosis or genotype) it is united preparation examination
The product of Chinese male lunger.
Wherein, the polymorphism of rs3092923 or the material of genotype can be by following at least one in detection human genome
Kind of method determine the polymorphism or genotype of rs3092923 needed for reagent and/or instrument：DNA sequencing, restriction fragment
Length polymorphism, single-strand conformation polymorphism, denaturing high-performance chromatography, SNP chip, TaqMan probe technology and Sequenom
MassArray technologies.Wherein, polymorphism or the genotype institute of rs3092923 are determined using Sequenom MassArray technologies
The reagent and/or instrument for needing include PCR primer to, the extension primer based on single base extension, phosphatase (such as shrimp alkalescence phosphorus
Sour enzyme (shrimp alkaline phosphatase, SAP)), resin, chip, MALDI-TOF (matrix-assisted
Laser desorption/ionization-time of fligh, matrix solid-dispersion flight time mass spectrum)
And other reagents and instrument required for Sequenom MassArray technologies；Determined using TaqMan probe technology
Reagent and/or instrument needed for the polymorphism or genotype of rs3092923 include TaqMan probe, PCR primer to, quantitative PCR
Instrument and its required for carrying out the software (such as 7500System SDS software) and TaqMan probe technology of Genotyping
His reagent；SNP chip is including the chip based on nucleic acid hybridization reaction, the chip based on single base extension, based on equipotential base
Because of the chip of specific primer extension, the chip based on " one-step method " reaction, the chip based on primer coupled reaction, it is based on
The chip of restriction enzyme reaction, the chip based on protein D NA association reactions, and based on fluorescence molecule DNA association reactions
Chip.
The product can be reagent or kit, can also be the system being made up of with instrument reagent or kit, such as by drawing
The system of thing and DNA sequencer composition, the system being made up of PCR reagent and DNA sequencing reagent and DNA sequencer, by TaqMan
Other examinations of probe, PCR primer to, quantitative PCR apparatus and required for carrying out the software and TaqMan probe technology of Genotyping
Agent composition system, by PCR primer to, Single base extension primer, chip, PCR instrument and carry out Genotyping software and
The system of other reagents and the instrument composition required for Sequenom MassArray technologies.
In one embodiment of the present of invention, the polymorphism of rs3092923 is determined using Sequenom MassArray technologies
And genotype.The PCR primer in sequence to not having particular/special requirement, as long as can amplify including the base including rs3092923
Because of a group DNA fragmentation, the concretely single stranded DNA in sequence table shown in SEQ ID No.1 and SEQ ID No.2.The list
Base extension primer single stranded DNA concretely in sequence table shown in SEQ ID No.3.Sequenom MassArray technologies institute
The other instruments of needs are MassARRAY Nanodispenser RS1000 point sample instruments (SEQUENOM companies).Sequenom
Chip required for MassArray technologies is SpectroCHIP (Sequenom) chip.The software tool for carrying out Genotyping
Body is the MALDI-TOF and softwares of TYPER 4.0 (sequenom).
The present invention has found in a sample (923 tuberculosis cases and 1033 controls) from Chinese population
Rs3092923 is the SNP related to Chinese male's pulmonary tuberculosis.Can will detect rs3092923 polymorphism or
The material of genotype (such as detects other mononucleotide polymorphics related with heating companion's thrombocytopenic syndromes to other materials
Property or genotype material) be united prepare examination Chinese population in generate heat with thrombocytopenic syndromes patient product
Product.
Specific embodiment
The present invention is further described in detail with reference to specific embodiment, the embodiment for being given is only for explaining
The bright present invention, rather than in order to limit the scope of the present invention.
Experimental technique in following embodiments, unless otherwise specified, is conventional method.
Material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
The foundation of the rs3092923 loci gene type methods of the detection CD40LG genes of embodiment 1
Rs3092923 is a SNP site for two equipotential polymorphisms on people's X chromosome, the variation be conversion (C/T,
It is then G/A on its complementary strand).In women population, the rs3092923 genotype is CC, CT and TT, and CC is rs3092923
Site is homozygous for C's, and TT is that rs3092923 sites are the homozygous of T, and CT is the heterozygous that rs3092923 sites are C and T.
In males, rs3092923 genotype is T/ (-) and C/ (-), and T/ (-) is that male X chromosome rs3092923 sites are T
Genotype, C/ (-) be male X chromosome rs3092923 sites be C genotype.
1st, the extraction of genomic DNA
Testing sample genomic DNA is extracted, is that template carries out genotype detection with it.
2nd, the design of primer and synthesis
It is to be measured using Sequenom companies Genotyping Tools and MassARRAY Assay Design Software for Design
The pcr amplification primer thing and Single base extension primer of SNP site, and transfer to biotech firm to synthesize.Detection PDGF-B genes
The sequence of the specific primer pair of rs3092923 loci gene types is：- the ACGTTGGATGTGCTTCACCTCACC of forward primer 5 '
ACAAAC-3 ' (the SEQ ID No.1 in sequence table)；- the ACGTTGGATGCCAAGTTGTTGCTCATGGTG-3 ' of reverse primer 5 '
(the SEQ ID No.2 in sequence table).For single base amplified reaction extension primer sequence for 5 '-
CACCACAAACTTTCCCT-3 ' (the SEQ ID No.3 in sequence table).
3rd, the foundation of the rs3092923 loci gene type methods of detection CD40LG genes
3.1PCR is expanded：PCR amplifications are carried out in 384 orifice plates, and each reaction system cumulative volume is 5 μ L, is prepared by table 1
PCR reaction systems.
The component of table 1 each PCR reaction system
| Reagent | Volume (μ L) |
| 10 × PCR buffer solutions | 0.5 |
| 0.4 | |
| dNTP mix(25mM) | 0.1 |
| HotStar Taq enzymes (5U/ μ L) | 0.1 |
| Ultra-pure water | 1.9 |
| DNA shown in SEQ ID No.1 | 1 |
| DNA shown in SEQ ID No.2 | 1 |
| Cumulative volume | 4 |
PCR response procedures are：94 DEG C 4 minutes；94 DEG C 20 seconds, 56 DEG C 30 seconds, 72 DEG C 1 minute, 45 circulation；72 DEG C 3 points
Clock；4 DEG C of holdings.
3.2PCR product alkaline phosphatase treatments：After PCR reactions terminate, by PCR primer SAP (shrimp alkal
Ine phosphatase, shrimp alkaline phosphotase) treatment, with remove system middle reaches from dNTPs, by table 2 prepare SAP reactants
System.
The SAP reaction systems of table 2
| Reagent | Volume (μ L) |
| Ultra-pure water | 1.53 |
| 10 × SAP buffer solutions | 0.17 |
| SAP enzymes (1.7U/ul) | 0.3 |
| Cumulative volume | 2 |
Reaction condition is：37 DEG C 40 minutes；85 DEG C 5 minutes；4 DEG C of maintenances.
3.3 Single base extensions：Using 10 × single base extension buffer solution, single alkali after alkaline phosphatase treatment terminates
The extension primer of the single base amplified reaction shown in base extension enzyme (1.7U/ μ l) and SEQ ID No.3 carries out single base and prolongs
Stretch reaction.
Reaction condition is：
I.94 DEG C 30 seconds
II.94 DEG C 5 seconds
III.52 DEG C 5 seconds
IV.80 DEG C 5 seconds
V. III, 4 circulations are returned to
VI. II, 39 circulations are returned to
VII.72 DEG C 3 minutes
VII.4℃
3.4 purifying resins：By in Clean Resin resins tiling to the resin plate of 6mg；Plus 16 μ l water to extension products
In corresponding aperture；Dried resin is poured into extension products plate, sealer, slow speed vertical rotates 30 minutes, make resin with reaction
Thing is fully contacted；Centrifugation makes resin sink to bottom hole portion.
3.5 chip point samples：Start MassARRAY Nanodispenser RS1000 point sample instruments (SEQUENOM companies), will
Extension products after purifying resin are moved on 384 hole SpectroCHIP (Sequenom) chips (SEQUENOM companies).
3.6 Mass Spectrometer Methods：SpectroCHIP chips after point sample are analyzed using MALDI-TOF, testing result is used
The softwares of TYPER 4.0 (sequenom) parting and output result.
The rs3092923 sites of embodiment 2CD40LG genes and the analysis of Chinese male's pulmonary tuberculosis neurological susceptibility
The method set up with embodiment 1, to Chinese population (923 tuberculosis cases and 1033 controls)
The rs3092923 loci gene types of CD40LG genes are analyzed.
1st, research object
Case group：923 lungers, and meet People's Republic of China's health industry standard diagnosis of pulmonary tuberculosis mark
Accurate (WS 288-2008).
Control group：1033 controls, with People's Republic of China (PRC) health industry standard diagnosis of pulmonary tuberculosis standard (WS288-
2008) not hectic is confirmed after checking UP.
The demographic characteristics of research object are shown in Table 3, and all research objects are the Chinese han population of consanguinity-less relation.It is all
Research object endorsed Informed Consent Form, and population statistics and the medical history of individual are collected by the questionnaire of structuring.
This research obtains the approval of chest hospital of Hebei province, Shijiazhuang No. 5 Hospital and Beijing electric power Hospital Ethical Committee.
2nd, the determination of the rs3092923 loci gene types of CD40LG genes
The frequency distribution of the genotype and equipotential in the rs3092923 sites of CD40LG genes is as shown in table 3 in crowd.
Result shows, in all of research object, the frequency of T equipotentials is that the frequency of 92.5%, C equipotentials is in case group
7.5%；The frequency of T equipotentials is that the frequency of 88.6%, C equipotentials is 11.4% in control group.Frequency ratio of the T equipotentials in case group
Frequency in control group is high, and with significant difference, the T equipotentials for showing rs3092923 sites are phthisical risk equipotential.
In three genotype in all of research object rs3092923 sites, the individuality of TT and T/ (-) genotype is in disease
Ratio in example group is higher than its ratio in control group, and the individuality of CC and C/ (-) genotype and CT genotype is in case group
Ratio be respectively lower than the individual ratio in control group of corresponding gene type.In all of research object, with carry CC and
The individuality of C/ (-) genotype is compared, and the individual pulmonary tuberculosis onset risk for carrying TT and T/ (-) genotype increases, and OR values are 1.8
[95% confidential interval (95%CI)=1.24-2.62；P=0.0060].
In male population, the frequency of T equipotentials is that the frequency of 93.6%, C equipotentials is 6.4% in case group；T in control group
The frequency of equipotential is 11.7% for the frequency of 88.3%, C equipotentials.Frequency of the T equipotentials in the male population of case group is than this etc.
Frequency of the position in the male population of control group is high, with significant difference, shows that the T equipotentials in rs3092923 sites are China
The phthisical risk equipotential of people male.
In two genotype in male population rs3092923 sites, the individual ratio in case group of T/ (-) genotype
Example is higher than its ratio in control group, and the individual ratio in case group of C/ (-) genotype is less than it in control group
Ratio.In male population, compared with the individuality of C/ (-) genotype is carried, the individual pulmonary tuberculosis morbidity of T/ (-) genotype is carried
Risk increases, and OR values are 1.95 [95% confidential intervals (95%CI)=1.3-2.91；P=0.0033].
And in female group, the frequency of T equipotentials is that the frequency of 90.3%, C equipotentials is 9.7% in case group；Control group
The frequency of middle T equipotentials is 10.7% for the frequency of 89.3%, C equipotentials.Frequency of the T equipotentials in the female group of case group is than being somebody's turn to do
Frequency of the equipotential in the female group of control group is high by 1.0%, does not have significant difference.In women, with carrying CC genotype
Individuality compare, carry TT genotype individual pulmonary tuberculosis onset risk do not dramatically increase, OR values be 0.93 [95% confidence area
Between (95%CI)=0.32-2.76；P=0.9015], no difference of science of statistics；Compared with the individuality of CC genotype is carried, CT is carried
The individual pulmonary tuberculosis onset risk of genotype is not dramatically increased, and OR values are 0.73 [95% confidential interval (95%CI)=0.23-
2.3；P=0.5941], no difference of science of statistics.
Result shows, it is possible to use rs3092923 sites examination Chinese male lunger.
The demographic characteristics of the research object of table 3
Note：Data is shown as number (percentage) or mean (standard deviation).
* BCG vaccination state is with and without comparing the P values that obtain between two groups.
The rs3092923 of the CD40LG genes of table 4 and the phthisical association analysis of Chinese population
Note：OR, odds ratio (odds ratio)；CI, confidential interval (confidence interval)；
CC and C/ (-)*Represent the CC genotype of women and C/ (-) genotype of male；TT and T/ (-)*Represent the TT of women
Genotype and T/ (-) genotype of male.
aData are represented by logistic regression analyses, and has carried out the school at age, smoking and BCG vaccination state
Just.
Claims (4)
1. the polymorphism of rs3092923 or the material of genotype are preparing examination Chinese male's pulmonary tuberculosis in detection human genome
Application in patient product.
2. the polymorphism of rs3092923 or the material of genotype are preparing detection Chinese male's pulmonary tuberculosis in detection human genome
Application in neurological susceptibility product.
3. the polymorphism of rs3092923 or the material of genotype are preparing detection and Chinese male's lung knot in detection human genome
Application in the product of the SNP that nuclear phase is closed.
4. the polymorphism of rs3092923 or the material of genotype are preparing identification or auxiliary identification and China in detection human genome
Application in the product of the related SNP of people male's pulmonary tuberculosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510263119.2A CN104846096B (en) | 2015-05-21 | 2015-05-21 | The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510263119.2A CN104846096B (en) | 2015-05-21 | 2015-05-21 | The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846096A CN104846096A (en) | 2015-08-19 |
| CN104846096B true CN104846096B (en) | 2017-06-30 |
Family
ID=53846077
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510263119.2A Active CN104846096B (en) | 2015-05-21 | 2015-05-21 | The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104846096B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009009752A2 (en) * | 2007-07-11 | 2009-01-15 | Intergenetics, Inc. | Genetic models for stratification of cancer risk |
| CN102062774A (en) * | 2009-11-13 | 2011-05-18 | 程小星 | Kit for detecting tuberculosis treatment effect |
| WO2013138497A1 (en) * | 2012-03-13 | 2013-09-19 | Baylor Research Institute | Early detection of tuberculosis treatment response |
-
2015
- 2015-05-21 CN CN201510263119.2A patent/CN104846096B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009009752A2 (en) * | 2007-07-11 | 2009-01-15 | Intergenetics, Inc. | Genetic models for stratification of cancer risk |
| CN102062774A (en) * | 2009-11-13 | 2011-05-18 | 程小星 | Kit for detecting tuberculosis treatment effect |
| WO2013138497A1 (en) * | 2012-03-13 | 2013-09-19 | Baylor Research Institute | Early detection of tuberculosis treatment response |
Non-Patent Citations (3)
| Title |
|---|
| genetic susceptibility to tuberculosis in africans: a genome-wide scan;Richard B et al.;《PNAS》;20081231;第97卷(第14期);第8005-8009页 * |
| Haplotype structure of TNFRSF5-TNFSF5 (CD40–CD40L) and association analysis in systemic lupuserythematosus;Chadha S et al.;《European journal of human genetics》;20050112;第13卷(第7期);第670页左栏第3行-倒数第6行，材料和方法，讨论，表1-2、4 * |
| Variants of the CD40 ligand gene are not associated with increased susceptibility to tuberculosis in West Africa;Campbell SJ et al.;《Immunogenetics》;20030829;第55卷(第7期);摘要，第503页左栏第12行-第506页左栏倒数第3行，表1-4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104846096A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2019201658A (en) | Multiplex pyrosequencing using non-interfering noise canceling polynucleotide identification tags | |
| EP2007901B1 (en) | Rapid genotyping analysis and the device thereof | |
| EP2551356B1 (en) | Method for detecting target base sequence using competitive primer | |
| CN107849606A (en) | The method for improving sequencing sensitivity of future generation | |
| JP5662293B2 (en) | SNP for diagnosing attention deficit / hyperactivity disorder and microarray and kit including the same | |
| CN107475371A (en) | It was found that the method for Drug Discovery biomarker | |
| KR101220806B1 (en) | Identification of group of hypertension-susceptibility genes | |
| EP2561101A2 (en) | X-str multiplex system | |
| CN105473736B (en) | Science of heredity based on nano-probe is examined | |
| CN102719537A (en) | Multidrug-resistant mycobacterium tuberculosis non-fluorescent DNA (deoxyribonucleic acid) microarray detection method and kit | |
| Zhang et al. | Determination of ABO blood group genotypes using the real‑time loop‑mediated isothermal amplification method | |
| CN104789673B (en) | Applications of the rs1800818 in heating companion's thrombocytopenic syndromes that new bunyavirus causes are detected | |
| JPWO2007055255A1 (en) | Method for amplifying a plurality of nucleic acid sequences for identification | |
| CN104846096B (en) | The application in the detection in compatriots male's pulmonary tuberculosis of CD40LG gene rs3092923 polymorphisms | |
| EP1829979A1 (en) | Method of identifying gene with variable expression | |
| US20200291451A1 (en) | Rhd gene allele associated with a weak d phenotype and its uses | |
| KR20200070935A (en) | KASP primer set based on SNP for discriminating Korean melon cultivar and F1 hybrid purity checking and uses thereof | |
| KR20150056004A (en) | Discrimination method for product traceability and identification of chicken using Microsatellite DNA | |
| CN116445596B (en) | Product and method for human genotyping and application thereof | |
| CN108949965B (en) | Application of the SNP marker in type-2 diabetes mellitus diagnosis | |
| JP6286904B2 (en) | Probe for detecting SNP (rs8103142) | |
| WO2023058522A1 (en) | Method for analyzing structural polymorphism, primer pair set, and method for designing primer pair set | |
| US20140073530A1 (en) | Rapid Genotyping Analysis and the Method Thereof | |
| Tsai et al. | Comprehensive analysis of UGT1A1 polymorphisms through high-resolution melting analysis and DNA sequencing | |
| CN106222289A (en) | The application in examination heating companion thrombocytopenic syndromes patient of the rs1143634 polymorphism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |